Molecular Mechanisms of Synergy Between IL-13 and IL-17A
in Severe Asthma
A dissertation submitted to the
Graduate School
of the University of Cincinnati
in partial fulfillment of the
requirements for the degree of
Doctor of Philosophy
in the Immunology Graduate Program
of the College of Medicine
by
Sara L. Hall
M.S. University of Cincinnati
2011
Committee Chair: Ian P. Lewkowich, Ph.D.
1. Abstract
Increased IL-17A production has been associated with more severe asthma; however, the mechanisms whereby IL-17A can contribute to IL-13-driven pathology in asthmatic patients remain unclear. In this thesis, we sought to elucidate the molecular mechanisms by which IL-
17A enhances IL-13-dependent airway pathology in patients with severe asthma using in vivo and in vitro systems. We have found that compared to mice given intratracheal (i.t.) IL-13 alone, those co-exposed to IL-13 + IL-17A demonstrate enhanced airway hyperresponsiveness (AHR), mucus production, airway inflammation, and IL-13-induced gene expression. In vitro, IL-17A directly enhanced IL-13-induced gene expression in asthma-relevant murine and human cells. In contrast to the exacerbating effect of IL-17A on IL-13-driven responses, co-treatment with IL-13 diminished IL-17A-driven gene expression in vivo and in vitro. Mechanistically, in vivo and in primary human and murine cells, the IL-17A mediated increase in IL-13-induced gene expression was associated with a rapid increase in IL-13-driven signal transducer and activator of transcription (STAT)6 phosphorylation.
Disrupting protein-tyrosine phosphatase function using Na3VO4 abrogated IL-17A- mediated enhancement of IL-13-driven STAT6 phosphorylation, suggesting that the ability of
IL-17A to augment IL-13 activity was driven by changes in protein-tyrosine phosphatase activity. Consistent with this, co-exposure to IL-13 + IL-17A triggered a rapid decrease in the phosphorylation of Src homology region 2 domain-containing phosphatase (SHP)-1 and SHP-2, negative regulators of IL-13 signal transduction. Pharmacologic inhibition of SHP-1 but not
SHP-2 similarly abrogated IL-17A-mediated enhancement of IL-13-driven STAT6 phosphorylation. However, the ability of IL-17A-driven alterations in protein-tyrosine
ii phosphatase activity to enhance cytokine signaling was specific for IL-13, as IL-17A had no effect on IL-6- and IFN-γ-dependent activation of STAT3 and STAT1, respectively.
Surprisingly, the enhancement of STAT6 phosphorylation was not sufficient to explain
IL-17A-mediated increases in IL-13-driven gene expression. Although IL-13 and IL-17A activate distinct cellular signaling pathways, we have identified specific transcription factors downstream of the IL-17A/Act1/TRAF6 signaling axis that influence transcriptional enhancement between IL-13 and IL-17A. Inhibition of NF-κB or C/EBPβ and C/EBPδ transcription factors partially attenuated IL-17A-mediated enhancement of IL-13-induced gene expression, while the inhibition of p38 mitogen-activated protein kinase (MAPK) completely abrogated the effect of IL-17A in cells co-exposed to IL-13 + IL-17A. However, the inhibition of p38 MAPK did not diminish IL-17A-mediated enhancement of STAT6 phosphorylation, implying that IL-17A signaling differentially regulates the accumulation of IL-13-induced
STAT6 activation and gene expression.
Collectively, our data suggest that IL-17A contributes to asthma pathophysiology by:
1) Negatively regulating protein-tyrosine phosphatase activity to increase the
capacity of IL-13 to activate the STAT6 signaling axis, and
2) Transcriptional cooperation between IL-13-driven STAT6 and IL-17A-induced
transcription factors.
These data represent the first mechanistic explanation of how IL-17A can directly contribute to the pathogenesis of IL-13-driven pathology in asthma. Further, our results identify multiple novel regulators of IL-13 activity, which may be targeted in future therapies.
iii
iv 2. Acknowledgements
Foremost, I would like to thank my mentor, Dr. Ian Lewkowich, for his patience, support, and guidance during this dissertation. It was an honor to be his first Ph.D. student. I would also like to acknowledge my committee members, Dr. Fred Finkelman, Dr. Senad Divanovic, Dr.
Matthew Weirauch, and Dr. Tim Le Cras, for their thoughtful feedback and encouragement over the last five years.
I would also like to thank my friends and family. Their contributions to my success, and sanity, cannot be overstated. Last, but never least, I must thank my loving and encouraging husband, James. This dissertation could not have been accomplished without his support, and I look forward to discovering the next chapter together!
v Table of Contents
1. Abstract ii
2. Acknowledgements v
3. List of Original Communications xi
4. Aim of the Study 1
4.1 Statement of the Problem 2
4.2 Background and Rationale 2
4.3 Objective 4
5. Review of the Literature 5
5.1 Public Health Implications of Asthma 6
5.1.1 Asthma Pathogenesis and Epidemiology 6
5.1.2 Asthma Treatment 7
5.1.3 Severe Asthma and Corticosteroid Resistance 8
5.2 The Immunopathology of Asthma 8
5.2.1 The Development of Allergic Asthma 8
5.2.2 Innate Immunity in Allergic Inflammation 11
5.2.3 Th2 Cells and Allergic Asthma 12
vi 5.2.4 Th17 Cells and Severe Asthma 14
5.3 The Th2/Th17 Cytokine Milieu 15
5.3.1 Distinct Roles for IL-13 and IL-4 in Allergic Inflammation 15
5.3.2 IL-13 Effector Functions in Asthma 17
5.3.3 IL-13 Signal Transduction and Regulation 19
5.3.4 Distinct Features of IL-17A 22
5.3.5 IL-17A Effector Functions in Asthma 24
5.3.6 IL-17A Signal Transduction and Regulation 26
6. Materials and Methods 30
6.1 Mice 31
6.2 In Vivo Cytokine Treatment Protocol and Analysis of AHR 31
6.3 Determination of Th2 Cytokine and IgE Concentration 32
6.4 Cell Culture 32
6.4.1 Culture Conditions and In Vitro Cytokine Treatment 32
6.4.2 Lung Fibroblast Isolation and Culture 33
6.4.3 CD11c Enrichment of Dendritic Cells 34
6.4.4 Human Subjects and Nasal Epithelial Cell Sampling 34
6.5 DNA Constructs, Promoter Cloning, and Mutagenesis 35
6.6 Luciferase Assay 35
6.7 mRNA Stability Assay 36
6.8 Inhibitor Assays 36
vii 6.8.1 Cycloheximide Assay 36
6.8.2 Protein-Tyrosine Phosphatase Inhibitor Assays 37
6.8.3 NF-κB, C/EBP, and MAPK Inhibitor Assays 37
6.9 Flow Cytometry 38
6.10 Immunoblotting and Immunoprecipitation 38
6.11 RNA Purification and Real-Time PCR 39
6.12 Statistical Analysis 39
7. IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced 41
STAT6 Phosphorylation
7.1 Introduction 42
7.2 Results 43
7.2.1 IL-17A Increases IL-13-Induced Lung Pathology In Vivo 43
7.2.2 Reciprocal Co-Regulation of IL-13- and IL-17A-Induced Genes 44
In Vivo
7.2.3 IL-13Rα2 is not Required for IL-17A-Mediated Enhancement of 45
IL-13 Pathology
7.2.4 Reciprocal Co-Regulation of IL-13- and IL-17A-Induced Genes 46
In Vitro
7.2.5 IL-17A-Mediated Enhancement of IL-13-Induced Gene Express- 46
ion Requires Functional IL-13 and IL-17A Signaling Complexes in the
Same Cell
7.2.6 IL-17A does not Enhance the Stability of IL-13-Induced Tran- 47
viii scripts
7.2.7 IL-17A Enhances IL-13-Driven STAT6 Phosphorylation 48
7.2.8 Reciprocal Co-Regulation by IL-13 and IL-17A in Human Cells 50
8. IL-17A-Mediated Inhibition of SHP-1 Enhances IL-13 Signal 69
Transduction
8.1 Introduction 70
8.2 Results 72
8.2.1 TRAF6 and TRAF3 are not Required for IL-17A-Mediated 72
Enhancement of IL-13-Induced STAT6 Phosphorylation
8.2.2 Treatment with IL-13 and IL-17A Augments Tyrosine Kinase 74
Activity Upstream of STAT6
8.2.3 Co-Stimulation with IL-13 and IL-17A Inhibits the Phosphor- 74
ylation of SHP-1 and SHP-2
8.2.4 SHP-1 is Required for IL-17A-Mediated Enhancement of STAT6 76
Phosphorylation
8.2.5 IL-17A does not Enhance STAT3 or STAT1 Phosphorylation 77
9. Identification of Transcriptional Regulators Controlling 85
IL-17A-Mediated Enhancement of IL-13 Activity
9.1 Introduction 86
9.2 Results 86
ix 9.2.1 TRAF6 does not Contribute to the Enhancement of pSTAT6, but 87
is Required for IL-13/IL-17A Transcriptional Synergy
9.2.2 5’-Upstream Elements Mediate Enhanced Arg1 and C3 88
Promoter Activity by IL-13 and IL-17A
9.2.3 Inhibition of C/EBP Transcription Factors Attenuates Transcrip- 89
tional Cooperation Between IL-13 and IL-17A
9.2.4 NF-κB also Contributes to Transcriptional Cooperation Between 91
IL-13 and IL-17A
9.2.5 Erk MAPK Upregulates Gene Expression but not IL-13/IL-17A 91
Synergy
9.2.6 p38 MAPK is Required for Transcriptional Synergy Between 93
IL-13 and IL-17A
10. Discussion 104
10.1 Major Findings of the Study 105
10.2 Directions for Future Research 113
10.3 Conclusion 116
11. Glossary 118
12. Bibliography 121
x 3. List of Original Communications
This thesis is based on the following original communications. Some related unpublished results are also included in this thesis.
Chapter 7 – Hall SL, Baker T, Lajoie S, Richgels PK, Yang Y, McAlees JW, Van Lier A,
Wills-Karp M, Sivaprasad U, Acciani TH, LeCras TD, Biagini Myers J, Butsch
Kovacic M, and Lewkowich IP: IL-17A Enhances IL-13 Activity by Enhancing
IL-13-Induced Signal Transducer and Activator of Transcription 6 Activation, J
Allergy Clin Immunol, 2017 Feb; 139(2):462-471.e14.
Chapter 8 – Hall SL, McAlees JW, Richgels PK, Starczynowski DT, and Lewkowich IP: IL-
17A-Mediated Inhibition of SHP-1 Enhances IL-13 Signal Transduction, Under
review.
Chapter 9 – Hall SL and Lewkowich IP: Identification of Transcriptional Regulators
Controlling IL-17A-Mediated Enhancement of IL-13 Activity, Unpublished.
xi Chapter 4
Aim of the Study
1 4. Aim of the Study
4.1 Statement of the Problem
There has been a dramatic increase in the frequency and severity of asthma in recent decades.1-3 Allergic asthma results from the development of an inappropriate immune response to inhaled innocuous antigens such as house dust mite (HDM).4 Clinical features of mild/moderate allergic asthma include elevated serum IgE levels, eosinophilic airway inflammation, mucus hypersecretion, and airway hyperresponsiveness (AHR).4-7 Collectively, these features contribute to the classic symptoms of asthma, including coughing, wheezing, shortness of breath, and chest tightness.
In contrast, in severe asthma disease symptoms are exaggerated and often unresponsive to conventional therapies, resulting in more frequent and more severe exacerbations, as well as increased risk of death.8-12 These differences are suggestive of a more complex underlying pathological condition; however, we still do not have a good basic understanding of what drives disease to transition from mild to severe. If we can address this knowledge gap, we can better design therapies to target severe asthmatics, a population that is presently underserved by current therapies.
4.2 Background and Rationale
CD4+ Th2 cells play a central role in the pathogenesis of allergic asthma, primarily through the production of cytokines, including IL-4, IL-5, and IL-13.13-24 Of these cytokines, several lines of evidence support a central role for IL-13 in the pathology of allergic asthma in
2 mice and humans.18-21, 25, 26 IL-13 primarily signals via a STAT6-dependent pathway.27-29 Upon ligand binding, STAT6 is activated via phosphorylation of conserved tyrosine residue 641
(pSTAT6, Tyr641), and the activated transcription factor translocates to the nucleus where it regulates gene expression.
Previous studies have shown that both IL-13 and STAT6 are necessary for the induction of airway inflammation, mucus overproduction, and AHR in models of allergic airway disease, and delivery of IL-13 to the lung is sufficient to recapitulate many of these features in allergen naïve mice.18-21 Further underscoring the importance of IL-13 in allergic inflammation, IL-13 is overexpressed in the sputum and bronchial biopsies of asthmatics,25 and polymorphic variants in genes encoding both IL-13 and IL-13 receptor subunits are consistently associated with asthma and atopy in humans.26 Although the expression of IL-13 is also upregulated in severe asthma,30 distinct differences in airway pathology, such as enhanced AHR, corticosteroid resistance, and neutrophilic rather than eosinophilic inflammation, suggest that severe asthma arises from a different process than mild disease.
The increased presence of neutrophils as well as the understanding that Thl7 cytokines drive neutrophilia led to the belief that IL-17A may play a role in severe asthma pathogenesis.31-
33 In support of this tenet, recent studies have found that Thl7 cells and IL-17A levels correlate positively with a more severe asthma phenotype in humans and mice,34-39 and clinical studies have identified polymorphisms in the IL17A promoter associated with increased asthma risk.40, 41
Overall, these data suggest that although IL-13 and Th2 cytokines are responsible for much of the pathology associated with asthma, the co-production of IL-17A may contribute to the transition from mild to severe disease. However, the mechanisms through which IL-17A triggers more severe asthma pathology are unclear.
3 4.3 Objective
Several lines of study have unequivocally demonstrated the biological importance of the
IL-13/STAT6 pathway in asthma pathophysiology. Accumulating evidence suggests that aberrant production of IL-17A is a key determinant of more severe inflammation and airway dysfunction in asthma; however, the molecular changes underlying severe asthma pathogenesis are incompletely understood. Although the cellular pathways activated by IL-13 and IL-17A differ, an important unanswered question is how interactions between IL-13 and IL-17A influence asthma pathogenesis.
Thus, in this body of work we sought to clarify the cellular and molecular mechanisms by which IL-17A influences IL-13-driven airway pathology in patients with severe asthma, using:
1) In vivo models of IL-13-induced lung pathology, and
2) In vitro cultures of relevant cell types.
Our proposed research has subsequently elucidated specific signaling components, regulatory mechanisms, and target cell populations critical to the exacerbation of asthma. This outcome is significant because it clarifies the role of the Th17 pathway in asthma pathogenesis and may aid in the innovation of novel strategies for the treatment of severe disease.
4 Chapter 5
Review of the Literature
5 5. Review of the Literature
5.1 Public Health Implications of Asthma
5.1.1 Asthma Pathogenesis and Epidemiology
Asthma is a common, chronic inflammatory disease of the airways. Individuals with asthma may experience breathing difficulties, including recurrent episodes of coughing, wheezing, shortness of breath, and chest tightness. Within the lungs, these symptoms are reflective of a complex interaction between reversible airway obstruction, AHR, and underlying airway inflammation.4-6 Over time, many asthmatic patients also experience varying degrees of airway structural changes and remodeling, leading to a progressive decline in lung function.7
Asthma is most often diagnosed in early childhood, but adult-onset asthma is also common.42
Moreover, although atopy and allergy are major risk factors for the development of asthma, not all asthma patients are atopic.43 The diverse phenotypes and mechanisms underlying the initiation, persistence, and severity of asthma continue to present unique challenges to classifying and treating the disorder.
Asthma prevalence is increasing in the United States and worldwide, which may be due, in part, to advances in diagnosis and phenotyping,44-49 but also to the adoption of an increasingly urban, Western lifestyle.50 Epidemiological studies conducted by the Centers for Disease Control and Prevention report that the number of people with asthma in the United States increased by
28% between 2001 and 2011.1, 2 Currently, an estimated 39.5 million people in the United States have been diagnosed with asthma, including 7.1 million children.2 Moreover, the economic burden associated with asthma, including both direct and indirect expenditures, ranks as one of
6 the highest among chronic illnesses, costing the United States $56 billion in 2007.51 Given the increasing disease prevalence, the life-long complications, and the increasing cost of healthcare, there is a great need for a better understanding of this disease process, as well as improved treatment options, for asthmatics.
5.1.2 Asthma Treatment
The overarching goals of current asthma therapies are to reverse or prevent long-term symptoms, to maintain normal lung function, and to prevent exacerbations.52, 53 The methods used to treat asthma include “reliever” and “controller” medications. Reliever medications such as short- or long-acting β2-agonists (SABA, LABA) are taken as needed and act quickly to relieve bronchoconstriction and acute asthma symptoms.54, 55 However, SABA or LABA use does not reverse the underlying airway inflammation or AHR, and thus controller medications are usually taken daily on a long-term basis to keep persistent asthma under control.
Inhaled corticosteroids are currently the most effective anti-inflammatory controller medications available for the treatment of asthma, and in clinical studies corticosteroids have demonstrated efficacy in the long-term control of symptoms, improvement of lung function, and decrease in AHR.56, 57 Of note, regular treatment with corticosteroids significantly reduces the number of hospitalizations and fatalities due to asthma, an advantage that has yet to be extended to other asthma therapies.57 However, long-term corticosteroid use carries the risk of several adverse side effects, including immunosuppression, weight gain, osteoporosis, and cataract formation.52, 53, 58 Consequently, efforts should be taken to limit or discontinue the use of corticosteroids in the future, while optimizing alternative treatment strategies such as targeted biological therapeutics.
7 5.1.3 Severe Asthma and Corticosteroid Resistance
Although inhaled corticosteroids are highly effective at controlling symptoms in patients with milder forms of asthma, their efficacy in patients with severe disease is limited. Steroid- refractory asthmatics make up only 5-10% of asthma patients, but these individuals contribute to more than 50% of the healthcare costs associated with asthma.8 Patients with severe asthma are more likely to be hospitalized and demonstrate a higher rate of asthma-related mortality.9, 10
Moreover, although all asthma patients are susceptible to exacerbations, among patients with severe disease the risk of an exacerbation leading to death is markedly increased.11, 12
Compounding these statistics, the mechanisms that regulate severe asthma progression and exacerbation remain incompletely understood. Current European Respiratory Society (ERS) and American Thoracic Society (ATS) guidelines define severe asthma based on a combination of medication use and disease symptoms.59 Clinically, ERS/ATS define severe asthma as
“asthma that requires treatment with high dose inhaled corticosteroids plus a second controller or systemic corticosteroids to prevent it from becoming uncontrolled, or that remains uncontrolled despite this therapy.”59 More recently, the introduction of molecular phenotyping has revealed pathological heterogeneity within and between patients with mild and severe asthma.44-49 Thus, to move our collective understanding of severe asthma forward, we must better address the importance of the molecular pathways underlying severe disease pathology.
5.2 The Immunopathology of Asthma
5.2.1 The Development of Allergic Asthma
8 Asthma is recognized as a heterogeneous disorder with a number of distinct phenotypes; however, the most common form of asthma in adults (60%) and children (80%) is allergic asthma.43 In a genetically susceptible individual, allergic asthma results from the development of an inappropriate immune response to innocuous environmental antigens (“allergens”), such as pollen, mold, HDM, pet dander, or cockroach droppings. Hallmark features of allergic asthma, including elevated serum IgE, eosinophilic airway inflammation, mucus hypersecretion, and bronchial hyperreactivity, have conventionally been linked to the effector functions of allergen- specific CD4+ Th2 cells,4-6, 13-17 whereas in asthma patients and experimental models of severe asthma the presence of airway neutrophilia suggested a role for CD4+ Th17 cells.34-38, 60
However, recent large-scale genome-wide association studies (GWAS) have identified that asthma susceptibility is most strongly associated with genes encoding epithelial factors such as
IL-33 (IL33) and ST2 (IL1RL1) rather than factors associated with allergy (i.e., IgE production),61-63 suggesting that allergy itself may not be sufficient to initiate asthma pathology.
Airway epithelial cells provide the first line of defense in the respiratory tract against microorganisms, allergens, and pollutants.64 Many inhaled allergens directly activate the epithelium through interactions with pattern recognition receptors such as Toll-like receptor
(TLR)4 and TLR2.65-67 Proteolytic activity is also a characteristic common to many allergens and enhances sensitization by altering epithelial cell structure and disrupting the epithelial barrier.68-
70 There is evidence that allergen-driven disruption of airway epithelial cells is specific to asthma patients, as fungal allergens have been shown to selectively enhance epithelial permeability in samples taken from asthmatic, but not healthy, individuals.71 The asthmatic epithelium is also more susceptible to oxidant stress and apoptosis,72 which may explain the fragility of the epithelium observed in asthmatic bronchial biopsies.73 Overall, this enhanced sensitivity may
9 underlie the altered immune response to allergens in asthmatic patients; however, it is unknown whether these changes are causative or a consequence of ongoing inflammation in the airways.
The precise mechanisms dictating the decision between immune tolerance and allergic sensitization are incompletely understood. However, allergen-activated airway epithelial cells are an important source of cytokines that may bias the immune response toward sensitization, including IL-33, IL-25 (IL-17E), and TSLP, as well as reactive oxygen species (ROS).74-78
Proximal to the airway lumen populations of dendritic cells (DC), the primary antigen presenting cell in the lung, form dense networks in the airway epithelium, strategically positioning them for antigen capture and the influence of epithelial mediators.79 Lung DCs produce IL-10 but express low levels of IL-12 and MHC class II, an immature phenotype that promotes the differentiation of Th2 cells.80 In response to allergen exposure, airway epithelial cells also produce chemokines such as CCL2 and CCL20, further enhancing monocyte and DC recruitment to the lung.66, 81
Epithelial release of IL-33 and TSLP acts directly on DCs to upregulate OX40 ligand expression, which is vital to the development of Th2 cells.75, 76, 82 Th2 polarization is further enhanced by IL-
25, which upregulates the expression of Th2 master regulator GATA-3 (discussed further below).77, 78 Thus, under the influence of these signals, allergen-epithelium interactions direct the recruitment, maturation, and activation of DCs necessary to prime Th2 responses.
Epithelial-derived factors also exert pro-inflammatory effects on other cells of the innate immune system. For example, several studies have demonstrated that IL-33 is a potent activator of mast cells and basophils, promoting their survival, adhesion, and migration.83-85 IL-33 has also been shown to promote eosinophil survival in vitro, as well as the release of IL-4 and IL-13 from basophils.86-88 In addition, the more recently described type 2 innate lymphoid cells (ILC) have been shown to produce significant amounts of IL-5 and IL-13 in response to IL-33, TSLP, and
10 IL-25,89-92 suggesting that epithelial-derived factors may contribute to both the initiation and maintenance of Th2-polarized responses by activating ILCs.
Collectively, these reports highlight a central role for the airway epithelium in initiating and regulating the immune response to allergens that contribute to asthma pathogenesis.
Allergen-driven responses are subsequently reinforced through the actions of Th2 effector cytokines, initiating a feedback loop that further perpetuates airway dysfunction.
5.2.2 Innate Immunity in Allergic Inflammation
Antigen-specific IgE production, with subsequent IgE binding to high-affinity receptors
(FcεRI) on mast cells, is central to the initiation and propagation of allergic responses. Mast cell activation leads to the rapid release of preformed pro-inflammatory mediators, including histamine, tryptase, chymase, proteoglycans, and cysteinyl leukotrienes.93 Subsequently, a late- phase reaction driven by mast cell-derived cytokines and chemokines promotes edema and the influx of immune cells. Basophils share many features with mast cells, including expression of
FcεRI and the release of histamine following activation; however, a distinct feature of basophils is their rapid, non-IgE mediated expression of the Th2 cytokines, which provides an early source for Th2-skewing IL-4 and IL-13.86, 87 Moreover, recent data from murine models suggests a direct role for basophils in antigen presentation via the expression of MHC class II molecules.94
Eosinophils, in turn, play a prominent role in respiratory allergy and are the predominant population of cells infiltrating the bronchial mucosa of patients with asthma.95 Similar to mast cells and basophils, activated eosinophils release granule-stored pro-inflammatory proteins and cytokines that promote Th2 immunity. IL-5 generated at sites of allergic inflammation acts distally on the bone marrow to release eosinophils into circulation, while IL-4 and IL-13 play a
11 central role in promoting eosinophil trafficking to mucosal tissue by upregulating the expression of eotaxins (CCL11 and CCL26) and endothelial VCAM-1.96 While the accumulation of eosinophils in the airways has consistently been considered a hallmark of allergic asthma, tissue and peripheral blood eosinophilia are also markedly increased in certain phenotypes of non- allergic asthma. For example, non-atopic eosinophilic asthma is one of the most severe and difficult-to-treat asthma subtypes; however, it is still unknown how an eosinophilic response is triggered in these patients.97, 98
One potential explanation for non-atopic eosinophilic asthma may come from ILCs, which are tissue-resident immune cells that play a critical role in tissue homeostasis and barrier function.89-92 Unlike adaptive immune cells, ILCs lack rearranged antigen receptors but are able to rapidly respond to a wide range of environmental signals. As described previously, activated type 2 ILCs produce large amounts of IL-5 and IL-13 in response to epithelial-derived cytokines,89-92 suggesting that they may contribute to the Th2-like chronic inflammation observed in patients with non-allergic asthma. Similarly, type 3 (IL-22- and IL-17A-producing) ILCs have been implicated in causing AHR associated with obesity, which is a major risk factor for the development of non-atopic severe, steroid-resistant asthma.47, 99 Type 2 and type 3 ILC-like cells have also been described in humans;99, 100 however, as ILCs have only recently been discovered, many of their functions within the context of allergic and non-allergic inflammation are still being clarified.
5.2.3 Th2 Cells and Allergic Asthma
The CD4+ Th2 lineage, which produces IL-4, IL-5, IL-13, and IL-10, has critical functions in regulating the immune response against extracellular parasites, but has also been
12 implicated in the development of asthma and other allergic diseases. Th2 differentiation requires
IL-4-induced STAT6 activation, although STAT5A and STAT3 have also been reported to contribute to the Th2 phenotype.101-103 Once activated, STAT6 promotes expression of the Th2 master regulator GATA-3, which promotes Th2 differentiation by inducing the expression of
Th2 effector cytokines, selectively stimulating the growth of Th2 cells, and suppressing Th1 differentiation.104
Initial studies of the cellular infiltrate of asthmatics revealed an increase in CD4+ Th2 cells, eosinophils, and degranulated mast cells in their bronchoalveolar lavage (BAL) fluid and airway biopsies.13-17 The Th2 cytokines IL-4, IL-5, and IL-13 are also increased in the airways of asthmatics, and are responsible for initiating and perpetuating key pathophysiological features of the disorder.18-24 Experimental models of asthma have reinforced a central role for Th2 cells in the induction of AHR and airway inflammation, which can be abrogated by depleting CD4+ T cells prior to allergen challenge.17 Th2 cytokines induce changes in mice that resemble asthma in humans. IL-4 is critical for Th2 cell induction and expansion and promotes IgE production by B cells,22 while IL-5 promotes eosinophil differentiation and maturation.23, 24 IL-13, in turn, is both necessary and sufficient to recapitulate most of the features of allergic asthma, including AHR, goblet cell hyperplasia, mucus production, and fibrosis.18-21
However, the Th2 paradigm does not adequately explain the full spectrum of asthma.
Neutrophils are frequently observed in the lungs and sputum of asthmatics, particularly in patients with severe, corticosteroid resistant disease.33-38, 45, 60 Moreover, biological therapeutics targeting atopy in general and Th2 cytokines specifically have been ineffective at treating asthma as a whole, but are more efficacious if patients are first characterized using cellular or molecular
13 biomarkers.105-108 Collectively, these results suggest that immunologic factors in addition to Th2 cells and cytokines contribute to asthma pathogenesis.
5.2.4 Th17 Cells and Severe Asthma
Th17 cells are a distinct lineage of CD4+ effector T cells characterized by expression of the transcription factor RORγt and the production of pro-inflammatory cytokines, including IL-
17A, IL-17F, IL-21, and IL-22.109-111 The mechanisms dictating the differentiation of Th17 cells in humans have been difficult to elucidate.112 However, in mice STAT3-dependent signals from
TGF-β and IL-6 have been implicated in the differentiation of CD4+ Th17 cells, while IL-21 and
IL-23 promote Th17 cell survival and expansion.113, 114
Both animal and human studies have demonstrated an important role for Th17 cells and cytokines in the development of allergic airway inflammation, particularly in severe asthma.
Thl7 cells and IL-17A levels correlate with a more severe asthma phenotype in humans and mice, including enhanced AHR, glucocorticoid insensitivity, and neutrophilic airway inflammation.33-38, 45, 60 More recently, a unique subset of IL-4+/IL-17A+ CD4+ T cells (Th2/Th17 cells) have been described in the blood, BAL fluid, and lungs of asthmatics.115, 116 Asthmatic patients with a predominance of dual-positive Th2/Th17 cells (“Th2/Th17 predominant”) exhibit the greatest airway obstruction, hyperreactivity, and steroid use relative to “Th2 predominant” or
“Th2/Th17 low” subgroups.117 Collectively, these studies suggest a link between Th17 cytokines such as IL-17A and severe asthma; however, the mechanisms whereby IL-17A influences disease severity, especially in asthmatic patients with mixed Th2/Th17 phenotypes, remain unclear.
14 5.3 The Th2/Th17 Cytokine Milieu
5.3.1 Distinct Roles for IL-13 and IL-4 in Allergic Inflammation
The Th2 cytokine IL-13 is a central effector molecule in allergic asthma, and is sufficient to induce several hallmark pathological features of allergic airway disease, including airway inflammation, mucus hypersecretion, AHR, and airway remodeling (i.e., mucus cell metaplasia, smooth muscle hypertrophy and hyperplasia, subepithelial fibrosis).18-21 IL-13 mediates these effects by interacting with a complex receptor scheme involving IL-4Rα: both IL-4 and IL-13 are ligands of the type II IL-4 receptor (IL-4Rα, IL-13Rα1), while IL-4 exclusively binds to the type I IL-4 receptor (IL-4Rα, γc), and IL-13 can also bind to membrane or soluble isoforms of a unique receptor chain known as IL-13Rα2.28, 29
Engagement of either type I or type II IL-4 receptors activates the central transcription factor STAT6, and as a result IL-13 demonstrates considerable functional overlap with IL-4.27-29
Global STAT6 deficiency impairs Th2 differentiation, abrogates Th2 cytokine production, and partially attenuates pulmonary inflammation following allergen challenge.27, 118, 119 This protection is primarily due to the absence of IL-4 signaling, rather than IL-13, as IL-13Rα1 is not expressed on murine T cells or B cells (although it is present on human B cells).120-123
However, the adoptive transfer of wild-type (WT) Th2 cells into STAT6 deficient mice does not restore antigen-induced pulmonary eosinophilia, AHR, and mucus production to WT levels.124
Moreover, the reconstitution of STAT6 signaling in lung epithelial cells or smooth muscle cells is sufficient to confer IL-13-induced lung pathology in the absence of inflammation and fibrosis.125-128 Taken together, these studies suggest a distinct role for the IL-13/STAT6 axis in pulmonary structural cells.
15 In vivo studies using IL-4Rα antagonists,129, 130 as well as mice deficient in IL-13, IL-4, or receptor subunits,20-22, 131, 132 have helped to further characterize the unique and overlapping functions of IL-13 and IL-4 in allergic airway inflammation. These observations are further exemplified in models of parasitic infection where IL-13, but not IL-4, is necessary for Th2- driven expulsion of Nippostrongyloides brasiliensis.133 Many hypotheses have been proposed to explain the relative differences in the contribution of IL-13 and IL-4 to allergic inflammation, including differences in the relative expression of type I and type II receptors on different subpopulations of cells,120-123 differences in binding affinity and receptor assembly for IL-13 versus IL-4,134 and differences in the quantity/source of cytokine production in the lung.135-137
Although initially characterized as a decoy receptor,138-140 the exclusive ability of IL-13 to bind IL-13Rα2 may also contribute to some of its distinct functions in allergic inflammation.
IL-13Rα2 has been proposed to signal via various STAT6-independent pathways, including AP-
1 in a model of bleomycin-induced lung fibrosis,141 as well as Erk MAPK, AKT, and Wnt/β- catenin as part of a heteromeric complex with IL-13 and Chi3l1.142 Moreover, allergen-driven
AHR, eosinophilia, and mucus production are attenuated in mice deficient for the membrane isoform of IL-13Rα2,143 suggesting that 1) IL-13Rα2 might be required for maximal induction of allergic airway disease, and 2) that membrane and soluble isoforms may have unique roles.
Collectively, these reports highlight the complexities of IL-13 and IL-4 signaling. While
IL-4 influences many features of the adaptive branch of the allergic response via the type I receptor, IL-13 perpetuates the pathological features of asthma by activating the type II receptor in non-hematopoietic cell types. Ongoing investigations into the distinct roles of IL-4 and IL-13- driven responses in the lung may lead to improved treatments for asthma.
16 5.3.2 IL-13 Effector Functions in Asthma
One of the key hallmarks of asthma is the presence of AHR, which is defined by an exaggerated response of the airways to nonspecific or specific stimuli resulting in airway obstruction. In humans, this is typically evaluated by measuring changes in forced expiratory volume in 1 second (FEV1) in response to inhaled bronchoconstrictors. Studies in mice have implicated IL-13 signaling in airway epithelial cells,125-127 airway smooth muscle cells,128 and even alveolar macrophages144 in driving AHR; however, there are limitations to the interpretation of murine studies, as the most common pulmonary function tests used in humans are not routinely applied in mice.145
Although the etiology of AHR remains incompletely understood, several lines of evidence suggest that IL-13 is a key mediator of AHR in experimental models of asthma.18-21 It is likely that IL-13-driven AHR occurs independent of the recruitment of inflammatory cells into the airways, as studies using IL-13 blockade or mice deficient in various immune cells have shown that T cells, B cells, and eosinophils are not required for IL-13 to induce AHR.18, 20, 146, 147
Alternatively, IL-13 may induce AHR via direct effects on resident cells in the airway.
