DOCSLIB.ORG

Proposal of Sphingomonadaceae Fam. Nov., Consisting of Sphingomonas Yabuuchi Et Al. 1990, Erythrobacter Shiba and Shimidu 1982, Erythromicrobium Yurkov Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Proposal of Sphingomonadaceae Fam. Nov., Consisting of Sphingomonas Yabuuchi Et Al. 1990, Erythrobacter Shiba and Shimidu 1982, Erythromicrobium Yurkov Et Al Microbiol. Immunol., 44(7), 563-575, 2000 Proposal of Sphingomonadaceae Fam. Nov., Consisting of Sphingomonas Yabuuchi et al. 1990, Erythrobacter Shiba and Shimidu 1982, Erythromicrobium Yurkov et al. 1994, Porphyrobacter Fuerst et al. 1993, Zymomonas Kluyver and van Niel 1936, and Sandaracinobacter Yurkov et al. 1997, with the Type Genus Sphingomonas Yabuuchi et al. 1990 Yoshimasa Kosako*°', Eiko Yabuuchi2, Takashi Naka3,4, Nagatoshi Fujiwara3, and Kazuo Kobayashi3 'JapanCollection of Microorganis ms,RIKEN (Institute of Physical and ChemicalResearch), Wako, Saitama 351-0198, Japan, 2Departmentof Microbiologyand Immunology , AichiMedical University, Aichi 480-1101, Japan, 'Departmentof Host Defense,Osaka City University, Graduate School of Medicine,Osaka, Osaka 545-8585, Japan, and Instituteof SkinSciences, ClubCosmetics Co., Ltd., Osaka,Osaka 550-0005, Japan ReceivedJanuary 25, 2000; in revisedform, April 11, 2000. Accepted April 14, 2000 Abstract:Based on the results of phylogeneticanalysis of the 16SrDNA sequences and the presence of N- 2'-hydroxymyristoyldihydrosphingosine 1-glucuronic acid (SGL-1)and 2-hydroxymyristicacid (non- hydroxymyristicacid in Zymomonas)in cellular lipids,a new family,Sphingomonadaceae, for Group 4 of the alpha-subclassof the classProteobacteria is hereinproposed and a descriptionof the familyis given.The familyconsists of six genera, Sphingomonas,Erythrobacter, Erythromicrobium, Porphyrobacter, Sandara- cinobacterand Zymomonas.Thus, all the validlypublished and currently known genera in Group 4 of the alpha-subclassof Proteobacteriabelong to Sphingomonadaceaefam. nov.Among them, type strains of two species, Porphyrobacter and Erythrobacter, Sandaracinobactersibiricus and Sphingomonasursincola, respectively,are facultativelyphotosynthetic due to bacteriochlorophyll(Bchl)-a. The type strains of two subspeciesof Zymomonasmobilis are facultativeanaerobes. The presenceof SGL-1together with the results of a phylogeneticanalysis of the 16SrDNA sequences recommends a newcriteria by whichto definethe new family Sphingomonadaceae.The type genus is SphingomonasYabuuchi et al. 1990. Keywords: Sphingomonadaceae fam. nov., New family,Proteobacteria, Alpha-subclass, Sphingoglycolipid *Address correspondence to Dr. Yoshimasa Kosako, Japan ismen and Zellkulturen, Braunschweig GmbH, Germany; EY, Collection of Microorganisms, RIKEN (The Institute of Physical Eiko Yabuuchi, Department of Microbiology and Immunology, and Chemical Research), Wako, Saitama 351-0198, Japan. Aichi Medical University, Aichi, Japan; GC, guanine plus cyto- Fax: x--81-48-462-4618. E-mail: [email protected] sine; GIFU, Department of Microbiology,Gifu University School of Medicine,Gifu, Japan; IAM, Institute of Applied Microbiology, University of Tokyo, Tokyo, Japan; IFO, Institute for Fermenta- Abbreviations: ACM, Australian Collection of Microorgan- tion Osaka, Osaka, Japan; JCM, Japan Collection of Microor- isms, Department of Microbiology, University of Queensland, ganisms, RIKEN (The Institute of Physical and Chemical Queensland, Australia; AMPC, amoxicillin; ATCC, American Research), Saitama, Japan; LMG, Laboratorium voor Microbi- Type Culture Collection, Mananas, Virginia, U.S.A.; comb. nov., ologie, Universuteit Gent, Gent, Belgium; PYA, peptone (1%)- combinatio nova= new combination; CVC, clavulanic acid; yeast extract (1%)-NaCI (0.5%) agar; RDP, Ribosomal Data- DDBJ, DNA Data Bank of Japan, Institute of Genetics, Mishima, base Project, Center for Microbial Ecology, Michigan State Uni- Shizuoka, Japan; DSM, Deutsche Sammlung von Mikroorgan- versity, Michigan, U.S.A.; SGL, Sphingoglycolipid, 563 564 Y. KOSAKO ET AL ATCC 10829, a type strain of Flavobacterium devo- the genus Sphingomonas. In addition to these, "Sphin- rans (Zimmermann 1890) Bergey et al. 1923"L, was a gomonas wittchii" was proposed by Yabuuchi et al for the high GC organism and found to have N-2'-hydrox- strain known as dibenzo-p-dioxin metabolizing strain ymyristoyl dihydrosphingosine 1-glucuronic acid (SGL- RW1 (personal communications). 