Prostaglandin E1 Inhibits GLI2 Amplification–Associated Activation

Published OnlineFirst May 5, 2020; DOI: 10.1158/0008-5472.CAN-19-2052

CANCER RESEARCH | MOLECULAR CELL BIOLOGY

Prostaglandin E1 Inhibits GLI2 Ampliﬁcation–Associated Activation of the Hedgehog Pathway and Drug Refractory Tumor Growth Fujia Wu1,2, Chenze Zhang1,2, Chen Zhao1, Hao Wu1,2, Zhaoqian Teng1,2,3, Tao Jiang4,5,6, and Yu Wang1,2,3

ABSTRACT ◥ Aberrant activation of the Hedgehog (HH) signaling pathway SMO mutagenesis and GLI2 amplification. Consistent with a role in underlines the initiation and progression of a multitude of cancers. HH pathway regulation, EP4 receptor localized to the PC. Mecha- The effectiveness of the leading drugs vismodegib (GDC-0449) and nistically, PGE1 inhibited HH signaling through the EP4 receptor, sonidegib (LDE225), both Smoothened (SMO) antagonists, is com- enhancing cAMP-PKA activity, which promoted phosphorylation promised by acquisition of mutations that alter pathway components, and degradation of GLI2 via the ubiquitination pathway. PGE1 also notably secondary mutations in SMO and amplification of GLI2,a effectively inhibited the growth of drug refractory human medullo- transcriptional mediator at the end of the pathway. Pharmacologic blastoma xenografts. Together, these results identify PGE1 and other blockade of GLI2 activity could ultimately overcome these diversified prostaglandins as potential templates for complementary therapeutic refractory mechanisms, which would also be effective in a broader development to circumvent resistance to current generation SMO spectrum of primary tumors than current SMO antagonists. To this antagonists in use in the clinic. end, we conducted a high-content screening directly analyzing the ciliary translocation of GLI2, a key event for GLI2 activation in HH Significance: These findings show that PGE1 exhibits pan- signal transduction. Several prostaglandin compounds were shown to inhibition against multiple drug refractory activities for inhibit accumulation of GLI2 within the primary cilium (PC). In Hedgehog-targeted therapies and elicits significant antitumor particular, prostaglandin E1 (PGE1), an FDA-approved drug, is a effects in xenograft models of drug refractory human medullo- potent GLI2 antagonist that overcame resistance mechanisms of both blastoma mimicking GLI2 amplification.

Introduction Mammalian HH signal transduction is controlled by the Patched1 (PTCH1)-mediated suppression of Smoothened (SMO), a seven-pass The evolutionarily conserved Hedgehog (HH) signaling pathway transmembrane protein that traffics continuously through the primary plays critical roles in embryonic patterning and adult tissue homeo- cilium (PC; refs. 5, 6). Inactive SMO failed to regulate the activity state stasis (1, 2). Hyperactive HH signaling has been linked to a range of of GLI2, the primary transcription activator of HH pathway, which malignant tumors through tumor initiation, maintenance of tumor thus was sequentially phosphorylated by protein kinase A (PKA), stem/progenitor cells, and support of tumor–stroma interaction (3, 4). glycogen synthase kinase-3b (GSK-3b), and casein kinase 1 (CK1), and Therefore, the HH signaling has emerged as a therapeutic target of trafficked to the proteasome for degradation. On HH ligand [Sonic interest for cancer therapy, and intensive efforts have been made to hedgehog (SHH), Desert hedgehog (DHH), or Indian hedgehog develop targeted pathway antagonists. (IHH)] binding to the shared receptor PTCH1, the inhibitory effect on SMO is relieved, enabling SMO ciliary accumulation and activation (5, 6). Consequently, GLI2 translocates in activated full-length form from the cilium to the nucleus (7), where it 1State Key Laboratory of Stem Cell and Reproductive Biology, Institute of induces orchestrated expression of target genes, including GLI1 and Zoology, Chinese Academy of Sciences, Beijing, China. 2University of Chinese PTCH1. Academy of Sciences, Beijing, China. 3Institute for Stem Cell and Regeneration, Constitutive HH signaling contributes to tumorigenesis mainly 4 Chinese Academy of Sciences, Beijing, China. Department of Neurosurgery, through two types of mechanisms. First, ligand-independent hyper- 5 Beijing TianTan Hospital, Capital Medical University, Beijing, China. Beijing active pathway activity within the tumor cell drives tumorigenesis in Neurosurgical Institute, Capital Medical University, Beijing, China. 6China Nation- al Clinical Research Center for Neurological Diseases, Beijing, China. basal cell carcinoma (BCC), the most common cancer in Caucasian population (8), medulloblastoma, the most common childhood brain Note: Supplementary data for this article are available at Cancer Research cancer (9), and rhabdomyosarcoma (10). Almost all cases of BCC are Online (http://cancerres.aacrjournals.org/). initiated by ligand-independent HH activity, most commonly through Current address for Y. Wang: College of Life Sciences and Oceanography, PTCH1 loss-of-function or SMO gain-of-function mutations (11, 12). Shenzhen University, Shenzhen, China. Similarly, hyperactive HH signaling has emerged as the driver in Corresponding Authors: Yu Wang, Institute of Zoology, Chinese Academy of approximately 30% of medulloblastoma through ligand-independent Sciences, 1 Beichen West Road, Beijing 100101, China. Phone: 86-18612208166; mechanisms including inactivating mutations in PTCH1 and SUFU, E-mail: [email protected]; and Tao Jiang, Department of Neurosur- fi – gery, Beijing TianTan Hospital, Capital Medical University, Beijing 100050, China. and genomic ampli cation of GLI2 (13 15). Second, HH pathway Phone: 86-10-59975049; E-mail: [email protected] activation in surrounding stromal cells has been found to support the growth of tumor cells in a paracrine manner, whereby stromal cells Cancer Res 2020;80:2818–32 receive HH ligand from tumor cells and secrete stimulatory factors in doi: 10.1158/0008-5472.CAN-19-2052 response for tumor progression (16). Such mechanism was documen- 2020 American Association for Cancer Research. ted in a broad range of malignancies, most notably those in blood,