Consistent with this hypothesis, IL-13 transgenic mice that only express STAT6 in the airway epithelium develop IL-13-induced AHR in association with excessive mucus production.125 The capacity of IL-13 to regulate airway mucus production appears to result from direct effects on airway epithelial cells, as IL-13 has been shown to upregulate mucin gene expression and secretion in epithelial cell lines in vitro.148 Moreover, although STAT6 deficient IL-13 transgenic mice do not develop mucus hypersecretion, the selective restoration of STAT6 in the airway epithelium reconstitutes mucin gene expression, mucus metaplasia, and AHR.125 However, a subsequent study demonstrated that mice with a conditional deletion of IL-4Rα in airway
17 epithelial cells were not protected from AHR despite decreased mucus production,126 suggesting that AHR and mucus hypersecretion can be regulated independently.
As IL-13-driven STAT6 signaling in the airway epithelium is sufficient to trigger AHR in mice,125 but IL-4Rα expression on the airway epithelium is not required,126 this suggests that other cell types can contribute to the development of AHR. In support of this tenet, studies using mice that selectively express or delete IL-4Rα on smooth muscle cells have similarly demonstrated that the direct effects of IL-13 on airway smooth muscle cells are sufficient, but not necessary, to induce AHR.128 Although it is possible that airway smooth muscle contraction may indirectly result from the actions of epithelial-derived mediators, IL-13 has been shown to directly enhance the contractility of airway smooth muscle cells in vitro148-150 as well as decrease
134 their relaxation in response to β2-agonists. Consistent with these findings, IL-13 has been shown to augment calcium signaling in both human and mouse airway smooth muscle cells.147,
151 Finally, because increases in airway smooth muscle mass are one of the major structural changes reported in asthmatics,152, 153 it is possible that the effects of IL-13 on smooth muscle function are a result of airway remodeling. Although IL-13 does not directly regulate airway smooth muscle cell hyperplasia and hypertrophy, it may influence smooth muscle proliferation indirectly by enhancing expression of the cysteinyl leukotriene receptor CysLT1.154 In addition, it has been proposed that cysteinyl leukotrienes promote the migration of airway smooth muscle cells toward the epithelium,155 placing both smooth muscle cells and epithelial cells within close proximity of the effects of IL-13 in the airway.
In addition to mucus metaplasia and smooth muscle thickening, subepithelial fibrosis is a central feature of airway remodeling in asthma pathophysiology that contributes to diminished lung function.156 Although the mechanisms underlying its development have not been fully
18 elucidated, IL-13 has been shown to promote collagen production by three distinct, but potentially overlapping, mechanisms. First, because fibroblasts express IL-13 receptors, it is possible that IL-13 contributes to subepithelial fibrosis by directly stimulating fibroblast proliferation and collagen production.157, 158 Alternatively, this pro-fibrotic effect may be mediated by IL-13-stimulated production and/or activation of TGF-β.132, 141, 159 Of note, eosinophils are also an important source of TGF-β in asthma;160, 161 however, additional cellular pathways are likely involved in IL-13-induced fibrosis, as eosinophil deficient mice are only partially protected.162 Finally, IL-13 has also been shown to promote the alternative activation of macrophages by upregulating the synthesis of arginase I.163 Arginase I is an enzyme which catalyzes the hydrolysis of L-arginine to form urea and L-ornithine, leading to the production of
L-proline and polyamines which promote fibroblast proliferation, collagen production, and fibrosis.
Taken together, these studies highlight the diverse repertoire of IL-13 effector functions and suggest that IL-13 promotes the hallmark features of asthma via combinatorial effects on lung-resident cells. Further studies are needed to clarify the contribution of IL-13 signaling pathways in the individual cell types (i.e., airway epithelium, smooth muscle, fibroblasts) involved in asthma pathophysiology.
5.3.3 IL-13 Signal Transduction and Regulation
The type II IL-4 receptor has no intrinsic kinase activity, but rather has constitutively associated Janus tyrosine kinases (JAK), which are responsible for propagating downstream signal transduction. When IL-13 or IL-4 binds to the receptor, the IL-4Rα subunit activates
JAK1, whereas IL-13Rα1 activates TYK2.28, 29 Subsequently, the IL-4Rα subunit becomes
19 phosphorylated at three conserved tyrosine residues (Tyr575, Tyr603, Tyr631) in the cytoplasmic tail, forming a docking site for latent STAT6 monomers.164 The functional activity of STAT6 is consequently dependent on JAK-mediated phosphorylation of Tyr641, which promotes STAT6 homodimerization, nuclear translocation, and the transcription of IL-13- responsive genes.28, 165
The STAT6 molecule consists of an N-terminal coiled-coil domain which contains a nuclear localization signal, a DNA-binding domain, an SH2 domain important for STAT6 recruitment and dimerization, and a C-terminal transactivation domain that regulates
166 transcription. All STAT proteins bind to a palindromic core motif TTCN2-4GAA, with STAT6 preferentially binding a 3-4 nucleotide element between the dyad binding sites.167, 168 DNA microarrays have extensively catalogued STAT6 target genes in T cells and B cells isolated from
WT and STAT6 deficient mice, while chromatin immunoprecipitation experiments followed by high-throughput sequencing (ChIP-seq) have linked STAT6-driven transcription to epigenetic patterns under Th2-skewing conditions.169-171 However, IL-13-induced gene expression can vary widely depending on the cell type being studied.172 For example, in B cells STAT6 induces human Ig ε germline transcription and CD23 expression,173 whereas in macrophages STAT6 preferentially promotes the transcription of genes associated with alternative activation including
Arg1 and Retnla,174 and in lung-resident epithelial cells and fibroblasts STAT6 predominantly promotes the expression of mucins and chemokines or genes associated with collagen production, respectively.175-177 At this time, transcriptome analysis of STAT6-driven genes in non-immune cells are less common,178 but would be valuable given the established effector functions of IL-13 in the lung epithelium and smooth muscle.
20 The differential expression of IL-13-induced genes across cell types may be explained, in part, by cooperation between STAT6 and other transcription factors. Consistent with this hypothesis, STAT6-driven gene expression can be enhanced by coordinated interactions with
C/EBPβ,179-181 NF-κB/Rel,173, 182, 183 PU.1,184, 185 or AP-1.186 Alternatively, although STAT6 is the dominant signaling pathway activated in response to IL-13, IRS-2 and STAT3 have also been implicated in IL-13 signaling and may contribute to relative differences in gene expression across cell types.187-190 The transcriptional activity of STAT6 is also influenced by a C-terminal transactivation domain.165, 191 The precise mechanisms coupling this domain to transcriptional activation are still incompletely understood, but posttranslational modifications through serine phosphorylation have been shown to be involved in its regulation. Previously, p38 MAPK has been shown to promote the activation of the transactivation domain of STAT6, although the mechanism is unclear.192
Lastly, although STAT6 activation in response to IL-13 has been well documented, the molecular mechanisms underlying the termination of STAT6 signaling are largely unknown.
STAT6 responses can be negatively regulated by SOCS-1 and SOCS-3,193, 194 while intracellular phosphatases previously reported to diminish STAT6 phosphorylation include PP2A195 and
PTP1B.196 In addition, an immunoreceptor tyrosine-based inhibitory motif (ITIM) in IL-4Rα serves as a docking site for protein-tyrosine phosphatases that negatively regulate STAT6 activation, including SHP-1, SHP-2, and SHIP1.197, 198 Alterations in SHP-1 tyrosine phosphatase activity have been shown to exacerbate airway pathology in both spontaneous199-201 and allergen- driven models of airway inflammation.197, 198 The role of tyrosine phosphatases has subsequently been well characterized in immune cells in response to IL-4;202-204 however, less is understood about their function in non-hematopoietic cell types following stimulation with IL-13.
21 5.3.4 Distinct Features of IL-17A
In the 1990s, IL-17A was the founding members of a new family of cytokines.205, 206 The
IL-17 cytokine family consists of six members, including IL-17A, IL-17B, IL-17C, IL-17D, IL-
25 (also known as IL-17E), and IL-17F, which are secreted as covalently linked dimers and bind to members of the IL-17 receptor family.207, 208 The IL-17 receptor family, in turn, is comprised of IL-17RA, IL-17RB, IL-17RC, IL-17RD, and IL-17RE subunits, all of which are type I transmembrane proteins that have conserved structural motifs, including extracellular fibronectin
III-like domains and a membrane proximal SEF/IL-17R (SEFIR) domain.207, 208 Although the mechanisms by which IL-17 receptor subunits interact to form productive signaling complexes is unknown, IL-17RA functions as a common subunit for several members of the IL-17 cytokine family, as detailed below.
IL-17A is the best-characterized member of the IL-17 cytokine family and forms a covalent homodimer to signal. By inducing the production of pro-inflammatory cytokines, chemokines, acute phase proteins, and anti-microbial peptides, IL-17A propagates neutrophil recruitment, inflammation, and host defense mechanisms.207-209 Dysregulated production of IL-
17A, in turn, can lead to excessive inflammation and tissue damage, and is associated with many inflammatory diseases in addition to asthma, including rheumatoid arthritis, multiple sclerosis, and psoriasis.210 IL-17A mediates pro-inflammatory effects by interacting with a receptor complex comprised of IL-17RA and IL-17RC subunits.211 The Th17 cytokine IL-17F also signals through the IL-17RA-IL-17RC receptor complex and shares ~50% sequence homology with IL-17A.212 IL-17A and IL-17F can also form heterodimers of intermediate signaling strength.213, 214 Nonetheless, IL-17A and IL-17F have distinct biological effects, which may be explained, in part, by differences in receptor binding affinity. For example, in humans IL-17F
22 binds to IL-17RA with a much lower affinity than IL-17A, while the binding affinity for IL-
17RC is comparable between the cytokines.213, 215, 216 Alternatively, it is possible that IL-17 receptor complexes exist with varying ratios of IL-17RA and IL-17RC across different tissues, thus manifesting different ligand preferences. However, studies comparing IL-17A deficient and
IL-17F deficient mice have shown that IL-17F plays a minimal role in the development of allergic responses, autoimmune encephalomyelitis, collagen-induced arthritis, and arthritis,212, 217 confirming a central role for IL-17A in disease pathology.
As described previously, IL-25 (which binds a receptor complex comprised of IL-17RA and IL-17RB) is primarily produced by mucosal epithelial cells and promotes Th2-driven inflammation.77, 78 Other members of the IL-17 family, including IL-17B, IL-17C, and IL-17D, remain poorly characterized. IL-17B (IL-17RA-IL-17RB receptor complex) and IL-17C (IL-
17RA-IL-17RE receptor complex) induce gene expression profiles similar to those induced by
IL-17A and IL-17F,218, 219 potentially due to shared use of the IL-17RA subunit. IL-17D has also been reported to promote the expression of pro-inflammatory genes; however, the receptor for
IL-17D is unknown.220
IL-17 family members initiate signaling events that are distinct from other cytokines of the adaptive immune system. For example, although Th1 and Th2 cytokines primarily signal via
JAK/STAT-driven pathways, the Th17 cytokine IL-17A promotes Act1/TRAF6 signaling, culminating in the activation of pro-inflammatory factors that are more commonly associated with innate immune pathways (i.e., NF-κB, MAPK).221-224 Moreover, structural motifs within the
IL-17RA subunit are reminiscent of receptors associated with innate immunity, such as TLRs.221
Thus, via production of IL-17A, Th17 cells bridge innate and adaptive signal transduction.
23 5.3.5 IL-17A Effector Functions in Asthma
A role for Th17 cytokines in allergic asthma in humans was first described in 2001 by two complementary studies.225, 226 In these studies, IL-17A was found to be elevated in the plasma and airways of asthmatic patients compared to non-asthmatic healthy controls. Ensuing work has shown that elevated expression of IL-17A in the lungs, sputum, and BAL fluid of asthmatic patients correlates with enhanced asthma severity,34, 35 and murine models eliciting mixed Th2/Th17 responses are associated with more severe airway inflammation and dysfunction than purely Th2-driven models.36-39 Subsequently, IL-17A has been implicated in association with several key features of severe asthma, including neutrophilic airway inflammation, corticosteroid resistance, and airway remodeling.
The presence of neutrophilia in severe asthma was first described in studies designed to differentiate eosinophilic from noneosinophilic asthma using bronchial biopsies.44, 45 More recently, studies using larger cohorts have defined sputum neutrophilia as a hallmark feature of a cluster of patients diagnosed with moderate-to-severe asthma.46-49 The contribution of IL-17A to airway neutrophilia has been substantiated in mouse models. The potent pro-inflammatory properties of IL-17A stimulate the production of neutrophil-associated growth factors and chemokines (GM-CSF, G-CSF, IL-6, IL-8, GRO-α) in lung structural cells, thereby triggering neutrophil infiltration.31-33 Further, IL-17A has been shown to act synergistically with TNF-α,
IL-1β, and IL-6 to enhance the expression and activity of neutrophil elastase and myeloperoxidase.227 Mice deficient in IL-17A or IL-17RA exhibit diminished neutrophil recruitment into the lung, absence of AHR, and reduced airway remodeling in response to allergen challenge, suggesting a causative role for IL-17A in asthma severity.38, 228, 229 However, more recent clustering studies of patients with asthma have revealed that the neutrophilic
24 inflammatory phenotype is primarily associated with increased markers of systemic inflammation, such as NLRP3, IL-1β, and IL-6, but not IL-17A.230-232 Compounding this observation, a recent study revealed that the presence of dual-positive Th2/Th17 cells in the BAL fluid of asthma patients correlates with asthma severity and BAL eosinophilia, but not neutrophilic inflammation.117 Thus, although correlations between IL-17A, airway neutrophilia, and disease severity have been demonstrated, a cause and effect relationship between IL-17A and neutrophilic asthma in humans has not been definitively established.
Another hallmark feature of severe asthma is corticosteroid resistance, which contributes to poor asthma control. Although the etiology of steroid resistance remains incompletely understood, several lines of evidence suggest a causative role for Th17 cells and cytokines.
Reconstitution of mice with allergen-specific Th2 cells induces the development of a steroid- sensitive allergic phenotype, whereas the adoptive transfer of Th17 cells induces severe, corticosteroid refractory asthma.36 Moreover, in human cells IL-17A has been shown to increase the expression of the glucocorticoid receptor-β, which is an inhibitory receptor,233 thus identifying a mechanism by which IL-17A may directly promote corticosteroid resistance.
However, it is also possible that corticosteroid use itself promotes Th17-skewing effects.
Consistent with this hypothesis, exposing murine lymphocytes to dexamethasone has been shown to promote and sustain Th17 differentiation in vitro.229 Moreover, in both mouse and human cells, dexamethasone has been shown to inhibit Th2 cytokine production but enhance the expression of IL-17A.36, 234 Collectively, these data suggest that IL-17A-producing cells are critical determinants of corticosteroid resistance. In the future, approaches to characterize or manipulate these cells and their cytokine signals may be useful for developing new therapeutic avenues for difficult-to-treat asthma.
25 As the main response to IL-17A occurs in epithelial cells, endothelial cells, and fibroblasts, it is not surprising that recent reports support a functional role for IL-17A in airway remodeling. Similar to IL-13, IL-17A has been shown to promote mucus hypersecretion,235, 236 airway smooth muscle contraction,237 and the development of airway fibrosis,238 suggesting that convergence of IL-13 and IL-17A signaling in pulmonary structural cells may contribute to the pathogenesis of severe forms of allergic asthma.
However, in contrast to data demonstrating a pro-asthmatic role for IL-17A, there is also evidence that IL-17A can play a protective role. In asthma models it appears that, when protective, γδ T cells are the primary source of IL-17A. For example, the adoptive transfer of IL-
17A-producing γδ T cells into mice with ongoing allergic inflammation decreases AHR and airway eosinophilia, whereas IL-17A-deficient γδ T cells are unable to resolve allergic inflammation.239 Similarly, although widespread inhibition of IL-17A is associated with reduced
IL-13-driven pathology (supporting a pro-asthmatic role for IL-17A), the inhibition of IL-17A production by γδ T cells exacerbates IL-13-driven pathology.240 Moreover, although IL-17A and airway neutrophilia have been associated with increased asthma severity in adults, a recent study suggests that airway neutrophilia in children correlates with improved lung function.241 To date, the mechanisms by which IL-17A limits allergen- or IL-13-induced lung pathology remain incompletely understood.
5.3.6 IL-17A Signal Transduction and Regulation
IL-17A binds to both IL-17RA and IL-17RC subunits to mediate signaling.211 The IL-
17RA subunit is required for IL-17A signaling and is punctuated by distinct intracellular motifs that regulate IL-17A signal transduction.221, 222 The SEFIR domain engages the U-box E3
26 ubiquitin ligase Act1, which is an essential adaptor protein in IL-17A-mediated signaling.223, 224
Unlike IL-17RA, Act1 contains TRAF binding sites, and accordingly can bind TAK1 and
TRAF6, leading to activation of NF-κB.224 Act1 is also upstream of C/EBPβ and C/EBPδ transcription factors, as well as MAPK signaling, all of which contribute to the regulation of IL-
17A-driven gene expression. The promoters of many IL-17A-induced genes have NF-κB and
C/EBP binding sites, which are required for IL-17A-mediated promoter activity.242-244 Proximal to the SEFIR domain, a C-terminal TIR-like loop (TILL) motif forms a structure similar to a BB- loop and is also required for IL-17A signaling, although an interacting partner has yet to be identified.221 Of note, the TILL domain is unique to IL-17RA, which may explain why the IL-
17RA subunit is shared across multiple receptors in the IL-17 family.245, 246 Also in the C- terminus of IL-17RA, a distal C/EBPβ-activation domain (C-BAD) regulates the activation of
C/EBPβ via sequential post-translational phosphorylation events that inhibit IL-17A-dependent pro-inflammatory gene expression.247 Lastly, TRAF3 is recruited to the IL-17A receptor in a signal-dependent manner. The binding of TRAF3 to a TRAF3 binding site in IL-17RA interferes with the formation of IL-17RA/Act1/TRAF6 complexes, subsequently suppressing downstream signaling as part of a negative feedback loop.248
In direct contrast to its potent pathogenicity, IL-17A is a relatively weak activator of NF-
κB.207 Thus, a notable feature of IL-17A is its ability to cooperate with other pro-inflammatory mediators, such as TNF-α, IL-1β, IL-6, IL-22, IFN-γ.249-254 Several underlying mechanisms have been implicated in synergy between IL-17A and pro-inflammatory cytokines. For example, in synovial tissue IL-17A has been shown to enhance responsiveness to TNF-α signaling by increasing TNFRII expression.255 Alternatively, for some genes, synergy between IL-17A and
TNF-α occurs at the level of transcription and involves enhanced activation of, as well as
27 cooperation between, NF-κB and C/EBP transcription factors.243 Synergy between cytokines at the transcriptional level may occur as a result of several mechanisms, such as C/EBP family members and associated chromatin remodeling proteins establishing an active chromatin site, thus rendering enhancer/promoter elements accessible to additional transcription factors.256 The molecular basis for IL-17A-induced transcriptional synergy may also be explained by physical associations between NF-κB and C/EBP factors, leading to the enhancement or stabilization of transcription factor binding to promoter elements.256 The expression of many pro-inflammatory genes is also enhanced post-transcriptionally through the process of mRNA stabilization. In particular, CXCL1, CXCL2, and CXCL5 are induced weakly by TNF-α and are subject to rapid degradation, yet in the presence of both IL-17A and TNF-α their stability is significantly increased.257-260 Mechanistically, mRNA stabilization is mediated by Act1 and MAPK signaling, but does not require TRAF6.257 MAPK stabilizes mRNA through the inhibition of destabilizing proteins such as tristetraprolin (TTP). However, in addition to TTP, TRAF2 and TRAF5 have also been implicated in IL-17A-dependent mRNA stabilization through inhibition of the splicing factor complex SF2.261, 262 Overall, the capacity of IL-17A to signal cooperatively with other cytokines is a significant component of its biology, as inflammatory environments contain multiple cytokines that can act in concert.
Aberrant IL-17A production is a key determinant of several autoimmune and inflammatory diseases. Thus, it is not surprising that there are multiple layers of regulation in place to control IL-17A signal transduction. TRAF4, for example, uses the same TRAF binding site as TRAF6, thus competing with TRAF6 to bind Act1.263 As described previously, TRAF3 has also been shown to be a negative regulator of IL-17A signaling.248 TRAF molecules themselves may also be targets for inhibitory enzymes. The deubiquitinase USP25 limits IL-
28 17A-dependent signal transduction by removing K63-linked ubiquitin chains on both TRAF6 and TRAF5, thus inhibiting the transcription of IL-17A target genes as well as mRNA stability.264 Another enzyme, A20, was recently found to interact with the C-BAD domain of IL-
17RA, triggering deubiquitination of TRAF6 and limiting IL-17A-dependent activation of NF-
κB and MAPK.265 The IL-17RD receptor subunit, which has no known ligand, has also been implicated as a negative regulator of IL-17A-induced NF-κB activity, yet unexpectedly plays a positive role in MAPK signaling, 266, 267 suggesting that IL-17RD may simultaneously decrease de novo transcription but enhance mRNA stability. Collectively, these studies emphasize the complexity of IL-17A signaling, and highlight multiple potential therapeutic avenues for targeting the IL-17A response.
29 Chapter 6
Materials and Methods
30 6. Materials and Methods
6.1 Mice
Male and female A/J, BALB/c, C57BL/6, Cd11cCre/Cre (C57BL/6), and Vav1Cre/Cre
(C57BL/6) mice were obtained from Jackson Laboratories. Vav1Cre/Cre mice were bred with
Traf6Flox/Flox mice (129/SvJ and C57BL/6 mixed genetic background) (a gift of Dr. Yongwon
Choi, University of Pennsylvania)268 to generate Vav1-Cre+Traf6+/+ and Vav1-Cre+Traf6Flox/Flox mice. Cd11cCre/Cre mice were bred with Traf3Flox/Flox mice (129/SvJ and C57BL/6 mixed genetic background) (a gift from Dr. Gail Bishop, University of Iowa)269 to generate Cd11c-Cre-
Traf3Flox/Flox and Cd11c-Cre+Traf3Flox/Flox mice. Male and female IL-13Rα2-/- (BALB/c) (a gift of
Dr. Gurjit Khurana-Hershey), STAT6-/- (BALB/c) (a gift of Dr. Fred Finkelman), IL4Rα-F709
(BALB/c) (a gift of Dr. Simon Hogan), and IL-17RA-/- (C57BL/6) (Amgen) mice were obtained from Cincinnati Children’s Hospital Medical Center. All mice were housed in a specific pathogen-free facility. Procedures were approved by Cincinnati Children’s Hospital Medical
Center Institutional Animal Care and Use Committee.
6.2 In Vivo Cytokine Treatment Protocol and Analysis of AHR
A/J, BALB/c, and IL-13Rα2-/- (BALB/c) mice were treated i.t. with PBS, 2 µg or 5 µg of rIL-13, 2 µg or 5 µg of rIL-17A, or a combination of both cytokines (BioLegend, eBioscience) on days 0, 3, and 6, and sacrificed on day 7 to measure AHR. AHR was evaluated using the
Airway Pressure Time Index (APTI) technique. In brief, mice were anaesthetized, intubated, and respirated at a rate of 120 breaths/minute with a constant tidal volume (0.2 mL) and paralyzed
31 with decamethonium bromide (25 mg/kg). After a stable baseline was achieved, acetylcholine
(50 mg/kg) was injected into the inferior vena cava and dynamic airway pressure (cm H2O × second) was recorded for 5 minutes. After AHR measurements, lung segments were snap-frozen for subsequent analysis by real-time PCR and Western blot. To collect BAL fluid, lungs were lavaged three times with a 1.0 mL aliquot of cold Hank’s balanced salt solution (Invitrogen).
Recovered lavage fluid (~70-80%) was centrifuged (300 × g for 8 minutes) and the cell pellet resuspended in 1.0 mL of 10% FBS in 1X PBS. Total cells were counted with a hemocytometer.
Slides were prepared by cytocentrifugation (Cytospin 4, Thermo Scientific), and stained with
Diff-Quik (Dade Behring). Differential counts were determined using morphologic criteria under a light microscope with evaluation of ≥ 500 cells/slide.
6.3 Determination of Th2 Cytokine and IgE Concentration
BAL fluid and serum samples were collected from animals following AHR measurements and centrifuged at 3,000 × g for 5 minutes to remove cell debris. BAL fluid concentrations of IL-4, IL-5, IL-9, and IL-10 and total serum IgE were measured by enzyme- linked immunosorbent assay (ELISA) (eBioscience).
6.4 Cell Culture
6.4.1 Culture Conditions and In Vitro Cytokine Treatment
All cells were maintained in a humidified incubator at 37 °C and 5% CO2. NIH/3T3 cells
(ATCC CRL-1658) (murine, fibroblast), A549 cells (ATCC CCL-185) (human, lung
32 epithelium), Caco-2 cells (ATCC HTB-37) (human, colon epithelium), and RAW 264.7 cells
(ATCC TIB-71) (murine, macrophage) were maintained in DMEM supplemented with 10%
FBS, 1% L-glutamine, and 1% mixture of penicillin and streptomycin. Murine CD11c+ bone marrow-derived dendritic cells (BMDC) and lung fibroblasts (generated as below) were maintained in RPMI supplemented with 10% FBS, 1% L-glutamine, 1% penicillin/streptomycin, and 0.1% β-mercaptoethanol. HBEC3-KT cells (ATCC CRL-4051) (human, bronchial epithelium) were maintained in K-SFM supplemented with Epidermal Growth Factor 1-53 and
Bovine Pituitary Extract (Invitrogen).
During serum starvation, cells were grown in culture medium supplemented with 0.1%
FBS. All cell cultures were stimulated with IL-13 (100 ng/mL), TNF-α (10 ng/mL), IL-17A (100 ng/mL), IL-6 (100 ng/mL), IFN-γ (100 ng/mL), or Na3VO4 (100 µM) (Sigma-Aldrich) in various combinations, unless otherwise noted. All cytokines were purchased from eBioscience.
6.4.2 Lung Fibroblast Isolation and Culture
Lungs from BALB/c, C57BL/6, IL-17RA-/- (C57BL/6), STAT6-/- (BALB/c), and IL4Rα-
F709 (BALB/c) mice were excised, minced, and placed in 6.0 mL of serum-free RPMI containing Liberase CI (0.5 mg/mL) (Roche), DNase I (0.5 mg/mL) (Sigma-Aldrich), 1% L- glutamine, a 1% mixture of penicillin and streptomycin, and 0.1% β-mercaptoethanol at 37 °C for 45 minutes. The tissue was forced through a 70 µm cell strainer, and red blood cells were lysed with ACK lysis buffer (Invitrogen). Cells were washed with RPMI containing 10% FBS, cultured at 37 °C for 2 hours in a T-25 flask to remove macrophage and monocyte contaminants.
Non-adherent cells were transferred to a new T-75 flask and cultured until confluent. Passage of cells 3-4 times following Trypsin digestion (0.25%) (Invitrogen) removed remaining cell
33 contaminants. For Transwell assays, lung fibroblasts were co-cultured in polyester Transwell plates (10 µm) (Corning) in complete culture medium to confluence, then incubated in serum starve medium supplemented with IL-13, IL-17A, or both cytokines. RNA was isolated at 24 hours.
6.4.3 CD11c Enrichment of Dendritic Cells
Total bone marrow cells from Cd11c-Cre-Traf3Flox/Flox and Cd11c-Cre+Traf3Flox/Flox mice were cultured in RPMI supplemented with 10% FBS, 1% L-glutamine, 1% penicillin/streptomycin, and 0.1% β-mercaptoethanol, with the addition of GM-CSF (10 ng/mL)
(Peprotech) on days 0 and 3. BMDC were harvested on day 6. Spleens from Vav1-Cre+Traf6+/+ and Vav1-Cre+Traf6Flox/Flox mice were excised and incubated at 37 °C in 6 mL of serum-free
RPMI containing Liberase CI (0.5 mg/mL) (Roche), DNase I (0.5 mg/mL) (Sigma-Aldrich), 1%
L-glutamine, 1% penicillin/streptomycin, and 0.1% β-mercaptoethanol for 45 minutes. Spleen tissue was forced through a 70 µm cell strainer, and red blood cells were lysed using ACK lysis buffer (Invitrogen). CD11c+ bone marrow-derived dendritic cells or spleen cells were positively selected using CD11c Microbeads (Miltenyi Biotec).
6.4.4 Human Subjects and Nasal Epithelial Cell Sampling
Nasal epithelial cells (NEC) were obtained from healthy donors at Cincinnati Children’s
Hospital Medical Center. Cells were collected following informed consent, and all studies were approved by the Institutional Review Board (IRB#2008-0711). Nasal mucosa was sampled as described elsewhere.270 To expand primary NECs, cells were resuspended in BEGM (Lonza) and
34 cultured in an upright T-25 flask, changing medium every 48 hours. Once confluent, cells were expanded in a T-25 flask lying flat until confluent. 50,000 cells were then transferred into 24- well plates and allowed to reach confluence. Once confluent, cells were treated with cytokines as described.
6.5 DNA Constructs, Promoter Cloning, and Mutagenesis
CMV500 empty vector (Addgene plasmid #33348) and CMV500 A-C/EBP (Addgene plasmid #33352) constructs were a gift from Charles Vinson.271 The pNF-κB-Luc reporter construct was obtained from Agilent and the pRL-TK construct was obtained from Promega. The pGL3-Arg1 promoter constructs have been described previously.272 Putative STAT6, NF-κB, and C/EBP transcription factor binding sites in the murine C3 promoter were compiled using
MotifViz,273 PROMO,274 TESS,275 and TRED276 predictive algorithms. A set of PCR primers with recognition sequences for SacI and XhoI digestion were used to amplify the C3 promoter region from genomic DNA. Oligonucleotides to amplify the promoter fragments and introduce mutations are detailed in Table 6-1. Promoter fragments were cloned into the pGL3-basic vector
(Promega). Site-directed mutagenesis was performed using the Quik-Change procedure
(Stratagene) according to the manufacturer’s instructions. All mutations were introduced into the
-3108/-124 construct.
6.6 Luciferase Assay
To measure NF-κB activity (NIH/3T3 cells), C3 promoter activity (NIH/3T3 cells), and
Arg1 promoter activity (RAW 264.7 cells), cells were transfected with Firefly luciferase
35 constructs at a concentration of 100 ng/well. A Renilla luciferase plasmid (pRL-TK) (Promega) was co-transfected as a control for transfection efficiency at a concentration of 5 ng/well.
Transfections were performed using FuGENE HD (Promega) according to the manufacturer’s protocol. The following day, cells were stimulated with IL-13, IL-17A, or both cytokines.
Twenty-four hours following cytokine treatment, cells were lysed and luciferase assays were performed using a Dual-Luciferase Reporter Assay System (Promega) on a Synergy 2 luminometer (BioTek). Relative luciferase activity was expressed as the ratio of Firefly luciferase activity to Renilla luciferase activity.
6.7 mRNA Stability Assay
NIH/3T3 cells were grown in complete culture medium to confluence, then incubated in serum starve medium supplemented with IL-13, TNF-α, IL-13 + IL-17A, or TNF-α + IL-17A at concentrations detailed in Section 6.4.1. Actinomycin D (ActD) (5 µg/mL) (Sigma-Aldrich) was added to cell cultures 12 (TNF-α ± IL-17A) or 16 (IL-13 ± IL-17A) hours following cytokine treatment and RNA was isolated prior to the addition of ActD and 2 hours (TNF-α ± IL-17A) or
24 hours (IL-13 ± IL-17A) following the addition of ActD.
6.8 Inhibitor Assays
6.8.1 Cycloheximide Assay
NIH/3T3 cells were grown in complete culture medium to confluence, then incubated in serum starve medium supplemented with cycloheximide (5 µg/mL) (Sigma-Aldrich) or dimethyl
36 sulfoxide (DMSO) (0.05% v/v) 2 hours prior to cytokine stimulation. Cells were stimulated in medium supplemented with IL-13, IL-17A, or both cytokines and harvested at indicated times.
6.8.2 Protein-Tyrosine Phosphatase Inhibitor Assays
NIH/3T3 cells were grown in complete culture medium to confluence and then incubated in serum starve medium supplemented with PTP Inhibitor II (256 µM), PHPS1 (1.46 µM), NSC-
87877 (0.71 µM) (Cayman Chemical), Na3VO4 (100 µM) (Sigma-Aldrich), or DMSO (0.065% vol/vol) 3 hours prior to cytokine stimulation. Cells were stimulated in medium supplemented with IL-13, IL-17A, or both cytokines and harvested at indicated times.
6.8.3 NF-κB, C/EBP, and MAPK Inhibitor Assays
NIH/3T3 cells were grown in complete culture medium to confluence, then incubated in serum starve medium supplemented with inhibitors or DMSO vehicle (0.05% v/v) 16 hours prior to cytokine stimulation. To evaluate the effect of NF-κB inhibition, cells were transfected with
NF-κB or C3 promoter luciferase constructs before incubation with CAY10512 (10 µM)
(Cayman Chemical). To inhibit C/EBP transcription factors, NIH/3T3 cells were transfected with expression constructs encoding CMV500 empty vector or CMV500 A-C/EBP at a concentration of 100 ng/well, unless otherwise noted. Transfections were performed using FuGENE HD
(Promega) according to the manufacturer’s protocol. For MAPK inhibitor assays, cells were incubated with SB203580 (1 µM) (Sigma-Aldrich) or U0126 (10 µM) (Sigma-Aldrich) 16 hours prior to cytokine stimulation. Cells were stimulated in medium supplemented with IL-13, IL-
17A, or both cytokines and harvested at indicated times.
37
6.9 Flow Cytometry
NIH/3T3 cells were grown in complete culture medium to confluence, then incubated in serum starve medium supplemented with IL-13, IL-17A, or both cytokines for 5, 15, 30, and 60 minutes. Cells were incubated with Trypsin-EDTA (0.05%) (Invitrogen) for 5 minutes at 37 °C, then fixed for 10 minutes with 2% paraformaldehyde at room temperature, and permeabilized in
90% methanol for 30 minutes at 4 °C. Cells were stored at -80 °C in 90% methanol until staining. Cells were stained for 1 hour at 4 °C with anti-phospho-STAT6-PE (pY641) (1:2.5)
(BD Biosciences).
