DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 7,807,373 B2 Srivastava Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 7,807,373 B2 Srivastava Et Al US007807373B2 (12) United States Patent (10) Patent No.: US 7,807,373 B2 Srivastava et al. (45) Date of Patent: Oct. 5, 2010 (54) PROSTATE SPECIFIC GENE, PCGEM1, AND GenBank. Accession No. ACO 13401, GI:8569780, 169700 bp DNA, METHODS OF USING PCEGM1 TO DETECT, Jul. 7, 2000. TREAT, AND PREVENT PROSTATE CANCER “AC003046.” EBI Database XPO02143197, Dec. 1, 2001. (75) Inventors: Shiv Srivastava, Potomac, MD (US); Srikantanet al., “Structure and Expression of a Novel Prostate Spe Judd W. Moul, Bethesda, MD (US); cific Gene: PCGEM1. Proc. American Assoc. Cancer Research Vasantha Srikantan, Rockville, MD Annual, XP000929230, vol. 40, p. 37 (Mar. 1999). (US); Zhiqiang Zou, Gaithersburg, MD Bussemakers et al., “A New Prostate-Specific Arker, Strongly (US) Overexpressed in Prostatic Tumors.” Urological Research, XP0020743.05, vol. 25, No. 1, p. 76 (Feb. 1997). (73) Assignee: Henry M. Jackson Foundation for the Wang et al., “Genes Regulated by Androgen in the Rat Ventral Pros Advancement of Military Medicine, tate.” Proc. Nat.1 Acad. Sci., U.S.A., vol. 94, pp. 12999-13004 (Nov. Rockville, MD (US) 1997). “ACO 13401, EBI Database XP002143200, Apr. 16, 2005. (*) Notice: Subject to any disclaimer, the term of this Srikantan et al., “PCGEM1, a Prostate-Specific Gene, Is Overex patent is extended or adjusted under 35 posed in Prostate Cancer.” Proc. Natl. Acad. Sci., vol.97, No. 22, pp. U.S.C. 154(b) by 285 days. 12216-12221 (Oct. 24, 2000). (21) Appl. No.: 12/166,723 Srikantan et al., Identification of Prostate Cancer Associated Novel Gene Expression Alterations, Proc. American Assoc. Cancer (22) Filed: Jul. 2, 2008 Research, vol.39, p. 362 (Mar. 1998). Srikantan et al., Identification of Prostate Cancer Associated Novel (65) Prior Publication Data Gene Expression Alterations, USUHS Research Day-Graduate Stu US 2010/O184O23 A1 Jul. 22, 2010 dent Colloquium, p. 164 (Apr. 1-2, 1998). Srikantan et al., Identification of Prostate Cancer Associated Novel Related U.S. Application Data Gene Expression Alterations, J. Urology, AUA 93rd Annual Meeting, (60) Division of application No. 10/802,823, filed on Mar. p. 40 (May 30-Jun. 4, 1998). 18, 2004, now abandoned, which is a continuation of Petrovics, et al. Oncogene, vol. 23, pp. 605-611 (2004). application No. 09/534,072, filed on Mar. 24, 2000, Genbank. Accession No. AC003046, GI:2583140, 22.9335bp DNA, now Pat. No. 6,828,429. Nov. 3, 1997. Moreno, J.G. et al., “Detection of Hematogenous Micrometastasis in (60) Provisional application No. 60/126,469, filed on Mar. Patients with Prostate Cancer, Cancer Research, 52.61 10-61 12 26, 1999. (Nov. 1992). (51) Int. Cl. Dixon et al., Cancer Chemother. Pharmacol., (1999)43(Suppl.):S78 CI2O I/68 (2006.01) S84. (52) U.S. Cl. ......................... 435/6: 435/91.2:536/23.1; Genbank. Accession No. AF099810, GI:38.00891, 193824 bp DNA, 536/24.33:436/64 Oct. 28, 1998. (58) Field of Classification Search ..................... 435/6, Genbank. Accession No. AC006925, GI:4417322, 176186 bp DNA, 435/91.2: 536/23.1, 24.33: 436/64 Mar. 16, 1999. See application file for complete search history. Office Action dated Dec. 20, 2005, from European Application No. (56) References Cited OO 9183732. Office Action dated Jul. 19, 2007, from European Application No. 00 U.S. PATENT DOCUMENTS 9183732. 