AACRJournals.org | 2818

PGE1 Inhibits GLI2 Activity and Drug Refractory Tumor Growth

pancreas, lung, stomach, colon, and prostate (3). Clinical implications via lentiviral infection of NIH/3T3 cells. The 3T3/GLI-luc cell line was of the paracrine mechanism of action are yet to be clarified as most created for GLI-luciferase reporter assays via two rounds of infections clinical trials using HH pathway antagonists to treat these cancers did using lentiviral particles harboring a GLI-responsive firefly luciferase not meet a positive conclusion (4). However, glasdegib was recently reporter and a constitutive Renilla luciferase expression construct, approved by the FDA for acute myeloid leukemia, thus highlighting respectively. Subclones overexpressing GLI2 or SMO-WT or potential expanded use of HH targeted cancer therapy beyond BCC SMO-D473H or SMO-W535L in 3T3/GLI-luc cells were generated. and medulloblastoma (17). DAOY cell lines that overexpress SMO-D473H or GLI2 were also Cyclopamine, a natural compound found in wild corn lily generated via lentiviral delivery. Med-113FH and Med-314FH tumor (Veratrum californicum), was identified as the first HH pathway cells were obtained from the brain tumor resource lab (http://www. inhibitor directly targeting SMO (18). Since then, many more SMO btrl.org). The passaging of Med-113FH and Med-314FH tumor cells inhibitors have been developed, and several of them, including was through serial transplantation into the cerebellum of immune- vismodegib, sonidegib, glasdegib, LY2940680, and BMS-833923, compromised mice. All cell lines were confirmed as Mycoplasma have delivered promising results in preclinical and clinical studies in negative using the Mycoplasma PCR Detection Kit (HD01-0105, HD HH-dependent cancers (3). Both vismodegib and sonidegib have been BIOSCIENCES). All primary cell lines were directly obtained from a approved by the FDA for treatment of advanced BCC (19, 20). public depository or from a commercial supplier and not additionally However, acquired resistance to vismodegib and sonidegib limits their authenticated. Cellular experiments were performed within 10 pas- long-term efficacy. Drug resistance can be acquired by genetic aberra- sages after thawing. tions of multiple pathway components including SMO mutations, SUFU mutations, and GLI2 amplifications (21–24). Notably, intratu- Compound reagents mor heterogeneity of those drug refractory mechanisms was identified, Chemical libraries used in our screening include the Prestwick further complicating the situation that next generation cancer therapy Chemical Library (Prestwick Chemical), the Spectrum Collection needs to tackle (21). In addition, current anti-SMO therapies failed to (Microsource Discovery Systems), the Library of Pharmacologically target primary tumors harboring mutations downstream of SMO Active Compounds (LOPAC, Sigma), FDA-approved Drug Library level (25). (Topscience), and customized in-house compound libraries. Cyclo- The emergence of multiple drug resistance mechanisms associated pamine, sulprostone, and butaprost were purchased from Sigma. with current SMO antagonists and lack of therapies targeting HH SAG was purchased from Millipore. Vismodegib and forskolin pathway downstream of SMO level has prompted our investigations (FSK) were purchased from Selleck. All prostaglandins except into alternative approaches. From a perspective of pathway epistasis, sulprostone and butaprost were purchased from Cayman Chemical. we reasoned that targeting hyperactive GLI2, the central transcription SHH-N conditioned medium was collected as previously activator of the pathway, would potentially deliver more effective described (26), and its control medium was collected from wild- therapeutic interventions that may pan-inhibit various drug refractory type Cos7 cells. mechanisms. Herein, we reported the discovery of a number of prostaglandins in a high-content screening for small molecules inhi- Imaging assay biting GLI2 ciliary accumulation. We demonstrated that prostaglandin 3T3/ARL13B::tagRFPT/EGFP::GLI2 cells were plated into 384-well E1 (PGE1), an approved drug as a representative among the class, imaging plate precoated with 0.1% gelatin (Sigma) at 1 104 cells/well delivered cross-inhibitory activities against drug refractory SMO in 50 mL of media. After cells reached confluence (1–2 days), test mutants and overexpressing GLI2. Mechanistic investigations revealed compounds were added in 0.5% calf serum medium for 24 hours in the that PGE1 acts through E-prostanoid receptor 4 (EP4), which localizes presence of SHH-N, and then cells were fixed with 4% paraformal- to the PC, to elevate cyclic adenosine monophosphate (cAMP)-PKA dehyde and stained with Hoechst 33342 (H3570, Invitrogen) for signaling, thus leading to phosphorylation and subsequent ubiquitina- imaging. Cells were imaged using Operetta High Content Screening tion primed degradation of GLI2. Furthermore, PGE1 effectively System (PerkinElmer) with a 40 high NA objective. The Harmony inhibits drug refractory tumor growth of GLI2-overexpressing medul- 4.1 software (PerkinElmer) was used for high-content screening data loblastoma xenografts. In summary, our study identified prostaglan- management and image quantification. The identical microscopic dins as potential source of drug repurposing opportunities, which are setting and input parameters were performed throughout the imaging capable of overcoming multiple drug resistance mechanisms associ- assay. ated with current generation SMO inhibitors and targeting medulloblastoma with broader molecular spectrum. In addition, the findings GLI-luciferase reporter assay provide novel mechanistic insights furthering understanding of HH As for the wild-type NIH/3T3 cells for examining HH signaling pathway modulation. activity, cells were plated at 2 104 cells/well into 96-well assay plates and transfected the next day using Fugene HD (E2311, Promega) with ap8 GLI binding sites (GLIBS)–firefly luciferase plasmid (27), a Materials and Methods constitutive Renilla luciferase plasmid, and other DNA plasmids as Cell lines indicated. After cells reached confluency in about 1 day, culture NIH/3T3, HEK293T, Cos7, DAOY, and MCF7 cells were obtained medium was switched to 0.5% calf serum medium and incubated for from the ATCC. NIH/3T3 cells were cultured in DMEM supplemen- 36 hours with other reagents as indicated. For stable reporter cell lines, ted with 10% (v/v) calf serum. HEK293T and Cos7 cells were cultured 3T3/GLI-luc or its derivatives were cultured in 96-well assay plates. in DMEM supplemented with 10% (v/v) FBS, and DAOY cells were Upon confluence, cells were treated with reagents in 0.5% calf serum cultured in MEM supplemented with 10% (v/v) FBS. MCF7 cells medium as indicated for 36 hours. Then the firefly and Renilla were cultured in MEM supplemented with 10% (v/v) FBS and luciferase activities were read sequentially by Luminescence Counter 0.01 mg/mL human recombinant insulin. 3T3/ARL13B::tagRFPT and (PerkinElmer). The Renilla luciferase signal was used to normalize the 3T3/ARL13B::tagRFPT/EGFP::GLI2 stable cell lines were generated firefly luciferase signal.

AACRJournals.org Cancer Res; 80(13) July 1, 2020 2819

Wu et al.

CRE-luciferase reporter assay procedure was as following. The membrane was incubated with HEK293T cells were seeded in 96-well assay plates and cotrans- Western blot stripping buffer (BE6224, EASYBIO) for 30 minutes at fected with a pGL4-CRE firefly luciferase construct and a constitutive room temperature in shaking motion and then washed 3 times per 10 Renilla luciferase construct. Twenty-four hours after transfection, cells minutes in TBST buffer. Other primary antibodies used in our study were treated with compounds as indicated and incubated for another include mouse anti-GLI1 (2643, Cell Signaling Technology), Goat 36 hours before being processed for reading luciferase signals using anti-GLI2 (AF3635, R&D), Sheep anti-GLI2 (AF3526, R&D), and Luminescence Counter (PerkinElmer). The firefly luciferase signal was mouse anti-EP4 (sc-55596, Santa Cruz Biotechnology). normalized by Renilla luciferase signal. RNA interference GLI2 overexpression For gene knockdown, the following shRNA plasmids: shEP4-1 The pCEFL-3 Flag-Gli2 (Gli2-WT) plasmid was generated by (targeting sequence: 50-GTACTGTTTCTGGACCCTTAT-30) and replacing 3 HA in plasmid pCEFL-3 HA-Gli2 (37671, Addgene) shEP4-2 (targeting sequence: 50-CAGTAAAGCAATAGAGAA- with 3 Flag. Site mutations were introduced into the Gli2-WT vector GAT-30), scrambled shRNA (targeting sequence: 50-AACGTGATT- to generate pCEFL-3 Flag-Gli2 DPKA (Gli2 DPKA) plasmid and TATGTCACCAGA-30) were constructed and used in transfection pCEFL-3 Flag-Gli2 DGSK-3b (Gli2 DGSK-3b) plasmid, whose studies. The transfection of shRNA plasmids was performed using mutated phosphorylation sites have been described as previously (28). Lipofectamine 2000 (11668019, Invitrogen) according to the manu- Transfection was performed in NIH/3T3 cells using Fugene HD facturer's protocol. (E2311, Promega) according to the manufacturer's instructions. Transfected cells were treated with compounds in 0.5% calf serum EP4 knockout via CRISPR-Cas9 approach for 36 hours before collecting the samples for examination. EP4 genomic mutations were generated by CRISPR-Cas9– mediated genomic editing. Single-guide RNA targeting murine EP4 Reverse transcription PCR genome was designed through the sgRNA design tool (https://portals. Total RNA was isolated from cultured cells or snap-frozen tumors broadinstitute.org/gpp/public/analysis-tools/sgrna-design). Genome using the TRIzol Reagent (15596018, Thermo Fisher Scientific). Each editing efficiency was examined through the Tide tool (https://tide. RNA sample was treated with DNase I (AM1907, Thermo Fisher deskgen.com), and the selected sequence is: GGCGGCGTAGGCC- Scientific) at 37C for 30 minutes to remove any contaminating GTTACGT. The annealed guide RNA oligos were inserted into a genomic DNA and then used as a template for cDNA synthesis with lentiviral plasmid digested by the BsmBI restriction enzyme. Genotyp- the GoScript cDNA Synthesis Kit (Promega) according to the man- ing was determined by sequencing PCR products amplified by the ufacturer's instructions. The High-Fidelity KOD-Plus-Neo (KOD-401, following primers: EP4 forward: TCTGTGCCATGAGCATCGAG; TOYOBO) was used for PCR amplification to determine gene expres- EP4 reverse: TCAGGACTTAGAAGGAAAAC. The PCR products sion. Primers for analyzing EP genes expression in mouse NIH/3T3 with double peaks were then inserted into a pEASY-Blunt Zero and human DAOY cells were listed in Supplementary Table S1. Cloning Vector (CB501-01, TransGen Biotech) and sent for Sanger sequencing to verify the sequence of each allele. Quantitative real-time PCR A 1/10 dilution of cDNA was used as a template with a SYBR Green– Immunofluorescence based PCR Master Mix (11201ES08, YEASEN) on a Roche@480 Real- The 3T3/ARL13B::tagRFPT cells were plated onto coverslips in 24- Time PCR System. The relative expression levels of mRNAs were well plates (200,000 cells /well) and maintained in DMEM supple- –DD calculated using 2 Ct. Glyceraldehyde-3-phosphate dehydrogenase mented with 10% (v/v) calf serum until reaching confluency, at which (Gapdh) was used as internal reference. The primer sequences used time the culture medium was switched to 0.5% calf serum medium for to quantify HH target genes are listed in Supplementary Table S1. 24 hours. After that, cells were fixed in 4% paraformaldehyde for 30 minutes, permeabilized in 0.3% Triton X-100 for 15 minutes, blocked Western blot analysis in 2% BSA plus 0.3% Triton X-100 for 1 hour, and then incubated Cells were lysed in RIPA buffer (C1053, APPLYGEN) supplemen- overnight at 4C with mouse monoclonal anti-EP4 antibody (sc- ted with 1 tablet of protease and phosphatase inhibitors (A32961, 55596, Santa Cruz Biotechnology, 1:200 dilution). After incubation Thermo Fisher Scientific) per 10 mL RIPA buffer. Equal amounts of overnight, cells were washed 3 times every 10 minutes, followed by the cell lysates were separated by SDS-PAGE and then transferred to incubation with a secondary antibody, Alexa Fluor 488 goat against polyvinylidene fluoride (PVDF) membranes. Subsequently, the mem- mouse IgG (HþL) (A-11001, Thermo Fisher S cientific, 1:500 dilu- branes were blocked in 5% nonfat milk or 5% BSA in TBST buffer at tion), at room temperature for 1 hour, then washed additional 3 times room temperature for 2 hours and then incubated overnight at 4Cin every 10 minutes. Cells were finally stained with Hoechst 33342 blocking solution with the primary antibodies. After incubation (H3570, Invitrogen) and washed, after which, the coverslips were overnight, membranes were washed 3 times per 10 minutes in TBST mounted and samples were imaged. Images were collected using a buffer, then incubated in 1:5,000 diluted horseradish peroxidase– Zeiss LSM 780 confocal microscope with a 63 oil objective and were labeled secondary antibodies (ZSBIO) at room temperature for 1 hour, processed with ZEN software (Zeiss). washed for 3 times every 15 minutes with TBST buffer, and then detected with chemiluminescent reagents (32106, Thermo Fisher Immunoprecipitation Scientific). As for detecting phosphorylation state of CREB, the blot For examining GLI2 ubiquitination, HEK293T cells were transient- on PVDF membrane was first developed with anti–p-CREB primary ly transfected with DNA plasmids as indicated, and treated with or antibody (9198, Cell Signaling Technology), then the same membrane without PGE1 for 36 hours, all samples were treated with 10 mmol/L was stripped and reprobed for total CREB protein with anti-CREB MG-132, a proteasome inhibitor, for 6 hours before collection. Cells primary antibody (9197, Cell Signaling Technology) and then with were collected and lysed in lysis buffer plus protease and phosphatase anti–b-actin (ab8226, Abcam) as an internal control. The stripping inhibitors (A32961, Thermo Fisher Scientific) for 50 minutes on a