6.10 Immunoblotting and Immunoprecipitation
Cell lysates were harvested at indicated times, resolved on 4-15% Mini-PROTEAN TGX gels (Bio-Rad), and immunoblotted with antibodies to CLCA3 (1:1000) (Abcam), TRAF6
(1:200) (Santa Cruz), phospho-STAT6 (Tyr641) (1:1000), STAT6 (1:1000), phospho-SHP-1
(Tyr564) (1:1000), SHP-1 (1:1000), phospho-SHP-2 (Tyr542, Tyr580) (1:1000), SHP-2
(1:1000), TRAF3 (1:1000), phospho-IκBα (Ser32) (1:1000), IκBα (1:1000), phospho-p38
MAPK (Thr180/Thr182) (1:1000), p38 MAPK (1:1000), phospho-p44/42 MAPK
(Thr202/Thr204) (1:1000), p44/42 MAPK (1:1000), or α-Tubulin (1:1000) (Cell Signaling). To evaluate TYK2 and JAK1 phosphorylation, cell lysates were first immunoprecipitated with antibodies to TYK2 (1:83) or JAK1 (1:500) (ThermoFisher Scientific) and protein A Dynabeads
(ThermoFisher Scientific), then immunoblotted with antibodies to phospho-Tyrosine (1:4000)
(BD Biosciences) or phospho-JAK1 (Tyr1022/1023) (1:1000) (Cell Signaling).
38 6.11 RNA Purification and Real-Time PCR
Total cellular RNA was extracted using TRI Reagent (Molecular Research Center) according to the manufacturer’s protocol and reverse transcribed using SuperScript II reverse transcriptase (Invitrogen). To assess IL-13 and IL-17A-induced message expression in lung sections and cell cultures, we used quantitative real-time PCR with SYBR Green mix (Bio-Rad).
Expression levels were normalized to S14 (mouse) or S13 (human).
6.12 Statistical Analysis
Data are expressed as mean ± standard error of the mean (S.E.M.). One-way ANOVA followed by the Tukey-Kramer test was used to determine differences between multiple groups.
For comparison between 2 groups, a Student’s t-test was performed. Figures were produced and statistics were analyzed with GraphPad Prism 5 (GraphPad Software).
39 Table 6-1. List of cloning primer sequences.
Oligo Sequence Location mC3.2984.S1 CGAGCTCCAAACTAATGCCTGCACCTCC -3108/-3087 mC3.1889.S2 CGAGCTCAGCTCAGTGAGGAAGTGGG -2013/-1994 mC3.1226.S3 CGAGCTCTAACTTGCTACATAGCAAGG -1350/-1330 mC3.778.S4 CGAGCTCGAACTTCTAGGCAGCCTTC -902/-883 mC3.416.S5 CGAGCTCCCACTGATTTAGCAAGACC -540/-521 mC3.176.S6 CGAGCTCGCTTGTTGCCCCAGGTTTG -300/-281 mC3.AS1 CCGCTCGAGGGGCAGAGGCGAGCTGGGG -143/-124 CAATAGCCAGGCCAGCAGGAATATCGGATT mC3.2984.mut.S1 -3108/-3058 TCATTTCTCGGAATTTGCAA TTGCAAATTCCGAGAAATGAAAT mC3.2984.mut.AS1 -3108/-3058 CCGATATTCCTGCTGGCCTGGCTATTG
Table 6-2. List of mouse and human primer sequences. Gene Species Left Sequence Right Sequence Tff2 Mouse AGGACTGTGCCAGTCGAAAC CTCGGCAGTAGCAACTCTCA Arg1 Mouse CATGAGCTCCAAGCCAAAGT TTTTTCCAGCAGACCAGCTT Alox15 Mouse CGGTCTACTTGTCTCCCTGC CTTGATCCCATCCAGAAGGA Ca2 Mouse CAACAACGGCCACTCCTTTA GAGCCCCAGTGAAAGTGAAA C3 Mouse GGCCTTCTCTCTAACAGCCA ATGCTGACCCTGAGGTCAAA Il13ra2 Mouse GGAGCGAATGGAGTGAAGAG TCCTTCTCCACAATAAGGCAA Cebpd Mouse TAAGGAGATGGACGCGTTTC GTTAGGCCAACTGTTCTCCG Cebpb Mouse GTTTCGGGACTTG CCCCGCAGGAACATCTTTA S100a8 Mouse CCATGCCCTCTAC ATCACCATCGCAA S100a9 Mouse GAAGGAAGGACAC GTCCAGGTCCTCC Csf2 Mouse CGAATATCTTCAGGCGGGT GGTACTGCTGGCTCACCTCT Lcn2 Mouse CAGAAGGCAGCTTTACGATG TCTGATCCAGTAGCGACAGC S14 Mouse GAGGAGTCTGGAGACGACGA TGGCAGACACCAAACACATT Il17ra Mouse GCTGGGATGGCTGCTTCT TTGACTCTGCAGCTCAGCC Il17rc Mouse GTCTTGGGGCTGAGGTACAG CCTGCTCCTCAGAGACATCC Il13ra1 Mouse GTGCTGCTACTGTGGACCG CTTCAGGAGGACTCCACGTC Il4ra Mouse GTGGAGCCTGAACTCGCA AGGAACAAGACCAGCAGGC Csf3 Mouse GCAAGTGAGGAAGATCCAGG ACTCAGGGAAGCCTTCGG SERPINB4 Human GTCGATTTACACTTACCTCGG GCCTTGTGTAGGACTTTAGATACT IL13RA2 Human TCTGTTCTTGGAAACCTGGC ATTTTGTCCATCAGCCTTGA LCN2 Human ACTCTTAATGTTGCCCAGCG ATGTCACCTCCGTCCTGTTT S13 Human CCCCACTTGGTTGAAGTTGA CTTGTGCAACACCATGTGAA
40 Chapter 7
IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced Signal
Transducer and Activator of Transcription 6 Activation
41 7.1 Introduction
IL-13 has been ascribed a central pathogenic role in experimental models of asthma because exogenous IL-13 induces mucus hypersecretion, AHR, and airway remodeling.18-21
Moreover, eliminating IL-13 signaling abrogates allergen-driven responses, and selective restoration of IL-13 signaling in airway epithelial cells or smooth muscle cells is sufficient to recapitulate most features of allergic asthma.125, 128 This suggests that IL-13-induced responses in pulmonary structural cells are critical to asthma pathogenesis. Recently, Th17 cytokines have been shown to influence the development and severity of asthma, and murine models eliciting mixed Th2/Th17 responses are associated with more severe airway inflammation and dysfunction than purely Th2 driven models.37, 39 Similar to IL-13, IL-17A signaling in airway smooth muscle cells also influences AHR,237 suggesting that the convergence of IL-13 and IL-
17A signaling in pulmonary structural cells can contribute to the pathogenesis of severe forms of allergic asthma.
In human subjects, IL-17A levels in lung biopsy specimens, sputum, and serum correlate with asthma severity,34-36, 226, 277 and a unique subset of IL-4+/IL-17A+ CD4+ T cells (Th2/Th17 cells) was recently identified in the blood, BAL fluid, and lungs of asthmatics.115-117 Asthmatic patients with a predominance of Th2/Th17 cells in the BAL fluid (“Th2/Th17 predominant”) exhibited the greatest airway obstruction, hyperreactivity, and steroid use relative to “Th2 predominant” or “Th2/Th17 low” subgroups.117 Although these studies suggest a link between
IL-17A and severe asthma in human subjects, the mechanisms whereby IL-17A influences disease severity, especially in subjects with mixed Th2/Th17 phenotypes, remain unclear.
Recent studies directed at determining how IL-17A regulates the development of IL-13- induced lung pathology have examined the effects of different doses or cellular sources of IL-
42 17A.37, 237, 239, 240 However, an important unanswered question is how interactions between IL-13 and IL-17A at the cellular and molecular levels influence asthma pathogenesis. Hence the aim of the present study was to determine molecular mechanisms by which IL-17A enhances IL-13 pathology in patients with severe asthma by using in vivo models of IL-13-induced lung pathology and in vitro cultures of relevant cell types.
7.2 Results
7.2.1 IL-17A Increases IL-13-Induced Pathology In Vivo
To examine the effect of IL-17A on IL-13-induced lung pathology, A/J mice were treated i.t. with PBS, IL-13 (2 µg or 5 µg), IL-17A (2 µg or 5 µg), or both cytokines on days 0, 3, and 6.
AHR, airway inflammation, mucus production, and gene expression were assessed on day 7.
While treatment with IL-17A alone failed to alter AHR, treatment with IL-13 induced AHR (Fig.
7-1, A and B). Treatment with 5 µg but not 2 µg of IL-17A enhanced AHR induced by 5 µg of
IL-13 (Fig. 7-1, B). Treatment with 5 µg of IL-13 and IL-17A did not increase Th2 cytokine expression in the BAL fluid or total IgE levels in the serum (Supp. Fig. 7-1, A and B). Further, although neither cytokine alone was administered at sufficiently high concentrations to increase total BAL cell numbers, simultaneous treatment with IL-13 and IL-17A increased BAL cell numbers (Fig. 7-1, C and D), primarily due to an increased frequency of neutrophils (Fig. 7-1, E and F). To examine goblet cell hyperplasia, we assessed levels of CLCA3, a protein highly expressed in murine goblet cells, in lung homogenates from cytokine-treated animals (Fig. 7-1,
G). IL-17A treatment did not increase CLCA3 protein in the lung, but treatment with IL-13 induced CLCA3 production in a dose-dependent manner, and IL-13-induced CLCA3 levels were
43 further enhanced by both doses of IL-17A. Thus, IL-17A exacerbates IL-13-driven AHR, airway inflammation, and mucus production.
7.2.2 Reciprocal Co-Regulation of IL-13- and IL-17A-Induced Genes In
Vivo
Transcript levels of IL-13-induced genes were assessed in animals treated with 5 µg of
IL-13 and IL-17A since consistent enhancement of IL-13-induced AHR, inflammation, and mucus were observed at these doses. Treatment with IL-13 induced the expression of Tff2, Arg1,
C3, Alox15, Ca2, and the gene encoding the IL-13 decoy receptor, Il13ra2 (Fig. 7-1, H). While
IL-17A treatment alone had little impact on the expression of these genes, co-treatment with IL-
17A enhanced IL-13-induced expression of these genes by nearly 3-fold. IL-17A-mediated enhancement of IL-13-induced lung pathology was not a result of increased expression of the IL-
13 receptor, as type II IL-4/IL-13 receptor (Il13ra1, Il4ra) transcript levels were unchanged
(Supp. Fig. 7-2, A and B).
In contrast to the enhancing effect of IL-17A on IL-13-induced gene expression, we found that expression of S100a8, S100a9, Lcn2, Csf2, Cebpb, and Cebpd was increased in animals exposed to IL-17A alone, but diminished in animals co-exposed to IL-17A and IL-13
(Fig. 7-1, I). The inhibitory effect of IL-13 on IL-17A-induced gene expression was also independent of changes in IL-17A receptor levels, as expression of IL-17A receptor subunits
(Il17ra, Il17rc) was unaltered (Supp. Fig. 7-2, C and D). Collectively, these data suggest that there is reciprocal co-regulation of IL-13- and IL-17A-induced genes in vivo.
44 7.2.3 IL-13Rα2 is not Required for IL-17A-Mediated Enhancement of IL-13
Pathology
Despite its reported role as an IL-13 inhibitor,138-140 allergen-driven AHR is attenuated in
IL-13Rα2-/- mice,143 suggesting that IL-13Rα2 may be required for maximal induction of AHR.
To determine if enhanced expression of Il13ra2 contributes to IL-17A-mediated enhancement of
IL-13-driven pathology, IL-13-induced AHR, inflammation, and gene expression were measured in WT BALB/c or IL-13Rα2-/- mice following i.t. treatment with 5 µg of cytokines. While AHR was attenuated in IL-13Rα2-/- animals relative to WT, treatment with IL-17A still enhanced IL-
13-driven AHR in IL-13Rα2-/- mice (Fig. 7-2, A). Despite difference in the absolute magnitude of basal, and IL-13-induced AHR, IL-17A exacerbated IL-13-induced AHR ~1.4-fold in both
WT and IL-13Rα2-/- animals (Supp. Fig. 7-3, A) suggesting that the effects of IL-17A were comparable in both strains. Similar to our observations in A/J mice, IL-17A enhanced IL-13- driven changes in BAL cellularity (Fig. 7-2, B), increased the frequency of neutrophils in the
BAL (Fig. 7-2, C and D), and increased IL-13-driven transcript levels in the lung (Fig. 7-2, E).
Further, although IgE was significantly elevated in the serum of IL-13Rα2-/- mice relative to
WT, antibody levels were not altered by cytokine treatment in either strain (Supp. Fig. 7-3, B).
IL-13 also diminished the expression of IL-17A-induced genes in both WT and IL13Rα2-/- mice
(Fig. 7-2, F). Collectively, these data suggest that the ability of IL-17A to enhance IL-13-induced lung pathology is not dependent on IL-13Rα2. Further, as IL-17A enhanced IL-13-induced pathology in both A/J (Fig. 7-1) and BALB/c animals (Fig. 7-2), this suggests these in vivo observations are not limited to a single mouse strain.
45 7.2.4 Reciprocal Co-Regulation of IL-13- and IL-17A-Induced Genes In
Vitro
To confirm that changes in gene expression reflected changes in transcriptional activity and not altered inflammatory cell recruitment, we expanded our studies to an in vitro analysis of fibroblasts, an IL-13- and IL-17A-responsive structural cell type. Initial dose-finding experiments using NIH/3T3 cells revealed strong induction of IL-13-responsive genes C3 and
Il13ra2 at 100 ng/mL (Supp. Fig. 7-4). Subsequently, IL-13-induced gene expression was examined over a 24-hour period. As in the whole lung, treatment with IL-13 by itself again augmented both C3 and Il13ra2 expression, while IL-17A failed to increase Il13ra2 expression and resulted in only modest expression of C3 (Fig. 7-3, A and B). Co-treatment with IL-13 and
IL-17A significantly elevated Il13ra2 and C3 expression relative to medium or IL-13 stimulated cells, as early as 2 hours and maximally between ~16-20 hours post treatment. Similar to in vivo,
IL-13 inhibited IL-17A-induced expression of Cebpd and Lcn2 (Fig. 7-3, C and D). Again, no effect was seen on the expression of either IL-13 or IL-17A receptor components (Supp. Fig. 7-
5). Taken together, these data recapitulate our in vivo observations and establish that IL-17A enhances IL-13-induced gene expression in a single cell population independent of the lung microenvironment.
7.2.5 IL-17A-Mediated Enhancement of IL-13-Induced Gene Expression
Requires Functional IL-13 and IL-17A Signaling Complexes in the
Same Cell
46 Given the time frame in which IL-17A enhanced IL-13-induced gene expression, the role of soluble IL-17A-induced factors was examined. To address this, WT C57BL/6 or IL-17RA-/- pulmonary fibroblasts were cultured in Transwell plates. In co-cultures consisting of WT fibroblasts on the top and bottom wells of the Transwell, IL-17A enhanced IL-13-induced gene expression, whereas in co-cultures consisting of IL-17RA-/- fibroblasts it did not (Supp. Fig. 7-6).
In co-cultures of WT and IL-17RA-/- cells, IL-13 induced similar levels of C3 and Il13ra2 expression (Fig. 7-4, A and B). However, in WT and IL-17RA-/- co-cultures treated with both cytokines, IL-17A enhanced IL-13-dependent C3 and Il13ra2 expression in the WT cells but not the IL-17RA-/- cells. IL-17A-induced expression of Lcn2 was abrogated in IL-17RA-/- fibroblasts, confirming their insensitivity to IL-17A (Fig. 7-4, C). Overall, these data demonstrate that IL-17A-induced mediators cannot enhance IL-13-induced gene expression in the absence of functional IL-17A receptors, suggesting that IL-17A acts directly on IL-13- responsive cells to increase IL-13-induced transcriptional activity.
7.2.6 IL-17A does not Enhance the Stability of IL-13-Induced Transcripts
IL-17A synergizes with innate cytokines (TNF-α, IL-1β) by increasing target mRNA stability.224, 257, 278 To determine whether IL-17A also regulates the stability of IL-13-induced transcripts, NIH/3T3 cells were incubated with IL-13 alone or in combination with IL-17A for
16 hours, then de novo transcription was blocked with ActD and mRNA degradation was evaluated over a 24-hour period. As expected, IL-17A improved the stability of TNF-α-induced
Csf3 and Lcn2 (Supp. Fig. 7-7). However, the half-life of IL-13-induced C3 (t1/2=6.3) and
Il13ra2 (t1/2=5.4) mRNA was slightly reduced rather than enhanced by IL-17A (C3, t1/2=3.9;
Il13ra2, t1/2=4.6) (Fig. 7-5, A and B), suggesting that mRNA stabilization does not contribute to
47 IL-17A-mediated enhancement of IL-13-induced C3 or Il13ra2 expression. Consistent with this observation, comparably greater levels of C3 and Il13ra2 transcripts were detected in cells that were stimulated with IL-13 and IL-17A both at the time of ActD addition and 24 hours post treatment (Supp. Fig. 7-8). Thus, in contrast to the central mechanism driving synergy between
IL-17A and TNF-α, these data suggest that IL-17A augments IL-13-induced transcript levels independently of mRNA stabilization.
7.2.7 IL-17A Enhances IL-13-Driven STAT6 Phosphorylation
As IL-13-driven lung pathology requires STAT6 expression,125 we evaluated the hypothesis that IL-17A augments IL-13-driven pathology by promoting activation of STAT6. To test this, NIH/3T3 cells were incubated with medium containing IL-13, IL-17A, or both cytokines, and pSTAT6 was evaluated by Western blot. Stimulation with IL-13 induced STAT6 phosphorylation (Fig. 7-6, A). While IL-17A did not increase pSTAT6, co-treatment with IL-
17A enhanced IL-13-driven STAT6 activation (Fig. 7-6, A). Pre-treatment of NIH/3T3 cells with cycloheximide (5 µg/mL) did not limit the ability of IL-17A to enhance IL-13-dependent STAT6 phosphorylation (Fig. 7-6, B). In fact, pSTAT6 levels were comparably increased (~1.7 fold) in
DMSO and cycloheximide exposed cultures (Fig. 7-6, C), suggesting that IL-17A-mediated enhancement of IL-13-dependent pSTAT6 does not require de novo protein synthesis. We also assessed STAT6 phosphorylation in cytokine-treated NIH/3T3 cells by phosphoflow cytometry.
Compared with IL-13-exposed cells, cells stimulated with IL-13 and IL-17A demonstrated significantly greater levels of pSTAT6 after 2 and 5 minutes of stimulation (Fig. 7-6, D, Supp.
Fig. 7-9). Although these changes appear modest, analyses of area under the curve (AUC) show
48 an approximately 9% increase in total pSTAT6 levels in cells exposed to IL-13 and IL-17A
(AUC, 9782) compared to those treated with IL-13 alone (AUC, 8991).
Based on these in vitro observations, we wanted to determine whether IL-17A also enhanced IL-13-driven STAT6 phosphorylation in vivo. Thus, pSTAT6 and total STAT6 levels were measured in whole lung homogenates from A/J mice treated with PBS, 5 µg IL-13, 5 µg
IL-17A, or 5 µg of both cytokines by means of Western blotting. Twenty-four hours after the final cytokine exposure, pSTAT6 was detectable in IL-13-treated animals but not PBS or IL-
17A-exposed animals, and IL-13-induced pSTAT6 levels were further heightened by IL-17A
(Fig. 7-6, E). Thus, we observe an association between increased pulmonary pSTAT6 levels,
AHR, airway inflammation, and mucus production in animals exposed to IL-13 and IL-17A.
Although STAT6 is the dominant signaling pathway activated in response to IL-13, additional pathways have been implicated in IL-13 signaling.187-190 To determine whether these signaling pathways can also contribute to IL-17A-mediated enhancement of IL-13 responses, we cultured lung fibroblasts from BALB/c WT or STAT6-/- mice in medium containing IL-13, IL-
17A, or both cytokines and assessed the expression of IL-13-induced (Fig. 7-6, F) and IL-17A- induced (Fig. 7-6, G) induced genes. In WT cells treatment with IL-13 induced the expression of both Il13ra2 and C3, and expression was augmented by IL-17A. In contrast, IL-13-induced
Il13ra2 and C3 expression was reduced in STAT6-/- fibroblasts, and IL-17A did not notably enhance expression further. IL-17A-induced expression of Lcn2 was inhibited by IL-13 in cells from WT but not STAT6-/- animals (Fig. 7-6, G), implying that inhibition of IL-17A signaling requires IL-13-induced STAT6 activation. Taken together, these findings suggest that IL-17A directly increases IL-13-induced gene expression through STAT6 activation, leading to enhanced
IL-13-dependent lung pathology.
49 7.2.8 Reciprocal Co-Regulation by IL-13 and IL-17A in Human Cells
Initial dose-finding experiments were carried out in normal human bronchial epithelial cells (HBEC3-KT) to determine if IL-17A also augmented IL-13 activity in human cells.
Although SERPINB4 expression was elevated at all IL-13 concentrations tested (5-100 ng/mL),
IL13RA2 was only induced by 100 ng/mL (Supp. Fig. 7-10, A and B). A dose of 100 ng/mL was selected for further study to ensure that potential regulatory influences of IL-13Rα2 would be present (Supp. Fig. 7-4). To test the ability of IL-17A to enhance IL-13-induced gene expression in primary human cells, NECs were collected from 7 healthy volunteers and IL-13-induced gene expression was assessed after treatment with IL-13, IL-17A or both IL-13 and IL-17A.
Treatment with IL-13 induced the expression of SERPINB4 and IL13RA2 (Fig. 7-7, A), and although IL-17A alone did not remarkably influence expression of these genes, treatment with both cytokines further increased IL-13-induced transcript levels in the majority of subjects.
Moreover, IL-13 also inhibited IL-17A-induced LCN2 expression (Fig. 7-7, B), demonstrating that our observations in mice are consistent in human primary cells.
To determine whether IL-17A also enhanced IL-13-driven STAT6 activation in human cells, human epithelial cell lines were incubated with medium containing IL-13, IL-17A, or both cytokines, and pSTAT6 levels were assessed by means of Western blotting. Both Caco-2 (Fig. 7-
7, C) and A549 (Fig. 7-7, D) cells demonstrated greater levels of IL-13-induced pSTAT6 when costimulated with IL-17A. Finally, to confirm that IL-17A increased IL-13-induced pSTAT6 levels in primary human cells, NECs from 2 donors were additionally exposed to cytokines, and pSTAT6 levels were assessed by means of Western blotting. As shown in Fig. 7-7, E, cells from both donors demonstrated IL-13-induced pSTAT6, which was further enriched in the presence of
IL-17A. Overall, these results demonstrate that IL-17A enhances IL-13 activity across a panel of
50 asthma-relevant human epithelial cells, suggesting a plausible mechanistic explanation for increased asthma severity in subjects who simultaneously produce measurable levels of both IL-
13 and IL-17A.
51 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Figure 7-1
A C E G ++ 1200 10 PBS IL-17A (2 μg) IL-17A (5 μg) 100 ++ PBS
) IL-17A (2 μg)
c CLCA3 )
e IL-17A (5 μg) 4 8 s 80 IL-13 (2 μg) )
x IL-13 (2 μg) + IL-17A (2 μg) 800 %
( IL-13 (2 μg) + IL-17A (5 μg) O α-Tubulin
2 6 # s # l 60
l H
e m c
c 4 ++ IL-13 (2 μg) IL-13+IL-7A (2 μg) IL-13+IL-17A (5 μg) ( F
400 40 I L
++ T A CLCA3 P 2 B BALF cells (x10
A 20
0 0 α-Tubulin IL-13 (μg) - - - 2 2 2 0 IL-13 (μg) - - - 2 2 2 Mac Lym Neu Eos IL-17A (μg) - 2 5 - 2 5 IL-17A (μg) - 2 5 - 2 5 IL-13 (5 μg) IL-13+IL-7A (2 μg) IL-13+IL-17A (5 μg)
B D F CLCA3 + + + 100 1200 10 ++ PBS + # # IL-17A (2 μg) α-Tubulin
) ### IL-17A (5 μg) c )
4 80 IL-13 (5 μg) e 8 )
s 0.8 # IL-13 (5 μg) + IL-17A (2 μg) + n
% + x i
( IL-13 (5 μg) + IL-17A (5 μg)
800 l s
u O 6 l 60 l
2 0.6 ++ b e
u H c
+++ T m F α / c 4 40 0.4
L ( 3
400 I A
A T B
C 0.2
P 2
BALF cells (x10 20
L A C 0 0 0 0 IL-13 (μg) - - - 2 2 2 5 5 5 IL-13 (μg) - - - 5 5 5 IL-13 (μg) - - - 5 5 5 Mac Lym Neu Eos IL-17A (μg) - 2 5 - 2 5 IL-17A (μg) - 2 5 - 2 5 IL-17A (μg) - 2 5 - 2 5 - 2 5
+ ) + )
H I 6 6 ++ ) 200 600 #
250 8 800 ) ++ 7 # 200 ## # 150 600 400 150 100 400 100 mRNA (x10 # mRNA (x10 200 mRNA (x10
mRNA (x10 50 200 50 Tff2 0 Arg1 0 0 0 S100a8 + + S100a9 ) 7 )
) 300 8 400 100 300 # 8 ) # ++ + 9 80 300 200 200 60 200 40 100 mRNA (x10
100 mRNA (x10 100 mRNA (x10 mRNA (x10 20 C3 Csf2 0 Lcn2 0 0
0 Alox15 ) ) ) 5 6 8 200 ) 400 80 500 7 + 400 300 60 150 300 200 40 100 200 mRNA (x10 mRNA (x10 mRNA (x10
mRNA (x10 100 50 20 ## 100
Ca2 0 0 0
0 Cebpb Cebpd PBS IL-13 IL-17A IL-13 + Il13ra2 PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + (5 μg) (5 μg) IL-17A (5 μg) (5 μg) IL-17A (5 μg) (5 μg) IL-17A (5 μg) (5 μg) IL-17A
Figure 7-1. Dose-dependent effects of IL-13 and IL-17A in vivo. A-I, AHR in A/J mice treated intratracheally with IL-13 or IL-17A (Fig. 7-1, A and B); total cell counts from BAL fluid of cytokine-treated animals (Fig. 7-1, C and D); frequency of macrophages, lymphocytes, neutrophils, and eosinophils in the BAL fluid (Fig. 7-1, E and F); CLCA3 and α-Tubulin expression and densitometry in total lung homogenates (Fig. 7-1, G); and total lung expression of IL-13-induced (Fig. 7-1, H) and IL-17A-induced (Fig. 7-1, I) transcripts after cytokine treatment. #P < .05, ##P < .01, and ###P < .001 versus PBS. +P < .05, ++P < .01, and +++P < .001 versus IL-13. Means + S.E.M.s of 4 to 9 mice per group (pooled over 3 independent experiments) are shown.
52 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Figure 7-2
A WT (BALB/c) B WT (BALB/c) C D -/- -/- IL-13Rα2 IL-13Rα2 100 100 + PBS PBS IL-13 IL-13 ) 40 ) 1500 ) c + + 80 IL-17A 80 IL-17A
) e 6 - % %
/ s IL-13 + IL-17A - IL-13 + IL-17A ( ## (
0
## e 2
1 x s 30 s
+ p
α l l
x ## 60 60 l l
( +
1000 ty
R O
e ## ## e
- 2 s 3 c c l
d 1 l l H 20 F F ## 40 - 40
e m L L L c
I
Wi c A
500 A (
L
I 10 B B 20 20
A T
B P
A 0 0 0 0 PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + Mac Lym Neu Eos Mac Lym Neu Eos IL-17A IL-17A + E F + ) 7
) 150 400 600
600 ) 600 300 ) 6
8 ## ) 8
) +++ 6 9 # + ## # # # # 300 # 400 400 200 100 400 # # 200 mRNA (x10 mRNA (x10
200 mRNA (x10 200 100 50 200 mRNA (x10
mRNA (x10 #
mRNA (x10 100 C3 Arg1 Tff2 Lcn2 S100a9 0 0 0 Cebpd 0 0 0 PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + IL-17A IL-17A IL-17A IL-17A IL-17A IL-17A
Figure 7-2. IL-13Rα2 is not required for IL-17A-mediated enhancement of IL-13-induced pathol- ogy. A-F, AHR in WT or IL-13Rα2-/- mice treated intratracheally with IL-13 or IL-17A (Fig. 7-2, A); total cell counts from BAL fluid of cytokine-treated animals (Fig. 7-2, B); frequency of macrophages, lymphocytes, neutrophils, and eosinophils in BAL fluid (Fig. 7-2, C and D); and total lung expression of IL-13-induced (Fig. 7-2, E) and IL-17A-induced (Fig. 7-2, F) transcripts after cytokine treatment. #P < .05 and ##P < .01 versus PBS. +P < .05 and +++P < .001 versus IL-13 (Fig. 7-2, A and B) or IL-17A (Fig. 7-2, F). Means + S.E.M.s of 5 to 11 mice per group (pooled over 3 independent experiments) are shown.
53 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Figure 7-3
A B 120 120 Medium +++ Medium ) +++ ### 8 ) ## 8 100 IL-13 100 IL-13 IL-17A +++ IL-17A 80 ### 80 IL-13 + IL-17A IL-13 + IL-17A 60 60 +++ ## ### ++ mRNA (x10 40 mRNA (x10 40 ### +++ C3 20 + ### 20 ++ ++ ### ##
### Il13ra2 ### ## 0 0 1 2 4 8 1 2 4 8 0.5 12 16 20 24 0.5 12 16 20 24 Time (hours) Time (hours) C D 600 200 Medium ### Medium ### ) 7 )
IL-13 6 IL-13 IL-17A 150 IL-17A 400 IL-13 + IL-17A IL-13 + IL-17A 100 ## mRNA (x10
200 mRNA (x10 +++ 50 Lcn2 Cebpd
0 0 1 2 4 8 1 2 4 8 0.5 12 16 20 24 0.5 12 16 20 24 Time (hours) Time (hours)
Figure 7-3. Reciprocal co-regulation of IL-13- and IL-17A-induced genes occurs in vitro. A-D, Real-time PCR analysis of C3 (Fig. 7-3, A), Il13ra2 (Fig. 7-3, B), Cebpd (Fig. 7-3, C), and Lcn2 (Fig. 7-3, D) expression in NIH/3T3 cells stimulated with IL-13, IL-17A, or both cytokines over 24 hours. ##P < .01 and ###P < .001 versus medium. +P < .05, ++P < .01, and +++P < .001 versus IL-13 (Fig. 7-3, A and B) or IL-17A (Fig. 7-3, C). Means + S.E.M.s of 4 to 8 replicates per condition are shown. Results show 1 of 3 independent experiments.
54 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Figure 7-4
A B C WT (C57Bl/6) (Top) 250 400 ++ 800 +++
-/- ) 7 IL-17RA (Bottom) ### ) ### 8 ) 8 200 +++ 300 600 ### 150 # 200 400 100
# # mRNA (x10 mRNA (x10
mRNA (x10 100 200 50 C3 Lcn2 0 Il13ra2 0 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A IL-17A
Figure 7-4. IL-17A directly signals on IL-13-responsive cells to enhance gene expression. A-C, Real-time PCR analysis of C3 (Fig. 7-4, A), Il13ra2 (Fig. 7-4, B), and Lcn2 (Fig. 7-4, C) expression in cocultured WT or IL-17RA-/- lung fibroblasts stimulated with IL-13, IL-17A, or both cytokines for 24 hours. #P < .05 and ###P < .001 versus medium. ++P < .01 and +++P < .001 versus IL-13 (Fig. 7-4, A and B) or IL-17A (Fig. 7-4, C). Means + S.E.M.s of 3 replicates per condition are shown. Results show 1 of 3 independent experiments.
55 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Figure 7-5
A B
125 IL-13 t½=6.3 g 125 IL-13 t½=5.4 n i g
n IL-13 + IL-17A t½=3.9 IL-13 + IL-17A t½=4.6 i 100 ain 100 m ain e r
m
e 75 75 A r
N A R N
50 m 50
R 2 m a
r 3 25 25 3 C
1 l I %
0 0 % 0 4 8 2 6 0 4 0 4 8 2 6 0 4 1 1 2 2 1 1 2 2 Time after ActD (hours) Time after ActD (hours)
Figure 7-5. IL-17A does not stabilize IL-13-induced transcripts. A and B, Percentage mRNA remaining of IL-13-induced C3 (Fig. 7-5, A) and Il13ra2 (Fig. 7-5, B) in NIH/3T3 cells stimulated with IL-13 or IL-13 plus IL-17A for 16 hours and
incubated with ActD. Real-time PCR analysis of transcript levels was evaluated over 24 hours, and t1⁄2 was calculated. Means + S.E.M.s of 4 to 8 replicates per condition shown. Results show 1 of 3 independent experiments.
56 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Figure 7-6
A B C 2.0 DMSO Cycloheximide DMSO 1.5 Cycloheximide pSTAT6 6 T
A 1.0 T S
STAT6 p 0.5 Fold Increase Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A 0.0 IL-13 IL-13 + IL-17A D E 4000 Medium PBS IL-17A (5μg) IL-13 2.5 +++
IL-17A pSTAT6 6 FI ### 3000 + IL-13 + T 2.0 M IL-17A A g T +++ STAT6 1.5 S 6 2000 / 6 T
T 1.0 A IL-13 (5μg) IL-13 + IL-17A A T T S 1000 0.5 p S pSTAT6 p 0.0 0 PBS IL-17A IL-13 IL-13 + Unstained 2 5 15 30 60 STAT6 IL-17A Time (minutes)
F G ++
) 500 + 800 100
5
) 0
### 8
## ) 1 WT (BALB/c)
0 ## 7
x 80
400 1 0 ( -/-
600 x
1 STAT6
( x
#
A (
300 60
A
N
A R
400 N
N R m 40
200
R
m
2
m
a
2
r 200
100 n 20
3
c
1
C3
l L I 0 0 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A IL-17A
Figure 7-6. IL-17A directly enhances IL-13-driven pSTAT6. A-G, pSTAT6/STAT6 levels in NIH/3T3 cells pretreated with dimethyl sulfoxide (DMSO; Fig. 7-6, A) or cycloheximide (Fig. 7-6, B) and then stimulated with cytokines for 5 minutes. Densitometry of pSTAT6/STAT6 expression shown in Fig. 7-6, A and B (Fig. 7-6, C). Geometric mean fluorescence intensity of pSTAT6 by using phosphoflow in NIH/3T3 cells stimulated with cytokines over 1 hour (Fig. 7-6, D). pSTAT6/STAT6 expression and associated densitometry in whole lung homogenates from cytokine-treated A/J mice (means + S.E.M.s of n=7-10 mice per group, pooled from 3 independent experiments (Fig. 7-6, E). Real-time PCR analysis of C3 and Il13ra2 (Fig. 7-6, F) or Lcn2 (Fig. 7-6, G) expression in WT and STAT6-/- lung fibroblasts stimulated with cytokines for 24 hours. #P < .05, ##P < .01, and ###P < .001 versus PBS or medium. +P < .05, ++P < .01, and +++P < .001 versus IL-13. Cycloheximide immunoblots show 1 of 3 independent experiments. Phosphoflow cytometry and real-time PCR results show means + S.E.M.s of 4 to 6 replicates per condition. Results show 1 of 2 independent experiments.