6,828,429 B1 12/2004 Srivastava et al. 2001/005.3519 A1 12, 2001 Fodor et al. * cited by examiner Primary Examiner Stephen L Rawlings FOREIGN PATENT DOCUMENTS (74) Attorney, Agent, or Firm—MH2 Technology Law Group WO WO95/19434 7, 1995 LLP WO WO99.00498 1, 1999 WO PCT/USOO.O7906 5, 2000 (57) ABSTRACT OTHER PUBLICATIONS A nucleic acid sequence that exhibits prostate-specific Petrovics et al. (Oncogene. Jan. 15, 2004; 23 (2): 605-611).* Fu et al. (DNA Cell Biol. Mar. 2006; 25 (3): 135-141).* expression and over-expression in tumor cells is disclosed. Ifere et al. (Recent Pat. DNA Gene Seq. Nov. 2009; 3 (3): 151-163).* The sequence and fragments thereof are useful for detecting, GenBank. Accession No. ACO 13401, GI:6289254, 163807 bp DNA, diagnosing, preventing, and treating prostate cancer and other Nov. 9, 1999. prostate related diseases. The sequence is also useful for GenBank. Accession No. ACO 13401, GI:8050939, 170695 bp DNA, measuring hormone responsiveness of prostate cancer cells. May 24, 2000. GenBank. Accession No. ACO 13401, GI:8099084, 172760 bp DNA, May 26, 2000. 7 Claims, 21 Drawing Sheets U.S. Patent Oct. 5, 2010 Sheet 1 of 21 US 7,807,373 B2 STRATEGY FORTHEIDENTIFICATION OF GENE EXPRESSIONALTERATIONS IN PROSTATE CANCER OCTEMBEDDED FROZEN PROSTATE TUMOR/NORMAL TISSUE MAKE 6 am SERIAL SECTIONS HISTOLOGICALEXAMINATION OF H & ESLIDE RNA PREPARATION RT-PCRAMPLIFICATIONUSING ARBITRARY AND ANCHORED PRIMER CONTAINING 5 M13 ORT7 SEQUENCES HIGHRESOLUTIONGEL ELECTROPHORESIS (GENOMYX SYSTEM) AND EXCISION OF DIFFERENTIALLY EXPRESSEDBANDS REAMPLIFICATIONUSING M13 AND T7 PRIMERS PURIFICATION AND AUTOMATED DNA SEQUENCING ONAB1377 USING M13/T7 PRIMER DNA SEQUENCE DATABASE SEARCH (NCBI, CGAP) RT-PCR USING GENE SPECIFIC PRIMER FORTUMOR SPECIFIC ALTERATIONS TO SCREEN RNAFROMDEFINED GROUP OF PATIENTS AND CELL LINES ANALYZE EXPRESSION PATTERN STUDY BIOLOGICAL FUNCTION FOR CLINICAL CORRELATIONS OF SELECTED GENES FIG. 1 U.S. Patent Oct. 5, 2010 Sheet 2 of 21 US 7,807,373 B2 TNT NTNT NT T-TUMOR N-NORMAL - or t 1. 8 FIG 2 T-TUMOR St T N T N T N T N T N - No RT - N-NORMAL : : -- CYTOKERATIN T N T N T N T N T N - No RT : - PCGEM 1 FIG 3 U.S. Patent Oct. 5, 2010 Sheet 3 of 21 US 7,807,373 B2 123 CD >>H O >< LLI CY<C H= Z -- PCGEM 1 FIG 4 U.S. Patent Oct. 5, 2010 Sheet 4 of 21 US 7,807,373 B2 WHSOOd| SDENTO}}_LNOO O 1 nM 10 nM O 12 HR FIG 5A U.S. Patent Oct. 5, 2010 Sheet 5 of 21 US 7,807,373 B2 K b 2.37 - 18S 1.35 FIG 5B U.S. Patent Oct. 5, 2010 Sheet 6 of 21 US 7,807,373 B2 MO&&WWNO9 - "... ONWS) TWNBOW - WHOWAL - SOON HoWA is OOO TWNS OOAH HOWWOLS - rt : SWAONW - ANOX 98 SW TWTXS - WIT SDN?. - WLNOW NW 9 - LAWH - . 3 E3 : MOOX?. OOO8 WHA (SNINI IWSOOnW) NOOO SNILSSLN TWWS - MAWAO - SISL - WISOd SWAHL - NB9TS - 2 : ; ; ; U.S. Patent Oct. 5, 2010 Sheet 7 of 21 US 7,807,373 B2 appendix lung trachoa placent fetal fitn fatal fetal at it fit brin heart karey er open thymus ting yeast A a st an co "Poly (A) human 00 ng 100 ng 100 ng 100ng 100 gg isong a U.S. Patent Oct. 5, 2010 Sheet 8 of 21 US 7,807,373 B2 U.S. Patent Oct. 5, 2010 Sheet 9 of 21 US 7,807,373 B2 cDNA sequence of PCGEM Sed. ID No. 1 AAGGCACTCT GGCACCCAGTTTTGGAACTG CAGTTTTAAA AGTCATAAATTGAATGAAAA TGATAGCAAA 70 CCTGGAGGTTTTTAAAGAGCTATTTATAGGTCCCTGGACA GCATCTTTTTTCAATTAGGC AGCAACCTTT 