2820 Cancer Res; 80(13) July 1, 2020 CANCER RESEARCH

PGE1 Inhibits GLI2 Activity and Drug Refractory Tumor Growth

rotor at 4C. After 12,000 g centrifugation for 15 minutes, the lysates total volume of 100 mL of 1:1 mixture of PBS:Matrigel were were immunoprecipitated with 2 mg specific antibody overnight at 4C, injected subcutaneously at the flank of each 6- to 7-week-old NOD- and 30 mL Protein A/G PLUS-Agarose (SC-2003, Santa Cruz Biotech- PrkdcscidIl2rgtm1/Vst mice (VITALSTAR). When tumors were grown nology) was washed and then added for an additional 3 hours. to a median size of 100 mm3, mice were randomized into three groups Thereafter, the precipitants were washed 5 times with lysis buffer, (n ¼ 8 in each group) and treated with solvent only, vismodegib and the samples were boiled with loading buffer for 5 minutes and (30 mg/kg, daily oral administration), and PGE1 (15 mg/kg daily i.p. analyzed by immunoblotting to examine GLI2 ubiquitination. Anti- administration) for 51 days, respectively. Tumor volume was mea- bodies against FLAG (F1804, Clone M2, Sigma) and HA (ab9110, sured with calipers once every 3 days and calculated by the formula: Abcam) were used to examine GLI2 ubiquitination. length width width 0.5. At the end of the treatment period, each For examining GLI2 phosphorylation, HEK293T cells were tran- tumor was harvested and divided for qRT-PCR, hematoxylin and eosin siently transfected with DNA plasmids as indicated. Thirty-six hours (H&E), and IHC analyses. after treatment with or without PGE1, cells were collected and processed for immunoprecipitation assay following the above proce- H&E staining and IHC dures. Then the samples were analyzed by immunoblotting to examine Tumor samples were freshly collected, formalin-fixed, and paraffin GLI2 phosphorylation. Antibodies against FLAG (F1804, Clone M2, embedded. Before staining, sections were rehydrated by xylene and a Sigma) and phospho-(Ser/Thr) PKA substrate (9621, Cell Signaling series of descending concentrations of ethanol, and then rinsed by Technology) were used to examine GLI2 phosphorylation. deionized H2O. For H&E staining, sections were incubated with H&E following standard procedures. For IHC staining, sections were per- Cell viability assays formed with sodium citrate buffer for heat-induced epitope retrieval, Cells were plated at 3,000 cells per well in 96-well plates and treated and then incubated with 1:600 diluted rabbit anti-Ki67 antibody with drugs as indicated for 72 hours. The CCK-8 reagent (B34302, (ab15580, Abcam) at 4C overnight, washed 3 times every 10 minutes Biomake) was directly added into the plate at 10 mL/well and incubated with PBS, and then detected with the anti-rabbit DAB kit (PV-9001, at 37 C for 4 hours. Cell viability was assessed using a PerkinElmer ZSBIO). Slides were rinsed by deionized H2O, dehydrated by a series of plate reader. ascending concentrations of ethanol and xylene, and then cover slipped. The resulting slides were digitally scanned at 40 magnifi- Patient-derived orthotopic xenograft experiments cation on an Aperio VERSA 8 system (Leica Biosystems). The patient-derived orthotopic xenograft experiments were approved by the Institutional Animal Care and Use Committee of Statistical analysis Institute of Zoology, Chinese Academy of Sciences, and conducted Data were shown as mean SD throughout the paper. Two-way according to institutional guidelines. The surgery of orthotopic ANOVA was used for comparing tumor growth curves. Log-rank xenograft experiments was carried out in 6- to 7-week-old NOD- (Mantel–Cox) test was used for comparing survival curves. For other PrkdcscidIl2rgtm1/Bcgen mice (BIOCYTOGEN) following anesthetized comparisons, two-tailed Student t tests were used to generate P values, by i.p. injection of 400 mg/kg 2,2,2-Tribromoethanol (T1420, TCI). and a P value less than 0.05 was considered statistically significant. The head of mouse was properly placed in a stereotaxic apparatus in a Plots and statistical tests were performed by GraphPad Prism software. sterile environment, and then a small incision was made starting Asterisks () always represent degree of significance as follows. between the ears and ending near the back of the skull using a sterile , P < 0.05; , P < 0.01; , P < 0.001; and NS, not significant. scalpel. Then, a 0.8-mm-diameter burr hole is placed in the calvarium using a hand-held microdrill (78001, RWD Life Science) with a 0.8- mm burr (78042, RWD Life Science) using the following coordinates: Results 2 mm posterior to the lambdoid suture, 2 mm lateral to the midline, A high-content screening identifies prostaglandin compounds and 2.5 mm ventral from the surface of the skull. Note that 3 105 as GLI2 antagonists Med-113FH cells or Med-314FH cells in a volume of 3 mL were The essential role of GLI2 ciliary accumulation in HH pathway stereotaxically injected into the cerebellum using a 33G needle activation presents a novel opportunity for high-content drug discov- mounted at a Hamilton syringe (7634-01, Hamilton) at an infusion ery targeting GLI2. We thus developed a high-content screening rate of 1 mL/min. After injection, the needle was kept in place for about method for small molecules that inhibit GLI2 translocation to the 5 minutes to equilibrate the pressure within the cranial vault. The cilia. To facilitate identification of the PC, we first introduced a incision was closed with two to three interrupted sterile sutures construct of ADP-ribosylation factor-like GTPase 13B (ARL13B) (CR434, Jinhuan Medical). Mice were randomized into different tagged with red fluorescent tagRFPT into HH-responsive NIH/3T3 groups (n ¼ 5 in each group) according to the proper luminescence cells. ARL13B is a GTPase required for ciliogenesis (29). Subclones of signal. For drug treatment in vivo, vismodegib was used at 30 mg/kg this cell line were created by introducing EGFP::GLI2 expression for oral administration once a day, and PGE1 was used at 15 mg/kg for lentivirus particles. Mouse GLI2 was used in the EGFP fusion i.p. administration once a day. Tumor growth was monitored weekly construct. A clone with low EGFP::GLI2 expression, designated by bioluminescence acquisitions using the IVIS Spectrum Imaging 3T3/ARL13B::tagRFPT/EGFP::GLI2 cell line, was selected for further System (PerkinElmer). Survival data were collected throughout these study. In this cell line, EGFP::GLI2 mirrored previously reported orthotopic xenograft experiments. endogenous GLI2 ciliary trafficking behaviors (30, 31). EGFP accumulation in the PC was observed upon treatment with SHH-N, the Flank xenograft experiments SHH N-terminal signal peptide, or SAG, a small-molecule SMO The flank xenograft experiments were approved by the Institutional agonist. And its SHH-N–induced ciliary accumulation was attenuated Animal Care and Use Committee of Institute of Zoology, Chinese by vismodegib or cyclopamine (Supplementary Fig. S1A and S1B). Academy of Sciences, and conducted in compliance with institutional Moreover, GLI-dependent transcriptional activity responds to these guidelines. In brief, 5 106 GLI2-overexpressed DAOY cells in a treatments as expected for both 3T3/ARL13B::tagRFPT/EGFP::GLI2

AACRJournals.org Cancer Res; 80(13) July 1, 2020 2821

Wu et al.