57 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Figure 7-7
A B ) 5
2.5 )
8 100 8.0 ) 5
(x10 2.0 (x10
A 10 6.0 A (x10
1.5 A
mRN 1 4.0
1.0 mRN mRN .1 2.0 0.5 LCN2
IL13RA2 .01
SERPINB4 0 0 Medium IL-17A IL-13 IL-13 + Medium IL-17A IL-13 IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A IL-17A C D E Caco-2 A549 Pt 1 Pt 2
IL-13 + IL-13 + IL-13 + IL-13 + Medium IL-13 IL-17A IL-17A Medium IL-13 IL-17A IL-17A Medium IL-13 IL-17A IL-17A Medium IL-13 IL-17A IL-17A pSTAT6 pSTAT6 pSTAT6
STAT6 STAT6 STAT6
0.0 0.0 0.0 T6 T6 0.5 0.5 T6 A A A 0.5 T T 1.0 1.0 T
1.5 1.5 1.0 T6/S T6/S T6/S A A 2.0 2.0 A T T T 1.5 2.5 2.5 pS pS pS 3.0 3.0 2.0
Figure 7-7. Reciprocal co-regulation by IL-13 and IL-17A is conserved in human cells. A and B, Real-time PCR analysis of SERPINB4 or IL13RA2 (Fig. 7-7, A) and LCN2 (Fig. 7-7, B) expression in primary human NECs (n=7) stimulated with IL-13, IL-17A, or both cytokines for 24 hours. C-E, pSTAT6/STAT6 levels and associated densitometric analysis in Caco-2 (Fig. 7-7, C) or A549 (Fig. 7-7, D) cells stimulated with cytokines for 5 minutes or NECs (n=2) stimulated with cytokines for 15 minutes (Fig. 7-7, E). Caco-2 and A549 immunoblots show 1 of 2 or 3 independent experiments, respectively.
58 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Supplementary Figure 7-1
A ## B 0.25 # 400 # PBS ### # IL-13 ## 0.20 IL-17A ) 300 ## IL-13 + IL-17A l m / . 0.15 g D n . 200 (
O 0.10 E g
I 100 0.05
0.00 0 IL-4 IL-5 IL-9 IL-10 PBS IL-13 IL-17A IL-13 + IL-17A
Supplementary Figure 7-1. A and B, Th2 cytokine levels in BAL fluid (Supp. Fig. 7-1, A) and total serum IgE levels (Supp. Fig. 7-1, B) of A/J mice after intratracheal cytokine treatment. #P < .05, ##P < .01, and ###P < .001 versus PBS. Means + S.E.M.s of 4 to 9 mice per group (pooled over 3 independent experiments) are shown.
59 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Supplementary Figure 7-2
A B C D 500 800
100 )
)
6 )
150 8
)
6
0
0
8
0
1 0
1 400 1
80 x 1
x 600
(
x
(
x
(
(
A
100 A 300
A 60
A
N N
N 400
N
R R
R 200 R
40 m
m
m
m
c
50 a r
1 200
r
a 7
a 100 r
20 7
r
1
4
1
l
3
l
l
I
I
I 1 l 0 0 0 I 0 PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + (5 μg) (5 μg) IL-17A (5 μg) (5 μg) IL-17A (5 μg) (5 μg) IL-17A (5 μg) (5 μg) IL-17A
Supplementary Figure 7-2. A-D, Total lung expression of IL-13 (Supp. Fig. 7-2, A and B) and IL-17A (Supp. Fig. 7-2, C and D) receptor subunits in A/J mice after intratracheal cytokine treatment. Means + S.E.M.s of 4 to 9 mice per group (pooled over 3 independent experiments) are shown.
60 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Supplementary Figure 7-3
A WT (BALB/c) B IL-13R 2-/- + 5 1.4 ) + ## 2000
ge +++
n 4 +++
) +++ ha
l 1500 ## 1.4 C +++ m 3 /
d ## g l n o 1000 (
F 2 ## ( E
I g I T 1 500 P A 0 0 PBS IL-13 IL-17A IL-13 + PBS IL-13 IL-17A IL-13 + IL-17A IL-17A
Supplementary Figure 7-3. Fold change of APTI data shown in Fig. 7-2, A (Supp. Fig. 7-3, A), and total serum IgE levels (Supp. Fig. 7-3, B) in BALB/c WT or IL-13Rα2-/- mice after intratracheal cytokine treatment. ##P < .01 versus PBS. +P < .05 and +++P < .001. The numbers above the IL-13 plus IL-17A-induced AHR bars indicate the fold difference in AHR between IL-13- and IL-13 plus IL-17A-exposed WT or IL-13Rα2-/- mice. Means + S.E.M.s of 5 to 11 mice per group (pooled over 3 independent experiments) are shown.
61 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Supplementary Figure 7-4
A B )
200 5 600 ##
) ### 7
150 ### ### (x10 400 A (x10
A 100
# mRN 200 mRN 50 C3 0 0 0 5 10 25 50 100 Il13ra2 0 5 10 25 50 100 IL-13 (ng/ml) IL-13 (ng/ml)
Supplementary Figure 7-4. A and B, Real-time PCR analysis of C3 (Supp. Fig. 7-4, A) and Il13ra2 (Supp. Fig. 7-4, B) expression in NIH/3T3 cells stimulated with IL-13 (0-100 ng/mL) for 24 hours. #P < .05, ##P < .01, and ###P < .001 versus medium. Means + S.E.M.s of 4 replicates per condition are shown. Results show 1 of 2 independent experiments.
62 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Supplementary Figure 7-5
A B 200 Medium 400 Medium ) ) 6 6 IL-13 IL-13 150 IL-17A 300 IL-17A IL-13+IL-17A IL-13+IL-17A
100 200 mRNA (x10 mRNA (x10
50 100 Il4ra Il13ra1 0 0 4 8 4 8 12 16 20 24 12 16 20 24 Time (hours) Time (hours) C D 200 150
) Medium Medium ) 6 7 IL-13 IL-13 150 IL-17A IL-17A 100 IL-13+IL-17A IL-13+IL-17A 100 mRNA (x10 mRNA (x10 50 50 Il17ra Il17rc
0 0 4 8 4 8 12 16 20 24 12 16 20 24 Time (hours) Time (hours)
Supplementary Figure 7-5. A-D, Real-time PCR analysis of IL-13 (Supp. Fig. 7-5, A and B) and IL-17A (Supp. Fig. 7-5, C and D) receptor subunits in NIH/3T3 cells stimulated with IL-13, IL-17A, or both over 24 hours. Data are representative of at least 3 experiments. Means + S.E.M.s of 4 replicates per condition are shown. Results show 1 of 3 independent experiments.
63 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Supplementary Figure 7-6
A B C WT (C57Bl/6): Top +++ )
250 Bottom 7 400 +++ 800
+ ### ) 8 ) 8 200 ## ## 300 600 ### 150 200 400 100 # mRNA (x10
100 mRNA (x10 200 mRNA (x10 50 C3 Lcn2 0 Il13ra2 0 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A IL-17A D IL-17RA-/-: E F Top )
250 Bottom 7 400 800 ) 8 ) 8 ## 200 300 # ## 600 150 200 400
100 mRNA (x10 mRNA (x10
mRNA (x10 100 200 50 C3 Lcn2 0 Il13ra2 0 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A IL-17A
Supplementary Figure 7-6. A-F, Real-time PCR analysis of C3 (Supp. Fig. 7-6, A and D), Il13ra2 (Supp. Fig. 7-6, B and E), and Lcn2 (Supp. Fig. 7-6, C and F) expression in cocultured C57BL/6 WT/WT or IL-17RA-/-/IL-17RA-/- lung fibroblasts stimulated with IL-13, IL-17A, or both cytokines for 24 hours. #P < .05, ##P < .01, and ###P < .001 versus medium. +P < .05 and +++P < .001 versus IL-13. Means + S.E.M.s of 3 replicates per condition are shown. Results show 1 of 3 independent experiments.
64 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Supplementary Figure 7-7
A B
125 TNF-α t½=2.3 125 TNF-α t½=3.4 g g n n i TNF- + IL-17A i TNF-α + IL-17A t½=63.3 α t½=107.1 100
100 ain ain m m e e R
75 R 75
A A N N
50 R 50 R m
m
2 3 f n 25 s 25 c L C
% % 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 6 8 10 12 2 4 6 8 10 12 Time after ActD (min) Time after ActD (min)
Supplementary Figure 7-7. A and B, Percentage of mRNA remaining of Csf3 (Supp. Fig. 7-7, A) and Lcn2 (Supp. Fig. 7-7, B) in NIH/3T3 cells stimulated with TNF-α or TNF-α plus IL-17A for 12 hours and incubated with ActD. Real-time PCR analysis of
transcript levels was evaluated over 2 hours, and t1⁄2 was calculated. Means + S.E.M.s of 4 replicates per condition are shown. Results show 1 of 2 indepndent experiments.
65 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Supplementary Figure 7-8
A + B +++ +++
) 800 100 ### 7 Time of ActD addition ###
) Time of ActD addition 600 8 24 hr. after ActD addition 75 24 hr. after ActD addition 400 200 ## 50 ### 100
mRNA (x10 80
mRNA (x10 60 25 40
C3 20 Il13ra2 0 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A
Supplementary Figure 7-8. A and B, Real-time PCR analysis of C3 (Supp. Fig. 7-8, A) and Il13ra2 (Supp. Fig. 7-8, B) expression in NIH/3T3 cells stimulated with IL-13, IL-17A, or both cytokines before and 24 hours after incubation with ActD. ##P < .01 and ###P < .001 versus medium. +P < .05 and +++P < .001 versus IL-13. Means + S.E.M.s of 4 replicates per condition are shown. Results show 1 of 3 independent experiments.
66 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Supplementary Figure 7-9
A 5 min 15 min 30 min 60 min
Unstained Medium IL-17A IL-13 IL-13 + IL-17A
2 3 4 5 2 3 4 5 2 3 4 5 0 10 10 10 10 0 10 10 10 10 0 10 2 10 3 10 4 10 5 0 10 10 10 10 phospho-STAT6
Supplementary Figure 7-9. A, pSTAT6 phosphoflow staining in NIH/3T3 cells stimulated with IL-13, IL-17A, or both over 30 minutes. Means + S.E.M.s of 6 replicates per condition are shown. Results show 1 of 2 independent experiments.
67 Chapter 7 IL-17A Enhances IL-13 Activity by Enhancing IL-13-Induced STAT6 Activation
Supplementary Figure 7-10
A B ) 8
) 150 200 6
## ## (x10 150 (x10
100 A A 100 mRN mRN 50 50
0 0 IL13RA2 0 5 10 25 50 100 0 5 10 25 50 100 SERPINB4 IL-13 (ng/ml) IL-13 (ng/ml)
Supplementary Figure 7-10. A and B, Real-time PCR analysis of IL13RA2 (Supp. Fig. 7-10, A) and SERPINB4 (Supp. Fig. 7-10, B) expression in HBEC3-KT cells stimulated with IL-13 (0-100 ng/mL) for 24 hours. ##P < .01 versus medium. Means + S.E.M.s of 4 replicates per condition are shown.
68 Chapter 8
IL-17A-Mediated Inhibition of SHP-1 Enhances IL-13 Signal
Transduction
69 8.1 Introduction
The Th2 cytokine IL-13 is a central effector molecule in allergic asthma, being both necessary and sufficient to induce several hallmark pathological features of allergic asthma, including eosinophilic airway inflammation, mucus hypersecretion, AHR, and airway remodeling.18-21 The IL-13 receptor (which also serves as the type II IL-4 receptor) is a heterodimer comprised of IL-4Rα and IL-13Rα1.29, 279, 280 As both IL-4 and IL-13 signaling through the IL-4Rα/IL-13Rα1 complex results in activation of a central transcription factor,
STAT6, IL-13 demonstrates considerable functional overlap with IL-4. Global STAT6 deficiency impairs Th2 differentiation, abrogates Th2 cytokine production, and attenuates pulmonary inflammation following allergen challenge, primarily due to defective IL-4 signaling in lymphocytes.27, 118, 119 However, the adoptive transfer of WT Th2 cells into STAT6 deficient mice does not restore antigen-induced pulmonary eosinophilia, AHR, and mucus production to
WT levels,124 suggesting an important role for STAT6 beyond Th2 cell differentiation. In support of this, while global STAT6 deficient mice fail to develop an inflammatory response to i.t. administered IL-13, reconstitution of STAT6 signaling in pulmonary epithelial cells or smooth muscle cells is sufficient to restore the pathologic effects of i.t. IL-13 administration.125,
128 Taken together, these studies suggest a divergent role for the IL-13/STAT6 axis between immune cells and pulmonary structural cells; however, the totality of the regulatory mechanisms that influence IL-13 signaling in airway structural cells remain poorly understood.
When IL-13 or IL-4 bind to the type II IL-4 receptor, the IL-13Rα1 and IL-4Rα subunits are phosphorylated by constitutively associated kinases JAK1 and TYK2, forming a docking site for monomeric STAT6.29, 279, 280 The activation of STAT6 is subsequently dependent on
JAK1/TYK2-mediated phosphorylation of Tyr641, which promotes STAT6 homodimerization,
70 nuclear translocation, and transcription of IL-13-responsive genes.29, 165, 279, 280 Conversely, an
ITIM in IL-4Rα serves as a docking site for phosphatases that negatively regulate STAT6 activation, including SHP-1, SHP-2, and SHIP1.197, 202 Reduction in SHP-1 tyrosine phosphatase activity has been shown to exacerbate airway pathology in both spontaneous199-201 and allergen- driven197, 198 models of airway inflammation – effects which were presumed to be largely due to enhanced Th2 differentiation observed in the context of amplified IL-4 signaling in lymphocytes.
However, a recent study has shown that SHP-1 deficiency disproportionately enhances IL-13 signaling via the type II receptor relative to activation of the type I receptor by IL-4,197 suggesting that a previously underappreciated boost in IL-13 signaling may contribute to lung pathology in these models. Moreover, even though the influence of SHP-1 inhibition on IL-13 or
IL-4 signaling is comparatively modest (~20-50% increase), the effects on airway pathology are clear,197, 198, 201 suggesting that subtle changes in IL-13 or IL-4 signal transduction are capable of driving profound airway pathology.
Aberrant production of the Th17 cytokine IL-17A is a key determinant of more severe inflammation and airway dysfunction in asthma.34-36, 60 However, the molecular changes underlying severe asthma pathogenesis are incompletely understood. Underscoring the importance of this observation, we have recently demonstrated that intratracheal exposure to IL-
13 and the Th17 cytokine IL-17A exacerbates IL-13-driven STAT6 phosphorylation concomitant with enhanced airway inflammation, AHR, and mucus production.281 However, while these data suggest that IL-17A contributes to asthma pathogenesis by enhancing IL-13-dependent phosphorylation of STAT6, the mechanisms by which IL-17A influences STAT6 activation are unknown. Although the proximal mediators underlying the activation and regulation of STAT6 have been extensively catalogued, they have not previously been explored in the context of co-
71 stimulation with IL-17A, which activates a TRAF6-dependent signaling pathway distinct from
IL-13. Hence the aim of the present study was to determine the mechanisms whereby IL-17A enhances the activation of STAT6 using a combination of molecular approaches.
8.2 Results
8.2.1 TRAF6 and TRAF3 are not Required for IL-17A-Mediated
Enhancement of IL-13-Induced STAT6 Phosphorylation
To begin to delineate the mechanisms whereby IL-17A enhances IL-13-induced STAT6 activation, we first examined the importance of canonical IL-17A signaling pathways. The E3 ubiquitin ligase TRAF6 is a key adaptor in IL-17A signal transduction, allowing the activation of
NF-κB, MAPK, and C/EBPβ following binding of IL-17A to the IL-17 receptor complex.207 To evaluate whether IL-17A-mediated enhancement of IL-13 activity required TRAF6, we assessed the capacity of IL-17A to enhance IL-13-induced STAT6 phosphorylation in cytokine-stimulated
CD11c+ spleen cells from Vav1-Cre+Traf6+/+ and Vav1-Cre+Traf6Flox/Flox mice. In Vav1-
Cre+Traf6+/+ CD11c+ cells, stimulation with IL-13 induced pSTAT6, while treatment with IL-
17A did not. Consistent with our observations in pulmonary structural cells,281 co-treatment with both IL-13 and IL-17A enhanced IL-13-induced pSTAT6 (Fig. 8-1, A), confirming that IL-17A enhances IL-13-induced STAT6 activation in hematopoietic cells in addition to non- hematopoietic cells. Similarly, IL-13- but not IL-17A-stimulated CD11c+ cells from Vav1-
Cre+Traf6Flox/Flox demonstrated accumulation of activated pSTAT6. Stimulation with IL-13 and
IL-17A further increased pSTAT6 levels in Vav1-Cre+Traf6Flox/Flox CD11c+ cells (Fig. 8-1, A).
IL-17A enhanced IL-13-induced STAT6 phosphorylation comparably in TRAF6 sufficient and
72 deficient cells (~1.9-fold) (Fig. 8-1, B), suggesting that IL-17A is able to enhance STAT6 phosphorylation independently of signaling events activated downstream of TRAF6.
TRAF3 constitutively associates with the IL-13Rα1 chain of the IL-13 receptor via the adapter protein MIP-T3, where it inhibits the tyrosine phosphorylation and transcriptional activity of STAT6.282 However, TRAF3 can also be recruited to the IL-17 receptor complex upon stimulation with IL-17A where it displaces TRAF6 from the IL-17 receptor complex, acting as a negative regulator of IL-17A signaling.248 This suggests the possibility that IL-17A may augment IL-13 signal transduction by recruiting TRAF3 away from the IL-13 receptor complex, thereby removing a brake on IL-13 signaling. To test this hypothesis, we stimulated
BMDCs from Cd11c-Cre-Traf3Flox/Flox or Cd11c-Cre+Traf3Flox/Flox mice with medium alone, IL-
13, IL-17A, or IL-13 + IL-17A and assessed pSTAT6 by Western blotting. In Cd11c-Cre-
Traf3Flox/Flox CD11c+ BMDCs, stimulation with IL-13 induced pSTAT6, while treatment with IL-
17A did not (Fig. 8-1, C). As expected, treatment with both IL-13 and IL-17A resulted in greater levels of STAT6 activation compared to either cytokine alone (Fig. 8-1, C). Notably, we observed a tendency towards increased levels of pSTAT6 in IL-13-treated Cd11c-
Cre+Traf3Flox/Flox BMDCs compared to Cd11c-Cre-Traf3Flox/Flox BMDCs (Fig. 8-1, D), implying that interactions between TRAF3 and the IL-13 receptor might influence the magnitude of IL-13 signaling. However, the deletion of TRAF3 did not limit the ability of IL-17A to enhance IL-13- driven pSTAT6, as IL-13-induced pSTAT6 levels were comparably increased (~1.6-fold) in IL-
13 + IL-17A treated Cd11c-Cre- and Cd11c-Cre+Traf3Flox/Flox CD11c+ cells (Fig. 8-1, D).
Collectively, these findings suggest that IL-17A-mediated enhancement of IL-13-driven STAT6 signaling occurs independently of TRAF6 and TRAF3.
73 8.2.2 Treatment with IL-13 and IL-17A Augments Tyrosine Kinase Activity
Upstream of STAT6
To determine whether IL-17A mediated enhancement of IL-13 signaling was specific for
STAT6, or whether IL-17A might also influence upstream kinase activity, we assessed the ability of IL-17A to enhance IL-13-induced JAK1/TYK2 activity. NIH/3T3 cells, which we have previously used to assess IL-13 and IL-17A signaling,281 were stimulated with medium, IL-17A,
IL-13, or IL-13 + IL-17A for 2 minutes, and lysates were collected. TYK2 was immunoprecipitated with anti-TYK2, the precipitated protein was separated on a gel, and immunoblotted for phospho-tyrosine (pTyr) and total TYK2 (Fig. 8-2, A). Consistent with the literature,279 we found that treatment with IL-13 induced the phosphorylation of TYK2. While
IL-17A did not induce measurable TYK2 phosphorylation, TYK2 demonstrated greater levels of phosphorylation in cells stimulated with IL-13 + IL-17A (Fig. 8-2, A). IL-17A-mediated enhancement of IL-13-induced TYK2 phosphorylation was not a result of increased expression, as total TYK2 levels were not altered by cytokine treatment in the input (Fig. 8-2, B, upper).
Further, TYK2 expression was markedly reduced in the post-immunoprecipitation supernatant
(Fig. 8-2, B, lower), confirming the efficiency of the procedure. Similar results were observed for the IL-4Rα-associated kinase JAK1 (Supp. Fig. 8-1), suggesting that IL-17A signaling has broad influences on intracellular kinases that are responsible for regulating the activity of STAT6 downstream of IL-13.
8.2.3 Co-Stimulation with IL-13 and IL-17A Inhibits the Phosphorylation of
SHP-1 and SHP-2
74
Protein-tyrosine phosphatases play an important role in the negative regulation of JAK phosphorylation following activation of the type II IL-4 receptor.197, 202 As we observe IL-17A- mediated enhancement of pSTAT6 and upstream kinases TYK2 and JAK1, it is possible that IL-
17A-mediated enhancement of IL-13-induced TYK2/JAK1/STAT6 signaling may result from a reciprocal decrease in tyrosine phosphatase activity induced by IL-17A. To broadly test the role of intracellular phosphatases in the regulation of IL-13-induced signaling, we stimulated
NIH/3T3 cells for 5 minutes with IL-13 alone, or IL-13 in the presence of the general tyrosine phosphatase inhibitor, Na3VO4. As expected, stimulation with IL-13 induced pSTAT6 (Fig. 8-3,
A and B). The addition of Na3VO4 by itself did not induce pSTAT6, but co-incubation with IL-
13 + Na3VO4 increased IL-13-driven STAT6 activation by approximately ~1.5-fold (Fig. 8-3, A and B), a level of synergy comparable to that observed between IL-13 and IL-17A in CD11c+ cells (Fig. 8-1, A-D) and in NIH/3T3 cells (Fig. 8-3, C and D). This suggests that global inhibition of tyrosine phosphatases is sufficient to recapitulate the effect of IL-17A on IL-13 signaling.
Because the protein-tyrosine phosphatases SHP-1 and SHP-2 can directly modulate IL-
4/IL-13 signaling,197, 202-204 we examined the effect of IL-13 and IL-17A on SHP-1/2 activation.
To this end, NIH/3T3 cells were stimulated with medium, IL-13, IL-17A, or IL-13 + IL-17A for
2 minutes, and accumulation of phosphorylated SHP-1 (pSHP-1, Tyr564) and SHP-2 (pSHP-2,
Tyr542, Tyr580) was assessed by Western blot. Consistent with the literature,283 we found that total SHP-2 expression was higher than SHP-1 in non-hematopoietic NIH/3T3 cells. Following stimulation with either IL-13 or IL-17A alone, we observed increases in pSHP-1 and pSHP-2
(Fig. 8-3, E and F), suggesting that both phosphatases can be activated in non-hematopoietic cells. Conversely, in lysates from IL-13 + IL-17A stimulated NIH/3T3 cells, we detected
75 decreased levels of pSHP-1 and pSHP-2 similar to those observed in unstimulated cells (Fig. 8-3,
E and F), which is indicative of impaired activation and suggests that IL-17A may enhance IL-
13-induced pSTAT6 by limiting the ability of SHP-1 and/or SHP-2 to dephosphorylate STAT6.
8.2.4 SHP-1 is Required for IL-17A-Mediated Enhancement of STAT6
Phosphorylation
We next asked whether disrupting protein-tyrosine phosphatase function within the context of IL-13 and IL-17A stimulation would be sufficient to abrogate the enhancement of IL-
13-driven activity. To this end, NIH/3T3 cells were pretreated with vehicle (DMSO) or Na3VO4 for 3 hours to globally prevent the activation of endogenous tyrosine phosphatases. Cells were subsequently stimulated with medium, IL-13, IL-17A, or IL-13 + IL-17A for 2 minutes and
STAT6 activation was assessed by Western blot. As expected, Na3VO4 had no effect on STAT6 activation in unstimulated cells, or those stimulated with IL-17A alone, relative to DMSO treatment (Fig. 8-4, A and B). While DMSO treated cells displayed IL-13-induced pSTAT6, pretreatment with Na3VO4 further enhanced this, confirming our previous observations that intracellular tyrosine phosphatases limit IL-13-induced STAT6 activation (Fig. 8-4, A and B).
Interestingly, while IL-17A enhanced IL-13-induced STAT6 phosphorylation in DMSO treated cells, pretreatment with Na3VO4 completely abrogated the ability of IL-17A to further enhance
STAT6 activation (Fig. 8-4, B). This suggests that the ability of IL-17A to increase IL-13- induced STAT6 activation is driven by changes in protein-tyrosine phosphatase activity.
Subsequently, to investigate the functional consequences of specifically impairing SHP-1 and/or SHP-2 recruitment to IL-4Rα, we utilized mice genetically engineered to express a mutant IL-4Rα chain which lacks the ITIM domain required for recruitment of SHP-1 and SHP-
76 2 to the type II IL-4 receptor (IL-4RαF709).197 Primary pulmonary fibroblasts were isolated from WT (BALB/c) and IL-4RαF709 mice, and stimulated with medium, IL-13, IL-17A, or both cytokines. pSTAT6 levels were evaluated by Western blotting. As previously reported, compared to IL-13-stimulated cultures from WT mice, greater levels of pSTAT6 were observed in IL-13- treated IL-4RαF709 fibroblasts (Fig. 8-4, C). Treatment with IL-17A by itself, in turn, did not induce pSTAT6. However, while IL-17A augmented IL-13-induced pSTAT6 in wild-type pulmonary fibroblasts, IL-17A had no effect on IL-13-dependent STAT6 activation in cells expressing the IL-4RαF709 construct (Fig. 8-4, C).
To evaluate the relative importance of SHP-1 versus SHP-2 in IL-17A-mediated enhancement of IL-13-induced STAT6 activation, NIH/3T3 cells were pretreated with a panel of inhibitors against both SHP-1 and SHP-2 (NSC-87877, 0.71 µM), SHP-1 alone (PTP Inhibitor II,
256 µM), or SHP-2 (PHPS1, 1.46 µM) alone. Consistent with the data from IL-4RαF709 mice, simultaneous inhibition of both SHP-1 and SHP-2 abrogated the ability of IL-17A to elevate IL-
13-driven STAT6 activation (Fig 8-4, D). In contrast, pretreatment of NIH/3T3 cells with inhibitors specific for SHP-2 did not affect the ability of IL-17A to enhance IL-13-driven STAT6 activation (Fig. 8-4, E). However, similar to our observations with Na3VO4, and in the IL-
4RαF709 mice, we found that the inhibition of SHP-1 alone was sufficient to abrogate the ability of IL-17A to synergize with IL-13 (Fig. 8-5, F). Thus, the effect of IL-17A on IL-13-driven pathology can be abrogated by specific inhibition of SHP-1 activity.
8.2.5 IL-17A does not Enhance STAT3 or STAT1 Phosphorylation
Activation of JAK activity is crucial for activation of many STAT molecules, in response
77 to different cytokine receptor pairs.284, 285 As such, we next wished to evaluate if the ability of IL-
17A to regulate intracellular phosphatase activity represented a broadly felt influence on
JAK/STAT signal transduction. As IL-17A has previously been shown to synergize with IL-6 and IFN-γ,253, 254 we tested the ability of IL-17A to enhance IL-6-induced activation of STAT3 or
IFN-γ-induced activation of STAT1. NIH/3T3 cells were incubated with IL-6 or IFN-γ, either alone or in combination with IL-17A, and phosphorylation of STAT3 (pSTAT3, Tyr705) (Fig. 8-
5, A and B) and STAT1 (pSTAT1, Tyr701) (Fig. 8-5, C and D) was evaluated by means of
Western blotting. Stimulation with IL-6 or IFN-γ induced pSTAT3 or pSTAT1 respectively, while treatment with IL-17A by itself did not. However, in contrast to the effect of IL-17A on
IL-13-driven pSTAT6, we found that IL-6- and IFN-γ-dependent activation of STAT3 and
STAT1 were not further enhanced by IL-17A. These data suggest that IL-17A-induced changes in SHP-1 activity may selectively augment IL-13-dependent STAT6 signaling. Collectively, these results provide a mechanistic basis for understanding the ability of IL-17A to enhance IL-
13-driven signal transduction and the resultant lung pathology.
78 Chapter 8 IL-17A-Mediated Inhibition of SHP-1 Enhances IL-13 Signal Transduction
Figure 8-1
A B Vav1-Cre+Traf6+/+ Vav1-Cre+Traf6Flox/Flox 4 + +/+ IL-13 + IL-13 + Vav1-Cre Traf6 Med. IL-13 IL-17A IL-17A Med. IL-13 IL-17A IL-17A + Flox/Flox Vav1-Cre Traf6 *
T6 3 ##
pSTAT6 A
T ### STAT6 2 T6/S A
T # 1
TRAF6 pS
0 αTubulin Medium IL-13 IL-17A IL-13 + IL-17A C D Cd11c-Cre-Traf3Flox/Flox Cd11c-Cre+Traf3Flox/Flox 6 # Cd11c-Cre-Traf3Flox/Flox IL-13 + IL-13 + Cd11c-Cre+Traf3Flox/Flox Med. IL-13 IL-17A IL-17A Med. IL-13 IL-17A IL-17A T6
A 4
pSTAT6 T
STAT6 T6/S A 2 T
TRAF3 pS 0 Tubulin Medium IL-13 IL-17A IL-13 + α IL-17A
Figure 8-1. TRAF6 and TRAF3 are not required for IL-17A-mediated enhancement of IL-13- induced STAT6 phosphorylation. A-B, pSTAT6/STAT6 and TRAF6/αTubulin levels (Fig. 8-1, A) and associated densito- metric values (Fig. 8-1, B) in Vav1-Cre+Traf6+/+ and Vav1-Cre+Traf6Flox/Flox CD11c+ spleen cells stimulated with cytokines for 15 minutes. C-D, pSTAT6/STAT6 and TRAF3/αTubulin levels (Fig. 8-1, C) and associated densitometric values (Fig. 8-1, D) in Cd11c-Cre- Traf3Flox/Flox and Cd11c-Cre+Traf3Flox/Flox CD11c+ BMDCs stimulated with cytokines for 5 minutes. # P < 0.05, ## P < 0.01, and ### P < 0.001 versus Medium. * P < 0.05. Immunoblots are representative of 3 independent experiments.
79 Chapter 8 IL-17A-Mediated Inhibition of SHP-1 Enhances IL-13 Signal Transduction
Figure 8-2
A B IP: anti-TYK2 IL-13 + Med. IL-17A IL-13 IL-17A IP: anti-TYK2 IL-13 + TYK2 Med. IL-17A IL-13 IL-17A 5% Input IB: pTyr αTubulin IP TYK2 TYK2 5% Sup. αTubulin
Figure 8-2. Treatment with IL-13 and IL-17A enhances TYK2 phosphorylation. A-B, pTyr/TYK2 levels detected in the anti-TYK2 immunoprecipitants (Fig. 8-2, A), and TYK2/αTubulin levels detected in the immunoprecipitation input (Fig. 8-2, B, upper) and supernatant (Fig. 8-2, B, lower) of NIH/3T3 cells stimulated with cytokines for 2 minutes. Immunoblots are represen- tative of 3 independent experiments.
80 Chapter 8 IL-17A-Mediated Inhibition of SHP-1 Enhances IL-13 Signal Transduction
Figure 8-3
A B
1.5
IL-13 + 6 T ### Med. IL-13 Na 3VO 4 Na 3VO 4 A
T 1.0 S / # pSTAT6 6 T
A 0.5 T S
STAT6 p 0.0 Medium IL-13 Na 3VO4 IL-13 + Na VO C D 3 4 0.6 * ### IL-13 + 6 T Med. IL-13 IL-17A IL-17A A
T 0.4 S pSTAT6 / 6 T
A 0.2 # T
STAT6 S p
0.0 Medium IL-13 IL-17A IL-13 + IL-17A E F 4 2.5 1 2 - - P IL-13 + P 2.0 3 H H S S /
Med. IL-13 IL-17A IL-17A / 1.5 2 pSHP-1 (564) 1.0 -1 (564) -2 (580) P FoldChange P FoldChange
H 1 H 0.5 S S p p SHP-1 0 0.0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A 4
pSHP-2 (542) 2 - P 3 H S / pSHP-2 (580) 2 -2 (542) P FoldChange 1 H S SHP-2 p 0 Medium IL-13 IL-17A IL-13 + IL-17A
Figure 8-3. Co-stimulation with IL-13 and IL-17A inhibits the phosphorylation of SHP-1 and SHP-2. A-B, pSTAT6/STAT6 levels (Fig. 8-3, A) and associated densitometric values (Fig. 8-3, B) in NIH/3T3 cells stimulated with
IL-13, Na3VO4, or both for 5 minutes. C-D, pSTAT6/STAT6 levels (Fig. 8-3, C) and associated densitometric values (Fig. 8-3, D) in NIH/3T3 cells stimulated with cytokines for 2 minutes. E-F, pSHP-1/SHP-1 and pSHP-2/SHP-2 levels (Fig. 8-3, E) and associated densitometric values (Fig. 8-3, F) in NIH/3T3 cells stimulated with cytokines for 2 minutes. # P < 0.05 and ### P < 0.001 versus Medium. * P < 0.05. Immunoblots are representative of 3 independent experiments.