1) in cellular lipids (35). From these and other fea- The class Proteobacteria Stackebrandt et al. 1988 tures, ATCC 10829 was reidentified as an strain of (24) was proposed for the phylogenetic taxon that Pseudomonas paucimobilis Holmes et al. 1977"L (9), includes the "purple bacteria and their relatives" which is listed in the approved list of bacterial names described by Woese et al (32). (22). Because strain ATCC 10829 was not a original On the basis of the results of the 16S rDNA sequence Zimmermann strain but a later misidentified organism, comparison, Takeuchi et al. reported in 1994 (27) that the the name F devorans could not be a senior synonym of genus Sphingomonas belongs to the alpha-subclass of the P paucimobilis. A similar component, SGL-1, was Proteobacteria and is a part of Group 4. Strains of fac- found in the cellular lipids of yellow-pigmented iso- ultatively photosynthetic species of four genera Por- lates originally identified as strains of Pseudomonas sp. phyrobacter, Erythrobacter, Sandaracinobacter and Eryth- including P paucimobilis, Flavobacterium sp. and Sphin- romicrobium, together with facultatively anaerobic gobacterium sp. In addition to this, the results of a Zyymomonasare also reported as belonging to Group 4 of phylogenetic analysis of partial nucleotide sequences the alpha-subclass of Proteobacteria. of the 16S rDNA led to the proposal of a new genus, In 1976, De Ley and Swing proposed an improved Sphingomonas Yabuuchi et al. 1990" with the type taxonomy and nomenclature of the genus Zymomonas species Sphingomonas paucimobilis (Holmes et al. 1977) Kluyver and van Niel 1936" (4). From the phenotypic Yabuuchi et al. 1990" (34). In this new genus, three new and genetic data, they unified "Z. anaerobica" subsp. species, S. adhaesiva, S. parapaucimobilis and S. "anaerobica" and "Z. anaerobica" subsp. "immobilis," yanoikuyae, and a new combination, S. capsulata (Leif- and raised Zymomonas mobilis (Lindner) De Ley and son 1962") Yabuuchi et al. 1990" were named and Swing 1976" to a species. The proposal of Z. mobilis described. Two other strains containing SGL-1 in their subsp. pomaceae" by De Ley and Swing automatically cellular lipids were differentiated from the above-men- created Z. mobilis subsp. mobilis. tioned species; the authors were reluctant to name them The genus Erythrobacter is made up of two species. because each of them was a single strain. Erythrobacter longus Shiba and Simidu 1982" (21) and Since then, 14 new species and three new combina- Erythrobacter litoralis Yurkov et al. 1994" (36) were tions of Sphingomonas have been validly named and proposed for an aerobic organism containing bacteri- described. The 14 new species are: S. macrogoltabidus ochlorophyll a. Takeuchi et al. 1993"; S. sanguis Takeuchi et al. 1993' Erythromicrobium ramosum Yurkov et al. 1994" was and S. terrae Takeuchi et al. 1993' (25); 3-ketolactose- proposed for a strain isolated from a marine cyanobac- producing S. rosa Takeuchi et al. 1995"; S. pruni terial mat (36). A new genus, Porphyrobacter Fuerst et Takeuchi et al. 1995v'; S. asaccharolytica Takeuchi et al. al. 1993", with a single type species, P. neustonensis 1995" and S. mali Takeuchi et al. 1995" (26); S. Fuerst et al. 1993", was proposed for aerobic bacteri- chlorophenolica Nohynek et al. 1995".