cell line and its parental 3T3/ARL13B::tagRFPT cell line (Supplemen- potent HH pathway agonist by binding and activating SMO pro- tary Fig. S1C). These data indicate that EGFP::GLI2 is a bone fide tein (35), were applied, in contrast to results obtained for vismodegib reporter of GLI2 ciliary localization well-suited to high-content (Fig. 2G and H). In addition to pathway activity introduced by SAG, screening. To probe the transcriptional output of the HH pathway that introduced at a further upstream level by SHH-N, can also be activity, we next generated another NIH/3T3 reporter stable cell line inhibited by PGE1, probed by various measurements (Supplementary designated as 3T3/GLI-luc, in which firefly luciferase is driven by GLI- Fig. S5A–S5C). Taking these data together, PGE1 showed pan- dependent transcriptional activity through 8 tandem repeats of inhibition for multiple drug-resistant causes of SMO targeted cancer GLIBS (32), and a constitutive Renilla luciferase reporter serves as therapy, including GLI2 overexpression and SMO mutations, and an internal control (Supplementary Fig. S1D–S1F). We overexpressed PGE1 likely functions at a downstream level from SMO. mouse GLI2 in this 3T3/GLI-luc cell line (named 3T3/GLI-luc/GLI2) via delivery of lentiviral particles containing a CMV-driven mouse PGE1 antagonizes GLI2 via a cAMP-PKA-ubiquitin regulatory GLI2 expression construct (Supplementary Fig. S1G). Exogenous cascade GLI2, which can be readily detected by Western blot, elicited robust We next explored potential mechanisms underlying PGE1 inhibi- luciferase reporter activity in comparison with the parental cell tion against GLI2. Previous reports suggest that PGE1 might function (Supplementary Fig. S1H and S1I). through activation of cAMP signaling (36, 37). To this end, we Using the 3T3/ARL13B::tagRFPT/EGFP::GLI2 cell line, we con- employed a luciferase reporter controlled by cAMP responsive element ducted a high-content screening for small-molecule inhibitors of (CRE). PGE1 indeed activated CRE-luciferase reporter in a dose- SHH-N–induced ciliary accumulation of EGFP::GLI2 (Supplementary dependent manner (Fig. 3A), similar to a known cAMP agonist Fig. S2A). Compound libraries screened herein include FDA-approved FSK (Supplementary Fig. S6A; ref. 38). To test whether PGE1 inhi- drugs, candidates being studied in clinical trials and compounds with bition of GLI2 works through a cAMP-PKA–dependent mechanism, annotated biological functions. Through this screening, we identified we generated a GLI2 mutant where PKA phosphorylation sites were several hits that include known HH pathway inhibitors, thus validating altered (GLI2 DPKA), along with another GLI2 variant for compar- the assay (Supplementary Fig. S2B). Among the hits were 6 prosta- ison, where phosphorylation sites of GSK-3b were mutated (GLI2 glandins, including prostaglandin A1 (PGA1), prostaglandin D1 DGSK-3b; Fig. 3B; ref. 28). In the GLI-luciferase assay, we found that alcohol (PGD1 alcohol), 5-trans prostaglandin D2 (5-trans PGD2), PGE1 and FSK failed to inhibit GLI2 DPKA–induced HH pathway PGE1, prostaglandin J2 (PGJ2), and 15-deoxy-D12,14-prostaglandin J2 activation, whereas wild-type GLI2 WT and GLI2 DGSK-3b remain (15-deoxy-D12,14-PGJ2; Fig. 1A–C). unaffected (Fig. 3C), suggesting PGE10s GLI2 regulation specifically In agreement of GLI2 amplification as a drug refractory mechanism dependent on PKA-mediated phosphorylation. for vismodegib, no inhibitory effect against GLI2-induced luciferase To further study whether PGE1 regulation of GLI2 is mediated by activity was observed for vismodegib at concentration up to 10 mmol/L, PKA, we took advantage of PKI, an inhibitor peptide of PKA (39). We way higher than its saturated dose against wild-type activity (Fig. 1D; also generated a PKI mutant (PKI mut) control, mutating essential Supplementary Fig. S1F). In contrast, all 6 prostaglandins identified in arginines at 20 and 21 positions (40). As expected, administration of the primary high-content screening and additional 16 prostaglandin PKI, but not its mutant form, significantly decreased CRE-luciferase analogs inhibit GLI2-induced pathway activity in the GLI-luciferase signals stimulated by either PGE1 or FSK (Supplementary Fig. S6B). In assay (Fig. 1D; Supplementary Fig. S3A–S3P). Among these prosta- support of PGE1 functioning through PKA-mediated GLI2 regulation, glandins, PGE1, also known as alprostadil, is an FDA-approved drug PKI rescued the PGE1 inhibitory effect on GLI2-induced HH pathway commonly used for the treatment of pulmonary hypertension, erectile activity (Fig. 3D) and GLI2 protein level (Fig. 3E). Furthermore, using dysfunction, and peripheral artery occlusive disease (33, 34). There- a polyclonal antibody developed against phosphorylated substrates of fore, we used PGE1 as a representative of these prostaglandins in PKA, we observed that PGE1 treatment results in GLI2 phosphory- further investigations. We confirmed that PGE1 effectively inhibits lation, and such phosphorylation was abrogated by PKI (Fig. 3F). expression of GLI2 target genes, including Gli1 and Ptch1, whereas Together with GLI2 mutagenesis analyses (Fig. 3B and C), these vismodegib and cyclopamine showed no inhibitory effects (Fig. 1E). results demonstrate PGE1 inhibits GLI2 activity by modulating PKA-mediated phosphorylation of GLI2. PGE1 inhibits drug-resistant SMO mutants The decreased GLI2 protein level on introduction of PGE1 (Fig. 3E) Given that PGE1 overcomes drug resistance introduced at the prompted us to further examine the potential effect of PGE1 on GLI2 GLI level, we suspect, from an epistasis standpoint, it would also ubiquitination. Previous studies suggest that GLI2 protein stability overcome other major drug refractory mechanisms introduced by may be regulated by a sequence of events from multisite phosphor- SMO mutations and show activity with a broader spectrum. Therefore, ylation, ubiquitination, and consequent degradation by the protea- we examined HH pathway activity mediated by two drug refractory some (41, 42). To this end, we transfected Flag-Gli2 WT construct SMO mutants, SMO-D473H and SMO-W535L (also known as into HEK293T cells with HA-ubiquitin construct in the presence or SMO-M2; refs. 8, 23), which were identified in patients who experi- absence of PGE1. Strikingly, PGE1 treatment increased the ubiquiti- enced devastating cancer relapses during vismodegib treat- nation of GLI2 in comparison with a vehicle control. Treatment with ments (21, 24). In agreement with this expectation, PGE1 effectively PKI, not its mutant, reversed this effect (Fig. 3G). These data support suppressed both vismodegib-resistant mutants in luciferase reporter a working mechanism of PGE1 regulation of GLI2 mediated by a assays of HH pathway activity (Fig. 2A and B), and while examining cascade of events, including activation of PKA, followed by GLI2 endogenous Gli1 and Ptch1 mRNA expression levels (Fig. 2C–E), and phosphorylation, ubiquitination, and subsequent degradation. endogenous GLI1 protein level (Fig. 2F). All 6 prostaglandins identified from the primary high-content screening inhibited SMO PGE1 initiates GLI2 regulation through the EP4 receptor mutants with equivalent potency to wild-type SMO (SMO- Having identified the cAMP-PKA-ubiquitination regulatory cas- – WT; Fig. 2B; Supplementary Fig. S4A S4E). Consistently, no IC50 cade of PGE1 on GLI2 activity, it is tempting to ask that through which shift was observed for PGE1 when escalating concentrations of SAG, a receptor(s) does the drug trigger such effect. There are four

2822 Cancer Res; 80(13) July 1, 2020 CANCER RESEARCH

PGE1 Inhibits GLI2 Activity and Drug Refractory Tumor Growth

Figure 1. Identification of six prostaglandins that inhibit GLI2 accumulation in the PC. A, Chemical structures of the six prostaglandin hits. B and C, Representative images (B) and quantification (C) of prostaglandin inhibition of SHH-N–induced GLI2 ciliary accumulation in 3T3/ARL13B::tagRFPT/EGFP::GLI2 cells. Vismodegib (1 mmol/L) was used as a positive control. Prostaglandins were used at 10 mmol/L. Data present mean and SD of four replicates. Scale bar, 20 mm. D, Dose-response inhibition of the constitutive HH pathway activity by the identified 6 prostaglandins and vismodegib in 3T3/GLI-luc/GLI2 cells. Measurements were performed in quadruplicate. Data show mean SD. Please note that Ctrl% in this article is an additional normalization over the mean of DMSO (with or without other compound) treatment as 100%. E, qRT-PCR analysis of the effects of PGE1 (30 mmol/L), vismodegib (10 mmol/L), and cyclopamine (10 mmol/L) on endogenous Gli1 and Ptch1 expression in 3T3/GLI- luc/GLI2 cells. Data show mean SD from three biological replicates. , P < 0.01; NS, not significant; Student t test.

AACRJournals.org Cancer Res; 80(13) July 1, 2020 2823

Wu et al.

Figure 2. Examination of PGE10s effects against HH pathway activity introduced by SMO-D473H, SMO-W535L, and SAG, respectively. A and B, Effects of escalating concentrations of vismodegib (A) and PGE1 (B) on GLI-luciferase reporter activity in 3T3/GLI-luc cells overexpressing wild-type SMO (SMO-WT; red square), SMO- D473H (blue triangle), or SMO-W535L (green circle). C–E, qRT-PCR analysis of the effects of vismodegib (10 mmol/L) and PGE1 (30 mmol/L) on endogenous Gli1 and Ptch1 expression in 3T3/GLI-luc cells overexpressing wild-type SMO (C), SMO-D473H (D), or SMO-W535L (E). F, Western blot analysis of the effects of vismodegib (10 mmol/L) and PGE1 (30 mmol/L) on endogenous GLI1 protein expression in 3T3/GLI-luc cells overexpressing wild-type SMO, SMO-D473H, or SMO-W535L. b-Actin was used as a loading control. G and H, Dose-dependent inhibition of GLI-luciferase reporter activity by vismodegib (G) and PGE1 (H) in 3T3/GLI-luc cells stimulated with 10 nmol/L (blue circle), 50 nmol/L (red square), or 250 nmol/L (green triangle) SAG. Data present mean of quadruplicates SD. , P < 0.01; , P < 0.001; NS, not signiﬁcant; Student t test.