140 TTGCCCTATG CCGTAACCTG TGTCTGCAAC TTCCTCTAATTGGGAAATAG TAAGCAGATTCATAGAGCT 210 CAATGATAAA ATTGAACTAC GAGATGCACT GGGACTCAAC GTGACCTTAT CAAGTGAGCA GGCTTGGTGC 280 ATTTGACAC, TCATGATATC AGCCAAAGTG GAACTAAAAA CAGCTCCTGG AAGAGGACTA TGACATCATC 350 AGGTTGGGAG TCTCCAGGGA CAGCGGACCC TTTGGAAAAG GACTAGAAAGTGTGAAATCT ATTAGTCTTC 420 CATATGAAATTCTCTGTCTC TGTAAAAGCA TTTCATATTT ACAAGACACA GGCCTACTCC TAGGGCAGCA 490 AAAAGTGGCA ACAGGCAAGC AGAGGGAAAA GAGATCATGA GGCATTTCAG AGTGCACTGT CTTTTCATAT 560 ATTTCCAAT GCCGTATGTTTGGTTTTATTTTGGCCAAGC ATAACAATCT GCTCAAGAAAAAAAAATCTG 630 (AGAAAACAA ACGTCCCTTT GCCAATGTTA TGTTTCTTTTTGACAAGCCC TGAGATTTCT GAGGGGAATT 700 CACATAAATG GGATCAGGTC ATTCATTTAC CTTGTGTGCA AATATGATTT AAAGATACAA CCTTTGCAGA 770 CAGCAIGCTTTCCTAAGGGT AGCCACGTGG ACGACTAAGG GTAAAGCATT CTTCAAGATC ACTTAATCAA 840 CAAAGGTGCT CITTGCATTC TGAAATGCCCTTGTTGCAAA. TATTGGTTATATTGATTAAA TTTACACTTA 910 ATGGAAACAA CCTTTAACTT ACAGATGAAC AAACCCACAA AAGCAAAAAATCAAAAGCCC TACCTATGAT 980 TTCATATTTT CTGTGTAACT GGATTAAAGG ATTCCTGCTT GCTTTTGGGC ATAAATGATA ATGGAATATT 1050 TCCAGGTATT GTTTAAAATC AGGGCCCATC TACAAATTCT TAGCAATACT TTGGATAATT CTAAAATTCA 1120 CCTGGACATT GTCTAATTGTTTTTTATATA CATCTTGCT AGAATTTCAA ATTTTAAGTA TCTGAATTTA 1190 CTTAATTAGCTCTCCTGATC AATTCAAAAA CATTACTTTC CTAAATTTTAGACTATGAAG GTCATAAATT 1260 CAACAAATAT, ATCTACACAT ACAATTATAG ATTGTTTTTC ATTATAATGT CTTCATCTTA ACACAATTGT 1330 CTTTGTGATT GTTTTTAGAA AACTGAGAGTTTTAATTCAT AATTACTTCA TCAAAAAATT GTGGGAACAA 1400 TCCACCATTA, ATTCTATCTG ATTGTTTTTA TCTACATAAG GACTCTTAAG CTTCGTCCCTTGAACTCTTT 1470 TCTACTTAGT CCCATGTTTA AAATTACTAC TTTATATCTA AACCATTTAT GTTTTTCAATTCAATTTACA 1540 TGATGCTAAT TATGGCAATT ATAACAAATA TTAAAGATTT CGAAATAGAAAAAAAAAAAA AAA 1603 FIG. 8 U.S. Patent Oct. 5, 2010 Sheet 10 of 21 US 7,807,373 B2 cDNA sequence of PCGEM Seg. ID No.2 GCGGCCGCGT CGACGCAACTTCCTCTAATT GGGAAATAGT TAAGCAGATT CATAGAGCTG AATGATAAAA 70 TTGTACTTCG AGATGCACTG GGACTCAACG TGACCTTATC AAGTGAGATG GAGTCTTGCC CTGTCTCCAA 140 GGCEGGAGCC CAATGGTGTG ATCTTGGCTC ACTGCAACCT CCACCTCCCA GGTTCAAACGTTTCTCCTGC 210 CTCAGCCTCC CAAGTAACTG GGATTACAGC AGGCTTGGTG CATTTGACAC TTCATGATAT CAGCCAAAGT 280 GGAACTAAAA ACAGCTCCTG GAAGAGGACT ATGACATCAT CAGGTTGGGA GTCTCCAGGG ACAGCGGACC 350 CTTTGGAAAA GGACTAGAAA GTGTGAAATC TATTAGTCTT CGATATGAAA TTCTCTGTCT CCGTAAAAGC 420 ATTTCATATT TACAAGACAC AGGCCTACTC CTAGGGCAGC AAAAAGTGGC AACAGGCAAG CAGAGGGAAA 490 ACACATCATGAGCCATTTCA GAGTGCACTG TCTTTTCATA TATTTCCAA TGCCGTATGTTTGGTTTTAT 560 TTTGGCCAAG CATAACAATC TGCTCAAAAAAAAAAAATCT GGAGAAAACA AAGGTGCCTT TGCCAATGTT 630 ATGTTTCTTTTTGACAAGCC CTGAGATTTC TGAGGGGAATTCACATAAAT GGGATCAGGT CATTCATTTA 700 CCTTGTGTGC AAATATGATT TAAAGATACA ACCTTTGCAG AGAGCATGCTTTCCTAAGGG TAGGCACGTG 770 GACGACTAAG GGTAAAGCAT TCTTCAAGAT CAGTTAATCA AGAAAGGTGC TCTTGCATT CTGAAATGCC 840 CTTGTTCCAA ATATTGGTTA TATTGATTAA ATTTACACTTAATGGAAACA ACCTTTAACTTACAGATGAA 910 CAAACCCCAC AAAACCAAAA AATCAAAAGC CCTACCTATG ATTTCATATTTTCCTGTAA CTCCATTAAA 980 GGATTCCTCC TTCCTTTTGG GCATAAATGA TAATGGAATA TTTCCAGGTATTGTTTAAAA TCAGGGCCCA 1050 TCTACAAATT CTTAGCAATA
Load more

Recommended publications
  • Long Noncoding RNA and Cancer: a New Paradigm Arunoday Bhan, Milad Soleimani, and Subhrangsu S