81 Chapter 8 IL-17A-Mediated Inhibition of SHP-1 Enhances IL-13 Signal Transduction
Figure 8-4
A B
DMSO Na 3VO4 IL-13 + IL-13 + Med. IL-13 IL-17A IL-17A Med. IL-13 IL-17A IL-17A pSTAT6 pSTAT6
STAT6 STAT6
C BALB/c IL-4RαF709 IL-13 + IL-13 + Med. IL-13 IL-17A IL-17A Med. IL-13 IL-17A IL-17A pSTAT6
STAT6
D E F NSC-87877 PHPS1 PTP Inhibitor II
IL-13 + IL-13 + IL-13 + Med. IL-13 IL-17A IL-17A Med. IL-13 IL-17A IL-17A Med. IL-13 IL-17A IL-17A pSTAT6 pSTAT6 pSTAT6
STAT6 STAT6 STAT6
Figure 8-4. SHP-1 is required for IL-17A-mediated enhancement of STAT6 phosphorylation. A-B,
pSTAT6/STAT6 levels in NIH/3T3 cells pretreated with dimethyl sulfoxide (DMSO; Fig. 8-4, A) or Na3VO4 (Fig. 8-4, B) and then stimulated with cytokines for 2 minutes. C, pSTAT6/STAT6 levels in BALB/c wild-type and IL-4RαF709 lung fibroblasts (Fig. 8-4, C) stimulated with cytokines for 5 minutes. D-F, pSTAT6/STAT6 levels in NIH/3T3 cells pretreated with NSC-87877 (Fig. 8-4, D), PHPS1 (Fig. 8-4, E), or PTP Inhibitor II (Fig. 8-4, F), and then stimulated with cytokines for 2 minutes. Immunoblots are representative of 2 independent experiments.
82 Chapter 8 IL-17A-Mediated Inhibition of SHP-1 Enhances IL-13 Signal Transduction
Figure 8-5
A B 1.5 IL-6 +
Med. IL-6 IL-17A IL-17A 3 T
A 1.0 T S pSTAT3 / 3 T A
T 0.5 S STAT3 p
0.0 Medium IL-6 IL-17A IL-6 + IL-17A
C D 2.0 IFN-γ + Med. IFN-γ IL-17A IL-17A 1 1.5 T A T S
pSTAT1 /
1 1.0 T A T S STAT1 p 0.5
0.0 Medium IFN-γ IL-17A IFN-γ + IL-17A
Figure 8-5. IL-17A does not enhance STAT3 or STAT1 phosphorylation. A-B, pSTAT3/STAT3 levels (Fig. 8-5, A) and associated densitometric values (Fig. 8-5, B) in NIH/3T3 cells stimulated with cytokines for 5 minutes. C-D, pSTAT1/STAT1 levels (Fig. 8-5, C) and associated densitometric values (Fig. 8-5, D) in NIH/3T3 cells stimulated with cytokines for 5 minutes. Immunoblots are representative of 2 independent experiments.
83 Chapter 8 IL-17A-Mediated Inhibition of SHP-1 Enhances IL-13 Signal Transduction
Supplementary Figure 8-1
A B IP: anti-JAK1 IL-13 + Med. IL-13 IL-17A IL-17A IP: anti-JAK1 IL-13 + JAK1 Med. IL-13 IL-17A IL-17A 5% Input IB: pJAK1 αTubulin IP JAK1 JAK1 5% Sup. αTubulin
Supplementary Figure 8-1. Treatment with IL-13 and IL-17A enhances JAK1 phosphorylation. A-B, pJAK1/JAK1 levels detected in the anti-JAK1 immunoprecipitants (Supp. Fig. 8-1, A) and JAK1/αTubulin levels detected in the immunoprecipitation input (Supp. Fig. 8-1, B, upper) and supernatant (Supp. Fig. 8-1, B, lower) of NIH/3T3 cells stimulated with cytok- ines for 2 minutes. Immunoblots are representative of 3 independent experiments.
84 Chapter 9
Identification of Transcriptional Regulators Controlling IL-17A-
Mediated Enhancement of IL-13 Activity
85 9.1 Introduction
In Chapter 7 we showed that IL-17A enhances IL-13-induced pSTAT6, leading to the exacerbation of IL-13-dependent lung pathology. In Chapter 8 we demonstrated that the capacity of IL-17A to augment pSTAT6 is dependent on recruitment of the protein-tyrosine phosphatase
SHP-1 to the IL-13 receptor, providing a mechanistic underpinning for enhanced
TYK2/JAK1/STAT6 signal transduction. In addition, we have shown that IL-17A acts directly on IL-13-responsive cells to increase STAT6-driven transcription of multiple IL-13-induced genes (Chapter 7); however, details regarding the contribution of IL-17A-induced intermediates to the transcriptional changes driven by IL-13 and IL-17A have not been previously explored.
IL-17A activates a number of downstream pathways contemporaneous with the activation of STAT6 by IL-13, including NF-κB, C/EBPδ, C/EBPβ, and MAPK.207, 208 As STAT6-driven gene expression can be enhanced by coordinated interactions with C/EBPβ,179-181 NF-κB/Rel,173,
182, 183 and AP-1,186 it is plausible that IL-17A-induced factors may cooperate with STAT6 to further promote gene expression following co-treatment with IL-13 and IL-17A. Subsequently, for the following studies we used a combination of chemical inhibitors and genetic approaches to block individual components of IL-17A signaling, with the goal of further clarifying the mechanisms underlying transcriptional regulation of enhanced IL-13-induced genes. As a result, we have identified several novel regulators of IL-13-driven gene expression. This work fills major gaps in our understanding of the regulation and interaction between Th2- and Th17-driven molecular pathways in severe asthma.
9.2 Results
86 9.2.1 TRAF6 does not Contribute to the Enhancement of pSTAT6, but is
Required for IL-13/IL-17A Transcriptional Synergy
TRAF6 is a crucial upstream component in the initiation of IL-17A-dependent activation of NF-κB, C/EBP, and MAPK signaling.286 Thus, to explore the contribution of IL-17A-induced signaling pathways to transcriptional synergy, we cultured CD11c+ spleen cells from Vav1-
Cre+Traf6+/+ or Vav1-Cre+Traf6Flox/Flox mice in medium containing IL-13, IL-17A, or IL-13 + IL-
17A and assessed the expression of IL-13-induced (C3, Arg1) and IL-17A-induced (Lcn2) genes
(Fig. 9-1, A-C). In Vav1-Cre+Traf6+/+ cells treatment with IL-13 induced the expression of C3 and Arg1, and expression of both was further augmented by IL-17A (Fig. 9-1, A and B). In contrast, although IL-13-induced expression of C3 or Arg1 was not diminished in the Vav1-
Cre+Traf6Flox/Flox cells, synergy was abrogated as co-treatment with IL-13 + IL-17A did not enhance gene expression. IL-17A-mediated induction of C3 expression was abrogated in cells from Vav1-Cre+Traf6Flox/Flox mice (Fig. 9-1, A). Similarly, although Lcn2 levels were elevated at baseline in Vav1-Cre+Traf6Flox/Flox cells relative to WT cells, IL-17A-induced expression of Lcn2 was abrogated in TRAF6 deficient cells, confirming their insensitivity to IL-17A (Fig. 9-1, C).
As we have previously shown that IL-17A enhances IL-13-induced STAT6 phosphorylation comparably between TRAF6 sufficient and deficient cells (Chapter 8), it is not likely that the abrogation of transcriptional synergy in Vav1-Cre+Traf6Flox/Flox cells is due to decreased STAT6 activation. Rather, the implications of these results are two-fold: 1) they imply that IL-17A- mediated enhancement of STAT6 phosphorylation is necessary, but not sufficient, to drive increased transcriptional activity in response to IL-13 and IL-17A, and 2) they suggest that IL-
17A-induced factors activated downstream of TRAF6 cooperate with STAT6 to enhance IL-13- driven gene expression.
87 9.2.2 5’-Upstream Elements Mediate Enhanced Arg1 and C3 Promoter
Activity by IL-13 and IL-17A
IL-17A signaling is primarily mediated through TRAF6-dependent activation of NF-κB,
C/EBPβ, C/EBPδ, and MAPK.207, 208 Not surprisingly, NF-κB and C/EBP binding sites are statistically overrepresented in the promoters of IL-17A-driven genes;242-244 however, these binding sites are also abundant in the promoters of many IL-13-induced genes, and NF-κB and
C/EBP transcription factors have previously been shown to cooperate with STAT6 in response to co-stimulation with IL-4 and CD40L.173, 179-183 To identify IL-17A-induced transcription factors involved in IL-13/IL-17A synergy, we investigated the promoter regions of genes which show strong synergistic expression when stimulated with IL-13 + IL-17A - to this end, the 5’ regions immediately upstream of Arg1 and C3 were chosen for further analysis. Synergistic interactions between C/EBPβ and STAT6 binding sites in an enhancer region 4 kilobases upstream of the
Arg1 transcription start site have been described previously (Fig. 9-2, A),272 while a 3 kilobase segment of the C3 promoter was chosen because in silico analysis indicated the presence of several putative binding sites for STAT6, NF-κB, and C/EBP transcription factors within DNase
I hypersensitive sites (Fig. 9-2, B).
To directly evaluate the effect of IL-13 and IL-17A co-stimulation on promoter activity, cells were transfected with luciferase reporter plasmids containing serial truncations of either the
Arg1 or C3 promoter regions, respectively, prior to cytokine stimulation. RAW 264.7 cells were chosen for analysis of the Arg1 promoter, as Arg1 is highly expressed in macrophages.272 C3 promoter activity, in turn, was assessed in NIH/3T3 cells, in which we have previously shown that co-stimulation with IL-13 and IL-17A strongly enhances C3 expression.281 A Renilla
88 luciferase construct driven by the thymidine kinase promoter served as an internal transfection control. Transfection of RAW 264.7 cells with a 2 kilobase fragment of the Arg1 promoter had little effect on cytokine-driven promoter activity relative to cells transfected with empty vector, while transfection with a 4 kiloboase fragment (which contains validated STAT6 and C/EBP binding sites) demonstrated increased promoter activity specifically in response to IL-13 (Fig. 9-
2, C). Although IL-17A alone did not influence Arg1 promoter activity in either the 2 or 4 kilobase fragments, activation of the 4 kilobase fragment was significantly increased following treatment with both cytokines (Fig. 9-2, C).
The C3 promoter region, in turn, contains a more complex mix of putative STAT6,
C/EBP and NF-κB binding sites (Fig. 9-2, B). Thus, several fragments of the C3 promoter ≥416 base pairs were responsive to cytokine stimulation in NIH/3T3 cells (Fig. 9-2, D). However, only the 3 kilobase fragment demonstrated synergistically enhanced promoter activity in response to
IL-13 + IL-17A. This suggests that a cluster of transcription factor binding sites in the distal 5’ portion of the promoter might be important for transcriptional cooperation between IL-13 and
IL-17A. However, C3 promoter activity was largely driven by IL-17A rather than IL-13, suggesting that additional mechanisms may be involved in the regulation of C3 expression. For example, this may be a reflection of the cell type and/or gene chosen for study, as the IL-17A receptor is highly enriched on fibroblasts and acute-phase proteins such as C3 are strongly induced by IL-17A.207, 208 Nonetheless, these data support our hypothesis that IL-17A-driven transcription factors may be cooperating with STAT6 to enhance IL-13-induced gene expression, ultimately leading to increased IL-13-dependent lung pathology.
89 9.2.3 Inhibition of C/EBP Transcription Factors Attenuates Transcriptional
Cooperation Between IL-13 and IL-17A
Mutation of the C/EBP binding site in the Arg1 promoter has previously been shown to abrogate synergy between IL-13 and IL-10.272 To similarly evaluate the contribution of C/EBP transcription factors in the C3 promoter, we used PCR-based site-directed mutagenesis to introduce a 4 base pair mutation into one C/EBP binding site in the 3 kilobase C3 promoter construct (Fig. 9-3, A). This site was chosen due to its proximity to a STAT6 binding site, as well as its appearance across all of the predictive algorithms we employed to compile transcription factor binding sites. Consistent with our previous observations, in NIH/3T3 cells transfected with the WT C3 promoter, promoter activity was largely driven by IL-17A and activation was significantly enhanced in the presence of both cytokines (Fig. 9-3, B). In contrast, in cells transfected with the mutant C3 promoter construct (C/EBP mutant), IL-17A-dependent promoter activity was significantly reduced and the synergistic enhancement of promoter activity was blocked (Fig. 9-3, B).
Promoter assays may not perfectly recapitulate the regulation of endogenous genes. Thus, as an alternative approach to test the role of C/EBP family members, ΝΙΗ/3Τ3 cells were transfected with a dominant negative C/EBP expression vector (A-C/EBP) prior to cytokine treatment. Initial dose-finding experiments revealed marked inhibition of the IL-17A-responsive gene Lcn2 in cells transfected with 100 ng of A-C/EBP (Supp. Fig. 9-1, A). Similar to our observations in the luciferase reporter model, the absence of C/EBP transcription factors abrogated IL-17A-mediated enhancement of IL-13-driven C3 expression in cells treated with IL-
13 + IL-17A (Fig. 9-3, C). In contrast, the expression of Il13ra2 was partially attenuated in A-
C/EBP-transfected cells following treatment with both cytokines (Fig. 9-3, D), suggesting that
90 the transcription of IL-13-induced genes may have differential dependencies on C/EBP transcription factors, which may only be partial in some cases. Taken together, these results imply that additional IL-17A-induced factors, such as NF-κB, may be acting in parallel with
C/EBPβ and C/EBPδ to increase STAT6 transcriptional activity.
9.2.4 NF-κB also Contributes to Transcriptional Cooperation Between IL-13
and IL-17A
To evaluate the contribution of NF-κB to the enhancement of IL-13 responsive genes, we cultured NIH/3T3 cells in medium containing DMSO or an NF-κB inhibitor (CAY10512) prior to stimulation with IL-13, IL-17A, or both cytokines. A dose titration was performed to determine the optimal concentration of CAY10512 (Supp. Fig. 9-2, A), and 10 µM was chosen for further study, as it was the lowest concentration to abrogate IL-17A-dependent NF-κB activity. Subsequently, in DMSO treated cells stimulation with IL-13 induced the expression of both C3 and Il13ra2, and expression was augmented by IL-17A (Fig. 9-4, A and B).
Pretreatment with CAY10512 did not limit IL-13-induced expression of C3 and Il13ra2 (Fig. 9-
4, A and B), implying that IL-13 signaling does not require activation of NF-κB. However, IL-
17A-mediated enhancement of C3 and Il13ra2 was significantly, although incompletely, diminished in the absence of NF-κB. Taken together, these results suggest that both NF-κB and
C/EBP transcription factors contribute to IL-17A-mediated enhancement of IL-13-induced gene expression.
91 9.2.5 Erk MAPK Upregulates Gene Expression but not IL-13/IL-17A
Synergy
IL-17A is a comparatively weak activator of NF-κB relative to other pro-inflammatory stimuli such as TNF-α (Supp. Fig. 9-3, A), suggesting that the activation of additional pathways may contribute to the magnitude of transcriptional enhancement. IL-17A activates Erk, p38, and
JNK MAPK, but Erk is considered the most rapidly and strongly activated.207, 208 Thus, to evaluate the contribution of Erk MAPK to transcriptional synergy between IL-13 and IL-17A,
NIH/3T3 cells were incubated in medium containing DMSO or an Erk inhibitor (U0126, 10 µM) prior to treatment with IL-13, IL-17A, or both cytokines. Erk was constitutively phosphorylated in unstimulated DMSO treated cells, and phosphorylation was modestly increased in the presence of IL-13 and IL-17A (Fig. 9-5, A). In contrast, in NIH/3T3 cells treated with U0126
Erk phosphorylation was markedly diminished (Fig. 9-5, B), suggesting that the inhibitor blocked Erk signaling. Given the constitutive activation of Erk observed in unstimulated cells,
C3 and Il13ra2 transcript levels were substantially reduced in U0126-treated cells across all treatment relative to DMSO controls (Supp. Fig. 9-4, A and B), making direct comparison of synergy between DMSO and inhibitor-treated samples difficult. Thus, to better assess IL-13/IL-
17A synergy in the presence and absence of Erk activation, the data were normalized by calculating the fold change in gene expression relative to unstimulated cells (Fig. 9-5, C and D).
After such normalization, it was clear that while IL-13 induced the expression of both C3 and
Il13ra2, stimulation with IL-13 + IL-17A enhanced expression to a similar extent in DMSO and
U0126 treated cells (Fig. 9-5, C and D). Collectively, these results suggest that Erk MAPK influences the overall scale of IL-13-induced gene expression but is not required for transcriptional synergy between IL-13 and IL-17A.
92
9.2.6 p38 MAPK is Required for Transcriptional Synergy Between IL-13
and IL-17A
JNK MAPK was not strongly induced by IL-17A in NIH/3T3 cells (data not shown) and therefore was not selected for further study. However, stimulation with IL-17A by itself or in the presence of IL-13 induced p38 phosphorylation (Fig. 9-6, A), which was blocked by pretreatment with 1 µM of the p38 antagonist SB203580 (Fig. 9-6, B). SB203580 treatment did not influence IL-13-induced C3 and Il13ra2 expression relative to DMSO treated cells, yet in contrast to Erk MAPK, the blockade of p38 completely abrogated any further IL-17A-mediated enhancement of expression (Fig. 9-6, B and C). However, the pharmacologic inhibition of p38 did not augment pSTAT6 (Fig. 9-6, D), suggesting that the inhibition of gene expression was not a result of diminished STAT6 activity. Rather, by recapitulating our observations in Vav1-
Cre+TRAF6Flox/Flox cells, the lack of transcriptional synergy in the absence of p38 signaling suggests that activation of the TRAF6-p38 MAPK axis by IL-17A is selectively required for transcriptional cooperation between IL-13 and IL-17A.
93 Chapter 9 Identification of Transcriptional Regulators Controlling IL-17A-Mediated Enhancement of IL-13 Activity
Figure 9-1
A + B +++ C ) 50 + +/+ ++ ) 15 + +/+ 300 + +/+ 9 9
) Vav1-Cre Traf6 Vav1-Cre Traf6 Vav1-Cre Traf6 7 ### +++ 250 Vav1-Cre+Traf6Flox/Flox Vav1-Cre+Traf6Flox/Flox Vav1-Cre+Traf6Flox/Flox 40 ### 200 + (x10 (x10 10 150 (x10 A 30 A 100 A 5 20 5 4 mRN mRN 3 mRN 10 2 g1 r
C3 1 Lcn2 0 A 0 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-1 3 + Medium IL-13 IL-17A IL-1 3 + IL-17A IL-17A IL-17A
Figure 9-1. TRAF6 is Required for Transcriptional Cooperation Between IL-13 and IL-17A. A-C, Real-time PCR analysis of C3 (Fig. 9-1, A), Arg1 (Fig. 9-1, B), and Lcn2 (Fig. 9-1, C) expression in Vav1-Cre+Traf6+/+ and Vav1- Cre+Traf6Flox/Flox CD11c+ spleen cells stimulated with IL-13, IL-17A, or both cytokines for 24 hours. ###P < .001 versus Medium. +P < .05, ++P < .01, and +++P < .001. Means + S.E.M.s of 3 mice per group are shown. Results show 1 of 2 independent experiments.
94 Chapter 9 Identification of Transcriptional Regulators Controlling IL-17A-Mediated Enhancement of IL-13 Activity
Figure 9-2
A B Arg1 promoter C3 promoter STAT6 C/EBP STAT6 C/EBP NF-κB
Luciferase Luciferase
4000 2000 0 3000 1882 1226 778 416 176 0
C D 20 +++ 40 Medium ### Medium 15 +++ ## IL-13 IL-13 ###
30 Activity IL-17A IL-17A Activity
r
r ### IL-13 + IL-17A 10 + IL-13 + IL-17A ### # 20 # # # # omote # omote r Fold Increase r
P 5
P Fold Increase 10
C3
Arg1 0 0 4000 2000 0 3000 1882 1226 778 416 176 0
Figure 9-2. 5’-Upstream Elements Mediate Enhanced Promoter Activity by IL-13 and IL-17A. A and B, Schematic of the murine Arg1 (Fig. 9-2, A) and C3 (Fig. 9-2, B) promoter regions indicating STAT6 (red), C/EBP (yellow), and NF- κB (green) binding sites and the size of luciferase promoter constructs. C and D, Lucfierase activity in RAW264.7 cells transfected with Arg1 promoter constructs (Fig. 9-2, C) and NIH/3T3 cells transfected with C3 promoter constructs (Fig. 9-2, D) and stimulated with IL-13, IL-17A, or both cytokines for 24 hours. #P < .05, ##P < .01, and ###P < .001 versus Medium. +P < .05 and +++P < .001. Means + S.E.M.s of 4 to 8 replicates per condition are shown. Arg1 results show 1 independent experiment. C3 results show 1 of 3 in- dependent experiments.
95 Chapter 9 Identification of Transcriptional Regulators Controlling IL-17A-Mediated Enhancement of IL-13 Activity
Figure 9-3
A B C3 promoter 25 STAT6 C/EBP NF-κB Wild-type 20 C/EBP Mutant +++ +++
Luciferase Activity ###
r 15 +++ 3000 10 ### omote r Fold Increase P 5
GGAATTTGGCAATTCATT Wild-type C3 ||||| | | | |||||| 0 GGAATATCGGATTTCATT C/EBP mutant Medium IL-13 IL-17A IL-13 + IL-17A C D
++ +++ 30 60 ) ## Empty vector ### 5 Empty vector ) 8 A-C/EBP A-C/EBP
20 (x10 40 A (x10 ### A ###
10 mRN 20 C3 mRN Il13ra2 0 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A
Figure 9-3. Inhibition of C/EBP Transcription Factors Attenuates Transcriptional Cooperation Between IL-13 and IL-17A. A and B, Schematic of the murine C3 promoter region indicating wild-type and C/EBP mutant DNA binding sequences (Fig. 9-3, A). Luciferase activity in NIH/3T3 cells transfected with wild-type or mutant C3 promoter constructs (Fig. 9-3, B) and stimulated with IL-13, IL-17A, or both cytokines for 24 hours. C and D, Real-time PCR analysis of C3 (Fig. 9-3, C) and Il13ra2 (Fig. 9-3, D) expression in NIH/3T3 cells transfected with an empty vector or A-C/EBP dominant negative expression construct and stimulated with cytokines for 16 hours. ##P < .01 and ###P < .001 versus Medium. ++P <.01 and +++P < .001. Means + S.E.M.s of 6 to 12 replicates per condition are shown. Results show 1 independent experiment.
96 Chapter 9 Identification of Transcriptional Regulators Controlling IL-17A-Mediated Enhancement of IL-13 Activity
Figure 9-4
A B + ++ +++ 50 ### 100 +++
DMSO ) DMSO 6 ### ) 9 40 CAY10512 80 CAY10512 (x10 A (x10 30 ## 60 A ### 20 40 mRN mRN 10 20 C3
0 Il13ra2 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A
Figure 9-4. NF-κB also Contributes to Transcriptional Cooperation Between IL-13 and IL-17A. A and B, Real-time PCR analysis of C3 (Fig. 9-4, A) and Il13ra2 (Fig. 9-4, B) expression in NIH/3T3 cells pretreated with dimethyl sulfoxide (DMSO) or an NF-κB inhibitor (CAY10512) and stimulated with IL-13, IL-17A, or both cytokines for 16 hours. ##P < .01 and ###P < .001 versus Medium. +P < .05, ++P <.01, and +++P < .001. Means + S.E.M.s of 4 replicates per condition are shown. Results show 1 independent experiment.
97 Chapter 9 Identification of Transcriptional Regulators Controlling IL-17A-Mediated Enhancement of IL-13 Activity
Figure 9-5
A B DMSO U0126 IL-13 + IL-13 + Medium IL-13 IL-17A IL-17A Medium IL-13 IL-17A IL-17A pErk1/2 pErk1/2
Erk1/2 Erk1/2
C D 200 10 DMSO ## DMSO ## U0126 8 U0126 # 150 6 100 mRNA
mRNA 4 C3 Fold Change Fold Change 50 Il13ra2 2
0 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A
Figure 9-5. Erk MAP Kinase Upregulates Gene Expression but not IL-13/IL-17A Synergy. A and B, pErk/Erk levels in NIH/3T3 cells pretreated with dimethyl sulfoxide (DMSO; Fig. 9-5, A) or an Erk MAP kinase inhibitor (U0126; Fig. 9-5, B) and then stimulated with IL-13, IL-17A, or both cytokines for 5 minutes. C and D, Real-time PCR analysis of C3 (Fig. 9-5, C) and Il13ra2 (Fig. 9-5, D) expression in NIH/3T3 cells pretreated with DMSO or U0126 and stimulated with cytokines for 16 hours. #P < .05 and ##P < .01 versus Medium. Means + S.E.M.s of 4 replicates per condition are shown. Results show 1 of 2 independent experi- ments.
98 Chapter 9 Identification of Transcriptional Regulators Controlling IL-17A-Mediated Enhancement of IL-13 Activity
Figure 9-6
A B DMSO SB203580 IL-13 + IL-13 + Medium IL-13 IL-17A IL-17A Medium IL-13 IL-17A IL-17A pp38 pp38
p38 p38
C D + ++ 100 ++ 10 ++
DMSO ### ###
80 A 8 e e SB203580 g N g A n n R a a N
h 6 h 60 # m R
C C
2
m
d a d l r l 3
40 o 4 3 o C F 1 F
l 20 I 2
0 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A
E SB203580 IL-13 + Medium IL-13 IL-17A IL-17A pSTAT6
STAT6
Figure 9-6. p38 MAP Kinase is Required for Transcriptional Synergy Between IL-13 and IL-17A. A and B, pp38/p38 levels in NIH/3T3 cells pretreated with dimethyl sulfoxide (DMSO; Fig. 9-6, A) or a p38 MAP kinase inhibitor (SB203580; Fig. 9-6, B) and then stimulated with IL-13, IL-17A, or both cytokinesfor 5 minutes. C and D, Real-time PCR analysis of C3 (Fig. 9-6, C) and Il13ra2 (Fig. 9-6, D) expression in NIH/3T3 cells pretreated with DMSO or SB203580 and stimulated with cytokines for 16 hours. E, pSTAT6/STAT6 levels in NIH/3T3 cells pretreated with SB203580 and stimulated with cytokines for 5 minutes. #P < .05 and ###P < .001 versus Medium. +P < .05 and ++P < .01. Means + S.E.M.s of 4 replicates per condition are shown. Results show 1 of 2 independent experiments.
99 Chapter 9 Identification of Transcriptional Regulators Controlling IL-17A-Mediated Enhancement of IL-13 Activity
Supplementary Figure 9-1
A 80
) 25 ng Empty vector 6
0 50 ng Empty vector 1 60 x
( 100 ng Empty vector
A 25 ng A-C/EBP
N 40 50 ng A-C/EBP R
m 100 ng A-C/EBP
2 20 n c L 0 Medium IL-17A
Supplementary Figure 9-1. A, Real-time PCR analysis of Lcn2 expression in NIH/3T3 cells transfected with an empty vector (25-100 ng) or A-C/EBP dominant negative expression construct (25-100 ng) and stimulated with IL-17A for 16 hours. Means + S.E.M.s of 4 replicates per condition are shown. Results show 1 independent experiment.
100 Chapter 9 Identification of Transcriptional Regulators Controlling IL-17A-Mediated Enhancement of IL-13 Activity
Supplementary Figure 9-2
A +++ +++ 80 +++ +++ Medium ### IL-17A 60 ###
40 B Activity
κ ## -
F 20 N
0 DMSO 0.1 1 10 15 100 CAY10512 (μM)
Supplementary Figure 9-2. A, Luciferase activity in NIH/3T3 cells transfected with an NF-κB responsive reporter construct and stimulated with IL-17A for 24 hours in medium containing dimethyl sulfoxide (DMSO) or an NF-kB inhibitor (CAY10512, 0.1-100 μM). ##P < .01 and ###P < .001 versus Medium. +++P < .001. Means + S.E.M.s of 6 replicates per condition are shown. Results show 1 independent experiment.
101 Chapter 9 Identification of Transcriptional Regulators Controlling IL-17A-Mediated Enhancement of IL-13 Activity
Supplementary Figure 9-3
A 150
### y t i v i
t 100 c A
B
- 50 F N
0 Medium TNF- IL-17A
Supplementary Figure 9-3. A, Luciferase activity in NIH/3T3 cells transfected with an NF-κB responsive reporter construct and stimulated with TNF-α or IL-17A for 24 hours. ###P < .001 versus Medium. Means + S.E.M.s of 6 replicates per condition are shown. Results show 1 independent experiment.
102 Chapter 9 Identification of Transcriptional Regulators Controlling IL-17A-Mediated Enhancement of IL-13 Activity
Supplementary Figure 9-4
A B ++ +++ 50 ### 200 +
DMSO ) DMSO 8
) ###
9 U0126 U0126 40 150 (x10 A (x10 30 A # 100 20 mRN
mRN 50 10 C3
0 Il13ra2 0 Medium IL-13 IL-17A IL-13 + Medium IL-13 IL-17A IL-13 + IL-17A IL-17A
Supplementary Figure 9-4. A and B, Real-time PCR analysis of C3 (Supp. Fig. 9-3, A) and Il13ra2 (Supp. Fig. 9-3, B) expression in NIH/3T3 cells pretreated with dimethyl sulfoxide (DMSO) or an Erk MAP kinase inhibitor (U0126) and stimulated with IL-13, IL-17A, or both cytokines for 16 hours. #P < .05 and ###P < .001 versus Medium. +P < .05, ++P <.01, and +++P < .001. Means + S.E.M.s of 4 replicates per condition are shown. Results show 1 of 2 independent experiments.
103 Chapter 10
Discussion
104 10. Discussion
10.1 Major Findings of the Study
The main findings of this study are summarized in Fig. 10-1, with the original communications referred to by their Chapter numbers. Allergic asthma is widely viewed as a
Th2-driven disease, and the Th2 cytokine IL-13 is central for disease pathogenesis.18-21, 27
Despite reports of elevated IL-17A production in severe asthmatics,34-36, 115-117, 226, 277 little is known about how IL-17A influences IL-13-driven responses. In this thesis, we propose a novel pathway wherein IL-17A enhances IL-13-induced signaling and gene expression both in vitro and in vivo. IL-17A-mediated enhancement of IL-13 signaling and gene expression occurs rapidly, and requires IL-17RA expression in IL-13-responsive cells. It is not a result of altered
IL-13 receptor expression and is independent of molecular processes driving synergy between
IL-17A and other pro-inflammatory mediators (i.e., TNF-α). Mechanistically, we observe that
IL-17A enhances IL-13-dependent activation of a key mediator of allergic responses, the transcription factor STAT6.
Even subtle changes in the intensity of IL-13 signaling can influence disease outcome.281,34-36, 226, 277 As such, understanding the molecular basis underlying enhanced STAT6 activation is important. Indeed, the present study demonstrates that the capacity of IL-17A to selectively inhibit the recruitment of endogenous protein-tyrosine phosphatases to the IL-13 receptor is required to augment STAT6 activation. In support of this, we observe that upstream of STAT6, co-stimulation with IL-13 and IL-17A also enhances phosphorylation of the IL-13 receptor-associated JAK kinases JAK1 and TYK2. Increased JAK activity occurs concomitantly with the de-phosphorylation of the tyrosine phosphatases SHP-1 and SHP-2. Mechanistically, we
105 find that the ability of IL-17A to enhance IL-13-dependent pSTAT6 is abrogated in cells that specifically lack the ability to recruit SHP-1, but not SHP-2, to the IL-13 receptor complex.
Moreover, we observe that while IL-17A may counteract IL-13-induced recruitment of tyrosine phosphatase activity, it has no influence on the capacity of other JAK/STAT-signaling cytokines
(IL-6, IFN-γ) to activate their cognate receptors. Collectively, these data suggest a non-redundant role for SHP-1 in a highly cytokine-specific IL-17A-mediated enhancement of IL-13-dependent
STAT6 phosphorylation.
Our data are consistent with previous reports demonstrating that changes in tyrosine phosphatase levels can alter STAT6-driven pathology. In motheaten (me) and viable motheaten
(mev) mice,287-289 SHP-1 deficiency results in a lymphoproliferative phenotype and spontaneous inflammation in multiple organs, including the lung.199-201 The pulmonary phenotype in mev mice is punctuated by a Th2-like inflammatory response, most of which is resolved by selective deletion of IL-13 or STAT6, but not IL-4, implying that the spontaneous lung pathology in mev mice results from aberrant IL-13 signaling in pulmonary structural cells.201 Similarly, in a model of OVA-induced allergic airway inflammation, heterozygous me/+ mice exhibit enhanced airway pathology relative to WT mice, suggesting that SHP-1 may also play a functional role in the regulation of allergen-driven responses.198 In support of this observation, mice homozygous for a mutation in the SHP-1 binding site of IL-4Rα (IL-4RαF709) demonstrate increased airway pathology at baseline and in response to OVA as a direct result of enhanced STAT6 phosphorylation by IL-4 and, disproportionately, by IL-13, suggesting a role for SHP-1 in the regulation of IL-13-mediated responses.197 Likely because of a strong association with T cell
290-292 293 lymphomas, reports linking global SHP-1 deficiency with allergic disorders are limited.
However, polymorphisms in the intracellular domain of IL-4Rα have been associated with
106 asthma and atopy in humans,294 suggesting a relationship between alteration of IL-4/IL-13 receptor signaling and allergic inflammation.
The current results confirm and extend our previous observations of IL-17A-mediated exacerbation on IL-13-induced pathology,281 showing that by reducing activity of SHP-1, but not
SHP-2, IL-17A is able to enhance pSTAT6 levels in non-hematopoietic cells. As such, it seems unlikely that the inhibition of SHP-2 activity by IL-17A is involved in the more severe AHR and allergic asthma observed following treatment with IL-13 + IL-17A in vivo. However, as SHP-2, rather than SHP-1, is more highly expressed in non-hematopoietic cells,283 including the fibroblasts and epithelial cells that are the presumed targets of IL-13 in in vivo models of allergic asthma, the apparent importance of SHP-1 in mediating the IL-17A-driven exacerbation of IL-
13-induced STAT6 activation is surprising. Although these results support a role for SHP-1 in regulating the effects of IL-17A on IL-13-driven STAT6 phosphorylation, there are clear effects of IL-13 + IL-17A on the activity of SHP-2 as well. As such, we cannot not exclude the possibility that alterations in SHP-2 phosphatase activity could impact additional IL-17A- or IL-
13-activated cell signaling networks.