E-prostanoid receptors for PGE1, designated EP1, EP2, EP3, and specific agonist; ref. 46). In GLI-luciferase assays, qRT-PCR analyses of EP4 (43). To determine which EP subtype(s) transduces the PGE1 endogenous Gli1 and Ptch1, and Western blot examination of GLI1 signal, we first examined their expression and found that only EP1 and protein level, rivenprost elicited a similar effect on HH signaling EP4 were detected in the NIH/3T3 cells, HH-responsive cells used in compared with PGE1, whereas neither sulprostone nor butaprost was primary screening and secondary studies above, thus excluding EP2 active, indicating EP4 receptor–mediated PGE10s effect on HH sig- and EP3 as the functional receptor for PGE1 action in this scenario naling (Fig. 4B–D). (Fig. 4A). Next, we took advantage of the selective EP agonists, We next further addressed the question of whether EP4 mediates the including sulprostone (agonist of EP1 and EP3; ref. 44), butaprost PGE1-induced HH pathway inhibition by knocking out EP4 using the (EP2 receptor–specific agonist; ref. 45), and rivenprost (EP4 receptor– CRISPR-Cas9 approach (Supplementary Fig. S7A and S7B). In strong

2824 Cancer Res; 80(13) July 1, 2020 CANCER RESEARCH

PGE1 Inhibits GLI2 Activity and Drug Refractory Tumor Growth

Figure 3. Regulatory mechanisms underlining PGE1 inhibition of GLI2. A, A CRE-luciferase reporter assay examining the effect of increasing amount of PGE1 on cAMP-PKA levels. Reporter activity in the presence of PGE1 was normalized against activity in the DMSO-treated control. B, Schematics of GLI2 WT and its mutant forms in which mutated phosphorylation sites are highlighted in red (GLI2 DPKA and GLI2 DGSK-3b). C, Examination of GLI-luciferase activity upon transfection with GLI2 expression plasmids and treatments with PGE1 (50 mmol/L) or FSK (50 mmol/L) in NIH/3T3 cells. D and E, Examination of PKI rescuing effects on PGE1 inhibition of GLI2 activity by GLI-luciferase reporter assay (D) and Western blot analysis of GLI2 (E) in NIH/3T3 cells. PKI mutant (PKI mut) was used as a comparative control. PGE1 was used at 50 mmol/L. F, Immunoprecipitation assay examining phospho-GLI2 with antiphospho-(Ser/Thr) PKA substrate antibody that detects proteins containing a phosphoserine/threonine residue with arginine at the -3 position in HEK293T cells transfected with indicated constructs followed by PGE1 (50 mmol/L) treatment. G, Immunoprecipitation assay examining the effect of PGE1 (50 mmol/L) on the ubiquitination status of FLAG-GLI2 WT in HEK293T cells. Data are represented as mean SD of four replicates. The P value shown was calculated by Student t test. , P < 0.001; NS, not signiﬁcant.

AACRJournals.org Cancer Res; 80(13) July 1, 2020 2825

Wu et al.

Figure 4. PGE1 acts through the EP4 receptor to inhibit the HH signaling pathway. A, RT-PCR analysis of the expression of four EP receptors in NIH/3T3 cells. NIH/3T3 cells

cultured in serum-starved medium [NIH/3T3 (-)] and 10% calf serum media [NIH/3T3 (þ)] were both examined. Mouse ovary cells and the distilled water (H2O) were used as positive and negative controls, respectively. Gapdh was used as the internal reference. B–D, Effects of selective EP agonists on the SHH-N–induced pathway activity in NIH/3T3 cells. B, GLI-luciferase reporter activity in NIH/3T3 cells treated with SHH-N in combination with 10 mmol/L of PGE1, sulprostone, butaprost, and rivenprost, respectively. Data present the mean of quadruplicates SD. (Continued on the following page.)

2826 Cancer Res; 80(13) July 1, 2020 CANCER RESEARCH

PGE1 Inhibits GLI2 Activity and Drug Refractory Tumor Growth

contrast with wild-type cells, treatment of PGE1 in EP4 knockout with 15 mg/kg PGE1 on a daily basis led to significant tumor growth monoclonal cell lines failed to inhibit HH pathway activation induced inhibition (Fig. 6A and B). On the contrary, saturated treatments with by SHH-N, probed by mRNA levels of Gli1 and Ptch1 and protein level 30 mg/kg vismodegib on a daily basis conferred no inhibition of tumor of GLI1 (Fig. 4E and F). Consistently, PGE1 also failed to inhibit SAG- growth (Fig. 6A and B). Of note, previous studies showed a daily induced HH pathway activities in EP4 knockout cells (Supplementary treatment regime with 25 mg/kg vismodegib delivered complete þ Fig. S7C and S7D). These findings directed us to examine the sub- blockade against the growth of Ptch1 / murine tumor allografts (54). cellular localization of EP4 in the NIH/3T3 cells. Immunofluorescence In agreement with a PGE1 inhibitory action on GLI2, PGE1 imaging analysis showed that EP4 colocalized with the PC marker attenuated GLI1 and PTCH1 expression in the tumors (Fig. 6C). ARL13B, in agreement with its role in PGE1 regulation of HH pathway H&E staining revealed that PGE1-treated tumors showed evidence (Fig. 4G). Taken together, we concluded that PGE1 initiates the of necrosis as seen by destruction of organized nests of basophilic cAMP-PKA-ubiquitination regulatory cascade of GLI2 through acting tumor cells and pyknosis (black arrowhead), whereas vehicle or on EP4 receptor, possibly on the PC (Fig. 4H). vismodegib-treated tumors showed nests of well-organized tumor cells (red arrowhead; Fig. 6D). Consistent with tumor growth PGE1 inhibits growth of drug refractory human inhibition delivered by PGE1, Ki67-positive proliferating cells medulloblastoma xenografts markedly decreased in comparison with vehicle and vismodegib Having gained molecular insights of PGE1 regulation of GLI2 controls (Fig. 6E and F). activity, we next explored its potential application in treating refractory Two caveats can be found in the above DAOY-based studies: one is tumors associated with current SMO targeted cancer therapies. Pre- that the cell line might lose its accuracy in modeling the original tumor vious cancer studies in the field have utilized tumor allografts derived after prolonged passaging and in vitro culturing; the other is that from genetically modified mice, which were also limited in just xenografting to the flank did not accurately reflect real tumor envi- examining drug refractory SMO mutants (47, 48). To minimize ronment of medulloblastoma—the cerebellum. Therefore, we further interspecies variation, we first used DAOY cell line, a human SHH tested the effect of PGE1 using two patient-derived orthotopic xeno- subtype medulloblastoma cell line with known PTCH1 muta- graft models, Med-113FH and Med-314FH, harboring PTCH1 mutations (49, 50). It has been widely used as a SHH subtype medullo- tion and GLI2 amplification, respectively (55). Both of them express blastoma model for HH signaling studies (49–53). EP1, EP2, and EP4 EP4 (Supplementary Fig. S9A). Med-113FH cells stably expressing a receptors were detected through RT-PCR in DAOY cells (Supple- firefly luciferase reporter were transplanted into the cerebellum of mentary Fig. S8A). Among the selective EP agonists, only rivenprost immune-compromised mice, and tumors were measured with IVIS elicited inhibitory activity similar with PGE1 against the HH pathway imaging system. We treated the orthotopic allografts of Med-113FH activity in DAOY (Supplementary Fig. S8B), consistent with our with vehicle control or 15 mg/kg PGE1, and observed a significant observations in mouse NIH/3T3 cells (Fig. 4B–D). We thus concluded decrease in orthotopic tumor growth in PGE1-treated mice, as well as that PGE1 also acts on EP4 in DAOY cells. To model drug resistance an increase in overall survival in PGE1-treated mice (Fig. 7A–C). As arising from both SMO and GLI2 abnormalities, we generated DAOY expected, PGE1 treatment resulted in significant reduction of the sublines in which human SMO-D473H and human GLI2 were expression of endogenous GLI1 and PTCH1 mRNAs (Supplementary stably overexpressed, respectively. Cell viability and expression of Fig. S9B). Meanwhile, we observed a decreased protein level of GLI2 pathway target genes (GLI1 and PTCH1) in wild-type DAOY cells, and an elevated protein expression of p-CREB in Med-113FH ortho- SMO-D473H–overexpressed DAOY cells, and GLI2-overexpressed topic allografts treated with PGE1, supporting a consistent mechanism DAOY cells significantly decreased upon PGE1 treatments, whereas of action in Med-113FH tumors (Supplementary Fig. S9C). In a similar SMO-D473H–overexpressed DAOY cells and GLI2-overexpressed approach, orthotopic cerebellum tumors implanted with a firefly DAOY cells showed expected resistance to both vismodegib and luciferase–labeled subline of Med-314FH were treated with vehicle cyclopamine (Fig. 5A–F). To determine whether PGE1 acts on HH control or 30 mg/kg vismodegib or 15 mg/kg PGE1. We observed signaling via PKA activation in DAOY cells, we overexpressed GLI2 marked reduction in the growth of Med-314FH orthotopic allografts in DPKA and found that PGE10s effect on cellular viability was absent response to PGE1 but not vismodegib, together with an improved (Supplementary Fig. S8C). In addition, PGE10s inhibitory activity overall survival for Med-314FH orthotopic allografts treated with against HH pathway was no longer observed upon knockdown of PGE1 but not vismodegib (Fig. 7D–F). Consistently, in Med-314FH EP4, reinforcing the role of EP4 for PGE1 (Supplementary Fig. S8D). orthotopic allografts, we observed downregulation of endogenous These results demonstrated PGE10s effect against tumor cell growth GLI1 and PTCH1 mRNA expression, decreased GLI2 protein expres- in vitro and the underlining HH pathway activity. sion, and increased p-CREB protein expression after PGE1 treatment We next focused on GLI2-overexpressed DAOY cells in tumor (Supplementary Fig. S9D and S9E). xenograft studies in vivo, which also gained a growth advantage over It has been reported that PGE1 can efficiently cross the blood–brain wild-type DAOY cells (Supplementary Fig. S8E). Administrations barrier (BBB) in multiple mammals (56–58). And administration