    Published OnlineFirst July 12, 2017; DOI: 10.1158/0008-5472.CAN-16-2634 Cancer Review Research Long Noncoding RNA and Cancer: A New Paradigm Arunoday Bhan, Milad Soleimani, and Subhrangsu S. Mandal Abstract In addition to mutations or aberrant expression in the moting (oncogenic) functions. Because of their genome-wide protein-coding genes, mutations and misregulation of noncod- expression patterns in a variety of tissues and their tissue- ing RNAs, in particular long noncoding RNAs (lncRNA), appear specific expression characteristics, lncRNAs hold strong prom- to play major roles in cancer. Genome-wide association studies ise as novel biomarkers and therapeutic targets for cancer. In of tumor samples have identified a large number of lncRNAs this article, we have reviewed the emerging functions and associated with various types of cancer. Alterations in lncRNA association of lncRNAs in different types of cancer and dis- expression and their mutations promote tumorigenesis and cussed their potential implications in cancer diagnosis and metastasis. LncRNAs may exhibit tumor-suppressive and -pro- therapy. Cancer Res; 77(15); 1–17. Ó2017 AACR. Introduction lncRNAs (lincRNA) originate from the region between two pro- tein-coding genes; enhancer lncRNAs (elncRNA) originate from Cancer is a complex disease associated with a variety of genetic the promoter enhancer regions; bidirectional lncRNAs are local- mutations, epigenetic alterations, chromosomal translocations, ized within the vicinity of a coding transcript of the opposite deletions, and amplification (1). Noncoding RNAs (ncRNA) are strand; sense-overlapping lncRNAs overlap with one or more an emerging class of transcripts that are coded by the genome but introns and exons of different protein-coding genes in the sense are mostly not translated into proteins (2).
    [Show full text]
  • Oncotarget-05-764.Pdf
    Open Research Online The Open University’s repository of research publications and other research outputs Identification of a long non-coding RNA as a novel biomarker and potential therapeutic target for metastatic prostate cancer Journal Item How to cite: Crea, Francesco; Watahiki, Akira; Quagliata, Luca; Xue, Hui; Pikor, Larissa; Parolia, Abhijit; Wang, Yuwei; Lin, Dong; Lam, Wan L.; Farrar, William L.; Isogai, Takao; Morant, Rudolf; Castori-Eppenberger, Serenella; Chi, Kim N.; Wang, Yuzhuo and Helgason, Cheryl D. (2014). Identification of a long non-coding RNA as a novel biomarker and potential therapeutic target for metastatic prostate cancer. Oncotarget, 5(3) pp. 764–774. For guidance on citations see FAQs. c 2014 The Authors https://creativecommons.org/licenses/by/4.0/ Version: Version of Record Link(s) to article on publisher’s website: http://dx.doi.org/doi:10.18632/oncotarget.1769 Copyright and Moral Rights for the articles on this site are retained by the individual authors and/or other copyright owners. For more information on Open Research Online’s data policy on reuse of materials please consult the policies page. oro.open.ac.uk www.impactjournals.com/oncotarget/ Oncotarget, Vol. 5, No. 3 Identification of a long non-coding RNA as a novel biomarker and potential therapeutic target for metastatic prostate cancer Francesco Crea1, Akira Watahiki1,2, Luca Quagliata3, Hui Xue1, Larissa Pikor4, Abhijit Parolia1,5, Yuwei Wang1, Dong Lin1,2, Wan L. Lam4, William L. Farrar6, Takao Isogai7, Rudolf Morant8, Serenella Castori-Eppenberger3, Kim N. Chi2,9, Yuzhuo Wang1,2, and Cheryl D. Helgason1 1 Experimental Therapeutics, BC Cancer Agency Cancer Research Centre, Vancouver BC, Canada.