The phosphatase activity of SHP-1 and SHP-2 is controlled by C-terminal tyrosine phosphorylation, which is often provided by receptor-associated kinases.295, 296 Of note, we observe a rapid increase in SHP-1 and SHP-2 phosphorylation following the addition of IL-13 or
IL-17A by itself, which likely reflects the capacity of either cytokine to activate JAK1. However, despite increased JAK1 phosphorylation in the presence of both IL-13 and IL-17A, diminished phosphorylation of both SHP-1 and SHP-2 was observed in cells stimulated with both cytokines.
Because the levels of total SHP-1 and SHP-2 in the cellular homogenate were unchanged with any cytokine treatment, it is unlikely that the reduction of phosphorylated SHP-1 and SHP-2 is
107 due to rapid degradation of these proteins within the cell. Rather, we speculate that decreased pSHP-1/pSHP-2 levels in the presence of increased pJAK1 in IL-13 + IL-17A stimulated cells may be due to posttranslational modifications. As ubiquitination and serine phosphorylation have previously been implicated in the regulation of IL-13 signal transduction,192, 297-299 it is possible that these modifications may change substrate selectively and/or limit the recruitment of SHP-1 and SHP-2 to the IL-13 receptor complex.
Alternatively, alterations in cellular localization/receptor conformation may prevent the association of SHP-1 and SHP-2 with the IL-13 receptor when both IL-13 and IL-17A are present. Supporting this possibility, selective targeting of SHP-1 and SHP-2 to either the lipid rafts or nonraft fractions using mutant constructs influences their catalytic function in T cells, and the elimination of SHP-1 and SHP-2 from the lipid rafts has been shown to enhance T cell receptor signaling.300-302 While the presence of IL-13 and IL-17A receptor complexes in the lipid rafts has not been examined previously, our data suggest that IL-17A might enhance IL-13- dependent TYK2/JAK1/STAT6 signal transduction and limit SHP-1/SHP-2 phosphorylation by excluding SHP-1 and SHP-2 from the IL-13 receptor. Moreover, our observations that IL-17A does not increase signaling downstream of the IL-6 receptor (JAK1/JAK2/TYK2) or the IFN-γ receptor (JAK1/JAK2) suggest that the effects are unlikely at the level of the JAK kinases, but may be due to previously unappreciated unique interactions between IL-13 and IL-17A receptor subunits.
Our observation that IL-17A does not enhance IL-13-induced gene expression in STAT6 deficient cells suggests that STAT6, but not IRS-2 or STAT3 (other IL-13-activated pathways),188-190 is required for transcriptional synergy between IL-13 and IL-17A. However, little is known about the contribution of IL-17A-activated transcription factors to the regulation
108 of IL-13-induced genes or asthma pathophysiology. To address this knowledge gap, the present study demonstrates for the first time that, in addition to IL-13-driven STAT6 activation, a complex network of factors activated downstream of the IL-17A/TRAF6 axis directly contributes to IL-17A-mediated enhancement of IL-13-driven gene expression. Using a panel of
IL-13-induced genes previously validated in our in vivo and in vitro models, we report that IL-
17A does not enhance IL-13-induced gene expression in TRAF6 deficient cells, despite increased STAT6 phosphorylation, suggesting that the rapid increase in STAT6 phosphorylation is necessary, but not sufficient, to sustain the enhancement of gene expression at later time points.
Unexpectedly, of the pathways activated downstream of TRAF6, p38 MAPK was the most important determinant of transcriptional synergy between IL-13 and IL-17A, and pharmacologic inhibition of p38 recapitulated our observations in the TRAF6 deficient cells.
Although the mechanism by which p38 MAPK influences the enhancement IL-13-driven gene expression is unknown, the partial attenuation of transcriptional synergy in the absence of either
NF-κB or C/EBP transcription factors, but complete abrogation in the absence of p38, implies that p38 may regulate the activation of NF-κB and C/EBP family members downstream of IL-
17A. Consistent with this hypothesis, p38 has previously been shown to promote the expression and transcriptional activity of C/EBPβ and RelA, both of which can stabilize the binding of
STAT6 to its promoter element.303-307 Alternatively, it is plausible that STAT6 itself is a direct substrate for p38 kinase activity. In support of this tenet, p38 MAPK has previously been shown to directly regulate the activity of the C-terminal transactivation domain of STAT6.192 For other
STAT proteins, serine phosphorylation of the transactivation domain is required for the formation of stable DNA complexes and affects the specificity of target gene expression;
109 however, a functional consequence for this modification in STAT6 has not yet been determined.308, 309
In contrast to p38, Erk MAPK was constitutively phosphorylated in NIH/3T3 cells. Given the substantial reduction in gene expression observed in U0126-treated cells, we speculate that constitutive Erk activation may positively regulate the overall magnitude of IL-13-driven responses in these cells.310 Although it is unclear why the inhibition of p38 MAPK, but not Erk, limited IL-17A-mediated enhancement of IL-13-driven gene expression, other studies have shown that MAPK family members exhibit a high degree of substrate specificity,311 suggesting that p38 and Erk may preferentially target different transcriptional programs. Underscoring these observations, similar to IL-17A, p38 MAPK signaling is associated with steroid insensitivity.312-
314 In corticosteroid-resistant subjects with severe asthma, p38 has been shown to promote the phosphorylation of the glucocorticoid receptor, reducing its ligand binding affinity.312 Moreover, both LABAs and chemical inhibitors such as the one used in the present study (SB203580) have been shown to block p38 signaling and restore dexamethasone sensitivity to cells collected from severe asthmatics.313, 314 These findings, in conjunction with our observation that the inhibition of p38 abrogates IL-17A-driven enhancement of IL-13 transcripts, suggest that p38 MAPK inhibitors may have the potential to reverse corticosteroid insensitivity and mitigate the pathological effects of IL-17A in patients with severe asthma.
Another observation that has potentially broad implications is that IL-13 antagonizes IL-
17A-induced expression of innate antimicrobial genes (Lcn2, S100A8, S100A9, Csf2) in a
STAT6-dependent manner. Because IL-17A-induced gene products are important for limiting the growth of bacterial and fungal microorganisms, our data might explain the link between atopic disease and disordered microbial colonization.315-318 Furthermore, these results agree with
110 a recent report demonstrating that patients with “Th2 high” asthma exhibit less Th17-associated gene expression and that IL-13 blockade exacerbates Th17-associated inflammation.319 We contend that this counterregulation of IL-17A-induced gene expression by IL-13 might explain why recent endotyping studies have not consistently identified a role for Th17 cells or IL-17A in severe asthma, as these studies frequently use Th17 gene signatures to phenotype asthma patients.48, 320-322 Finally, as reliably detecting IL-17A protein is difficult, even individuals with identified “Th17 high” asthma,319 it is likely that identification of patients with Th17-involved disease will be difficult because both the primary cytokine signal (IL-17A),319, 323-326 and the downstream gene expression may be suppressed by ongoing Th2 inflammation. This challenge in identifying individuals with IL-17A-associated asthma suggests that the inclusion of many patients with IL-17A-independent disease might have limited the efficacy of anti-IL-17RA therapy in moderate-to-severe asthma in a recent clinical trial.327
Moreover, although our data are consistent with previous reports demonstrating IL-17A- mediated enhancement of IL-13 pathology37-39, 116, 328, 329 protective roles for IL-17A have been reported in mouse models of asthma239, 240 and Respiratory Syncytial Virus (RSV)-induced
AHR.330 In asthma models it appears that, when protective, IL-17A is produced primarily by γδ
T cells. For example, resolution of airway inflammation after allergen challenge is dependent on
IL-17A produced by γδ T cells.239 Similarly, although widespread inhibition of IL-17A production was associated with reduced IL-13-driven pathology (suggesting a pro-asthmatic role for IL-17A), inhibition of IL-17A production by γδ T cells exacerbated IL-13-driven pathology.240 How IL-17A-producing γδ T cells can limit IL-13-induced lung pathology remains unclear; however, additional factors produced by these cells may influence how IL-17A-derived signals are integrated. For example, others have shown that although IL-17A blockade limited
111 allergen-induced airway eosinophilia and cytokine production in WT mice, IL-17A blockade exacerbated these parameters in IL-22-/- mice,331 suggesting that the cytokine milieu influences protective versus pro-inflammatory effects of IL-17A. Alternatively, our observation that IL-
17A-mediated enhancement of IL-13-induced gene expression requires IL-13 and IL-17A signaling in the same cell suggests that where IL-17A is produced is also an important determinant of its role in asthma pathology. Although γδ T cells can be found equally distributed in the alveolar spaces, perivascularly, and within the visceral pleura, with slightly lower distribution near the smooth muscle and in the lamina propria, αβ T cells (the likely source of IL-
13) are found primarily in the alveolar spaces,332 suggesting that the unique ability of γδ-derived
IL-17A to control IL-13-induced AHR might be related to its inability to influence IL-13- exposed cells. Because we did not observe altered frequency of IL-17A+ γδ T cells (or any T cell subsets producing IL-13 or IL-17A) in response to exogenous cytokine administration (data not shown), it is unlikely that the increased IL-13-driven pathology observed in our model was due to altered γδ T cell activity.
In addition to asthma, the dysregulation of IL-13 signaling has also been implicated in diseases such as atopic dermatitis and ulcerative colitis.333, 334 IL-13 expression is increased in both acute and chronic lesions of patients with atopic dermatitis, while skin-specific overexpression of IL-13 in mice recapitulates key features of the disease in humans.335, 336 The expression of IL-17A is also elevated in atopic dermatitis skin lesions compared to normal skin;337 however, little is known about the importance of Th17 cytokines in the development of atopic dermatitis, especially relative to the role of IL-17A in psoriasis.338 Ulcerative colitis is also characterized by a Th2-driven immune response, and IL-13 has been shown to directly affect tight junction formation and apoptosis in the colonic epithelium.339 Moreover, similar to studies
112 conducted in humans with asthma, there is a correlation between IL-17A levels in ulcerative colitis patients and disease severity.340 Overall, the precise contribution of IL-13/IL-17A interactions to disorders associated with barrier defects merits additional exploration in the future.
Lastly, our finding that IL-17A is able to enhance IL-13-driven STAT6 activation in
CD11c+ immune cells has other potentially broad applications. Although the pathophysiological implications of IL-13 signaling in asthma are frequently discussed in the context of airway epithelial cells and smooth muscle cells,125, 128 IL-13 has also demonstrated important functions in hematopoietic cells, including monocytes and macrophages (alternative activation, increased
MHC class II and FcεRII expression, inhibition of pro-inflammatory gene expression),341-343 dendritic cells (maturation, increased MHC class II and co-stimulatory molecules),344, 345 and human B cells (proliferation, IgE class-switching).346 Given the ubiquitous expression of the IL-
17A receptor,206 it is possible that exposure to IL-13 and IL-17A might enhance these IL-13- dependent effects in immune cells under conditions of allergic inflammation, thereby further exacerbating immunopathology in the airways of severe asthma patients.
10.2 Directions for Future Research
Several intriguing questions concerning the regulation of IL-13 and IL-17A signal transduction still remain unresolved, the forefront of which is the mechanism underlying the inhibition of SHP-1 and SHP-2 activity. As described previously, we speculate that the rapid reduction in protein-tyrosine phosphatase activity may be dictated by post-translational modifications (i.e., ubiquitination) or alterations in cellular localization that limit SHP-1 and
SHP-2 recruitment to the IL-13 receptor complex. Our results have excluded the requirement for
113 TRAF6 and TRAF3, both E3 ubiquitin ligases; however, several additional ubiquitin-modifying enzymes are known to associate with the IL-17A receptor, including Act1, TRAF2, TRAF4,
TRAF5, and IKKi, which may be targeted using chemical inhibitors or genetic approaches.261-263
Of note, the inhibition of SHP-1 has also been shown to promote the degradation of Cbl-b, an E3 ubiquitin ligase that directly targets pSTAT6 for degradation.298, 299 Conversely, the SHP-2- associated ubiquitin ligase c-Cbl does not interact with STAT6,299, 347 which may provide a mechanistic explanation for the selective requirement for SHP-1 rather than SHP-2 in the enhancement of IL-13 signaling.
Alternatively, mutation experiments targeting SHP-1 and SHP-2 to different cellular fractions may address whether changes in cellular localization contribute to the reciprocal enhancement STAT6 phosphorylation and diminution of SHP-1/SHP-2 activity in the context of
IL-13 and IL-17A signaling. Additionally, taking into account the selective enhancement of IL-
13-driven STAT6 activation, but not STAT3 or STAT1 phosphorylation, we speculate that the effect of IL-17A on IL-13 may be due to unique changes in receptor distribution or co- localization between the IL-13 and IL-17A receptor complexes, which could be explored in cytokine-stimulated cells using cellular fractionation and/or confocal microscopy.
Moreover, it is interesting to note that IL-17A-mediated inhibition of SHP-1 specifically affected the IL-13-induced activation of STAT6, yet IL-17A did not affect IFN-γ-induced activation of STAT1 or IL-6-induced activation of STAT3. This level of specificity suggests that the development of a therapeutic strategy to specifically target this event (IL-17A-mediated inhibition of IL-13-induced SHP-1 activity) could provide an effective and specific tool to block the pathological effects of IL-17A on IL-13-induced pathology while sparing other JAK/STAT- related signaling. It would also be of interest to study whether there are differences in the ability
114 of IL-17A to inhibit IL-13-induced SHP-1 phosphorylation in human samples collected from from healthy subjects, or those with mild, moderate, or severe asthma, to determine if alterations in this pathway may drive the development of more severe asthma.
In addition, the mechanism underlying the inhibition of IL-17A-dependent gene expression in the presence of IL-13 and IL-17A remains obscure. Similar to our Transwell assays using IL-17RA-/- cells, co-cultures consisting of WT and IL-13Rα1-/- pulmonary fibroblasts could be used to address whether IL-13 acts directly on IL-17A responsive cells to decrease IL-
17A-induced transcriptional activity. Of note, in fibroblasts SHP-2 has previously been shown to promote the activation of Erk, p38, and JNK MAPK,348-350 all pathways induced by IL-17A.
Thus, the inhibition of SHP-2 observed in the combined presence of IL-13 and IL-17A (versus in the presence of either cytokine alone) might limit cellular responsiveness to MAPK-activating signals, and may provide a mechanistic explanation for the attenuation of IL-17A-driven gene expression cells stimulated with IL-13 + IL-17A.
It would also be of great interest to clarify the precise mechanisms dictating transcriptional cooperation between IL-13 and IL-17A-driven transcription factors, as this may reveal new molecular targets for asthma therapy. Co-immunoprecipitation of nuclear extracts would be useful in identifying interactions between STAT6, NF-κB, C/EBPβ, or C/EBPδ in cytokine-stimulated cells, and also how potential transcription factor complexes are influenced by the inhibition of p38 MAPK. Alternatively, we postulate that p38 may directly influence the transcriptional efficacy of STAT6 by modifying its serine phosphorylation. Moreover, mutation experiments targeted at conserved serine residues in the STAT6 transactivation domain would elucidate the functional consequences of STAT6 serine phosphorylation, which are currently unknown. Of note, these hypotheses are not mutually exclusive, and thus it is possible that both
115 may act to synergistically enhance IL-13-dependent gene expression in cells co-exposed to IL-13 and IL-17A.
10.3 Conclusion
Collectively, our findings provide a mechanistic underpinning for the association between increased IL-17A levels and severe asthma. Given the essential role for IL-13 and
STAT6 in AHR, airway inflammation, and mucus overproduction, our finding that IL-17A enhances IL-13-driven STAT6 phosphorylation by impairing the phosphatase activity of SHP-1 has important implications for the pathogenesis of IL-13-induced disease. Several biologic therapies targeting the STAT6 pathway are currently in clinical trials for the treatment of allergic asthma,351-353 which the present study implies may benefit severe asthmatics. However, IL-17A- mediated enhancement of IL-13-driven STAT6 phosphorylation is not sufficient to explain increases in IL-13-driven gene expression. Rather, it is evident that STAT6 must also cooperate with IL-17A-activated factors, including NF-κB, C/EBPβ, C/EBPδ, and p38 MAPK, to enhance
IL-13-driven transcript levels, although the mechanism of this interaction remains incompletely understood. Ultimately, we speculate that a better understanding of these pathways and their interactions will lead to improved molecular phenotyping of “Th2/Th17 high” asthma, as well as the development of new therapeutic approaches to selectively target asthmatic patients with IL-
17A-driven exacerbation of IL-13-mediated pathology.
116 Figure 10-1
Figure 10-1. Main Findings of this Study. Although the cellular pathways activated following IL- 13 (JAK1-TYK2-STAT6) and IL-17A (TRAF6-NF-κB-C/EBPβδ-MAPK) stimulation differ, in Chapter 7 we report that co-stimulation with IL-13 and IL-17A synergistically enhances IL-13-induced STAT6 phosphorylation (pSTAT6) and gene expression in vivo and in vitro. In contrast, co-exposure to IL-13 inhibits IL-17A-driven antimicrobial gene expression. In Chapter 8 we demonstrate that the ability of IL- 17A to augment IL-13-induced pSTAT6 is selectively driven by changes in SHP-1 protein-tyrosine phosphatase activity. However, in Chapter 9 we establish that IL-17A-induced factors, including NF-κB, C/EBP family members, and p38 MAPK, must also cooperate with STAT6 to enhance IL-13-driven promoter activity and gene expression. Overall, our data suggest that IL-17A contributes to asthma pathophysiology by 1) increasing the capacity of IL-13 to activate the STAT6 signaling axis, and 2) transcriptional cooperation between STAT6 and IL-17A-induced factors.
117 11. Glossary
A-C/EBP Dominant negative C/EBP expression vector
ActD Actinomycin D
AHR Airway hyperresponsiveness
APTI Airway Pressure Time Index
ATS American Thoracic Society
AUC Area under curve
BAL Bronchoalveolar lavage
BMDC Bone marrow-derived dendritic cell
C-BAD C/EBPβ-activation domain in IL-17RA
CAY10512 NF-κB inhibitor
ChIP-seq Chromatin immunoprecipitation followed by high-throughput sequencing
DC Dendritic cell
DMSO Dimethyl sulfoxide
ELISA Enzyme-linked immunosorbent assay
ERS European Respiratory Society
FEV1 Forced expiratory volume in 1 second
GWAS Genome-wide association study
HDM House dust mite
ILC Innate lymphoid cell i.t. Intratracheal
JAK Janus kinase
ITIM Immunoreceptor tyrosine-based inhibitory motif
118 LABA Long-acting β2-agonist
MAPK Mitogen-activated protein kinase
Na3VO4 Tyrosine phosphatase inhibitor
NEC Nasal epithelial cell
NSC-87877 SHP-1 and SHP-2 inhibitor
PHPS1 SHP-2 inhibitor
PTP Inhibitor II SHP-1 inhibitor pTyr Phospho-tyrosine
ROS Reactive oxygen species
RSV Respiratory Syncytial Virus
SABA Short-acting β2-agonist
SB203580 p38 MAPK inhibitor
SEFIR SEF/IL-17R domain in IL-17RA
S.E.M. Standard error of the mean
SHP Src homology region 2 domain-containing phosphatase pSHP-1 Phosphorylated SHP-1 pSHP-2 Phosphorylated SHP-2
STAT Signal transducer and activator of transcription pSTAT1 Phosphorylated STAT1 pSTAT3 Phosphorylated STAT3 pSTAT6 Phosphorylated STAT6
TILL TIR-like loop domain in IL-17RA
TLR Toll-like receptor
119 TTP Tristetraprolin
U0126 Erk MAPK inhibitor
WT Wild-type
120 12. Bibliography
1. National Health Interview Survey (NHIS) data: 2001 lifetime and current asthma. US Department
of Health and Human Services, CDC: 2004. Available from:
http://www.cdc.gov/asthma/nhis/01/data.htm.
2. National Health Interview Survey (NHIS) data: 2011 lifetime and current asthma. US Department
of Health and Human Services, CDC: 2012. Available from:
http://www.cdc.gov/asthma/nhis/2011/data.htm.
3. Bousquet J, Khaltaev N. Global surveillance, prevention and control of chronic respiratory
diseases: a comprehensive approach 2007.
4. Wills-Karp M. Immunologic basis of antigen-induced airway hyperresponsiveness. Annu Rev
Immunol 1999; 17:255-81.
5. Bousquet J, Jeffery PK, Busse WW, Johnson M, Vignola AM. Asthma. From
bronchoconstriction to airways inflammation and remodeling. Am J Respir Crit Care Med 2000;
161:1720-45.
6. Global Initiative for Asthma. Global Strategy for Asthma Management and Prevention, 2017.
Available from: www.ginasthma.org.
7. Bergeron C, Tulic MK, Hamid Q. Airway remodelling in asthma: from benchside to clinical
practice. Can Respir J 2010; 17:e85-93.
8. Akinbami LJ, Moorman JE, Bailey C, Zahran HS, King M, Johnson CA, et al. Trends in asthma
prevalence, health care use, and mortality in the United States, 2001-2010. NCHS Data Brief
2012:1-8.
9. Tough SC, Hessel PA, Ruff M, Green FH, Mitchell I, Butt JC. Features that distinguish those
who die from asthma from community controls with asthma. J Asthma 1998; 35:657-65.
121 10. Turner MO, Noertjojo K, Vedal S, Bai T, Crump S, Fitzgerald JM. Risk factors for near-fatal
asthma. A case-control study in hospitalized patients with asthma. Am J Respir Crit Care Med
1998; 157:1804-9.
11. Burr ML, Davies BH, Hoare A, Jones A, Williamson IJ, Holgate SK, et al. A confidential inquiry
into asthma deaths in Wales. Thorax 1999; 54:985-9.
12. Jalaludin BB, Smith MA, Chey T, Orr NJ, Smith WT, Leeder SR. Risk factors for asthma deaths:
a population-based, case-control study. Aust N Z J Public Health 1999; 23:595-600.
13. Walker C, Bode E, Boer L, Hansel TT, Blaser K, Virchow JC. Allergic and nonallergic
asthmatics have distinct patterns of T-cell activation and cytokine production in peripheral blood
and bronchoalveolar lavage. Am Rev Respir Dis 1992; 146:109-15.
14. Robinson DS, Hamid Q, Ying S, Tsicopoulos A, Barkans J, Bentley AM, et al. Predominant
TH2-like bronchoalveolar T-lymphocyte population in atopic asthma. N Engl J Med 1992;
326:298-304.
15. Robinson DS, Bentley AM, Hartnell A, Kay AB, Durham SR. Activated memory T helper cells
in bronchoalveolar lavage fluid from patients with atopic asthma: relation to asthma symptoms,
lung function, and bronchial responsiveness. Thorax 1993; 48:26-32.
16. Azzawi M, Bradley B, Jeffery PK, Frew AJ, Wardlaw AJ, Knowles G, et al. Identification of
activated T lymphocytes and eosinophils in bronchial biopsies in stable atopic asthma. Am Rev
Respir Dis 1990; 142:1407-13.
17. Gavett SH, Chen X, Finkelman F, Wills-Karp M. Depletion of murine CD4+ T lymphocytes
prevents antigen-induced airway hyperreactivity and pulmonary eosinophilia. Am J Respir Cell
Mol Biol 1994; 10:587-93.
18. Wills-Karp M, Luyimbazi J, Xu X, Schofield B, Neben TY, Karp CL, et al. Interleukin-13:
central mediator of allergic asthma. Science 1998; 282:2258-61.
122 19. Zhu Z, Homer RJ, Wang Z, Chen Q, Geba GP, Wang J, et al. Pulmonary expression of
interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic
abnormalities, and eotaxin production. J Clin Invest 1999; 103:779-88.
20. Grünig G, Warnock M, Wakil AE, Venkayya R, Brombacher F, Rennick DM, et al. Requirement
for IL-13 independently of IL-4 in experimental asthma. Science 1998; 282:2261-3.
21. Walter DM, McIntire JJ, Berry G, McKenzie AN, Donaldson DD, DeKruyff RH, et al. Critical
role for IL-13 in the development of allergen-induced airway hyperreactivity. J Immunol 2001;
167:4668-75.
22. Barner M, Mohrs M, Brombacher F, Kopf M. Differences between IL-4R alpha-deficient and IL-
4-deficient mice reveal a role for IL-13 in the regulation of Th2 responses. Curr Biol 1998; 8:669-
72.
23. Nakajima H, Iwamoto I, Tomoe S, Matsumura R, Tomioka H, Takatsu K, et al. CD4+ T-
lymphocytes and interleukin-5 mediate antigen-induced eosinophil infiltration into the mouse
trachea. Am Rev Respir Dis 1992; 146:374-7.
24. Coffman RL, Seymour BW, Hudak S, Jackson J, Rennick D. Antibody to interleukin-5 inhibits
helminth-induced eosinophilia in mice. Science 1989; 245:308-10.
25. Berry MA, Parker D, Neale N, Woodman L, Morgan A, Monk P, et al. Sputum and bronchial
submucosal IL-13 expression in asthma and eosinophilic bronchitis. J Allergy Clin Immunol
2004; 114:1106-9.
26. Townley RG, Sapkota M, Sapkota K. IL-13 and its genetic variants: effect on current asthma
treatments. Discov Med 2011; 12:513-23.
27. Kuperman D, Schofield B, Wills-Karp M, Grusby MJ. Signal transducer and activator of
transcription factor 6 (Stat6)-deficient mice are protected from antigen-induced airway
hyperresponsiveness and mucus production. J Exp Med 1998; 187:939-48.
28. Hershey GK. IL-13 receptors and signaling pathways: an evolving web. J Allergy Clin Immunol
2003; 111:677-90; quiz 91.
123 29. Wills-Karp M, Finkelman FD. Untangling the complex web of IL-4- and IL-13-mediated
signaling pathways. Sci Signal 2008; 1:pe55.
30. Saha SK, Berry MA, Parker D, Siddiqui S, Morgan A, May R, et al. Increased sputum and
bronchial biopsy IL-13 expression in severe asthma. J Allergy Clin Immunol 2008; 121:685-91.
31. Laan M, Cui ZH, Hoshino H, Lötvall J, Sjöstrand M, Gruenert DC, et al. Neutrophil recruitment
by human IL-17 via C-X-C chemokine release in the airways. J Immunol 1999; 162:2347-52.
32. Jones CE, Chan K. Interleukin-17 stimulates the expression of interleukin-8, growth-related
oncogene-alpha, and granulocyte-colony-stimulating factor by human airway epithelial cells. Am
J Respir Cell Mol Biol 2002; 26:748-53.
33. Simpson JL, Grissell TV, Douwes J, Scott RJ, Boyle MJ, Gibson PG. Innate immune activation
in neutrophilic asthma and bronchiectasis. Thorax 2007; 62:211-8.
34. Bullens DM, Truyen E, Coteur L, Dilissen E, Hellings PW, Dupont LJ, et al. IL-17 mRNA in
sputum of asthmatic patients: linking T cell driven inflammation and granulocytic influx? Respir
Res 2006; 7:135.
35. Al-Ramli W, Préfontaine D, Chouiali F, Martin JG, Olivenstein R, Lemière C, et al. T(H)17-
associated cytokines (IL-17A and IL-17F) in severe asthma. J Allergy Clin Immunol 2009;
123:1185-7.
36. McKinley L, Alcorn JF, Peterson A, Dupont RB, Kapadia S, Logar A, et al. TH17 cells mediate
steroid-resistant airway inflammation and airway hyperresponsiveness in mice. J Immunol 2008;
181:4089-97.
37. Lajoie S, Lewkowich IP, Suzuki Y, Clark JR, Sproles AA, Dienger K, et al. Complement-
mediated regulation of the IL-17A axis is a central genetic determinant of the severity of
experimental allergic asthma. Nat Immunol 2010; 11:928-35.
38. Wilson RH, Whitehead GS, Nakano H, Free ME, Kolls JK, Cook DN. Allergic sensitization
through the airway primes Th17-dependent neutrophilia and airway hyperresponsiveness. Am J
Respir Crit Care Med 2009; 180:720-30.
124 39. Wakashin H, Hirose K, Maezawa Y, Kagami S, Suto A, Watanabe N, et al. IL-23 and Th17 cells
enhance Th2-cell-mediated eosinophilic airway inflammation in mice. Am J Respir Crit Care
Med 2008; 178:1023-32.
40. Wang JY, Shyur SD, Wang WH, Liou YH, Lin CG, Wu YJ, et al. The polymorphisms of
interleukin 17A (IL17A) gene and its association with pediatric asthma in Taiwanese population.
Allergy 2009; 64:1056-60.
41. Chen J, Deng Y, Zhao J, Luo Z, Peng W, Yang J, et al. The polymorphism of IL-17 G-152A was
associated with childhood asthma and bacterial colonization of the hypopharynx in bronchiolitis.
J Clin Immunol 2010; 30:539-45.
42. National Center for Health Statistics, CDC, Asthma: 2014. Available from:
www.cdc.gov/nchs/fastats/asthma.htm.
43. Arbes SJ, Gergen PJ, Vaughn B, Zeldin DC. Asthma cases attributable to atopy: results from the
Third National Health and Nutrition Examination Survey. J Allergy Clin Immunol 2007;
120:1139-45.
44. Wenzel SE, Schwartz LB, Langmack EL, Halliday JL, Trudeau JB, Gibbs RL, et al. Evidence
that severe asthma can be divided pathologically into two inflammatory subtypes with distinct
physiologic and clinical characteristics. Am J Respir Crit Care Med 1999; 160:1001-8.
45. Green RH, Brightling CE, Woltmann G, Parker D, Wardlaw AJ, Pavord ID. Analysis of induced
sputum in adults with asthma: identification of subgroup with isolated sputum neutrophilia and
poor response to inhaled corticosteroids. Thorax 2002; 57:875-9.
46. The ENFUMOSA cross-sectional European multicentre study of the clinical phenotype of
chronic severe asthma. European Network for Understanding Mechanisms of Severe Asthma. Eur
Respir J 2003; 22:470-7.
47. Moore WC, Meyers DA, Wenzel SE, Teague WG, Li H, Li X, et al. Identification of asthma
phenotypes using cluster analysis in the Severe Asthma Research Program. Am J Respir Crit Care
Med 2010; 181:315-23.
125 48. Wu W, Bleecker E, Moore W, Busse WW, Castro M, Chung KF, et al. Unsupervised
phenotyping of Severe Asthma Research Program participants using expanded lung data. J
Allergy Clin Immunol 2014; 133:1280-8.
49. Shaw DE, Sousa AR, Fowler SJ, Fleming LJ, Roberts G, Corfield J, et al. Clinical and
inflammatory characteristics of the European U-BIOPRED adult severe asthma cohort. Eur
Respir J 2015; 46:1308-21.
50. Julia V, Macia L, Dombrowicz D. The impact of diet on asthma and allergic diseases. Nat Rev
Immunol 2015; 15:308-22.
51. Barnett SB, Nurmagambetov TA. Costs of asthma in the United States: 2002-2007. J Allergy Clin
Immunol 2011; 127:145-52.
52. Spahn JD, Covar RA. Weighing the risks of treatment versus nontreatment in pediatric asthma.
Pediatr Clin North Am 2003; 50:677-95.
53. Skoner JD, Schaffner TJ, Schad CA, Kwon AY, Skoner DP. Addressing steroid phobia:
improving the risk-benefit ratio with new agents. Allergy Asthma Proc 2008; 29:358-64.
54. Roberts JA, Bradding P, Britten KM, Walls AF, Wilson S, Gratziou C, et al. The long-acting
beta2-agonist salmeterol xinafoate: effects on airway inflammation in asthma. Eur Respir J 1999;
14:275-82.
55. Howarth PH, Beckett P, Dahl R. The effect of long-acting beta2-agonists on airway inflammation
in asthmatic patients. Respir Med 2000; 94 Suppl F:S22-5.
56. Barnes PJ, Pedersen S, Busse WW. Efficacy and safety of inhaled corticosteroids. New
developments. Am J Respir Crit Care Med 1998; 157:S1-53.
57. Suissa S, Ernst P. Inhaled corticosteroids: impact on asthma morbidity and mortality. J Allergy
Clin Immunol 2001; 107:937-44.
58. Kelly HW, Nelson HS. Potential adverse effects of the inhaled corticosteroids. J Allergy Clin
Immunol 2003; 112:469-78; quiz 79.
126 59. Chung KF, Wenzel SE, Brozek JL, Bush A, Castro M, Sterk PJ, et al. International ERS/ATS
guidelines on definition, evaluation and treatment of severe asthma. Eur Respir J 2014; 43:343-
73.
60. Cosmi L, Liotta F, Maggi E, Romagnani S, Annunziato F. Th17 cells: new players in asthma
pathogenesis. Allergy 2011; 66:989-98.
61. Gudbjartsson DF, Bjornsdottir US, Halapi E, Helgadottir A, Sulem P, Jonsdottir GM, et al.
Sequence variants affecting eosinophil numbers associate with asthma and myocardial infarction.
Nat Genet 2009; 41:342-7.
62. Moffatt MF, Gut IG, Demenais F, Strachan DP, Bouzigon E, Heath S, et al. A large-scale,
consortium-based genomewide association study of asthma. N Engl J Med 2010; 363:1211-21.
63. Reijmerink NE, Postma DS, Bruinenberg M, Nolte IM, Meyers DA, Bleecker ER, et al.
Association of IL1RL1, IL18R1, and IL18RAP gene cluster polymorphisms with asthma and
atopy. J Allergy Clin Immunol 2008; 122:651-4.e8.
64. Lambrecht BN, Hammad H. The airway epithelium in asthma. Nat Med 2012; 18:684-92.
65. Ryu JH, Yoo JY, Kim MJ, Hwang SG, Ahn KC, Ryu JC, et al. Distinct TLR-mediated pathways
regulate house dust mite-induced allergic disease in the upper and lower airways. J Allergy Clin
Immunol 2013; 131:549-61.