(Continued.) C, qRT-PCR analysis of mRNA levels of Gli1 and Ptch1in NIH/3T3 cells treated with SHH-N in combination with 10 mmol/L of PGE1, sulprostone, butaprost, or rivenprost. Data show mean SD from three independent experiments. D, Western blot analysis of endogenous GLI1 protein levels in cell lysates from NIH/3T3 cells treated with SHH-N in conjunction with 10 mmol/L of PGE1, sulprostone, butaprost, or rivenprost. b-Actin was used as a loading control. E, qRT-PCR analysis of Gli1 and Ptch1 mRNA levels in wild-type and EP4 knockout cells treated with SHH-N in combination with PGE1 (10 mmol/L) or vehicle control. F, Western blot analysis of GLI1 protein level in wild-type and EP4 knockout cells treated with SHH-N in combination with PGE1 (10 mmol/L) or vehicle control. b-Actin was used as a loading control. G, Immunostaining for EP4 and ARL13B in NIH/3T3 cells. Representative images of the endogenous localization of EP4 (green) and ARL13B (red) in serum- starved NIH/3T3 cells are shown. Cells were counterstained with Hoechst 33342 (blue). Scale bar, 10 mm. H, A model of PGE1 working mechanism for HH pathway inhibition. PGE1 acts on the EP4 receptor on the PC, which triggers the increase of cAMP levels, thereby enhancing PKA activity. Elevated PKA phosphorylates GLI2 and inhibits its translocation to the PC, which consequently promotes GLI2 ubiquitination and subsequent degradation, thus attenuating its activity. , P < 0.01; , P < 0.001; NS, not signiﬁcant; Student t test.

AACRJournals.org Cancer Res; 80(13) July 1, 2020 2827

Wu et al.

Figure 5. PGE1 inhibits the cell viability and HH pathway activity in human DAOY medulloblastoma cells and their derivative cell lines resistant to SMO inhibitors. A–C, Cell viability assays in wild-type DAOY cells (A), SMO-D473H–overexpressed DAOY cells (B), and GLI2-overexpressed DAOY cells (C) treated with PGE1 (100 mmol/L), vismodegib (10 mmol/L), and cyclopamine (10 mmol/L). Data represent mean of quadruplicates SD. D–F, qRT-PCR analysis of mRNA levels of GLI1 and PTCH1 in wild-type DAOY cells (D), SMO-D473H–overexpressed DAOY cells (E), and GLI2-overexpressed DAOY cells (F) treated with PGE1 (100 mmol/L), vismodegib (10 mmol/L), and cyclopamine (10 mmol/L). Data show mean SD from three independent experiments. , P < 0.05; , P < 0.01; , P < 0.001; NS, not signiﬁcant; Student t test.

of PGE1 in newborns resulted in neurological and electroencephalo- potentially exist for drug repurposing. Taken together, these results graphic changes, indicating distribution in the brain (59). Therefore, support that PGE1, as a representative of many prostaglandins BBB might not be an obstacle for repurposing PGE1 to treat medul- identified in this study, would provide potential opportunities for loblastoma, a brain disease. In addition, it was reported that PGE1 is further therapeutic translation targeting tumors refractory to cur- metabolized at a high speed in patients (60, 61). Therefore, we also rent generation SMO antagonists. examined its two main metabolites in human, 13,14-dihydro-PGE1 and 15-keto-13,14-dihydro-PGE1 (62). Both of them inhibit GLI2 activity, the former displays a comparable potency to PGE1, whereas Discussion the latter is less active (Supplementary Fig. S10A and S10B), thus Drug resistance is a major and devastating challenge associated with suggesting that its fast metabolism unlikely limits its activity against targeted cancer therapies. Those targeting HH pathway is no excep- GLI2-driven drug refractory human tumor growth. tion. Superior to the strategy targeting drug refractory SMO mutants, To further explore whether additional drug repurposing oppor- an alternative to target downstream GLI2 amplification, as demon- tunities exist, lastly we examined 4 FDA-approved prostaglandins strated in the current study, shows effects of a broader molecular (misoprostol, latanoprost, tafluprost, and travoprost) and 1 pros- spectrum and pan-inhibition against multiple drug refractory taglandin having undergone clinical trials (rivenprost; Supplemen- mechanisms, including SMO mutagenesis. Using PGE1 as a repre- tary Fig. S11A). Among them, misoprostol and rivenprost showed sentative of prostaglandins identified from our screening, a novel similar potency with PGE1 in antagonizing GLI2 activity, whereas mechanism of GLI2 regulation triggered by its action on EP4 receptor the other three, including latanoprost, tafluprost, and travoprost, was discovered (Fig. 4). More importantly, using human medullo- had no inhibitory effects (Supplementary Fig. S11A). This obser- blastoma xenograft models that displayed resistance to vismodegib, vation implied that additional opportunities other than PGE1 PGE1 demonstrated significant inhibition against tumor growth

2828 Cancer Res; 80(13) July 1, 2020 CANCER RESEARCH

PGE1 Inhibits GLI2 Activity and Drug Refractory Tumor Growth

Figure 6. Xenograft assay using human DAOY cells overexpressing GLI2. A, Macroscopic appearance of representative allografts at the end of these experiments on day 51. B, Change of tumor volumes over the time course of treatments with vehicle control, vismodegib (30 mg/kg), or PGE1 (15 mg/kg). Data depict mean SD; n ¼ 8in each group. C, qRT-PCR analysis of GLI1 and PTCH1 mRNA expression in tumors treated with vehicle control, vismodegib (30 mg/kg), and PGE1 (15 mg/kg), respectively. Data represent the mean of three samples SD. D and E, Representative images of H&E (D) and Ki67 (E) staining of tumor tissues treated with vehicle control or vismodegib (30 mg/kg) or PGE1 (15 mg/kg), respectively. Scale bar, 20 mm. F, Quantiﬁcation of Ki67 staining from tumors in E. Data present the mean of three samples SD. , P < 0.05; , P < 0.01; , P < 0.001; NS, not signiﬁcant. Student t test.

(Fig. 6A and B, Fig. 7D–F), thus highlighting potential opportunities central cellular organelle for HH signaling transduction (Fig. 4G). A for future clinical translation. hypothetical model was proposed where PGE1 binds to EP4 recep- We demonstrated PGE1 acts through EP4 to inhibit the HH tor on the cilium, thereby activating cAMP-PKA signaling to signaling. Intriguingly, we observed EP4 localization on the PC, the promote GLI2 phosphorylation and subsequent degradation in an

AACRJournals.org Cancer Res; 80(13) July 1, 2020 2829

Wu et al.

Figure 7. Patient-derived orthotopic xenograft experiments using the Med-113FH and the Med-314FH tumor models. A–C, Med-113FH tumor cells transduced with a firefly luciferase reporter were used for cerebellum injections of immune-compromised mice, which were then randomized for treatment with either vehicle control or PGE1 (15 mg/kg). The bioluminescence images (A) and corresponding data analysis (B) of Med-113FH allografts assessed by IVIS imaging. C, Kaplan–Meier survival curve of the mice injected with luciferase-labeled Med-113FH cells in the cerebellum. D–F, Med-314FH tumor cells transduced with a firefly luciferase reporter were used for cerebellum injections of immune-compromised mice, which were then randomized for treatment with vehicle control or vismodegib (30 mg/kg) or PGE1 (15 mg/kg). The bioluminescence images (D) and corresponding data analysis (E) of Med-314FH allografts assessed by IVIS imaging. F, Kaplan–Meier survival curve of the mice injected with luciferase-labeled Med-314FH cells in the cerebellum. Two-way ANOVA was used for the comparisons of tumor growth curves. Log-rank (Mantel–Cox) test was used for the comparisons of survival curves. Data depict mean SD, n ¼ 5 in each group.