    [Show full text]
  • Novel Long Non-Coding Rnas Are Specific Diagnostic and Prognostic Markers for Prostate Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.6 Novel long non-coding RNAs are specific diagnostic and prognostic markers for prostate cancer René Böttcher1,3, A. Marije Hoogland2, Natasja Dits1, Esther I. Verhoef2, Charlotte Kweldam2, Piotr Waranecki1, Chris H. Bangma1, Geert J.L.H. van Leenders2, Guido Jenster1 1Dept. of Urology, Erasmus MC, Rotterdam, The Netherlands 2Dept. of Pathology, Erasmus MC, Rotterdam, The Netherlands 3Dept. of Bioinformatics, Technical University of Applied Sciences Wildau, Wildau, Germany Correspondence to: Guido Jenster, e-mail: [email protected] Keywords: Long non-coding RNA, prostate cancer, in situ hybridization, exon array, biomarkers Received: August 22, 2014 Accepted: December 08, 2014 Published: February 17, 2015 ABSTRACT Current prostate cancer (PCa) biomarkers such as PSA are not optimal in distinguishing cancer from benign prostate diseases and predicting disease outcome. To discover additional biomarkers, we investigated PCa-specific expression of novel unannotated transcripts. Using the unique probe design of Affymetrix Human Exon Arrays, we identified 334 candidates (EPCATs), of which 15 were validated by RT-PCR. Combined into a diagnostic panel, 11 EPCATs classified 80% of PCa samples correctly, while maintaining 100% specificity. High specificity was confirmed by in situ hybridization for EPCAT4R966 and EPCAT2F176 (SChLAP1) on extensive tissue microarrays. Besides being diagnostic, EPCAT2F176 and EPCAT4R966 showed significant association with pT-stage and were present in PIN lesions. We also found EPCAT2F176 and EPCAT2R709 to be associated with development of metastases and PCa-related death, and EPCAT2F176 to be enriched in lymph node metastases. Functional significance of expression of 9 EPCATs was investigated by siRNA transfection, revealing that knockdown of 5 different EPCATs impaired growth of LNCaP and 22RV1 PCa cells.
    [Show full text]
  • Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications
    Stem Cell Rev and Rep DOI 10.1007/s12015-016-9662-8 Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications Behnam Ahmadian Baghbaderani 1 & Adhikarla Syama2 & Renuka Sivapatham3 & Ying Pei4 & Odity Mukherjee2 & Thomas Fellner1 & Xianmin Zeng3,4 & Mahendra S. Rao5,6 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract We have recently described manufacturing of hu- help determine which set of tests will be most useful in mon- man induced pluripotent stem cells (iPSC) master cell banks itoring the cells and establishing criteria for discarding a line. (MCB) generated by a clinically compliant process using cord blood as a starting material (Baghbaderani et al. in Stem Cell Keywords Induced pluripotent stem cells . Embryonic stem Reports, 5(4), 647–659, 2015). In this manuscript, we de- cells . Manufacturing . cGMP . Consent . Markers scribe the detailed characterization of the two iPSC clones generated using this process, including whole genome se- quencing (WGS), microarray, and comparative genomic hy- Introduction bridization (aCGH) single nucleotide polymorphism (SNP) analysis. We compare their profiles with a proposed calibra- Induced pluripotent stem cells (iPSCs) are akin to embryonic tion material and with a reporter subclone and lines made by a stem cells (ESC) [2] in their developmental potential, but dif- similar process from different donors. We believe that iPSCs fer from ESC in the starting cell used and the requirement of a are likely to be used to make multiple clinical products. We set of proteins to induce pluripotency [3]. Although function- further believe that the lines used as input material will be used ally identical, iPSCs may differ from ESC in subtle ways, at different sites and, given their immortal status, will be used including in their epigenetic profile, exposure to the environ- for many years or even decades.
    [Show full text]
  • The Emergence of Lncrnas in Cancer Biology
    Review The Emergence of lncRNAs in Cancer Biology John R. Prensner1,2 and Arul M. Chinnaiyan1–5 AbstAt R c The discovery of numerous noncoding RNA (ncRNA) transcripts in species from yeast to mammals has dramatically altered our understanding of cell biology, especially the biology of diseases such as cancer. In humans, the identification of abundant long ncRNA (lncRNA) >200 bp has catalyzed their characterization as critical components of cancer biology. Recently, roles for lncRNAs as drivers of tumor suppressive and oncogenic functions have appeared in prevalent cancer types, such as breast and prostate cancer. In this review, we highlight the emerging impact of ncRNAs in cancer research, with a particular focus on the mechanisms and functions of lncRNAs. Significance: lncRNAs represent the leading edge of cancer research. Their identity, function, and dysregulation in cancer are only beginning to be understood, and recent data suggest that they may serve as master drivers of carcinogenesis. Increased research on these RNAs will lead to a greater un- derstanding of cancer cell function and may lead to novel clinical applications in oncology. Cancer Discovery; 1(5):391–407. ©2011 AACR. intRoduction transcription reflects true biology or by-products of a leaky transcriptional system. Encompassed within these studies are A central question in biology has been, Which regions of the broad questions of what constitutes a human gene, what the human genome constitute its functional elements: those distinguishes a gene from a region that is simply transcribed, expressed as genes or those serving as regulatory elements? and how we interpret the biologic meaning of transcription.