66. Hammad H, Chieppa M, Perros F, Willart MA, Germain RN, Lambrecht BN. House dust mite
allergen induces asthma via Toll-like receptor 4 triggering of airway structural cells. Nat Med
2009; 15:410-6.
67. Tan AM, Chen HC, Pochard P, Eisenbarth SC, Herrick CA, Bottomly HK. TLR4 signaling in
stromal cells is critical for the initiation of allergic Th2 responses to inhaled antigen. J Immunol
2010; 184:3535-44.
68. Adam E, Hansen KK, Astudillo Fernandez O, Astudillo OF, Coulon L, Bex F, et al. The house
dust mite allergen Der p 1, unlike Der p 3, stimulates the expression of interleukin-8 in human
127 airway epithelial cells via a proteinase-activated receptor-2-independent mechanism. J Biol Chem
2006; 281:6910-23.
69. Pichavant M, Charbonnier AS, Taront S, Brichet A, Wallaert B, Pestel J, et al. Asthmatic
bronchial epithelium activated by the proteolytic allergen Der p 1 increases selective dendritic
cell recruitment. J Allergy Clin Immunol 2005; 115:771-8.
70. Kauffman HF, Tomee JF, van de Riet MA, Timmerman AJ, Borger P. Protease-dependent
activation of epithelial cells by fungal allergens leads to morphologic changes and cytokine
production. J Allergy Clin Immunol 2000; 105:1185-93.
71. Leino MS, Loxham M, Blume C, Swindle EJ, Jayasekera NP, Dennison PW, et al. Barrier
disrupting effects of alternaria alternata extract on bronchial epithelium from asthmatic donors.
PLoS One 2013; 8:e71278.
72. Bucchieri F, Puddicombe SM, Lordan JL, Richter A, Buchanan D, Wilson SJ, et al. Asthmatic
bronchial epithelium is more susceptible to oxidant-induced apoptosis. Am J Respir Cell Mol
Biol 2002; 27:179-85.
73. Lundgren R, Söderberg M, Hörstedt P, Stenling R. Morphological studies of bronchial mucosal
biopsies from asthmatics before and after ten years of treatment with inhaled steroids. Eur Respir
J 1988; 1:883-9.
74. Lloyd CM, Saglani S. Epithelial cytokines and pulmonary allergic inflammation. Curr Opin
Immunol 2015; 34:52-8.
75. Chu DK, Llop-Guevara A, Walker TD, Flader K, Goncharova S, Boudreau JE, et al. IL-33, but
not thymic stromal lymphopoietin or IL-25, is central to mite and peanut allergic sensitization. J
Allergy Clin Immunol 2013; 131:187-200.e1-8.
76. Ito T, Wang YH, Duramad O, Hori T, Delespesse GJ, Watanabe N, et al. TSLP-activated
dendritic cells induce an inflammatory T helper type 2 cell response through OX40 ligand. J Exp
Med 2005; 202:1213-23.
128 77. Wang YH, Angkasekwinai P, Lu N, Voo KS, Arima K, Hanabuchi S, et al. IL-25 augments type
2 immune responses by enhancing the expansion and functions of TSLP-DC-activated Th2
memory cells. J Exp Med 2007; 204:1837-47.
78. Hurst SD, Muchamuel T, Gorman DM, Gilbert JM, Clifford T, Kwan S, et al. New IL-17 family
members promote Th1 or Th2 responses in the lung: in vivo function of the novel cytokine IL-25.
J Immunol 2002; 169:443-53.
79. Hammad H, Lambrecht BN. Dendritic cells and epithelial cells: linking innate and adaptive
immunity in asthma. Nat Rev Immunol 2008; 8:193-204.
80. Stumbles PA, Thomas JA, Pimm CL, Lee PT, Venaille TJ, Proksch S, et al. Resting respiratory
tract dendritic cells preferentially stimulate T helper cell type 2 (Th2) responses and require
obligatory cytokine signals for induction of Th1 immunity. J Exp Med 1998; 188:2019-31.
81. Nathan AT, Peterson EA, Chakir J, Wills-Karp M. Innate immune responses of airway epithelium
to house dust mite are mediated through beta-glucan-dependent pathways. J Allergy Clin
Immunol 2009; 123:612-8.
82. Hoshino A, Tanaka Y, Akiba H, Asakura Y, Mita Y, Sakurai T, et al. Critical role for OX40
ligand in the development of pathogenic Th2 cells in a murine model of asthma. Eur J Immunol
2003; 33:861-9.
83. Saluja R, Ketelaar ME, Hawro T, Church MK, Maurer M, Nawijn MC. The role of the IL-33/IL-
1RL1 axis in mast cell and basophil activation in allergic disorders. Mol Immunol 2015; 63:80-5.
84. Iikura M, Suto H, Kajiwara N, Oboki K, Ohno T, Okayama Y, et al. IL-33 can promote survival,
adhesion and cytokine production in human mast cells. Lab Invest 2007; 87:971-8.
85. Xu D, Jiang HR, Kewin P, Li Y, Mu R, Fraser AR, et al. IL-33 exacerbates antigen-induced
arthritis by activating mast cells. Proc Natl Acad Sci U S A 2008; 105:10913-8.
86. Pecaric-Petkovic T, Didichenko SA, Kaempfer S, Spiegl N, Dahinden CA. Human basophils and
eosinophils are the direct target leukocytes of the novel IL-1 family member IL-33. Blood 2009;
113:1526-34.
129 87. Schneider E, Petit-Bertron AF, Bricard R, Levasseur M, Ramadan A, Girard JP, et al. IL-33
activates unprimed murine basophils directly in vitro and induces their in vivo expansion
indirectly by promoting hematopoietic growth factor production. J Immunol 2009; 183:3591-7.
88. Cherry WB, Yoon J, Bartemes KR, Iijima K, Kita H. A novel IL-1 family cytokine, IL-33,
potently activates human eosinophils. J Allergy Clin Immunol 2008; 121:1484-90.
89. Bernink JH, Germar K, Spits H. The role of ILC2 in pathology of type 2 inflammatory diseases.
Curr Opin Immunol 2014; 31:115-20.
90. Martinez-Gonzalez I, Steer CA, Takei F. Lung ILC2s link innate and adaptive responses in
allergic inflammation. Trends Immunol 2015; 36:189-95.
91. Chang YJ, Kim HY, Albacker LA, Baumgarth N, McKenzie AN, Smith DE, et al. Innate
lymphoid cells mediate influenza-induced airway hyper-reactivity independently of adaptive
immunity. Nat Immunol 2011; 12:631-8.
92. Monticelli LA, Sonnenberg GF, Artis D. Innate lymphoid cells: critical regulators of allergic
inflammation and tissue repair in the lung. Curr Opin Immunol 2012; 24:284-9.
93. Rivera J, Fierro NA, Olivera A, Suzuki R. New insights on mast cell activation via the high
affinity receptor for IgE. Adv Immunol 2008; 98:85-120.
94. Perrigoue JG, Saenz SA, Siracusa MC, Allenspach EJ, Taylor BC, Giacomin PR, et al. MHC
class II-dependent basophil-CD4+ T cell interactions promote T(H)2 cytokine-dependent
immunity. Nat Immunol 2009; 10:697-705.
95. Kay AB. The role of eosinophils in the pathogenesis of asthma. Trends Mol Med 2005; 11:148-
52.
96. Rosenberg HF, Phipps S, Foster PS. Eosinophil trafficking in allergy and asthma. J Allergy Clin
Immunol 2007; 119:1303-10; quiz 11-2.
97. Amelink M, de Groot JC, de Nijs SB, Lutter R, Zwinderman AH, Sterk PJ, et al. Severe adult-
onset asthma: A distinct phenotype. J Allergy Clin Immunol 2013; 132:336-41.
130 98. Fajt ML, Wenzel SE. Asthma phenotypes and the use of biologic medications in asthma and
allergic disease: the next steps toward personalized care. J Allergy Clin Immunol 2015; 135:299-
310; quiz 1.
99. Kim HY, Lee HJ, Chang YJ, Pichavant M, Shore SA, Fitzgerald KA, et al. Interleukin-17-
producing innate lymphoid cells and the NLRP3 inflammasome facilitate obesity-associated
airway hyperreactivity. Nat Med 2014; 20:54-61.
100. Mjösberg JM, Trifari S, Crellin NK, Peters CP, van Drunen CM, Piet B, et al. Human IL-25- and
IL-33-responsive type 2 innate lymphoid cells are defined by expression of CRTH2 and CD161.
Nat Immunol 2011; 12:1055-62.
101. Goenka S, Kaplan MH. Transcriptional regulation by STAT6. Immunol Res 2011; 50:87-96.
102. Cote-Sierra J, Foucras G, Guo L, Chiodetti L, Young HA, Hu-Li J, et al. Interleukin 2 plays a
central role in Th2 differentiation. Proc Natl Acad Sci U S A 2004; 101:3880-5.
103. Stritesky GL, Muthukrishnan R, Sehra S, Goswami R, Pham D, Travers J, et al. The transcription
factor STAT3 is required for T helper 2 cell development. Immunity 2011; 34:39-49.
104. Zhu J, Yamane H, Cote-Sierra J, Guo L, Paul WE. GATA-3 promotes Th2 responses through
three different mechanisms: induction of Th2 cytokine production, selective growth of Th2 cells
and inhibition of Th1 cell-specific factors. Cell Res 2006; 16:3-10.
105. Wenzel SE, Wang L, Pirozzi G. Dupilumab in persistent asthma. N Engl J Med 2013; 369:1276.
106. Hanania NA, Noonan M, Corren J, Korenblat P, Zheng Y, Fischer SK, et al. Lebrikizumab in
moderate-to-severe asthma: pooled data from two randomised placebo-controlled studies. Thorax
2015; 70:748-56.
107. Hanania NA, Wenzel S, Rosén K, Hsieh HJ, Mosesova S, Choy DF, et al. Exploring the effects of
omalizumab in allergic asthma: an analysis of biomarkers in the EXTRA study. Am J Respir Crit
Care Med 2013; 187:804-11.
131 108. Leckie MJ, ten Brinke A, Khan J, Diamant Z, O'Connor BJ, Walls CM, et al. Effects of an
interleukin-5 blocking monoclonal antibody on eosinophils, airway hyper-responsiveness, and the
late asthmatic response. Lancet 2000; 356:2144-8.
109. Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, et al. Interleukin
17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2
lineages. Nat Immunol 2005; 6:1123-32.
110. Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, et al. A distinct lineage of CD4 T cells
regulates tissue inflammation by producing interleukin 17. Nat Immunol 2005; 6:1133-41.
111. Ivanov II, Zhou L, Littman DR. Transcriptional regulation of Th17 cell differentiation. Semin
Immunol 2007; 19:409-17.
112. Romagnani S, Maggi E, Liotta F, Cosmi L, Annunziato F. Properties and origin of human Th17
cells. Mol Immunol 2009; 47:3-7.
113. Mangan PR, Harrington LE, O'Quinn DB, Helms WS, Bullard DC, Elson CO, et al. Transforming
growth factor-beta induces development of the T(H)17 lineage. Nature 2006; 441:231-4.
114. Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B. TGFbeta in the context of an
inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells.
Immunity 2006; 24:179-89.
115. Cosmi L, Maggi L, Santarlasci V, Capone M, Cardilicchia E, Frosali F, et al. Identification of a
novel subset of human circulating memory CD4(+) T cells that produce both IL-17A and IL-4. J
Allergy Clin Immunol 2010; 125:222-30.e1-4.
116. Wang YH, Voo KS, Liu B, Chen CY, Uygungil B, Spoede W, et al. A novel subset of CD4(+)
T(H)2 memory/effector cells that produce inflammatory IL-17 cytokine and promote the
exacerbation of chronic allergic asthma. J Exp Med 2010; 207:2479-91.
117. Irvin C, Zafar I, Good J, Rollins D, Christianson C, Gorska MM, et al. Increased frequency of
dual-positive TH2/TH17 cells in bronchoalveolar lavage fluid characterizes a population of
patients with severe asthma. J Allergy Clin Immunol 2014; 134:1175-86.e7.
132 118. Mathew A, MacLean JA, DeHaan E, Tager AM, Green FH, Luster AD. Signal transducer and
activator of transcription 6 controls chemokine production and T helper cell type 2 cell trafficking
in allergic pulmonary inflammation. J Exp Med 2001; 193:1087-96.
119. Tomkinson A, Duez C, Lahn M, Gelfand EW. Adoptive transfer of T cells induces airway
hyperresponsiveness independently of airway eosinophilia but in a signal transducer and activator
of transcription 6-dependent manner. J Allergy Clin Immunol 2002; 109:810-6.
120. Gauchat JF, Schlagenhauf E, Feng NP, Moser R, Yamage M, Jeannin P, et al. A novel 4-kb
interleukin-13 receptor alpha mRNA expressed in human B, T, and endothelial cells encoding an
alternate type-II interleukin-4/interleukin-13 receptor. Eur J Immunol 1997; 27:971-8.
121. Akaiwa M, Yu B, Umeshita-Suyama R, Terada N, Suto H, Koga T, et al. Localization of human
interleukin 13 receptor in non-haematopoietic cells. Cytokine 2001; 13:75-84.
122. Murata T, Husain SR, Mohri H, Puri RK. Two different IL-13 receptor chains are expressed in
normal human skin fibroblasts, and IL-4 and IL-13 mediate signal transduction through a
common pathway. Int Immunol 1998; 10:1103-10.
123. Ogata H, Ford D, Kouttab N, King TC, Vita N, Minty A, et al. Regulation of interleukin-13
receptor constituents on mature human B lymphocytes. J Biol Chem 1998; 273:9864-71.
124. Hoshino A, Tsuji T, Matsuzaki J, Jinushi T, Ashino S, Teramura T, et al. STAT6-mediated
signaling in Th2-dependent allergic asthma: critical role for the development of eosinophilia,
airway hyper-responsiveness and mucus hypersecretion, distinct from its role in Th2
differentiation. Int Immunol 2004; 16:1497-505.
125. Kuperman DA, Huang X, Koth LL, Chang GH, Dolganov GM, Zhu Z, et al. Direct effects of
interleukin-13 on epithelial cells cause airway hyperreactivity and mucus overproduction in
asthma. Nat Med 2002; 8:885-9.
126. Kuperman DA, Huang X, Nguyenvu L, Hölscher C, Brombacher F, Erle DJ. IL-4 receptor
signaling in Clara cells is required for allergen-induced mucus production. J Immunol 2005;
175:3746-52.
133 127. Kirstein F, Horsnell WG, Kuperman DA, Huang X, Erle DJ, Lopata AL, et al. Expression of IL-4
receptor alpha on smooth muscle cells is not necessary for development of experimental allergic
asthma. J Allergy Clin Immunol 2010; 126:347-54.
128. Perkins C, Yanase N, Smulian G, Gildea L, Orekov T, Potter C, et al. Selective stimulation of IL-
4 receptor on smooth muscle induces airway hyperresponsiveness in mice. J Exp Med 2011;
208:853-67.
129. Kruse N, Tony HP, Sebald W. Conversion of human interleukin-4 into a high affinity antagonist
by a single amino acid replacement. EMBO J 1992; 11:3237-44.
130. Aversa G, Punnonen J, Cocks BG, de Waal Malefyt R, Vega F, Zurawski SM, et al. An
interleukin 4 (IL-4) mutant protein inhibits both IL-4 or IL-13-induced human immunoglobulin
G4 (IgG4) and IgE synthesis and B cell proliferation: support for a common component shared by
IL-4 and IL-13 receptors. J Exp Med 1993; 178:2213-8.
131. Fish SC, Donaldson DD, Goldman SJ, Williams CM, Kasaian MT. IgE generation and mast cell
effector function in mice deficient in IL-4 and IL-13. J Immunol 2005; 174:7716-24.
132. Ramalingam TR, Pesce JT, Sheikh F, Cheever AW, Mentink-Kane MM, Wilson MS, et al.
Unique functions of the type II interleukin 4 receptor identified in mice lacking the interleukin 13
receptor alpha1 chain. Nat Immunol 2008; 9:25-33.
133. Urban JF, Noben-Trauth N, Donaldson DD, Madden KB, Morris SC, Collins M, et al. IL-13, IL-
4Ralpha, and Stat6 are required for the expulsion of the gastrointestinal nematode parasite
Nippostrongylus brasiliensis. Immunity 1998; 8:255-64.
134. LaPorte SL, Juo ZS, Vaclavikova J, Colf LA, Qi X, Heller NM, et al. Molecular and structural
basis of cytokine receptor pleiotropy in the interleukin-4/13 system. Cell 2008; 132:259-72.
135. Liang HE, Reinhardt RL, Bando JK, Sullivan BM, Ho IC, Locksley RM. Divergent expression
patterns of IL-4 and IL-13 define unique functions in allergic immunity. Nat Immunol 2011;
13:58-66.
134 136. Neill DR, Wong SH, Bellosi A, Flynn RJ, Daly M, Langford TK, et al. Nuocytes represent a new
innate effector leukocyte that mediates type-2 immunity. Nature 2010; 464:1367-70.
137. Price AE, Liang HE, Sullivan BM, Reinhardt RL, Eisley CJ, Erle DJ, et al. Systemically
dispersed innate IL-13-expressing cells in type 2 immunity. Proc Natl Acad Sci U S A 2010;
107:11489-94.
138. Chiaramonte MG, Mentink-Kane M, Jacobson BA, Cheever AW, Whitters MJ, Goad ME, et al.
Regulation and function of the interleukin 13 receptor alpha 2 during a T helper cell type 2-
dominant immune response. J Exp Med 2003; 197:687-701.
139. Daines MO, Hershey GK. A novel mechanism by which interferon-gamma can regulate
interleukin (IL)-13 responses. Evidence for intracellular stores of IL-13 receptor alpha -2 and
their rapid mobilization by interferon-gamma. J Biol Chem 2002; 277:10387-93.
140. Wood N, Whitters MJ, Jacobson BA, Witek J, Sypek JP, Kasaian M, et al. Enhanced interleukin
(IL)-13 responses in mice lacking IL-13 receptor alpha 2. J Exp Med 2003; 197:703-9.
141. Fichtner-Feigl S, Strober W, Kawakami K, Puri RK, Kitani A. IL-13 signaling through the IL-
13alpha2 receptor is involved in induction of TGF-beta1 production and fibrosis. Nat Med 2006;
12:99-106.
142. He CH, Lee CG, Dela Cruz CS, Lee CM, Zhou Y, Ahangari F, et al. Chitinase 3-like 1 regulates
cellular and tissue responses via IL-13 receptor α2. Cell Rep 2013; 4:830-41.
143. Chen W, Sivaprasad U, Gibson AM, Ericksen MB, Cunningham CM, Bass SA, et al. IL-13
receptor α2 contributes to development of experimental allergic asthma. J Allergy Clin Immunol
2013; 132:951-8.e1-6.
144. Kim JY, Sohn JH, Choi JM, Lee JH, Hong CS, Lee JS, et al. Alveolar macrophages play a key
role in cockroach-induced allergic inflammation via TNF-α pathway. PLoS One 2012; 7:e47971.
145. Vanoirbeek JA, Rinaldi M, De Vooght V, Haenen S, Bobic S, Gayan-Ramirez G, et al.
Noninvasive and invasive pulmonary function in mouse models of obstructive and restrictive
respiratory diseases. Am J Respir Cell Mol Biol 2010; 42:96-104.
135 146. Kibe A, Inoue H, Fukuyama S, Machida K, Matsumoto K, Koto H, et al. Differential regulation
by glucocorticoid of interleukin-13-induced eosinophilia, hyperresponsiveness, and goblet cell
hyperplasia in mouse airways. Am J Respir Crit Care Med 2003; 167:50-6.
147. Eum SY, Maghni K, Tolloczko B, Eidelman DH, Martin JG. IL-13 may mediate allergen-induced
hyperresponsiveness independently of IL-5 or eotaxin by effects on airway smooth muscle. Am J
Physiol Lung Cell Mol Physiol 2005; 288:L576-84.
148. Erle DJ, Sheppard D. The cell biology of asthma. J Cell Biol 2014; 205:621-31.
149. Shore SA. Direct effects of Th2 cytokines on airway smooth muscle. Curr Opin Pharmacol 2004;
4:235-40.
150. Chiba Y, Nakazawa S, Todoroki M, Shinozaki K, Sakai H, Misawa M. Interleukin-13 augments
bronchial smooth muscle contractility with an up-regulation of RhoA protein. Am J Respir Cell
Mol Biol 2009; 40:159-67.
151. Deshpande DA, Dogan S, Walseth TF, Miller SM, Amrani Y, Panettieri RA, et al. Modulation of
calcium signaling by interleukin-13 in human airway smooth muscle: role of CD38/cyclic
adenosine diphosphate ribose pathway. Am J Respir Cell Mol Biol 2004; 31:36-42.
152. Martin JG, Duguet A, Eidelman DH. The contribution of airway smooth muscle to airway
narrowing and airway hyperresponsiveness in disease. Eur Respir J 2000; 16:349-54.
153. Lambert RK, Wiggs BR, Kuwano K, Hogg JC, Paré PD. Functional significance of increased
airway smooth muscle in asthma and COPD. J Appl Physiol (1985) 1993; 74:2771-81.
154. Espinosa K, Bossé Y, Stankova J, Rola-Pleszczynski M. CysLT1 receptor upregulation by TGF-
beta and IL-13 is associated with bronchial smooth muscle cell proliferation in response to LTD4.
J Allergy Clin Immunol 2003; 111:1032-40.
155. Parameswaran K, Cox G, Radford K, Janssen LJ, Sehmi R, O'Byrne PM. Cysteinyl leukotrienes
promote human airway smooth muscle migration. Am J Respir Crit Care Med 2002; 166:738-42.
156. Elias JA. Airway remodeling in asthma. Unanswered questions. Am J Respir Crit Care Med
2000; 161:S168-71.
136 157. Doucet C, Brouty-Boyé D, Pottin-Clémenceau C, Canonica GW, Jasmin C, Azzarone B.
Interleukin (IL) 4 and IL-13 act on human lung fibroblasts. Implication in asthma. J Clin Invest
1998; 101:2129-39.
158. Oriente A, Fedarko NS, Pacocha SE, Huang SK, Lichtenstein LM, Essayan DM. Interleukin-13
modulates collagen homeostasis in human skin and keloid fibroblasts. J Pharmacol Exp Ther
2000; 292:988-94.
159. Lee CG, Homer RJ, Zhu Z, Lanone S, Wang X, Koteliansky V, et al. Interleukin-13 induces
tissue fibrosis by selectively stimulating and activating transforming growth factor beta(1). J Exp
Med 2001; 194:809-21.
160. Minshall EM, Leung DY, Martin RJ, Song YL, Cameron L, Ernst P, et al. Eosinophil-associated
TGF-beta1 mRNA expression and airways fibrosis in bronchial asthma. Am J Respir Cell Mol
Biol 1997; 17:326-33.
161. Ohno I, Nitta Y, Yamauchi K, Hoshi H, Honma M, Woolley K, et al. Transforming growth factor
beta 1 (TGF beta 1) gene expression by eosinophils in asthmatic airway inflammation. Am J
Respir Cell Mol Biol 1996; 15:404-9.
162. Fulkerson PC, Fischetti CA, Rothenberg ME. Eosinophils and CCR3 regulate interleukin-13
transgene-induced pulmonary remodeling. Am J Pathol 2006; 169:2117-26.
163. Barron L, Smith AM, El Kasmi KC, Qualls JE, Huang X, Cheever A, et al. Role of arginase 1
from myeloid cells in th2-dominated lung inflammation. PLoS One 2013; 8:e61961.
164. Wang HY, Paul WE, Keegan AD. IL-4 function can be transferred to the IL-2 receptor by
tyrosine containing sequences found in the IL-4 receptor alpha chain. Immunity 1996; 4:113-21.
165. Mikita T, Campbell D, Wu P, Williamson K, Schindler U. Requirements for interleukin-4-
induced gene expression and functional characterization of Stat6. Mol Cell Biol 1996; 16:5811-
20.
166. Chen HC, Reich NC. Live cell imaging reveals continuous STAT6 nuclear trafficking. J Immunol
2010; 185:64-70.
137 167. Fenghao X, Saxon A, Nguyen A, Ke Z, Diaz-Sanchez D, Nel A. Interleukin 4 activates a signal
transducer and activator of transcription (Stat) protein which interacts with an interferon-gamma
activation site-like sequence upstream of the I epsilon exon in a human B cell line. Evidence for
the involvement of Janus kinase 3 and interleukin-4 Stat. J Clin Invest 1995; 96:907-14.
168. Schindler U, Wu P, Rothe M, Brasseur M, McKnight SL. Components of a Stat recognition code:
evidence for two layers of molecular selectivity. Immunity 1995; 2:689-97.
169. Wei L, Vahedi G, Sun HW, Watford WT, Takatori H, Ramos HL, et al. Discrete roles of STAT4
and STAT6 transcription factors in tuning epigenetic modifications and transcription during T
helper cell differentiation. Immunity 2010; 32:840-51.
170. Schroder AJ, Pavlidis P, Arimura A, Capece D, Rothman PB. Cutting edge: STAT6 serves as a
positive and negative regulator of gene expression in IL-4-stimulated B lymphocytes. J Immunol
2002; 168:996-1000.
171. Chen Z, Lund R, Aittokallio T, Kosonen M, Nevalainen O, Lahesmaa R. Identification of novel
IL-4/Stat6-regulated genes in T lymphocytes. J Immunol 2003; 171:3627-35.
172. Lee JH, Kaminski N, Dolganov G, Grunig G, Koth L, Solomon C, et al. Interleukin-13 induces
dramatically different transcriptional programs in three human airway cell types. Am J Respir
Cell Mol Biol 2001; 25:474-85.
173. Iciek LA, Delphin SA, Stavnezer J. CD40 cross-linking induces Ig epsilon germline transcripts in
B cells via activation of NF-kappaB: synergy with IL-4 induction. J Immunol 1997; 158:4769-79.
174. Lawrence T, Natoli G. Transcriptional regulation of macrophage polarization: enabling diversity
with identity. Nat Rev Immunol 2011; 11:750-61.
175. Thai P, Chen Y, Dolganov G, Wu R. Differential regulation of MUC5AC/Muc5ac and hCLCA-
1/mGob-5 expression in airway epithelium. Am J Respir Cell Mol Biol 2005; 33:523-30.
176. Dabbagh K, Takeyama K, Lee HM, Ueki IF, Lausier JA, Nadel JA. IL-4 induces mucin gene
expression and goblet cell metaplasia in vitro and in vivo. J Immunol 1999; 162:6233-7.
138 177. Matsukura S, Stellato C, Plitt JR, Bickel C, Miura K, Georas SN, et al. Activation of eotaxin gene
transcription by NF-kappa B and STAT6 in human airway epithelial cells. J Immunol 1999;
163:6876-83.
178. Kanai A, Suzuki K, Tanimoto K, Mizushima-Sugano J, Suzuki Y, Sugano S. Characterization of
STAT6 target genes in human B cells and lung epithelial cells. DNA Res 2011; 18:379-92.
179. Delphin S, Stavnezer J. Characterization of an interleukin 4 (IL-4) responsive region in the
immunoglobulin heavy chain germline epsilon promoter: regulation by NF-IL-4, a C/EBP family
member and NF-kappa B/p50. J Exp Med 1995; 181:181-92.
180. Mikita T, Kurama M, Schindler U. Synergistic activation of the germline epsilon promoter
mediated by Stat6 and C/EBP beta. J Immunol 1998; 161:1822-8.
181. Tinnell SB, Jacobs-Helber SM, Sterneck E, Sawyer ST, Conrad DH. STAT6, NF-kappaB and
C/EBP in CD23 expression and IgE production. Int Immunol 1998; 10:1529-38.
182. Richards ML, Katz DH. Analysis of the promoter elements necessary for IL-4 and anti-CD40
antibody induction of murine Fc epsilon RII (CD23): comparison with the germline epsilon
promoter. J Immunol 1997; 158:263-72.
183. Messner B, Stütz AM, Albrecht B, Peiritsch S, Woisetschläger M. Cooperation of binding sites
for STAT6 and NF kappa B/rel in the IL-4-induced up-regulation of the human IgE germline
promoter. J Immunol 1997; 159:3330-7.
184. Pesu M, Aittomäki S, Välineva T, Silvennoinen O. PU.1 is required for transcriptional activation
of the Stat6 response element in the Igepsilon promoter. Eur J Immunol 2003; 33:1727-35.
185. Stütz AM, Woisetschläger M. Functional synergism of STAT6 with either NF-kappa B or PU.1
to mediate IL-4-induced activation of IgE germline gene transcription. J Immunol 1999;
163:4383-91.
186. Shen CH, Stavnezer J. Activation of the mouse Ig germline epsilon promoter by IL-4 is
dependent on AP-1 transcription factors. J Immunol 2001; 166:411-23.
139 187. Heller NM, Qi X, Junttila IS, Shirey KA, Vogel SN, Paul WE, et al. Type I IL-4Rs selectively
activate IRS-2 to induce target gene expression in macrophages. Sci Signal 2008; 1:ra17.
188. Umeshita-Suyama R, Sugimoto R, Akaiwa M, Arima K, Yu B, Wada M, et al. Characterization
of IL-4 and IL-13 signals dependent on the human IL-13 receptor alpha chain 1: redundancy of
requirement of tyrosine residue for STAT3 activation. Int Immunol 2000; 12:1499-509.
189. Wery-Zennaro S, Letourneur M, David M, Bertoglio J, Pierre J. Binding of IL-4 to the IL-
13Ralpha(1)/IL-4Ralpha receptor complex leads to STAT3 phosphorylation but not to its nuclear
translocation. FEBS Lett 1999; 464:91-6.
190. Sozzani P, Hasan L, Séguélas MH, Caput D, Ferrara P, Pipy B, et al. IL-13 induces tyrosine
phosphorylation of phospholipase C gamma-1 following IRS-2 association in human monocytes:
relationship with the inhibitory effect of IL-13 on ROI production. Biochem Biophys Res
Commun 1998; 244:665-70.
191. Lu B, Reichel M, Fisher DA, Smith JF, Rothman P. Identification of a STAT6 domain required
for IL-4-induced activation of transcription. J Immunol 1997; 159:1255-64.
192. Pesu M, Aittomäki S, Takaluoma K, Lagerstedt A, Silvennoinen O. p38 Mitogen-activated
protein kinase regulates interleukin-4-induced gene expression by stimulating STAT6-mediated
transcription. J Biol Chem 2002; 277:38254-61.
193. Dickensheets HL, Venkataraman C, Schindler U, Donnelly RP. Interferons inhibit activation of
STAT6 by interleukin 4 in human monocytes by inducing SOCS-1 gene expression. Proc Natl
Acad Sci U S A 1999; 96:10800-5.
194. Hebenstreit D, Luft P, Schmiedlechner A, Duschl A, Horejs-Hoeck J. SOCS-1 and SOCS-3
inhibit IL-4 and IL-13 induced activation of Eotaxin-3/CCL26 gene expression in HEK293 cells.
Mol Immunol 2005; 42:295-303.
195. Woetmann A, Brockdorff J, Lovato P, Nielsen M, Leick V, Rieneck K, et al. Protein phosphatase
2A (PP2A) regulates interleukin-4-mediated STAT6 signaling. J Biol Chem 2003; 278:2787-91.
140 196. Lu X, Malumbres R, Shields B, Jiang X, Sarosiek KA, Natkunam Y, et al. PTP1B is a negative
regulator of interleukin 4-induced STAT6 signaling. Blood 2008; 112:4098-108.
197. Tachdjian R, Al Khatib S, Schwinglshackl A, Kim HS, Chen A, Blasioli J, et al. In vivo
regulation of the allergic response by the IL-4 receptor alpha chain immunoreceptor tyrosine-
based inhibitory motif. J Allergy Clin Immunol 2010; 125:1128-36.e8.
198. Kamata T, Yamashita M, Kimura M, Murata K, Inami M, Shimizu C, et al. src homology 2
domain-containing tyrosine phosphatase SHP-1 controls the development of allergic airway
inflammation. J Clin Invest 2003; 111:109-19.
199. Ward JM. Pulmonary pathology of the motheaten mouse. Vet Pathol 1978; 15:170-8.
200. Rossi GA, Hunninghake GW, Kawanami O, Ferrans VJ, Hansen CT, Crystal RG. Motheaten
mice--an animal model with an inherited form of interstitial lung disease. Am Rev Respir Dis
1985; 131:150-8.
201. Oh SY, Zheng T, Kim YK, Cohn L, Homer RJ, McKenzie AN, et al. A critical role of SHP-1 in
regulation of type 2 inflammation in the lung. Am J Respir Cell Mol Biol 2009; 40:568-74.
202. Kashiwada M, Giallourakis CC, Pan PY, Rothman PB. Immunoreceptor tyrosine-based inhibitory
motif of the IL-4 receptor associates with SH2-containing phosphatases and regulates IL-4-
induced proliferation. J Immunol 2001; 167:6382-7.
203. Hanson EM, Dickensheets H, Qu CK, Donnelly RP, Keegan AD. Regulation of the
dephosphorylation of Stat6. Participation of Tyr-713 in the interleukin-4 receptor alpha, the
tyrosine phosphatase SHP-1, and the proteasome. J Biol Chem 2003; 278:3903-11.
204. Haque SJ, Harbor P, Tabrizi M, Yi T, Williams BR. Protein-tyrosine phosphatase Shp-1 is a
negative regulator of IL-4- and IL-13-dependent signal transduction. J Biol Chem 1998;
273:33893-6.
205. Rouvier E, Luciani MF, Mattéi MG, Denizot F, Golstein P. CTLA-8, cloned from an activated T
cell, bearing AU-rich messenger RNA instability sequences, and homologous to a herpesvirus
saimiri gene. J Immunol 1993; 150:5445-56.
141 206. Yao Z, Fanslow WC, Seldin MF, Rousseau AM, Painter SL, Comeau MR, et al. Herpesvirus
saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. J Immunol
2011; 187:4392-402.
207. Gaffen SL. Structure and signalling in the IL-17 receptor family. Nat Rev Immunol 2009; 9:556-
67.
208. Gaffen SL. An overview of IL-17 function and signaling. Cytokine 2008; 43:402-7.
209. Chang SH, Dong C. Signaling of interleukin-17 family cytokines in immunity and inflammation.
Cell Signal 2011; 23:1069-75.