2830 Cancer Res; 80(13) July 1, 2020 CANCER RESEARCH

PGE1 Inhibits GLI2 Activity and Drug Refractory Tumor Growth

ubiquitin-proteasome–dependent manner (Fig. 4H). In support of Authors’ Contributions themodel,wefoundthatGLI2DPKA was resistant to PGE1 Conception and design: F. Wu, Y. Wang treatment and PKI rescued PGE10s effect on GLI2 stability and Development of methodology: F. Wu, C. Zhang, C. Zhao transcriptional activity (Fig. 3C–E). Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): F. Wu, C. Zhang, Z. Teng Current study used PGE1 as a representative for mechanistic Analysis and interpretation of data (e.g., statistical analysis, biostatistics, investigations. Nonetheless, several prostaglandins showed similar computational analysis): F. Wu, H. Wu, T. Jiang, Y. Wang pan-inhibition against pathway activation at multiple levels, includ- Writing, review, and/or revision of the manuscript: F. Wu, T. Jiang, Y. Wang ing that associated with drug refractory mechanisms (Figs. 1D Administrative, technical, or material support (i.e., reporting or organizing data, and 2B; and Supplementary Fig. S4A–S4E). It was reported that constructing databases): C. Zhang, C. Zhao, H. Wu although functioning through distinct receptors, intracellular sig- Study supervision: T. Jiang, Y. Wang naling transduction stimulated by these prostaglandins converges Acknowledgments into cAMP elevation (63). In contrast, latanoprost, tafluprost, and 2þ We highly appreciate Dr. Andrew P. McMahon (University of South California, travoprost, which are known to enhance cellular Ca levels Los Angeles) for reading and discussion of this article. We are grateful to Dr. Yongbin through FP receptor (63), but have no effect on cAMP level, are Chen (Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, inactive in inhibition of GLI2 activity (Supplementary Fig. S11A). China) for sharing p8 GLIBS-firefly luciferase plasmid. We thank the Brain Tumor We observed that FP receptor is expressed in the NIH/3T3 cells Resource Lab at Fred Hutchinson Cancer Research Center for offering Med-113FH used in this experiment (Supplementary Fig. S11B), thus ruling out and Med-314FH human SHH medulloblastoma lines. We thank Dr. Changmei Liu the possibility that lack of inhibition against GLI2 activity is due to (Institute of Zoology, Chinese Academy of Sciences, Beijing, China) for the gift of mouse ovary samples. We also thank Dr. Wei Li (Institute of Zoology, Chinese lack of FP receptor expression. Academy of Sciences, Beijing, China) for assisting with protein ubiquitination The concentrations of PGE1 required for full inhibition of HH techniques. We would like to thank colleagues in our lab for helpful discussions and pathway activity in our cell-based assays (5–10 mmol/L, Fig. 2B our colleagues from the Zhongguacun Park Campus of the Institute of Zoology at the and H; and Supplementary Fig. S5A) are comparable with clin- Chinese Academy of Sciences for sharing instruments, technical assistance, and ically relevant level at 10 mmol/L reported for human cardiac helpful discussions. This study was supported by the National Natural Science regeneration (64), implying that dosing unlikely being a limiting Foundation of China (No. 91957121, 31571514 to Y. Wang), Beijing Municipal Natural Science Foundation (No. Z190013 to Y. Wang), Capital's Funds for Health factor for further clinical translation. It is also worth pointing out Improvement and Research (No. CFH 2018-2-2042 to T. Jiang), the Hundred Talents that PGE1 is not the only FDA-approved drug among active Program of Chinese Academy of Sciences, and State Key Laboratory of Stem Cell and prostaglandins identified in the current study (Supplementary Reproductive Biology (to Y. Wang). A patent covering the novel findings of Fig. S11A). Therefore, we provided a rich source of potential prostaglandins and analogs modulating HH pathway, GLI2 activity, and tumor fi opportunities for medicinal chemistry optimization, if necessary growth has been led. before entering clinical trials, and drug repurposing, taking advan- The costs of publication of this article were defrayed in part by the payment of page tages of their well-characterized pharmacokinetics and safety fi charges. This article must therefore be hereby marked advertisement in accordance pro les. with 18 U.S.C. Section 1734 solely to indicate this fact.

Disclosure of Potential Conflicts of Interest Received July 3, 2019; revised March 29, 2020; accepted April 30, 2020; No potential conflicts of interest were disclosed. published first May 5, 2020.

References 1. McMahon AP, Ingham PW, Tabin CJ. Developmental roles and clinical signif- 11. Gailani MR, Stahle-Backdahl M, Leffell DJ, Glynn M, Zaphiropoulos PG, icance of hedgehog signaling. Curr Top Dev Biol 2003;53:1–114. Pressman C, et al. The role of the human homologue of Drosophila patched 2. Roberts KJ, Kershner AM, Beachy PA. The stromal niche for epithelial stem cells: in sporadic basal cell carcinomas. Nat Genet 1996;14:78–81. a template for regeneration and a brake on malignancy. Cancer Cell 2017;32: 12. Reifenberger J, Wolter M, Weber RG, Megahed M, Ruzicka T, Lichter P, et al. 404–10. Missense mutations in SMOH in sporadic basal cell carcinomas of the skin and 3. Wu F, Zhang Y, Sun B, McMahon AP, Wang Y. Hedgehog signaling: from basic primitive neuroectodermal tumors of the central nervous system. Cancer Res biology to cancer therapy. Cell Chem Biol 2017;24:252–80. 1998;58:1798–803. 4. Amakye D, Jagani Z, Dorsch M. Unraveling the therapeutic potential of the 13. Cho YJ, Tsherniak A, Tamayo P, Santagata S, Ligon A, Greulich H, et al. hedgehog pathway in cancer. Nat Med 2013;19:1410–22. Integrative genomic analysis of medulloblastoma identifies a molecular sub- 5. Corbit KC, Aanstad P, Singla V, Norman AR, Stainier DY, Reiter JF. Vertebrate group that drives poor clinical outcome. J Clin Oncol 2011;29:1424–30. smoothened functions at the primary cilium. Nature 2005;437:1018–21. 14. Northcott PA, Shih DJ, Peacock J, Garzia L, Morrissy AS, Zichner T, et al. 6. Rohatgi R, Milenkovic L, Scott MP. Patched1 regulates hedgehog signaling at the Subgroup-specific structural variation across 1,000 medulloblastoma genomes. primary cilium. Science 2007;317:372–6. Nature 2012;488:49–56. 7. Kim J, Kato M, Beachy PA. Gli2 trafficking links hedgehog-dependent activation 15. Buczkowicz P, Ma J, Hawkins C. GLI2 is a potential therapeutic target in pediatric of smoothened in the primary cilium to transcriptional activation in the nucleus. medulloblastoma. J Neuropathol Exp Neurol 2011;70:430–7. Proc Natl Acad Sci U S A 2009;106:21666–71. 16. Yauch RL, Gould SE, Scales SJ, Tang T, Tian H, Ahn CP, et al. A paracrine 8. Xie J, Murone M, Luoh SM, Ryan A, Gu Q, Zhang C, et al. Activating requirement for hedgehog signalling in cancer. Nature 2008;455:406–10. Smoothened mutations in sporadic basal-cell carcinoma. Nature 1998;391: 17. Hoy SM. Glasdegib: first global approval. Drugs 2019;79:207–13. 90–2. 18. Chen JK, Taipale J, Cooper MK, Beachy PA. Inhibition of hedgehog signaling by 9.RaffelC,JenkinsRB,FrederickL,HebrinkD,AldereteB,FultsDW,etal. direct binding of cyclopamine to smoothened. Genes Dev 2002;16:2743–8. Sporadic medulloblastomas contain PTCH mutations. Cancer Res 1997;57: 19. Dlugosz A, Agrawal S, Kirkpatrick P. Vismodegib. Nat Rev Drug Discov 2012;11: 842–5. 437–8. 10. Tostar U, Malm CJ, Meis-Kindblom JM, Kindblom LG, Toftgard R, Unden AB. 20. Burness CB. Sonidegib: first global approval. Drugs 2015;75:1559–66. Deregulation of the hedgehog signalling pathway: a possible role for the PTCH 21. Sharpe HJ, Pau G, Dijkgraaf GJ, Basset-Seguin N, Modrusan Z, Januario T, et al. and SUFU genes in human rhabdomyoma and rhabdomyosarcoma develop- Genomic analysis of smoothened inhibitor resistance in basal cell carcinoma. ment. J Pathol 2006;208:17–25. Cancer Cell 2015;27:327–41.

AACRJournals.org Cancer Res; 80(13) July 1, 2020 2831

Wu et al.