(17); S. herbici- ochlorophyll-synthesizing bacteria (7). Another species, dovorans Zipper et al. 1996" (38); S. subarctica P. tepidarius, was proposed by Hanada et al. 1997 (8). Nohynek et al. 1996" (18); S. trueperi Kaempfer et al. The former was isolated from fresh water and budding 1997' (10); an aromatic-degrading species, S. aromati- multiplication was observed by electron microscopy. civorans Balkwill et al. 1997"'; S. subterranea Balk- The latter was a moderately thermophilic aerobe iso- will et al. 1997"'; and S. stygia Balkwill et al. 1997" (1). lated from a hot spring. Three species, Blastobacter natatoria Sly 1985' (23), The type strain of Sandaracinobacter sibiricus Yurkov "Rhizomonas" suberifaciens van Bruggen et al. 1990" et al. 1997".(37) was isolated from a freshwater algo- (30) and Erythromonas ursincola Yurkov et al. 1997' bacterial mat near hydrothermal sulfide-containing vents (37) were transferred to the genus Sphingomonas, and S. along a river bottom. natatoria, S. suberifaciens and S. ursincola were pro- In this study, with the two exceptions of unavailable posed (33). Publication of these three new combinations type strains of Sandaracinobacter sibiricus and the was listed in Validation List No. 70. After a phylogenetic unsuccessfully revived lyophile of S. herbicidovorans , we analysis, Pseudomonas echinoides Heumann 1962" was confirmed the distribution of sphingoglycolipid (SGL-1), transferred to the genus Sphingomonas as Sphingomonas morphological, physiological and biochemical charac- echinoides (Heumann 1962) Denner et al. 1999' (5). At teristics. The phylogeny of the 16S rDNA sequence present, 23 species are validly published as members of among the species in the alpha-4 group, including San- SPHINGOMONADACEAE KOSAKO AND YABUUCHI FAM. NOV. 565 daracinobacter sibiricus, was analyzed in order to elu- Phenotypic characterization and antimicrobial sus- cidate the possibility of proposing a new family to Group ceptibility tests. Morphologies of the cells of each strain 4 of the alpha-subclass of Proteobacteria. were observed by optical microscopy of Gram-stained preparations. Motility was observed by microscopy Materials and Methods
Load more

Recommended publications
  • Characterization of the Aerobic Anoxygenic Phototrophic Bacterium Sphingomonas Sp
    microorganisms Article Characterization of the Aerobic Anoxygenic Phototrophic Bacterium Sphingomonas sp. AAP5 Karel Kopejtka 1 , Yonghui Zeng 1,2, David Kaftan 1,3 , Vadim Selyanin 1, Zdenko Gardian 3,4 , Jürgen Tomasch 5,† , Ruben Sommaruga 6 and Michal Koblížek 1,* 1 Centre Algatech, Institute of Microbiology, Czech Academy of Sciences, 379 81 Tˇreboˇn,Czech Republic; [email protected] (K.K.); [email protected] (Y.Z.); [email protected] (D.K.); [email protected] (V.S.) 2 Department of Plant and Environmental Sciences, University of Copenhagen, Thorvaldsensvej 40, 1871 Frederiksberg C, Denmark 3 Faculty of Science, University of South Bohemia, 370 05 Ceskˇ é Budˇejovice,Czech Republic; [email protected] 4 Institute of Parasitology, Biology Centre, Czech Academy of Sciences, 370 05 Ceskˇ é Budˇejovice,Czech Republic 5 Research Group Microbial Communication, Technical University of Braunschweig, 38106 Braunschweig, Germany; [email protected] 6 Laboratory of Aquatic Photobiology and Plankton Ecology, Department of Ecology, University of Innsbruck, 6020 Innsbruck, Austria; [email protected] * Correspondence: [email protected] † Present Address: Department of Molecular Bacteriology, Helmholtz-Centre for Infection Research, 38106 Braunschweig, Germany. Abstract: An aerobic, yellow-pigmented, bacteriochlorophyll a-producing strain, designated AAP5 Citation: Kopejtka, K.; Zeng, Y.; (=DSM 111157=CCUG 74776), was isolated from the alpine lake Gossenköllesee located in the Ty- Kaftan, D.; Selyanin, V.; Gardian, Z.; rolean Alps, Austria. Here, we report its description and polyphasic characterization. Phylogenetic Tomasch, J.; Sommaruga, R.; Koblížek, analysis of the 16S rRNA gene showed that strain AAP5 belongs to the bacterial genus Sphingomonas M. Characterization of the Aerobic and has the highest pairwise 16S rRNA gene sequence similarity with Sphingomonas glacialis (98.3%), Anoxygenic Phototrophic Bacterium Sphingomonas psychrolutea (96.8%), and Sphingomonas melonis (96.5%).