210. Zhu S, Qian Y. IL-17/IL-17 receptor system in autoimmune disease: mechanisms and therapeutic
potential. Clin Sci (Lond) 2012; 122:487-511.
211. Toy D, Kugler D, Wolfson M, Vanden Bos T, Gurgel J, Derry J, et al. Cutting edge: interleukin
17 signals through a heteromeric receptor complex. J Immunol 2006; 177:36-9.
212. Yang XO, Chang SH, Park H, Nurieva R, Shah B, Acero L, et al. Regulation of inflammatory
responses by IL-17F. J Exp Med 2008; 205:1063-75.
213. Wright JF, Bennett F, Li B, Brooks J, Luxenberg DP, Whitters MJ, et al. The human IL-17F/IL-
17A heterodimeric cytokine signals through the IL-17RA/IL-17RC receptor complex. J Immunol
2008; 181:2799-805.
214. Chang SH, Dong C. A novel heterodimeric cytokine consisting of IL-17 and IL-17F regulates
inflammatory responses. Cell Res 2007; 17:435-40.
215. Kuestner RE, Taft DW, Haran A, Brandt CS, Brender T, Lum K, et al. Identification of the IL-17
receptor related molecule IL-17RC as the receptor for IL-17F. J Immunol 2007; 179:5462-73.
216. Ho AW, Gaffen SL. IL-17RC: a partner in IL-17 signaling and beyond. Semin Immunopathol
2010; 32:33-42.
217. Ishigame H, Kakuta S, Nagai T, Kadoki M, Nambu A, Komiyama Y, et al. Differential roles of
interleukin-17A and -17F in host defense against mucoepithelial bacterial infection and allergic
responses. Immunity 2009; 30:108-19.
142 218. Li H, Chen J, Huang A, Stinson J, Heldens S, Foster J, et al. Cloning and characterization of IL-
17B and IL-17C, two new members of the IL-17 cytokine family. Proc Natl Acad Sci U S A
2000; 97:773-8.
219. Yamaguchi Y, Fujio K, Shoda H, Okamoto A, Tsuno NH, Takahashi K, et al. IL-17B and IL-17C
are associated with TNF-alpha production and contribute to the exacerbation of inflammatory
arthritis. J Immunol 2007; 179:7128-36.
220. Starnes T, Broxmeyer HE, Robertson MJ, Hromas R. Cutting edge: IL-17D, a novel member of
the IL-17 family, stimulates cytokine production and inhibits hemopoiesis. J Immunol 2002;
169:642-6.
221. Maitra A, Shen F, Hanel W, Mossman K, Tocker J, Swart D, et al. Distinct functional motifs
within the IL-17 receptor regulate signal transduction and target gene expression. Proc Natl Acad
Sci U S A 2007; 104:7506-11.
222. Onishi RM, Park SJ, Hanel W, Ho AW, Maitra A, Gaffen SL. SEF/IL-17R (SEFIR) is not
enough: an extended SEFIR domain is required for il-17RA-mediated signal transduction. J Biol
Chem 2010; 285:32751-9.
223. Chang SH, Park H, Dong C. Act1 adaptor protein is an immediate and essential signaling
component of interleukin-17 receptor. J Biol Chem 2006; 281:35603-7.
224. Qian Y, Liu C, Hartupee J, Altuntas CZ, Gulen MF, Jane-Wit D, et al. The adaptor Act1 is
required for interleukin 17-dependent signaling associated with autoimmune and inflammatory
disease. Nat Immunol 2007; 8:247-56.
225. Wong CK, Ho CY, Ko FW, Chan CH, Ho AS, Hui DS, et al. Proinflammatory cytokines (IL-17,
IL-6, IL-18 and IL-12) and Th cytokines (IFN-gamma, IL-4, IL-10 and IL-13) in patients with
allergic asthma. Clin Exp Immunol 2001; 125:177-83.
226. Molet S, Hamid Q, Davoine F, Nutku E, Taha R, Pagé N, et al. IL-17 is increased in asthmatic
airways and induces human bronchial fibroblasts to produce cytokines. J Allergy Clin Immunol
2001; 108:430-8.
143 227. Hoshino H, Laan M, Sjöstrand M, Lötvall J, Skoogh BE, Linden A. Increased elastase and
myeloperoxidase activity associated with neutrophil recruitment by IL-17 in airways in vivo. J
Allergy Clin Immunol 2000; 105:143-9.
228. Ye P, Rodriguez FH, Kanaly S, Stocking KL, Schurr J, Schwarzenberger P, et al. Requirement of
interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating
factor expression, neutrophil recruitment, and host defense. J Exp Med 2001; 194:519-27.
229. Zhao J, Lloyd CM, Noble A. Th17 responses in chronic allergic airway inflammation abrogate
regulatory T-cell-mediated tolerance and contribute to airway remodeling. Mucosal Immunol
2013; 6:335-46.
230. Baines KJ, Simpson JL, Bowden NA, Scott RJ, Gibson PG. Differential gene expression and
cytokine production from neutrophils in asthma phenotypes. Eur Respir J 2010; 35:522-31.
231. Nagasaki T, Matsumoto H, Kanemitsu Y, Izuhara K, Tohda Y, Kita H, et al. Integrating
longitudinal information on pulmonary function and inflammation using asthma phenotypes. J
Allergy Clin Immunol 2014; 133:1474-7, 7.e1-2.
232. Manni ML, Trudeau JB, Scheller EV, Mandalapu S, Elloso MM, Kolls JK, et al. The complex
relationship between inflammation and lung function in severe asthma. Mucosal Immunol 2014;
7:1186-98.
233. Vazquez-Tello A, Halwani R, Hamid Q, Al-Muhsen S. Glucocorticoid receptor-beta up-
regulation and steroid resistance induction by IL-17 and IL-23 cytokine stimulation in peripheral
mononuclear cells. J Clin Immunol 2013; 33:466-78.
234. Gupta A, Dimeloe S, Richards DF, Chambers ES, Black C, Urry Z, et al. Defective IL-10
expression and in vitro steroid-induced IL-17A in paediatric severe therapy-resistant asthma.
Thorax 2014; 69:508-15.
235. Fujisawa T, Velichko S, Thai P, Hung LY, Huang F, Wu R. Regulation of airway MUC5AC
expression by IL-1beta and IL-17A; the NF-kappaB paradigm. J Immunol 2009; 183:6236-43.
144 236. Chen Y, Thai P, Zhao YH, Ho YS, DeSouza MM, Wu R. Stimulation of airway mucin gene
expression by interleukin (IL)-17 through IL-6 paracrine/autocrine loop. J Biol Chem 2003;
278:17036-43.
237. Kudo M, Melton AC, Chen C, Engler MB, Huang KE, Ren X, et al. IL-17A produced by αβ T
cells drives airway hyper-responsiveness in mice and enhances mouse and human airway smooth
muscle contraction. Nat Med 2012; 18:547-54.
238. Chakir J, Shannon J, Molet S, Fukakusa M, Elias J, Laviolette M, et al. Airway remodeling-
associated mediators in moderate to severe asthma: effect of steroids on TGF-beta, IL-11, IL-17,
and type I and type III collagen expression. J Allergy Clin Immunol 2003; 111:1293-8.
239. Murdoch JR, Lloyd CM. Resolution of allergic airway inflammation and airway hyperreactivity
is mediated by IL-17-producing {gamma}{delta}T cells. Am J Respir Crit Care Med 2010;
182:464-76.
240. Kinyanjui MW, Shan J, Nakada EM, Qureshi ST, Fixman ED. Dose-dependent effects of IL-17
on IL-13-induced airway inflammatory responses and airway hyperresponsiveness. J Immunol
2013; 190:3859-68.
241. Andersson CK, Adams A, Nagakumar P, Bossley C, Gupta A, De Vries D, et al. Intraepithelial
neutrophils in pediatric severe asthma are associated with better lung function. J Allergy Clin
Immunol 2017; 139:1819-29.e11.
242. Shen F, Hu Z, Goswami J, Gaffen SL. Identification of common transcriptional regulatory
elements in interleukin-17 target genes. J Biol Chem 2006; 281:24138-48.
243. Ruddy MJ, Wong GC, Liu XK, Yamamoto H, Kasayama S, Kirkwood KL, et al. Functional
cooperation between interleukin-17 and tumor necrosis factor-alpha is mediated by
CCAAT/enhancer-binding protein family members. J Biol Chem 2004; 279:2559-67.
244. Doreau A, Belot A, Bastid J, Riche B, Trescol-Biemont MC, Ranchin B, et al. Interleukin 17 acts
in synergy with B cell-activating factor to influence B cell biology and the pathophysiology of
systemic lupus erythematosus. Nat Immunol 2009; 10:778-85.
145 245. Rickel EA, Siegel LA, Yoon BR, Rottman JB, Kugler DG, Swart DA, et al. Identification of
functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol
2008; 181:4299-310.
246. Bordon Y. Cytokines: IL-17C joins the family firm. Nat Rev Immunol 2011; 11:805.
247. Shen F, Li N, Gade P, Kalvakolanu DV, Weibley T, Doble B, et al. IL-17 receptor signaling
inhibits C/EBPbeta by sequential phosphorylation of the regulatory 2 domain. Sci Signal 2009;
2:ra8.
248. Zhu S, Pan W, Shi P, Gao H, Zhao F, Song X, et al. Modulation of experimental autoimmune
encephalomyelitis through TRAF3-mediated suppression of interleukin 17 receptor signaling. J
Exp Med 2010; 207:2647-62.
249. Shen F, Ruddy MJ, Plamondon P, Gaffen SL. Cytokines link osteoblasts and inflammation:
microarray analysis of interleukin-17- and TNF-alpha-induced genes in bone cells. J Leukoc Biol
2005; 77:388-99.
250. Liang SC, Tan XY, Luxenberg DP, Karim R, Dunussi-Joannopoulos K, Collins M, et al.
Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance
expression of antimicrobial peptides. J Exp Med 2006; 203:2271-9.
251. Tohyama M, Hanakawa Y, Shirakata Y, Dai X, Yang L, Hirakawa S, et al. IL-17 and IL-22
mediate IL-20 subfamily cytokine production in cultured keratinocytes via increased IL-22
receptor expression. Eur J Immunol 2009; 39:2779-88.
252. Chabaud M, Fossiez F, Taupin JL, Miossec P. Enhancing effect of IL-17 on IL-1-induced IL-6
and leukemia inhibitory factor production by rheumatoid arthritis synoviocytes and its regulation
by Th2 cytokines. J Immunol 1998; 161:409-14.
253. Eid RE, Rao DA, Zhou J, Lo SF, Ranjbaran H, Gallo A, et al. Interleukin-17 and interferon-
gamma are produced concomitantly by human coronary artery-infiltrating T cells and act
synergistically on vascular smooth muscle cells. Circulation 2009; 119:1424-32.
146 254. Ma X, Reynolds SL, Baker BJ, Li X, Benveniste EN, Qin H. IL-17 enhancement of the IL-6
signaling cascade in astrocytes. J Immunol 2010; 184:4898-906.
255. Zrioual S, Ecochard R, Tournadre A, Lenief V, Cazalis MA, Miossec P. Genome-wide
comparison between IL-17A- and IL-17F-induced effects in human rheumatoid arthritis
synoviocytes. J Immunol 2009; 182:3112-20.
256. Bhatt D, Ghosh S. Regulation of the NF-κB-Mediated Transcription of Inflammatory Genes.
Front Immunol 2014; 5:71.
257. Hartupee J, Liu C, Novotny M, Sun D, Li X, Hamilton TA. IL-17 signaling for mRNA
stabilization does not require TNF receptor-associated factor 6. J Immunol 2009; 182:1660-6.
258. Liu Y, Mei J, Gonzales L, Yang G, Dai N, Wang P, et al. IL-17A and TNF-α exert synergistic
effects on expression of CXCL5 by alveolar type II cells in vivo and in vitro. J Immunol 2011;
186:3197-205.
259. Datta S, Novotny M, Pavicic PG, Zhao C, Herjan T, Hartupee J, et al. IL-17 regulates CXCL1
mRNA stability via an AUUUA/tristetraprolin-independent sequence. J Immunol 2010;
184:1484-91.
260. Karlsen JR, Borregaard N, Cowland JB. Induction of neutrophil gelatinase-associated lipocalin
expression by co-stimulation with interleukin-17 and tumor necrosis factor-alpha is controlled by
IkappaB-zeta but neither by C/EBP-beta nor C/EBP-delta. J Biol Chem 2010; 285:14088-100.
261. Bulek K, Liu C, Swaidani S, Wang L, Page RC, Gulen MF, et al. The inducible kinase IKKi is
required for IL-17-dependent signaling associated with neutrophilia and pulmonary inflammation.
Nat Immunol 2011; 12:844-52.
262. Sun D, Novotny M, Bulek K, Liu C, Li X, Hamilton T. Treatment with IL-17 prolongs the half-
life of chemokine CXCL1 mRNA via the adaptor TRAF5 and the splicing-regulatory factor SF2
(ASF). Nat Immunol 2011; 12:853-60.
263. Zepp JA, Liu C, Qian W, Wu L, Gulen MF, Kang Z, et al. Cutting edge: TNF receptor-associated
factor 4 restricts IL-17-mediated pathology and signaling processes. J Immunol 2012; 189:33-7.
147 264. Zhong B, Liu X, Wang X, Chang SH, Wang A, Reynolds JM, et al. Negative regulation of IL-17-
mediated signaling and inflammation by the ubiquitin-specific protease USP25. Nat Immunol
2012; 13:1110-7.
265. Garg AV, Ahmed M, Vallejo AN, Ma A, Gaffen SL. The deubiquitinase A20 mediates feedback
inhibition of interleukin-17 receptor signaling. Sci Signal 2013; 6:ra44.
266. Rong Z, Wang A, Li Z, Ren Y, Cheng L, Li Y, et al. IL-17RD (Sef or IL-17RLM) interacts with
IL-17 receptor and mediates IL-17 signaling. Cell Res 2009; 19:208-15.
267. Mellett M, Atzei P, Horgan A, Hams E, Floss T, Wurst W, et al. Orphan receptor IL-17RD tunes
IL-17A signalling and is required for neutrophilia. Nat Commun 2012; 3:1119.
268. Han D, Walsh MC, Cejas PJ, Dang NN, Kim YF, Kim J, et al. Dendritic cell expression of the
signaling molecule TRAF6 is critical for gut microbiota-dependent immune tolerance. Immunity
2013; 38:1211-22.
269. Xie P, Stunz LL, Larison KD, Yang B, Bishop GA. Tumor necrosis factor receptor-associated
factor 3 is a critical regulator of B cell homeostasis in secondary lymphoid organs. Immunity
2007; 27:253-67.
270. Guajardo JR, Schleifer KW, Daines MO, Ruddy RM, Aronow BJ, Wills-Karp M, et al. Altered
gene expression profiles in nasal respiratory epithelium reflect stable versus acute childhood
asthma. J Allergy Clin Immunol 2005; 115:243-51.
271. Ahn S, Olive M, Aggarwal S, Krylov D, Ginty DD, Vinson C. A dominant-negative inhibitor of
CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol Cell
Biol 1998; 18:967-77.
272. Pauleau AL, Rutschman R, Lang R, Pernis A, Watowich SS, Murray PJ. Enhancer-mediated
control of macrophage-specific arginase I expression. J Immunol 2004; 172:7565-73.
273. Fu Y, Frith MC, Haverty PM, Weng Z. MotifViz: an analysis and visualization tool for motif
discovery. Nucleic Acids Res 2004; 32:W420-3.
148 274. Messeguer X, Escudero R, Farré D, Núñez O, Martínez J, Albà MM. PROMO: detection of
known transcription regulatory elements using species-tailored searches. Bioinformatics 2002;
18:333-4.
275. Schug J. Using TESS to predict transcription factor binding sites in DNA sequence. Curr Protoc
Bioinformatics 2008; Chapter 2:Unit 2.6.
276. Jiang C, Xuan Z, Zhao F, Zhang MQ. TRED: a transcriptional regulatory element database, new
entries and other development. Nucleic Acids Res 2007; 35:D137-40.
277. Barczyk A, Pierzchala W, Sozañska E. Interleukin-17 in sputum correlates with airway
hyperresponsiveness to methacholine. Respir Med 2003; 97:726-33.
278. Henness S, Johnson CK, Ge Q, Armour CL, Hughes JM, Ammit AJ. IL-17A augments TNF-
alpha-induced IL-6 expression in airway smooth muscle by enhancing mRNA stability. J Allergy
Clin Immunol 2004; 114:958-64.
279. Pernis AB, Rothman PB. JAK-STAT signaling in asthma. J Clin Invest 2002; 109:1279-83.
280. Kuperman DA, Schleimer RP. Interleukin-4, interleukin-13, signal transducer and activator of
transcription factor 6, and allergic asthma. Curr Mol Med 2008; 8:384-92.
281. Hall SL, Baker T, Lajoie S, Richgels PK, Yang Y, McAlees JW, et al. IL-17A enhances IL-13
activity by enhancing IL-13-induced signal transducer and activator of transcription 6 activation.
J Allergy Clin Immunol 2017; 139:462-71.e14.
282. Niu Y, Murata T, Watanabe K, Kawakami K, Yoshimura A, Inoue J, et al. MIP-T3 associates
with IL-13Ralpha1 and suppresses STAT6 activation in response to IL-13 stimulation. FEBS Lett
2003; 550:139-43.
283. Chong ZZ, Maiese K. The Src homology 2 domain tyrosine phosphatases SHP-1 and SHP-2:
diversified control of cell growth, inflammation, and injury. Histol Histopathol 2007; 22:1251-67.
284. Mauldin IS, Tung KS, Lorenz UM. The tyrosine phosphatase SHP-1 dampens murine Th17
development. Blood 2012; 119:4419-29.
149 285. Christophi GP, Panos M, Hudson CA, Christophi RL, Gruber RC, Mersich AT, et al.
Macrophages of multiple sclerosis patients display deficient SHP-1 expression and enhanced
inflammatory phenotype. Lab Invest 2009; 89:742-59.
286. Schwandner R, Yamaguchi K, Cao Z. Requirement of tumor necrosis factor receptor-associated
factor (TRAF)6 in interleukin 17 signal transduction. J Exp Med 2000; 191:1233-40.
287. Green MC, Shultz LD. Motheaten, an immunodeficient mutant of the mouse. I. Genetics and
pathology. J Hered 1975; 66:250-8.
288. Shultz LD, Green MC. Motheaten, an immunodeficient mutant of the mouse. II. Depressed
immune competence and elevated serum immunoglobulins. J Immunol 1976; 116:936-43.
289. Van Zant G, Shultz L. Hematologic abnormalities of the immunodeficient mouse mutant, viable
motheaten (mev). Exp Hematol 1989; 17:81-7.
290. Zhang Q, Wang HY, Marzec M, Raghunath PN, Nagasawa T, Wasik MA. STAT3- and DNA
methyltransferase 1-mediated epigenetic silencing of SHP-1 tyrosine phosphatase tumor
suppressor gene in malignant T lymphocytes. Proc Natl Acad Sci U S A 2005; 102:6948-53.
291. Zhang Q, Raghunath PN, Vonderheid E, Odum N, Wasik MA. Lack of phosphotyrosine
phosphatase SHP-1 expression in malignant T-cell lymphoma cells results from methylation of
the SHP-1 promoter. Am J Pathol 2000; 157:1137-46.
292. Khoury JD, Rassidakis GZ, Medeiros LJ, Amin HM, Lai R. Methylation of SHP1 gene and loss
of SHP1 protein expression are frequent in systemic anaplastic large cell lymphoma. Blood 2004;
104:1580-1.
293. Wang Y, Zhu Z, Church TD, Lugogo NL, Que LG, Francisco D, et al. SHP-1 as a critical
regulator of Mycoplasma pneumoniae-induced inflammation in human asthmatic airway
epithelial cells. J Immunol 2012; 188:3371-81.
294. Wenzel SE, Balzar S, Ampleford E, Hawkins GA, Busse WW, Calhoun WJ, et al. IL4R alpha
mutations are associated with asthma exacerbations and mast cell/IgE expression. Am J Respir
Crit Care Med 2007; 175:570-6.
150 295. Zhang Z, Shen K, Lu W, Cole PA. The role of C-terminal tyrosine phosphorylation in the
regulation of SHP-1 explored via expressed protein ligation. J Biol Chem 2003; 278:4668-74.
296. Lu W, Gong D, Bar-Sagi D, Cole PA. Site-specific incorporation of a phosphotyrosine mimetic
reveals a role for tyrosine phosphorylation of SHP-2 in cell signaling. Mol Cell 2001; 8:759-69.
297. Brumell JH, Chan CK, Butler J, Borregaard N, Siminovitch KA, Grinstein S, et al. Regulation of
Src homology 2-containing tyrosine phosphatase 1 during activation of human neutrophils. Role
of protein kinase C. J Biol Chem 1997; 272:875-82.
298. Xiao Y, Qiao G, Tang J, Tang R, Guo H, Warwar S, et al. Protein Tyrosine Phosphatase SHP-1
Modulates T Cell Responses by Controlling Cbl-b Degradation. J Immunol 2015; 195:4218-27.
299. Qiao G, Ying H, Zhao Y, Liang Y, Guo H, Shen H, et al. E3 ubiquitin ligase Cbl-b suppresses
proallergic T cell development and allergic airway inflammation. Cell Rep 2014; 6:709-23.
300. Fawcett VC, Lorenz U. Localization of Src homology 2 domain-containing phosphatase 1 (SHP-
1) to lipid rafts in T lymphocytes: functional implications and a role for the SHP-1 carboxyl
terminus. J Immunol 2005; 174:2849-59.
301. Lacalle RA, Mira E, Gomez-Mouton C, Jimenez-Baranda S, Martinez-A C, Manes S. Specific
SHP-2 partitioning in raft domains triggers integrin-mediated signaling via Rho activation. J Cell
Biol 2002; 157:277-89.
302. Su MW, Yu CL, Burakoff SJ, Jin YJ. Targeting Src homology 2 domain-containing tyrosine
phosphatase (SHP-1) into lipid rafts inhibits CD3-induced T cell activation. J Immunol 2001;
166:3975-82.
303. Lai TY, Wu SD, Tsai MH, Chuang EY, Chuang LL, Hsu LC, et al. Transcription of Tnfaip3 is
regulated by NF-κB and p38 via C/EBPβ in activated macrophages. PLoS One 2013; 8:e73153.
304. Bradley MN, Zhou L, Smale ST. C/EBPbeta regulation in lipopolysaccharide-stimulated
macrophages. Mol Cell Biol 2003; 23:4841-58.
305. Olson CM, Hedrick MN, Izadi H, Bates TC, Olivera ER, Anguita J. p38 mitogen-activated
protein kinase controls NF-kappaB transcriptional activation and tumor necrosis factor alpha
151 production through RelA phosphorylation mediated by mitogen- and stress-activated protein
kinase 1 in response to Borrelia burgdorferi antigens. Infect Immun 2007; 75:270-7.
306. Schmeck B, Zahlten J, Moog K, van Laak V, Huber S, Hocke AC, et al. Streptococcus
pneumoniae-induced p38 MAPK-dependent phosphorylation of RelA at the interleukin-8
promotor. J Biol Chem 2004; 279:53241-7.
307. Saha RN, Jana M, Pahan K. MAPK p38 regulates transcriptional activity of NF-kappaB in
primary human astrocytes via acetylation of p65. J Immunol 2007; 179:7101-9.
308. Decker T, Kovarik P. Serine phosphorylation of STATs. Oncogene 2000; 19:2628-37.
309. Wang Y, Malabarba MG, Nagy ZS, Kirken RA. Interleukin 4 regulates phosphorylation of serine
756 in the transactivation domain of Stat6. Roles for multiple phosphorylation sites and Stat6
function. J Biol Chem 2004; 279:25196-203.
310. So EY, Oh J, Jang JY, Kim JH, Lee CE. Ras/Erk pathway positively regulates Jak1/STAT6
activity and IL-4 gene expression in Jurkat T cells. Mol Immunol 2007; 44:3416-26.
311. Sheridan DL, Kong Y, Parker SA, Dalby KN, Turk BE. Substrate discrimination among mitogen-
activated protein kinases through distinct docking sequence motifs. J Biol Chem 2008;
283:19511-20.
312. Irusen E, Matthews JG, Takahashi A, Barnes PJ, Chung KF, Adcock IM. p38 Mitogen-activated
protein kinase-induced glucocorticoid receptor phosphorylation reduces its activity: role in
steroid-insensitive asthma. J Allergy Clin Immunol 2002; 109:649-57.
313. Mercado N, Hakim A, Kobayashi Y, Meah S, Usmani OS, Chung KF, et al. Restoration of
corticosteroid sensitivity by p38 mitogen activated protein kinase inhibition in peripheral blood
mononuclear cells from severe asthma. PLoS One 2012; 7:e41582.
314. Mercado N, To Y, Kobayashi Y, Adcock IM, Barnes PJ, Ito K. p38 mitogen-activated protein
kinase-γ inhibition by long-acting β2 adrenergic agonists reversed steroid insensitivity in severe
asthma. Mol Pharmacol 2011; 80:1128-35.
152 315. Allen HB, Vaze ND, Choi C, Hailu T, Tulbert BH, Cusack CA, et al. The presence and impact of
biofilm-producing staphylococci in atopic dermatitis. JAMA Dermatol 2014; 150:260-5.
316. Clausen ML, Slotved HC, Krogfelt KA, Andersen PS, Agner T. In vivo expression of
antimicrobial peptides in atopic dermatitis. Exp Dermatol 2016; 25:3-9.
317. Hilty M, Burke C, Pedro H, Cardenas P, Bush A, Bossley C, et al. Disordered microbial
communities in asthmatic airways. PLoS One 2010; 5:e8578.
318. Huang YJ, Boushey HA. The microbiome in asthma. J Allergy Clin Immunol 2015; 135:25-30.
319. Choy DF, Hart KM, Borthwick LA, Shikotra A, Nagarkar DR, Siddiqui S, et al. TH2 and TH17
inflammatory pathways are reciprocally regulated in asthma. Sci Transl Med 2015; 7:301ra129.
320. Hinks TS, Zhou X, Staples KJ, Dimitrov BD, Manta A, Petrossian T, et al. Innate and adaptive T
cells in asthmatic patients: Relationship to severity and disease mechanisms. J Allergy Clin
Immunol 2015; 136:323-33.
321. Persson H, Kwon AT, Ramilowski JA, Silberberg G, Söderhäll C, Orsmark-Pietras C, et al.
Transcriptome analysis of controlled and therapy-resistant childhood asthma reveals distinct gene
expression profiles. J Allergy Clin Immunol 2015; 136:638-48.
322. Woodruff PG, Modrek B, Choy DF, Jia G, Abbas AR, Ellwanger A, et al. T-helper type 2-driven
inflammation defines major subphenotypes of asthma. Am J Respir Crit Care Med 2009;
180:388-95.
323. Newcomb DC, Boswell MG, Huckabee MM, Goleniewska K, Dulek DE, Reiss S, et al. IL-13
regulates Th17 secretion of IL-17A in an IL-10-dependent manner. J Immunol 2012; 188:1027-
35.
324. Newcomb DC, Boswell MG, Zhou W, Huckabee MM, Goleniewska K, Sevin CM, et al. Human
TH17 cells express a functional IL-13 receptor and IL-13 attenuates IL-17A production. J Allergy
Clin Immunol 2011; 127:1006-13.e1-4.
153 325. Newcomb DC, Zhou W, Moore ML, Goleniewska K, Hershey GK, Kolls JK, et al. A functional
IL-13 receptor is expressed on polarized murine CD4+ Th17 cells and IL-13 signaling attenuates
Th17 cytokine production. J Immunol 2009; 182:5317-21.
326. Wilson MS, Ramalingam TR, Rivollier A, Shenderov K, Mentink-Kane MM, Madala SK, et al.
Colitis and intestinal inflammation in IL10-/- mice results from IL-13Rα2-mediated attenuation
of IL-13 activity. Gastroenterology 2011; 140:254-64.
327. Busse WW, Holgate S, Kerwin E, Chon Y, Feng J, Lin J, et al. Randomized, double-blind,
placebo-controlled study of brodalumab, a human anti-IL-17 receptor monoclonal antibody, in
moderate to severe asthma. Am J Respir Crit Care Med 2013; 188:1294-302.
328. Huang F, Wachi S, Thai P, Loukoianov A, Tan KH, Forteza RM, et al. Potentiation of IL-19
expression in airway epithelia by IL-17A and IL-4/IL-13: important implications in asthma. J
Allergy Clin Immunol 2008; 121:1415-21, 21.e1-3.
329. Lewkowich IP, Lajoie S, Clark JR, Herman NS, Sproles AA, Wills-Karp M. Allergen uptake,
activation, and IL-23 production by pulmonary myeloid DCs drives airway hyperresponsiveness
in asthma-susceptible mice. PLoS One 2008; 3:e3879.
330. Newcomb DC, Boswell MG, Reiss S, Zhou W, Goleniewska K, Toki S, et al. IL-17A inhibits
airway reactivity induced by respiratory syncytial virus infection during allergic airway
inflammation. Thorax 2013; 68:717-23.
331. Besnard AG, Sabat R, Dumoutier L, Renauld JC, Willart M, Lambrecht B, et al. Dual Role of IL-
22 in allergic airway inflammation and its cross-talk with IL-17A. Am J Respir Crit Care Med
2011; 183:1153-63.
332. Wands JM, Roark CL, Aydintug MK, Jin N, Hahn YS, Cook L, et al. Distribution and leukocyte
contacts of gammadelta T cells in the lung. J Leukoc Biol 2005; 78:1086-96.
333. Brandt EB, Sivaprasad U. Th2 Cytokines and Atopic Dermatitis. J Clin Cell Immunol 2011; 2.
334. Strober W, Fuss IJ. Proinflammatory cytokines in the pathogenesis of inflammatory bowel
diseases. Gastroenterology 2011; 140:1756-67.
154 335. Hamid Q, Naseer T, Minshall EM, Song YL, Boguniewicz M, Leung DY. In vivo expression of
IL-12 and IL-13 in atopic dermatitis. J Allergy Clin Immunol 1996; 98:225-31.
336. Zheng T, Oh MH, Oh SY, Schroeder JT, Glick AB, Zhu Z. Transgenic expression of interleukin-
13 in the skin induces a pruritic dermatitis and skin remodeling. J Invest Dermatol 2009; 129:742-
51.
337. Toda M, Leung DY, Molet S, Boguniewicz M, Taha R, Christodoulopoulos P, et al. Polarized in
vivo expression of IL-11 and IL-17 between acute and chronic skin lesions. J Allergy Clin
Immunol 2003; 111:875-81.
338. Guttman-Yassky E, Lowes MA, Fuentes-Duculan J, Zaba LC, Cardinale I, Nograles KE, et al.
Low expression of the IL-23/Th17 pathway in atopic dermatitis compared to psoriasis. J Immunol
2008; 181:7420-7.
339. Heller F, Florian P, Bojarski C, Richter J, Christ M, Hillenbrand B, et al. Interleukin-13 is the key
effector Th2 cytokine in ulcerative colitis that affects epithelial tight junctions, apoptosis, and cell
restitution. Gastroenterology 2005; 129:550-64.
340. Raza A, Shata MT. Letter: pathogenicity of Th17 cells may differ in ulcerative colitis compared
with Crohn's disease. Aliment Pharmacol Ther 2012; 36:204; author reply 5.
341. Takeda K, Kamanaka M, Tanaka T, Kishimoto T, Akira S. Impaired IL-13-mediated functions of
macrophages in STAT6-deficient mice. J Immunol 1996; 157:3220-2.
342. Martinez FO, Helming L, Gordon S. Alternative activation of macrophages: an immunologic
functional perspective. Annu Rev Immunol 2009; 27:451-83.
343. Doherty TM, Kastelein R, Menon S, Andrade S, Coffman RL. Modulation of murine macrophage
function by IL-13. J Immunol 1993; 151:7151-60.
344. Ahn JS, Agrawal B. IL-4 is more effective than IL-13 for in vitro differentiation of dendritic cells
from peripheral blood mononuclear cells. Int Immunol 2005; 17:1337-46.
345. Webb DC, Cai Y, Matthaei KI, Foster PS. Comparative roles of IL-4, IL-13, and IL-4Ralpha in
dendritic cell maturation and CD4+ Th2 cell function. J Immunol 2007; 178:219-27.
155 346. Oettgen HC, Geha RS. IgE regulation and roles in asthma pathogenesis. J Allergy Clin Immunol
2001; 107:429-40.
347. Hoff H, Brunner-Weinzierl MC. The tyrosine phosphatase SHP-2 regulates differentiation and
apoptosis of individual primary T lymphocytes. Eur J Immunol 2007; 37:1072-86.
348. Mamik MK, Ghorpade A. Src homology-2 domain-containing protein tyrosine phosphatase
(SHP) 2 and p38 regulate the expression of chemokine CXCL8 in human astrocytes. PLoS One
2012; 7:e45596.
349. Schoenwaelder SM, Petch LA, Williamson D, Shen R, Feng GS, Burridge K. The protein
tyrosine phosphatase Shp-2 regulates RhoA activity. Curr Biol 2000; 10:1523-6.
350. Fukunaga K, Noguchi T, Takeda H, Matozaki T, Hayashi Y, Itoh H, et al. Requirement for
protein-tyrosine phosphatase SHP-2 in insulin-induced activation of c-Jun NH(2)-terminal kinase.
J Biol Chem 2000; 275:5208-13.
351. Corren J, Lemanske RF, Hanania NA, Korenblat PE, Parsey MV, Arron JR, et al. Lebrikizumab
treatment in adults with asthma. N Engl J Med 2011; 365:1088-98.
352. Ohga K, Kuromitsu S, Takezawa R, Numazaki M, Ishikawa J, Nagashima S, et al. YM-341619
suppresses the differentiation of spleen T cells into Th2 cells in vitro, eosinophilia, and airway
hyperresponsiveness in rat allergic models. Eur J Pharmacol 2008; 590:409-16.
353. Kau AL, Korenblat PE. Anti-interleukin 4 and 13 for asthma treatment in the era of endotypes.
Curr Opin Allergy Clin Immunol 2014; 14:570-5.
156