    [Show full text]
  • PCGEM1, a Prostate-Specific Gene, Is Overexpressed in Prostate Cancer
    PCGEM1, a prostate-specific gene, is overexpressed in prostate cancer Vasantha Srikantan*†, Zhiqiang Zou*†, Gyorgy Petrovics*, Linda Xu*, Meena Augustus*‡, Leland Davis*, Jeffrey R. Livezey*, Theresa Connell*, Isabell A. Sesterhenn§, Kiyoshi Yoshino¶, Gregory S. Buzard¶, F. K. Mostofi§, David G. McLeod*ሻ, Judd W. Moul*ሻ, and Shiv Srivastava*,** *Center for Prostate Disease Research, Department of Surgery, Uniformed Services University of the Health Sciences, Bethesda, MD 20814-4799; ‡Genetics Department, Division of Clinical Sciences, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892-4470; §Armed Forces Institute of Pathology, Department of Genitourinary Pathology, Washington, DC 20307; ¶Laboratory of Comparative Carcinogenesis, Science Applications International Corporation, National Cancer Institute, Frederick Cancer Research and Development Center, Frederick, MD 21702-1201; and ࿣Urology Service, Department of Surgery, Walter Reed Army Medical Center, Washington, DC 20307-5001 Communicated by Bernhard Witkop, National Institutes of Health, Chevy Chase, MD, August 17, 2000 (received for review February 28, 2000) A prostate-specific gene, PCGEM1, was identified by differential anti-PSMA monoclonal antibodies (4). Furthermore, promising display analysis of paired normal and prostate cancer tissues. immunotherapy approaches are being pursued with PSMA Multiple tissue Northern blot analysis revealed that PCGEM1 was peptides (5). Recently described prostate-specific genes include expressed exclusively in human prostate tissue. Analysis of PC- an androgen-regulated homeobox gene, NKX3.1, which exhibits GEM1 expression in matched normal and primary tumor specimens function(s) in mouse prostate growth͞development (6, 7) and revealed tumor-associated overexpression in 84% of patients with shows overexpression in a subset of CaP (26). A prostate-specific prostate cancer by in situ hybridization assay and in 56% of gene, prostate stem cell antigen, has been shown to exhibit patients by reverse transcription–PCR assay.
    [Show full text]
  • Lncrna‑P21 Promotes Chondrocyte Apoptosis in Osteoarthritis by Acting As a Sponge for Mir‑451
    MOLECULAR MEDICINE REPORTS 18: 5295-5301, 2018 LncRNA‑p21 promotes chondrocyte apoptosis in osteoarthritis by acting as a sponge for miR‑451 LUPING TANG, JIANBO DING, GUANGJU ZHOU and ZHIHAI LIU Department of Emergency Medicine, Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310009, P.R. China Received December 20, 2017; Accepted September 11, 2018 DOI: 10.3892/mmr.2018.9506 Abstract. Osteoarthritis (OA) is the most common type of by the overexpression of lncRNA-p21 was abolished by the arthritis, and remains to be social and medical challenge. miR-451 mimic. Investigation into the underlying mechanism Thus, identifying novel molecular targets is important for revealed that lncRNA-p21 interacted with miRNA-451. In the prevention and treatment of OA. Long noncoding RNAs addition, lncRNA-p21 negatively regulated the expression of (lncRNAs) have been reported to modulate various biological miR-451. Furthermore, lncRNA-p21 promoted the apoptosis and pathological processes. The aim of the present study was of chondrocytes in OA by acting as a sponge for miR-451. to investigate the role of lncRNA-p21 in OA and its underlying Thus, lncRNA-p21 was proposed as a promising target for the mechanism, in order to better understand the development of OA treatment of OA. and its treatment. Chondrocytes were isolated from cartilage samples obtained from OA and normal patients. Chondrocytes Introduction were transfected with microRNA (miRNA/miR)-451 mimics, miR-451 inhibitor, pcDNA3.1(+)-p21 or small interfering Osteoarthritis (OA) is reported to afflict nearly 250 million RNA-p21. Flow cytometry was performed to analyze cell people in the whole world and is the most common apoptosis and reverse transcription-quantitative polymerase arthritis (1,2).