    [Show full text]
  • Supplementary Information for Microbial Electrochemical Systems Outperform Fixed-Bed Biofilters for Cleaning-Up Urban Wastewater
    Electronic Supplementary Material (ESI) for Environmental Science: Water Research & Technology. This journal is © The Royal Society of Chemistry 2016 Supplementary information for Microbial Electrochemical Systems outperform fixed-bed biofilters for cleaning-up urban wastewater AUTHORS: Arantxa Aguirre-Sierraa, Tristano Bacchetti De Gregorisb, Antonio Berná, Juan José Salasc, Carlos Aragónc, Abraham Esteve-Núñezab* Fig.1S Total nitrogen (A), ammonia (B) and nitrate (C) influent and effluent average values of the coke and the gravel biofilters. Error bars represent 95% confidence interval. Fig. 2S Influent and effluent COD (A) and BOD5 (B) average values of the hybrid biofilter and the hybrid polarized biofilter. Error bars represent 95% confidence interval. Fig. 3S Redox potential measured in the coke and the gravel biofilters Fig. 4S Rarefaction curves calculated for each sample based on the OTU computations. Fig. 5S Correspondence analysis biplot of classes’ distribution from pyrosequencing analysis. Fig. 6S. Relative abundance of classes of the category ‘other’ at class level. Table 1S Influent pre-treated wastewater and effluents characteristics. Averages ± SD HRT (d) 4.0 3.4 1.7 0.8 0.5 Influent COD (mg L-1) 246 ± 114 330 ± 107 457 ± 92 318 ± 143 393 ± 101 -1 BOD5 (mg L ) 136 ± 86 235 ± 36 268 ± 81 176 ± 127 213 ± 112 TN (mg L-1) 45.0 ± 17.4 60.6 ± 7.5 57.7 ± 3.9 43.7 ± 16.5 54.8 ± 10.1 -1 NH4-N (mg L ) 32.7 ± 18.7 51.6 ± 6.5 49.0 ± 2.3 36.6 ± 15.9 47.0 ± 8.8 -1 NO3-N (mg L ) 2.3 ± 3.6 1.0 ± 1.6 0.8 ± 0.6 1.5 ± 2.0 0.9 ± 0.6 TP (mg
    [Show full text]
  • Characterization of Bacterial Communities Associated
    www.nature.com/scientificreports OPEN Characterization of bacterial communities associated with blood‑fed and starved tropical bed bugs, Cimex hemipterus (F.) (Hemiptera): a high throughput metabarcoding analysis Li Lim & Abdul Hafz Ab Majid* With the development of new metagenomic techniques, the microbial community structure of common bed bugs, Cimex lectularius, is well‑studied, while information regarding the constituents of the bacterial communities associated with tropical bed bugs, Cimex hemipterus, is lacking. In this study, the bacteria communities in the blood‑fed and starved tropical bed bugs were analysed and characterized by amplifying the v3‑v4 hypervariable region of the 16S rRNA gene region, followed by MiSeq Illumina sequencing. Across all samples, Proteobacteria made up more than 99% of the microbial community. An alpha‑proteobacterium Wolbachia and gamma‑proteobacterium, including Dickeya chrysanthemi and Pseudomonas, were the dominant OTUs at the genus level. Although the dominant OTUs of bacterial communities of blood‑fed and starved bed bugs were the same, bacterial genera present in lower numbers were varied. The bacteria load in starved bed bugs was also higher than blood‑fed bed bugs. Cimex hemipterus Fabricus (Hemiptera), also known as tropical bed bugs, is an obligate blood-feeding insect throughout their entire developmental cycle, has made a recent resurgence probably due to increased worldwide travel, climate change, and resistance to insecticides1–3. Distribution of tropical bed bugs is inclined to tropical regions, and infestation usually occurs in human dwellings such as dormitories and hotels 1,2. Bed bugs are a nuisance pest to humans as people that are bitten by this insect may experience allergic reactions, iron defciency, and secondary bacterial infection from bite sores4,5.