22. Buonamici S, Williams J, Morrissey M, Wang A, Guo R, Vattay A, et al. selectivities of prostaglandins and related analogs. Biochim Biophys Acta 2000; Interfering with resistance to smoothened antagonists by inhibition of the PI3K 1483:285–93. pathway in medulloblastoma. Sci Transl Med 2010;2:51ra70. 45. Gardiner PJ. Characterization of prostanoid relaxant/inhibitory receptors (psi) 23. Yauch RL, Dijkgraaf GJP, Alicke B, Januario T, Ahn CP, Holcomb T, et al. using a highly selective agonist, TR4979. Br J Pharmacol 1986;87:45–56. Smoothened mutation confers resistance to a hedgehog pathway inhibitor in 46. Yoshida K, Oida H, Kobayashi T, Maruyama T, Tanaka M, Katayama T, et al. medulloblastoma. Science 2009;326:572–4. Stimulation of bone formation and prevention of bone loss by prostaglandin E 24. Atwood SX, Sarin KY, Whitson RJ, Li JR, Kim G, Rezaee M, et al. Smoothened EP4 receptor activation. Proc Natl Acad Sci U S A 2002;99:4580–5. variants explain the majority of drug resistance in basal cell carcinoma. 47. Tang Y, Gholamin S, Schubert S, Willardson MI, Lee A, Bandopadhayay P, et al. Cancer Cell 2015;27:342–53. Epigenetic targeting of Hedgehog pathway transcriptional output through BET 25. Kool M, Jones DT, Jager N, Northcott PA, Pugh TJ, Hovestadt V, et al. Genome bromodomain inhibition. Nat Med 2014;20:732–40. sequencing of SHH medulloblastoma predicts genotype-related response to 48. Kim J, Aftab BT, Tang JY, Kim D, Lee AH, Rezaee M, et al. Itraconazole and smoothened inhibition. Cancer Cell 2014;25:393–405. arsenic trioxide inhibit Hedgehog pathway activation and tumor growth asso- 26. Wang Y, Arvanites AC, Davidow L, Blanchard J, Lam K, Yoo JW, et al. Selective ciated with acquired resistance to smoothened antagonists. Cancer Cell 2013;23: identification of hedgehog pathway antagonists by direct analysis of smoothened 23–34. ciliary translocation. ACS Chem Biol 2012;7:1040–8. 49. Singh J, Wen X, Scales SJ. The orphan G protein-coupled receptor Gpr175 27. Yang C, Chen W, Chen Y, Jiang J. Smoothened transduces hedgehog signal by (Tpra40) enhances hedgehog signaling by modulating cAMP levels. J Biol Chem forming a complex with Evc/Evc2. Cell Res 2012;22:1593–604. 2015;290:29663–75. 28. Riobo NA, Lu K, Ai X, Haines GM, Emerson CP. Phosphoinositide 3-kinase and 50. Triscott J, Lee C, Foster C, Manoranjan B, Pambid MR, Berns R, et al. Person- akt are essential for sonic hedgehog signaling. Proc Natl Acad Sci U S A 2006;103: alizing the treatment of pediatric medulloblastoma: polo-like kinase 1 as a 4505–10. molecular target in high-risk children. Cancer Res 2013;73:6734–44. 29. Caspary T, Larkins CE, Anderson KV. The graded response to sonic hedgehog 51. Tiberi L, Bonnefont J, van den Ameele J, Le Bon SD, Herpoel A, Bilheu A, depends on cilia architecture. Dev Cell 2007;12:767–78. et al. A BCL6/BCOR/SIRT1 complex triggers neurogenesis and suppresses 30. Haycraft CJ, Banizs B, Aydin-Son Y, Zhang Q, Michaud EJ, Yoder BK. Gli2 and medulloblastoma by repressing sonic hedgehog signaling. Cancer Cell 2014; Gli3 localize to cilia and require the intraflagellar transport protein polaris for 26:797–812. processing and function. PLoS Genet 2005;1:e53. 52. Raducu M, Fung E, Serres S, Infante P, Barberis A, Fischer R, et al. SCF (Fbxl17) 31. Kiprilov EN, Awan A, Desprat R, Velho M, Clement CA, Byskov AG, et al. ubiquitylation of sufu regulates hedgehog signaling and medulloblastoma Human embryonic stem cells in culture possess primary cilia with hedgehog development. EMBO J 2016;35:1400–16. signaling machinery. J Cell Biol 2008;180:897–904. 53. Gotschel€ F, Berg D, Gruber W, Bender C, Eberl M, Friedel M, et al. Synergism 32. Sasaki H, Hui C, Nakafuku M, Kondoh H. A binding site for Gli proteins is between Hedgehog-GLI and EGFR signaling in Hedgehog-responsive human essential for HNF-3beta floor plate enhancer activity in transgenics and can medulloblastoma cells induces downregulation of canonical Hedgehog-target respond to Shh in vitro. Development 1997;124:1313–22. genes and stabilized expression of GLI1. PLoS One 2013;8:e65403. 33. Murali S, Uretsky BF, Armitage JM, Tokarczyk TR, Betschart AR, Kormos RL, 54. Wong H, Alicke B, West KA, Pacheco P, La H, Januario T, et al. Pharmaco- et al. Utility of prostaglandin E1 in the pretransplantation evaluation of heart kinetic-pharmacodynamic analysis of vismodegib in preclinical models of failure patients with significant pulmonary hypertension. J Heart Lung Trans- mutational and ligand-dependent hedgehog pathway activation. Clin Cancer plant 1992;11:716–23. Res 2011;17:4682–92. 34. Weiss T, Fischer D, Hausmann D, Weiss C. Endothelial function in 55. Brabetz S, Leary SES, Grobner€ SN, Nakamoto MW, Seker-Cin¸ H, Girard EJ, patients with peripheral vascular disease: influence of prostaglandin E1. et al. A biobank of patient-derived pediatric brain tumor models. Nat Med Prostaglandins Leukot Essent Fatty Acids 2002;67:277–81. 2018;24:1752–61. 35. Chen JK, Taipale J, Young KE, Maiti T, Beachy PA. Small molecule modulation of 56. Taogoshi T, Nomura A, Murakami T, Nagai J, Takano M. Transport of smoothened activity. Proc Natl Acad Sci U S A 2002;99:14071–6. prostaglandin E1 across the blood-brain barrier in rats. J Pharm Pharmacol 36. McCarthy KD, de Vellis J. Alpah-adrenergic receptor modulation of beta- 2005;57:61–6. adrenergic, adenosine and prostaglandin E1 increased adenosine 3':5'-cyclic 57. Lin MT. Effects of brain monoamine depletions on thermoregulation in rabbits. monophosphate levels in primary cultures of glia. J Cyclic Nucleotide Res 1978;4: Am J Physiol 1980;238:R364–71. 15–26. 58. Holmes SW, Horton EW. The distribution of tritium-labelled prostaglandin E(1) 0 0 fi 37. Maganiello V, Vaughan M. Prostaglandin E1 effects on adenosine 3 :5 -cyclic injected in amounts suf cient to produce central nervous effects in cats and monophosphate concentration and phosphodiesterase activity in fibroblasts. chicks. Br J Pharmacol 1968;34:32–7. Proc Natl Acad Sci U S A 1972;69:269–73. 59. Fariello R, Olley PM, Coceani F. Neurological and electroencephalographic 38. Insel PA, Ostrom RS. Forskolin as a tool for examining adenylyl cyclase changes in newborns treated with prostaglandins E1 and E2. Prostaglandins expression, regulation, and G protein signaling. Cell Mol Neurobiol 2003;23: 1977;13:901–7. 305–14. 60. Cawello W, Schweer H, Dietrich B, Seyberth HW, Albrecht D, Fox A, et al. 39. Knighton DR, Zheng JH, Teneyck LF, Xuong NH, Taylor SS, Sowadski JM. Pharmacokinetics of prostaglandin E1 and its main metabolites after intraca- Structure of a peptide inhibitor bound to the catalytic subunit of cyclic aden- vernous injection and short-term infusion of prostaglandin E1 in patients with osine-monophosphate dependent protein-kinase. Science 1991;253:414–20. erectile dysfunction. J Urol 1997;158:1403–7. 40. Day RN, Walder JA, Maurer RA. A protein kinase inhibitor gene reduces both 61. Cawello W, Leonhardt A, Schweer H, Seyberth HW, Bonn R, Lomeli AL. Dose basal and multihormone-stimulated prolactin gene transcription. J Biol Chem proportional pharmacokinetics of alprostadil (prostaglandin E1) in healthy 1989;264:431–6. volunteers following intravenous infusion. Br J Clin Pharmacol 1995;40:273–6. 41. Bhatia N, Thiyagarajan S, Elcheva I, Saleem M, Dlugosz A, Mukhtar H, et al. Gli2 62. Schweer H, Meese CO, Watzer B, Seyberth HW. Determination of prostaglandin is targeted for ubiquitination and degradation by beta-TrCP ubiquitin ligase. E1 and its main plasma metabolites 15-keto-prostaglandin E0 and prostaglandin J Biol Chem 2006;281:19320–6. E0 by gas chromatography/negative ion chemical ionization triple-stage quad- 42. Pan Y, Wang C, Wang B. Phosphorylation of Gli2 by protein kinase a is required rupole mass spectrometry. Biol Mass Spectrom 1994;23:165–70. for Gli2 processing and degradation and the sonic hedgehog-regulated mouse 63. Mohan S, Ahmad AS, Glushakov AV, Chambers C, Dore S. Putative role of development. Dev Biol 2009;326:177–89. prostaglandin receptor in intracerebral hemorrhage. Front Neurol 2012;3:145. 43. Breyer RM, Bagdassarian CK, Myers SA, Breyer MD. Prostanoid receptors: 64. Weiss TW, Mehrabi MR, Kaun C, Zorn G, Kastl SP, Speidl WS, et al. Prosta- subtypes and signaling. Annu Rev Pharmacol Toxicol 2001;41:661–90. glandin E1 induces vascular endothelial growth factor-1 in human adult cardiac 44. Abramovitz M, Adam M, Boie Y, Carriere M, Denis D, Godbout C, et al. The myocytes but not in human adult cardiac fibroblasts via a cAMP-dependent utilization of recombinant prostanoid receptors to determine the affinities and mechanism. J Mol Cell Cardiol 2004;36:539–46.

2832 Cancer Res; 80(13) July 1, 2020 CANCER RESEARCH

Prostaglandin E1 Inhibits GLI2 Amplification−Associated Activation of the Hedgehog Pathway and Drug Refractory Tumor Growth

Fujia Wu, Chenze Zhang, Chen Zhao, et al.

Cancer Res 2020;80:2818-2832. Published OnlineFirst May 5, 2020.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-19-2052

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2020/05/05/0008-5472.CAN-19-2052.DC1

Cited articles This article cites 64 articles, 21 of which you can access for free at: http://cancerres.aacrjournals.org/content/80/13/2818.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/80/13/2818. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.