    [Show full text]
  • Association Between Lncrna PCGEM1 Polymorphisms and Prostate Cancer Risk
    Prostate Cancer and Prostatic Disease (2013) 16, 139–144 & 2013 Macmillan Publishers Limited All rights reserved 1365-7852/13 www.nature.com/pcan ORIGINAL ARTICLE Association between lncrna PCGEM1 polymorphisms and prostate cancer risk Y Xue1,2,5, M Wang2,3,5, M Kang2,3, Q Wang2,3,BWu2,3, H Chu1,2, D Zhong1,2, C Qin4, C Yin4, Z Zhang1,2,3 and D Wu2,3 BACKGROUND: Prostate cancer (PCa) gene expression marker 1 (PCGEM1), a long noncoding RNA, has drawn increasing attention for its important role in PCa. However, the association between genetic variations in the PCGEM1 gene and risk of PCa has not been investigated yet. METHODS: We investigated the effect of two tagging single-nucleotide polymorphism (tSNPs; rs6434568 and rs16834898) in PCGEM1 gene on PCa risk in the Chinese men. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the association. RESULTS: We found a significantly decreased risk of PCa for rs6434568 AC and AC/AA genotype (adjusted OR ¼ 0.76, 95% CI ¼ 0.60–0.97 for AC; adjusted OR ¼ 0.76, 95% CI ¼ 0.61–0.96 for AC/AA), as well as rs16834898 AC and AC/CC genotype (adjusted OR ¼ 0.76, 95% CI ¼ 0.59–0.97 for AC; adjusted OR ¼ 0.79, 95% CI ¼ 0.62–0.99 for AC/CC), compared with the CC and AA genotypes, respectively. When we evaluated these two tSNPs together based on the risk alleles (that is, rs6434568 C and rs16834898 A), we found that the combined genotypes with four risk alleles were associated with an increased risk of PCa compared with those carrying 0–3 risk alleles (1.53, 1.19–1.97), and this increased risk was more pronounced among subjects ofp70 years (1.80, 1.24– 2.62), Gleason scorep7 (1.68, 1.28–2.22) and PSA levelX20 (1.64, 1.24–2.18).
    [Show full text]
  • The Lncrnas PCGEM1 and PRNCR1 Are Not Implicated in Castration Resistant Prostate Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 5, No. 6 The lncRNAs PCGEM1 and PRNCR1 are not implicated in castration resistant prostate cancer John R. Prensner1,*, Anirban Sahu1,*, Matthew K. Iyer1,2,*, Rohit Malik1,*, Benjamin Chandler1, Irfan A. Asangani1, Anton Poliakov1, Ismael A. Vergara3, Mohammed Alshalalfa3, Robert B. Jenkins4, Elai Davicioni3, Felix Y. Feng1,5,7, Arul M. Chinnaiyan1,2,6,7,8 1 Michigan Center for Translational Pathology, University of Michigan, Ann Arbor, Michigan USA. 2 Department of Computational Medicine and Bioinformatics, Ann Arbor, Michigan USA. 3 GenomeDx Biosciences Inc., Vancouver, British Columbia, Canada. 4 Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, Minnesota USA. 5 Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan USA. 6 Department of Pathology, University of Michigan, Ann Arbor, Michigan USA. 7 Comprehensive Cancer Center, University of Michigan, Ann Arbor, Michigan USA. 8 Howard Hughes Medical Institute, University of Michigan, Ann Arbor, Michigan USA. * These authors contributed equally Correspondence to: Arul M. Chinnaiyan, email: [email protected] Keywords: prostate cancer, long noncoding RNA, androgen receptor Received: February 5, 2014 Accepted: March 21, 2014 Published: March 23, 2014 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT: Long noncoding RNAs (lncRNAs) are increasingly implicated in cancer biology, contributing to essential cancer cell functions such as proliferation, invasion, and metastasis. In prostate cancer, several lncRNAs have been nominated as critical actors in disease pathogenesis. Among these, expression of PCGEM1 and PRNCR1 has been identified as a possible component in disease progression through the coordination of androgen receptor (AR) signaling (Yang et al., Nature 2013, see ref.