    [Show full text]
  • Evolutionary Genomics of an Ancient Prophage of the Order Sphingomonadales
    GBE Evolutionary Genomics of an Ancient Prophage of the Order Sphingomonadales Vandana Viswanathan1,2, Anushree Narjala1, Aravind Ravichandran1, Suvratha Jayaprasad1,and Shivakumara Siddaramappa1,* 1Institute of Bioinformatics and Applied Biotechnology, Biotech Park, Electronic City, Bengaluru, Karnataka, India 2Manipal University, Manipal, Karnataka, India *Corresponding author: E-mail: [email protected]. Accepted: February 10, 2017 Data deposition: Genome sequences were downloaded from GenBank, and their accession numbers are provided in table 1. Abstract The order Sphingomonadales, containing the families Erythrobacteraceae and Sphingomonadaceae, is a relatively less well-studied phylogenetic branch within the class Alphaproteobacteria. Prophage elements are present in most bacterial genomes and are important determinants of adaptive evolution. An “intact” prophage was predicted within the genome of Sphingomonas hengshuiensis strain WHSC-8 and was designated Prophage IWHSC-8. Loci homologous to the region containing the first 22 open reading frames (ORFs) of Prophage IWHSC-8 were discovered among the genomes of numerous Sphingomonadales.In17genomes, the homologous loci were co-located with an ORF encoding a putative superoxide dismutase. Several other lines of molecular evidence implied that these homologous loci represent an ancient temperate bacteriophage integration, and this horizontal transfer event pre-dated niche-based speciation within the order Sphingomonadales. The “stabilization” of prophages in the genomes of their hosts is an indicator of “fitness” conferred by these elements and natural selection. Among the various ORFs predicted within the conserved prophages, an ORF encoding a putative proline-rich outer membrane protein A was consistently present among the genomes of many Sphingomonadales. Furthermore, the conserved prophages in six Sphingomonas sp. contained an ORF encoding a putative spermidine synthase.
    [Show full text]
  • Sequencing and Functional Analysis of a Multi-Component Dioxygenase from PAH-Degrading Sphingomonas Paucimobilis EPA505" (2010)
    Clemson University TigerPrints All Dissertations Dissertations 12-2010 Sequencing and functional analysis of a multi- component dioxygenase from PAH-degrading Sphingomonas paucimobilis EPA505 Renuka Miller Clemson University, [email protected] Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations Part of the Microbiology Commons Recommended Citation Miller, Renuka, "Sequencing and functional analysis of a multi-component dioxygenase from PAH-degrading Sphingomonas paucimobilis EPA505" (2010). All Dissertations. 678. https://tigerprints.clemson.edu/all_dissertations/678 This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations by an authorized administrator of TigerPrints. For more information, please contact [email protected]. SEQUENCING AND FUNCTIONAL ANALYSIS OF A MULTI-COMPONENT DIOXYGENASE FROM PAH-DEGRADING SPHINGOMONAS PAUCIMOBILIS EPA505 A Dissertation Presented to the Graduate School of Clemson University In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Microbiology by Renuka Persad Miller December 2010 Accepted by: Thomas A. Hughes, Committee Chair Steven Hayasaka Jeremy Tzeng Annel Greene i ABSTRACT Polycyclic aromatic hydrocarbons (PAHs) are hydrophobic organic compounds consisting of two or more fused benzene rings. PAHs derive from many different sources including petroleum refining, wood treatment, and coal coking industries. Because of their structural stability and water insolubility, PAHs are extremely resistant to degradation. These compounds are also believed to have mutagenic, carcinogenic, and teratogenic effects. Therefore, there are currently 16 PAH compounds on the EPA’s list of priority pollutants. Many species of bacteria have the ability to breakdown these persistent pollutants. However, bioremediation strategies using these organisms have many unresolved issues.
