Bipes Biporus)

Genomics of convergent limb loss in squamates

1Department of Organismic and Evolutionary Biology and Museum of Comparative Zoology, Harvard University

2Department of Herpetology, American Museum of Natural History 2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. 2018 © 48th European Contact Lens Society Of Ophthalmologists. All rights reserved - Any reproduction even in part is prohibited] .

Population genomics approach: closely related species

Genetic basis of beak diversity in Darwin’s finches 2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. (Lamichhaney et al, Nature, 2015; Lamichhaney et al, Science, 2016, 2018)

2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. 2018 © 48th European Contact Lens Society Of Ophthalmologists. All rights reserved - Any reproduction even in part is prohibited] .

2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited] . Comparative genomics of distantly related species: convergent limb loss in squamates

© Craig Chandler, Angie Fox, Jason Head, University of Nebraska-Lincoln 2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. https://reptile-savvy.weebly.com/evolution-of-snakes.html

Dibamidae New Guinea blind lizard

Gekkota Pink-tailed worm lizard Thick-tailed Gecko

Amphisbaenidae North American worm lizard European worm lizard Mexican mole lizard Anguidae European legless lizard California alligator lizard Serpentes Madagascar leaf-nosed snake Cordylidae Cape grass lizard Common crag lizard 2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. Hildebrandt’s skink Stripeneck skink Scincidae Braconnier’s short skink Androngo trivittatus Limbless/Limb-reduced Giant water skink

Limbed Tree skink 2018 © II Joint CongressMermaid on Evolutionary skink Biology 2018. All rights reserved - Any reproduction even in part is prohibited. Tree modified2018 from Zheng & Wiens, © MPE (48th2015) European Contact Lens Society Of Ophthalmologists. All rights reserved - Any reproduction even in part is prohibited] .

Dibamidae Thick-tailed Gecko Gekkota

Amphisbaenidae

Anguidae

Serpentes 72 MYA

Cordylidae Gekkota

Scincidae

Limbless/Limb reduced Pink tailed Worm lizard

Limbed

2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. Tree modified2018 from Zheng & Wiens, © MPE (48th2015) European Contact Lens Society Of Ophthalmologists. All rights reserved - Any reproduction even in part is prohibited] .

- Staining (C&S) Limb morphology - Microscopy - CT scans

Convergence in gene expression Tissue collections - Museum samples - Fresh tissues from field - RNA sequencing - Comparative transcriptomics 2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. Generate genomic Identify genomic resources loci associated with limb loss - Genome sequencing - Assembly and annotations - Genome-wide convergence screen

Dibamidaex CAS-173019 Gekkota

Amphisbaenidae

Anguidae Common crag lizard Serpentes (Pseudocordylus

Cordylidae melanotus)

2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. Scincidae Dg = Digits Limbless/Limb reduced T/F = Tibia / Fibula Limbed Fe = Femur Hindlimb Pv = Pelvis

Dibamidae

Gekkota

Amphisbaenidae

Dg = Digits

Anguidae R/U = Radius/Ulna Forelimbs Hm = Humerous Serpentes Pc = Pectoral Cordylidae Mexican mole lizard (Bipes biporus)

Limbless/Limb reduced Limbed

Dibamus novaeguinae Dibamidae CAS-SU 27070 Gekkota

Amphisbaenidae Hind limb

Anguidae

Serpentes

Cordylidae

Limbless/Limb reduced Limbed Dg = Digits T/F = Tibia / Fibula Fe = Femur 2018 © II Joint Congress on Evolutionary Biology 2018. All rightsPv reserved= Pelvis - Any reproduction even in part is prohibited. 2018 © 48th European Contact Lens Society Of Ophthalmologists. All rights reserved - Any reproduction even in part is prohibited] .

European legless lizard Dibamidae (Ophisaurus opodus) Gekkota CAS-184449

Amphisbaenidae

Anguidae

Serpentes

Cordylidae

Limbless/Limb reduced Limbed

Limb morphology

Tissue collections

o Sampling across the entire squamate phylogeny

2018 © II Joint Congress on Evolutionary Biology 2018. All rightsLimbless reserved - Any taxa reproduction even in part is prohibited. 2018 © 48th European Contact Lens Society Of Ophthalmologists. All rights reserved - Any reproduction even in part is prohibited] .