    [Show full text]
  • The Hallmarks of Cancer a Long Non-Coding RNA Point of View
    review REVIEW RNA Biology 9:6, 703-719; June 2012; © 2012 Landes Bioscience The hallmarks of cancer A long non-coding RNA point of view Tony Gutschner and Sven Diederichs* Helmholtz-University-Group “Molecular RNA Biology & Cancer”; German Cancer Research Center DKFZ; Heidelberg, Germany; Institute of Pathology; University of Heidelberg; Heidelberg, Germany Keywords: non-coding RNA, ncRNA, lincRNA, gene expression, carcinogenesis, tumor biology, cancer therapy, MALAT1, HOTAIR, XIST, T-UCR Abbreviations: ALT, alternative lengthening of telomeres; AR, androgen receptor; ANRIL, antisense non-coding RNA in the INK4 locus; Bax, BCL2-associated X protein; Bcl-2, B cell CLL/lymphoma 2; Bcl-xL, B cell lymphoma-extra large; CBX, chromobox homolog; cIAP2, cellular inhibitor of apoptosis; CUDR, cancer upregulated drug resistant; EMT, epithelial- mesenchymal-transition; eNOS, endothelial nitric-oxide synthase; ER, estrogen receptor; GAGE6, G antigene 6; GAS5, growth-arrest specific 5; GR, glucocorticoid receptor; HCC, hepatocellular carcinoma; HIF, hypoxia-inducible factor; HMGA1, high mobility group AT-hook 1; hnRNP, heterogenous ribonucleoprotein; HOTAIR, HOX antisense intergenic RNA; HOX, homeobox; HULC, highly upregulated in liver cancer; lncRNA, long non-coding RNA; lincRNA, long intergenic RNA; MALAT1, metastasis associated long adenocarcinoma transcript 1; Mdm2, murine double minute 2; miRNA, microRNA; mRNA, messenger RNA; mTOR, mammalian target of rapamycin; Myc, myelocytomatosis oncogene; NAT, natural antisense transcript; ncRNA, non-coding
    [Show full text]
  • The Long Non-Coding RNA PCGEM1 Is Regulated by Androgen Receptor
    Parolia et al. Molecular Cancer (2015) 14:46 DOI 10.1186/s12943-015-0314-4 SHORT COMMUNICATION Open Access The long non-coding RNA PCGEM1 is regulated by androgen receptor activity in vivo Abhijit Parolia1,2,3, Francesco Crea2,3,5, Hui Xue2,3, Yuwei Wang2,3, Fan Mo3, Varune Rohan Ramnarine3, Hui Hsuan Liu2, Dong Lin2,3,5, Nur Ridzwan Nur Saidy1,2, Pier-Luc Clermont2,4, Hongwei Cheng2,3, Colin Collins3, Yuzhuo Wang2,3*† and Cheryl D Helgason2,6*† Abstract Background: Long non-coding RNAs (lncRNAs) can orchestrate oncogenic or tumor-suppressive functions in cancer biology. Accordingly, PCGEM1 and PRNCR1 were implicated in progression of prostate cancer (PCa) as transcriptional co-regulators of the androgen receptor (AR). However, these findings were recently refuted asserting that neither gene physically binds to the AR. Despite evidence for differing AR transcriptional programs in vivo and in vitro, studies investigating AR-regulation of these genes hitherto have only been conducted in vitro. Here, we further examine the relevance of PCGEM1 and PRNCR1 in PCa, and their relationship with AR signaling, using patient-derived xenograft models. Findings: RNA sequencing of two distinct androgen-dependent models shows PCGEM1 to be considerably expressed, while PRNCR1 showed scant basal expression. PCGEM1 was sharply down-regulated following castration and up-regulated upon AR activation in vivo. However, we found no parallel evidence following AR stimulation in vitro.APCGEM1-associated gene expression signature (PES) was significantly repressed in response to androgen ablation therapy and in hormone-refractory versus hormone-naïve PCa patients. Furthermore, we found PCGEM1 was uniformly distributed in PCa cell nucleus and cytoplasm which remained unaltered upon AR transcriptional activation.
    [Show full text]
  • Genome-Wide Analysis of Long Noncoding RNA Signature in Human Colorectal Cancer
    Gene 556 (2015) 227–234 Contents lists available at ScienceDirect Gene journal homepage: www.elsevier.com/locate/gene Genome-wide analysis of long noncoding RNA signature in human colorectal cancer Yao Xue a,b,1,GaoxiangMaa,b,1,DongyingGuc,1, Lingjun Zhu d,QiuhanHuaa,b, Mulong Du a,b,HaiyanChua, Na Tong a, Jinfei Chen c, Zhengdong Zhang a,b,⁎, Meilin Wang a,b,⁎ a Department of Environmental Genomics, Jiangsu Key Laboratory of Cancer Biomarkers, Prevention and Treatment, Cancer Center, Nanjing Medical University, Nanjing, China b Department of Genetic Toxicology, The Key Laboratory of Modern Toxicology, Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing, China c Department of Oncology, Nanjing First Hospital, Nanjing Medical University, Nanjing, China d Department of Oncology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, China article info abstract Article history: Long noncoding RNAs (lncRNAs) have been widely regarded as crucial regulators in various biological processes Received 21 October 2014 involved in carcinogenesis. However, the comprehensive lncRNA expression signature in colorectal cancer re- Accepted 28 November 2014 mains fully unknown. We performed a high throughput microarray assay to detect lncRNA expression profile Available online 29 November 2014 in three paired human colorectal cancer tissues and their adjacent normal tissues. Additional 90 paired colorectal samples were collected to verify differently expression levels of two selected lncRNAs using q-RT-PCR assay. Keywords: Bioinformatic approaches were performed to explore into the functions of these differently expressed lncRNAs. lncRNA Colorectal cancer Microarray assay showed a series of lncRNAs were differently expressed in colorectal cancer. Two of the lncRNAs, Expression profile HOTAIR and a novel lncRNA, lncRNA-422 were confirmed in more samples (P = 0.015 for HOTAIR and P =0.027 GSEA for lncRNA-422, respectively).
    [Show full text]