    [Show full text]
  • Characterization of the Microbiome of Nipple Aspirate Fluid of Breast Cancer Survivors Received: 23 March 2016 Alfred A
    www.nature.com/scientificreports OPEN Characterization of the microbiome of nipple aspirate fluid of breast cancer survivors Received: 23 March 2016 Alfred A. Chan1,*, Mina Bashir2,3,*, Magali N. Rivas1,*, Karen Duvall4,5, Peter A. Sieling1, Accepted: 31 May 2016 Thomas R. Pieber3, Parag A. Vaishampayan2, Susan M. Love5 & Delphine J. Lee1 Published: 21 June 2016 The microbiome impacts human health and disease. Until recently, human breast tissue and milk were presumed to be sterile. Here, we investigated the presence of microbes in the nipple aspirate fluid (NAF) and their potential association with breast cancer. We compared the NAF microbiome between women with a history of breast cancer (BC) and healthy control women (HC) using 16S rRNA gene amplicon sequencing. The NAF microbiome from BC and HC showed significant differences in community composition. Two Operational Taxonomic Units (OTUs) showed differences in relative abundances between NAF collected from BC and HC. In NAF collected from BC, there was relatively higher incidence of the genus Alistipes. By contrast, an unclassified genus from theSphingomonadaceae family was relatively more abundant in NAF from HC. These findings reflect the ductal source DNA since there were no differences between areolar skin samples collected from BC and HC. Furthermore, the microbes associated with BC share an enzymatic activity, Beta-Glucuronidase, which may promote breast cancer. This is the first report of bacterial DNA in human breast ductal fluid and the differences between NAF from HC and BC. Further investigation of the ductal microbiome and its potential role in breast cancer are warranted. The human microbiome is the term applied to the universe of microbes that inhabit our skin and mucosal surfaces.
    [Show full text]
  • Sphingomonadaceae: Protective Against Breast Cancer? Ebidor Ufoumanefe Lawani‑Luwaji* and Tolulope Alade
    Lawani‑Luwaji and Alade Bull Natl Res Cent (2020) 44:191 https://doi.org/10.1186/s42269‑020‑00447‑0 Bulletin of the National Research Centre REVIEW Open Access Sphingomonadaceae: Protective against breast cancer? Ebidor Ufoumanefe Lawani‑Luwaji* and Tolulope Alade Abstract Background: Breast cancer is the most common malignancy and one of the leading causes of cancer‑linked deaths in women. The development of the mammary gland is regulated by oestrogen whose activities have also been linked with various diseases including breast cancer. Research has shown that host–microbiota relationship plays a role in human health and disease, so we investigated the association between breast microbiota and breast cancer. A search of the literature was conducted using search tools such as Google Scholar, PubMed, EBSCO and Cochrane library with the terms breast cancer, breast microbiota, microbiome and dysbiosis. A further search included Sphingomonas, Sphingobium yanoikuyae and oestrogen. The search terms were combined in original forms to get relevant stud‑ ies related to the subject under review. All articles written in English were included and publication dates were not limited. Conclusion: Taken together, the studies show that Sphingobium yanoikuyae might have a protective role in breast cancer, especially oestrogen positive, and highlights the need for further investigation into the use of the bacteria for prevention and possibly management of breast cancer. Keywords: Breast cancer, Microbiota, Dysbiosis, Sphingomonas Background to understand oestrogen receptor signalling (Korach Breast carcinoma embraces a group of diseases with def- et al. 2019). nite clinical, molecular and histopathologic properties. Tere are two main types of breast cancer: in situ It is the most common malignancy in females and is one and invasive carcinoma.
    [Show full text]
  • Sphingopyxis Sp. Strain OPL5, an Isoprene-Degrading Bacterium from the Sphingomonadaceae Family Isolated from Oil Palm Leaves
    microorganisms Article Sphingopyxis sp. Strain OPL5, an Isoprene-Degrading Bacterium from the Sphingomonadaceae Family Isolated from Oil Palm Leaves Nasmille L. Larke-Mejía 1 , Ornella Carrión 1 , Andrew T. Crombie 2, Terry J. McGenity 3 and J. Colin Murrell 1,* 1 School of Environmental Sciences, University of East Anglia, Norwich NR4 7TJ, UK; [email protected] (N.L.L.-M.); [email protected] (O.C.) 2 School of Biological Sciences, University of East Anglia, Norwich NR4 7TJ, UK; [email protected] 3 School of Life Sciences, University of Essex, Colchester CO4 3SQ, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-01603-592959 Received: 2 September 2020; Accepted: 7 October 2020; Published: 10 October 2020 Abstract: The volatile secondary metabolite, isoprene, is released by trees to the atmosphere in enormous quantities, where it has important effects on air quality and climate. Oil palm trees, one of the highest isoprene emitters, are increasingly dominating agroforestry over large areas of Asia, with associated uncertainties over their effects on climate. Microbes capable of using isoprene as a source of carbon for growth have been identified in soils and in the tree phyllosphere, and most are members of the Actinobacteria. Here, we used DNA stable isotope probing to identify the isoprene-degrading bacteria associated with oil palm leaves and inhabiting the surrounding soil. Among the most abundant isoprene degraders of the leaf-associated community were members of the Sphingomonadales, although no representatives of this order were previously known to degrade isoprene. Informed by these data, we obtained representatives of the most abundant isoprene degraders in enrichments, including Sphingopyxis strain OPL5 (Sphingomonadales), able to grow on isoprene as the sole source of carbon and energy.