Limb morphology

Tissue collections Illumina Fragment and Jumping libraries 10X Chromium

Oxford Nanopore

Family : Amphisbaenidae Method : Illumina 220 bp fragment + 6 kb jumping library

Species Bipes biporus Rhineura floridana (Mexican mole lizard) (North American worm lizard) Genome size 1.79 GB 2.18 GB 2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. Coverage (fragment 34 X 36 X library) Scaffold N50 38 KB 139 KB

Anolis carolinensis • Map scaffolds from draft genomes onto Anolis carolinensis genome (AnoCar2.0, Alföldi et al, Nature, 2011)

North American worm lizard (Rhineura floridana) ) 450 bp 400 350 300 250 200 150 100 50 2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. 0 Chr 1 Chr 2 Chr 3 Chr 4 Chr 5 Chr 6 Chr Chr Chr Chr Chr Chr Chr Size of chromosome Size of chromosome (millions Lga Lgb LGc LGd LGf LGg LGh

94.3 % of genome anchored as pseudochromosomes

(Cantarel et al, Genome research, 2008)

• Using homology evidence from human, mouse, chicken, Anolis lizard and western clawed frog (Xenopus troplicalis)

Whole-genome alignments ✕ ✓ ✕

Limbless taxa A ATCGTATGTCAGGACATAGA

Limbless taxa B ATCGTATGTCAGGACATAGA

Limbed taxa A ATCGAATGTCACGACTTAGA

Limbed taxa B ATCGAATGTCACGACTTAGA

2018 © II Joint Congress on Evolutionary Biology 2018.Anolis All rights reservedcarolinensis - Any reproduction evenATCG in part is prohibited.TATGTCACGACATAGA

Study sites, genes or indels where limbless taxa carry derived state

Sites or genomic regions where limbless taxa carry derived state

✓ Select genomic regions conserved across 100 vertebrates

Coding Regulatory

Intronic Variant effect prediction

Rhineura floridana

Bipes biporus

Anolis carolinensis Limbless/Limb reduced

Limbed

100,00 Derived conserved sites 80,00

40,00 Proportion 20,00

0,00 Intergenic Upstream Downstream Intron 5' UTR 3' UTR Coding

Rhineura floridana

Bipes biporus

Anolis carolinensis Limbless/Limb reduced

Limbed

100,00 Reference conserved sites Derived conserved sites 80,00 *

40,00

Proportion * * 20,00

0,00 Intergenic Upstream Downstream Intron 5' UTR 3' UTR Coding -16 2018 © II Joint Congress on Evolutionary Biology 2018. All rights* p reserved< 2.2 -x Any 10 reproduction even in part is prohibited. 2018 © 48th European Contact Lens Society Of Ophthalmologists. All rights reserved - Any reproduction even in part is prohibited] .

ZRS limb enhancer element of Sonic hedgehog (Shh) gene

2018 © II Joint Congress on Evolutionary KvonBiology 2018.et All rights al, reserved Cell, - Any reproduction2016 even in part is prohibited. 2018 © 48th European Contact Lens Society Of Ophthalmologists. All rights reserved - Any reproduction even in part is prohibited] .

ZRS limb enhancer element of Sonic hedgehog (Shh) gene

Deletion

Study limb morphology Different pairs in different stage of the workflow

Convergence of Tissue collections gene expression - RNA sequencing - Comparative transcriptomics 2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. - ATAC-sequencing Generate genomic Identify genomic resources loci associated with limbloss

# Challenges of doing genomic work on museum collections 2018 © II Joint Congress on Evolutionary Biology 2018. All rights reserved - Any reproduction even in part is prohibited. 2018 © 48th European Contact Lens Society Of Ophthalmologists. All rights reserved - Any reproduction even in part is prohibited] .

Edwards lab

• Additional genome assemblies

o Geckos Underwoodisaurus milii

Aprasia aurita

o Skinks

Pygomeles braconnieri

• Fresh tissues collections o High molecular weight DNA for genome sequencing o RNA sequencing o Comparative transcriptomics to study convergence of gene expression

• Anguids from Brazil • Diploglossus

João Tonini • Ophiodes