    [Show full text]
  • Kinetics of Mercury Accumulation by Freshwater Biofilms
    Environ. Chem. 2018, 14, 458–467 © CSIRO 2017 doi:10.1071/EN17073_AC Supplementary material Kinetics of mercury accumulation by freshwater biofilms Perrine DranguetA,B Vera I. SlaveykovaA and Séverine Le FaucheurA,C AUniversity of Geneva, Faculty of Sciences, Earth and Environment Sciences, Department F.-A. Forel for Environmental and Aquatic Sciences, Environmental Biogeochemistry and Ecotoxicology, Uni Carl Vogt, 66 Bvd Carl-Vogt, CH 1211, Geneva, Switzerland. BPresent address: Département de sciences biologiques, Université de Montréal, Pavillon Marie- Victorin CP6128, Succ. Centre-Ville, Montréal, Québec H3C 3J7, Canada CCorresponding author. Email: [email protected] Table S1. Targets and sequences of the primers used to characterise the bacterial communities in biofilms using qPCR and amplicon sequencing Molecular tool Primers Target Sequence (5’-3’) References P338f GCATGGCYGYCGTCAG All bacteria [1] P518r CGACGCCATCTTCATTCACAT merAF ATTCCAGCTCCAATAGCG qPCR Hg resistance [2] merAR GACTACGATGGTATCTAATC hgcAR Hg TCCGTAGGTGAACCTGCGG [3] hgcAR methylation TCCTCCGCTTATTGATATGC Universal 1053F small subunit GCATGGCYGYCGTCAG [4] ribosomal 1319R rRNA gene CGACGCCATCTTCATTCACAT Amplicon sequencing D512F ATTCCAGCTCCAATAGCG Nuclear small ribosomal [5] subunit 18S D978R GACTACGATGGTATCTAATC Table S2. Taxonomic ranks of the major microorganisms living in both biofilms (B1 and B2), as well as the number of sequences and their abundance (%) calculated with OTUs assigned to (a) bacteria and (b) microalgae prior (T0) and after 24h (T24)
    [Show full text]
  • Sphingobium Cupriresistens Sp. Nov., a Copper- Resistant Bacterium Isolated from Copper Mine Soil, and Emended Description of the Genus Sphingobium
    %paper no. ije040865 charlesworth ref: ije040865& New Taxa - Proteobacteria International Journal of Systematic and Evolutionary Microbiology (2013), 63, 000–000 DOI 10.1099/ijs.0.040865-0 Sphingobium cupriresistens sp. nov., a copper- resistant bacterium isolated from copper mine soil, and emended description of the genus Sphingobium Liqiong Li,3 Hongliang Liu,3 Zunji Shi and Gejiao Wang Correspondence State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Gejiao Wang Huazhong Agricultural University, Wuhan, 430070, PR China [email protected] or [email protected] A Gram-negative, aerobic, copper-resistant bacterium, designated strain CU4T, was isolated from copper mine soil in Daye, China. Phylogenetic analysis based on 16S rRNA gene sequences showed highest similarity to Sphingobium rhizovicinum CC-FH12-1T (98.4 %), followed by Sphingobium francense Sp+T (97.2 %), Sphingobium japonicum UT26T (97.1 %), Sphingobium abikonense NBRC 16140T (97.0 %), Sphingobium xenophagum DSM 6383T (96.9 %) and Sphingobium yanoikuyae DSM 7462T (95.5 %). The major fatty acids (.5 %) were summed feature 7 (C18 : 1v7c,C18 : 1v9t and/or C18 : 1v12t), summed feature 4 (C16 : 1v7c and/or iso- C15 : 0 2-OH), C16 : 0 and C14 : 0 2-OH, and the predominant quinone was ubiquinone Q-10. Spermidine was the major polyamine component. The major polar lipids were diphosphatidyl- glycerol, phosphatidylethanolamine, phosphatidylglycerol, sphingoglycolipid, phosphatidyldi- methylethanolamine and phosphatidylcholine. The genomic DNA G+C content of strain CU4T was 64.9 mol%. Comparison of DNA–DNA hybridization, phenotypic and chemotaxonomic characteristics between strain CU4T and phylogenetically related strains revealed that the new isolate represents a novel species of the genus Sphingobium, for which the name Sphingobium cupriresistens sp.
    [Show full text]
  • Sphingomonas Zeae Sp. Nov., Isolated from the Stem of Zea Mays
    International Journal of Systematic and Evolutionary Microbiology (2015), 65, 2542–2548 DOI 10.1099/ijs.0.000298 Sphingomonas zeae sp. nov., isolated from the stem of Zea mays Peter Ka¨mpfer,1 Hans-Ju¨rgen Busse,2 John A. McInroy3 and Stefanie P. Glaeser1 Correspondence 1Institut fu¨r Angewandte Mikrobiologie, Universita¨t Giessen, Giessen, Germany Peter Ka¨mpfer 2Institut fu¨r Mikrobiologie, Veterina¨rmedizinische Universita¨t, A-1210 Wien, Austria peter.kaempfer@agrar. 3 uni-giessen.de Department of Entomology and Plant Pathology, Auburn University, Alabama, USA A yellow-pigmented bacterial isolate (strain JM-791T) obtained from the healthy internal stem tissue of 1-month-old corn (Zea mays, cultivar ‘Sweet Belle’) grown at the Plant Breeding Unit of the E.V. Smith Research Center in Tallassee (Elmore county), Alabama, USA, was taxonomically characterized. The study employing a polyphasic approach, including 16S RNA gene sequence analysis, physiological characterization, estimation of the ubiquinone and polar lipid patterns, and fatty acid composition, revealed that strain JM-791T shared 16S rRNA gene sequence similarities with type strains of Sphingomonas paucimobilis (98.3 %), Sphingomonas pseudosanguinis (97.5 %) and Sphingomonas yabuuchiae (97.4 %), but also showed pronounced differences, both genotypically and phenotypically. On the basis of these results, a novel species of the genus Sphingomonas is described, for which we propose the name Sphingomonas zeae sp. nov. with the type strain JM-791T (5LMG 28739T5CCM 8596T). The genus
    [Show full text]
  • Benzo[A]Pyrene Co-Metabolism in the Presence of Plant Root Extracts and Exudates: Implications for Phytoremediation
    Environmental Pollution 136 (2005) 477e484 www.elsevier.com/locate/envpol Benzo[a]pyrene co-metabolism in the presence of plant root extracts and exudates: Implications for phytoremediation Jeremy A. Rentza, Pedro J.J. Alvarezb, Jerald L. Schnoora,* aCivil and Environmental Engineering, University of Iowa, Iowa City, IA 52242, USA bCivil and Environmental Engineering, Rice University, Houston, TX 77251, USA Received 29 July 2004; accepted 28 December 2004 Bacterial benzo[a]pyrene cometabolism, a plant-microbe interaction affecting polycyclic aromatic hydrocarbon phytoremediation was demonstrated with Sphingomonas yanoikuyae JAR02 that utilized plant root extracts and exudates as primary substrates. Abstract Benzo[a]pyrene, a high molecular weight (HMW) polycyclic aromatic hydrocarbon (PAH) was removed from solution by Sphingomonas yanoikuyae JAR02 while growing on root products as a primary carbon and energy source. Plant root extracts of osage orange (Maclura pomifera), hybrid willow (Salix alba!matsudana), or kou (Cordia subcordata), or plant root exudates of white mulberry (Morus alba) supported 15e20% benzo[a]pyrene removal over 24 h that was similar to a succinate grown culture and an unfed acetonitrile control. No differences were observed between the different root products tested. Mineralization of 14C-7- 14 benzo[a]pyrene by S. yanoikuyae JAR02 yielded 0.2 to 0.3% CO2 when grown with plant root products. Collectively, these observations were consistent with field observations of enhanced phytoremediation of HMW PAH and corroborated the hypothesis that co-metabolism may be a plant/microbe interaction important to rhizoremediation. However, degradation and mineralization was much less for root product-exposed cultures than salicylate-induced cultures, and suggested the rhizosphere may not be an optimal environment for HMW PAH degradation by Sphingomonas yanoikuyae JAR02.
    [Show full text]