DOCSLIB.ORG

Down-Regulation of RUNX1, RUNX3 and CBF‚ in Hepatocellular Carcinomas in an Early Stage of Hepatocarcinogenesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Down-Regulation of RUNX1, RUNX3 and CBF‚ in Hepatocellular Carcinomas in an Early Stage of Hepatocarcinogenesis ANTICANCER RESEARCH 26: 3633-3644 (2006) Down-regulation of RUNX1, RUNX3 and CBF‚ in Hepatocellular Carcinomas in an Early Stage of Hepatocarcinogenesis KOUJI MIYAGAWA1, CHOUHEI SAKAKURA1, SUSUMU NAKASHIMA1, TETSUJI YOSHIKAWA1, SHUICHI KIN1, YUENN NAKASE1, KOSEI ITO4, HISAKAZU YAMAGISHI2, HIROSHI IDA3,4, SHUJIRO YAZUMI3, TSUTOMU CHIBA4, YOSHIAKI ITO4 and AKEO HAGIWARA1 1Department of Surgery and Regenerative Medicine, Division of Surgery and Physiology of Digestive System, 2Department of Surgery and Regenerative Medicine, Division of Surgery and Oncology of Digestive System, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, Kamigyo-ku, Kawaramachi-dori, Kyoto 602-8566; 3Division of Gastroenterology and Hepatology, Graduate School of Internal Medicine, Kyoto University, Kyoto, 606-8507, Japan; 4Institute of Molecular and Cell Biology and Oncology Reseach Institute, National University of Singapore, 30 Medical Drive, Singapore 117609, Singapore Abstract. Background: Our previous studies suggested that Results: Among RUNX family genes, only RUNX3 showed deficient function of RUNX3 protein is causally related to frequent hemizygous deletion in HCC (40%, 17 out of 35 development and progression of human gastric cancer. cases). Ratios of RUNX mRNA to ‚-actin mRNA (x103) for RUNX3 is mapped to 1p36, which is frequently deleted in RUNX1 were 21.7±9.1, 11.8±5.6 and 5.5±2.5; for RUNX2, hepatocellular carcinomas (HCC), therefore, these tumors 0.7±0.7, 0.5±0.4 and 0.4±0.1; for RUNX3, 23.3±7.6, were investigated for expression and copy number changes of 5.8±2.3 and 1.9±0.9; for CBF‚, 17.9±7.0, 8.9±3.1 and RUNX3 and other Runt-related genes, RUNX1, RUNX2, and 5.5±2.1 (normal vs. LC vs. tumor, respectively, mean±SD). their co-factor CBF‚. Similarly nearby uninvolved liver Basal RUNX2 expression was very weak, with no significant showing cirrhosis or normal histology was investigated in difference between HCC and other groups. In contrast, conjunction with various clinicopathological factors. Materials RUNX1 and RUNX3 showed remarkable down-regulation in and Methods: Copy number change and expression change of 75% and 92% of HCC, respectively, as well as in 55% and RUNX family genes in 35 hepatocellular carcinoma specimens 71% of specimens with LC, a precancerous lesion for HCC. and adjoining liver with cirrhosis (LC) or normal histology Furthermore, CBF‚, an important cofactor of RUNX1, -2 and were estimated using quantitative reverse transcription -3, also was significantly downregulated, but less frequently and polymerase chain reaction (RT-PCR) and in situ hybridization. intensely than either RUNX1 or RUNX3. Prevalence of downregulation of RUNX1, RUNX3 and CBF‚ increased as LC progressed to HCC and as cancer stage progressed, suggesting that RUNX family genes may be involved early in Abbreviations: CBF, core binding factor; PEBP2, polyomavirus hepatocarcinogenesis, as well as in cancer progression. enhancer binding protein 2; FISH, fluorescence in situ hybridization; RT-PCR, reverse transcriptase-polymerase chain reaction; MSP, Conclusion: These findings suggest that RUNX3, as well as methylation-specific polymerase chain reaction; HCC, hepatocellular RUNX1 and CBF‚ play important roles in hepato- carcinoma; LC, liver cirrhosis; PBS, phosphate-buffered saline. carcinogenesis and that RUNX gene family involvement in hepatocarcinogenesis may be more widespread and complex Correspondence to: Chouhei Sakakura, MD, Ph.D., Department of than previously realized. Digestive Surgery, Kyoto Prefectural University of Medicine, Kamigyo-ku, Kawaramachi-dori, Kyoto 602, Japan. Tel: 81-75-251- Hepatocellular carcinoma (HCC) is among the most common 5527, Fax: 81-75-251-5522, e-mail: [email protected] human cancers worldwide (1). Epidemiological studies have Key Words: Hepatocellular carcinoma, RUNX1, RUNX3, CBF‚, implicated infection with hepatitis B virus (HBV) or C virus hepatocarcinogenesis. (HCV) and ingestion of foods contaminated by aflatoxins in 0250-7005/2006 $2.00+.40 3633 ANTICANCER RESEARCH 26: 3633-3644 (2006) the occurrence of HCC (2). Recent molecular genetic studies as follows: Stage I, 4 cases; Stage II, 23 cases; Stage III, 6 cases; have attributed human cancers to multiple genetic Stage IV, 2 cases. Clinical samples were washed with ice-cold alterations, involving both proto-oncogenes and tumor phosphate-buffered saline (PBS) and immediately homogenized in Isogen reagent (Nippon Gene, Osaka, Japan), and total RNA was suppressor genes in hepatocellular carcinomas (3). extracted and stored at –80ÆC until use. Ethics approval exists and Nonetheless, molecular mechanisms of hepatocellular written informed consent was obtained from each patient prior to carcinogenesis remain poorly understood. tissue acquisition. Recent studies suggested that RUNX family genes are involved in many types of human cancer. RUNX1 is essential Fluorescence in situ hybridization (FISH). FISH was carried out as for definitive hematopoiesis, and is expressed in a variety of described previously (20). Two probes were used: pUCl.77 (specific for the pericentromeric regions of chromosome 1) and a RUNX3 myeloid and lymphoid lineages, while core binding factors BAC clone (RP11-84-D-1), which contains 169 kb of DNA (CBF) / polyomavirus enhancer binding protein2 (PEBP2)- including all of the exons of RUNX3. One microgram each of the binding sites are present in many hematopoietic cell-specific PUC1.77 and RUNX3 BAC probes were labeled with bio-16-dUTP target genes, suggesting important roles at subsequent and dig-11-dUTP, respectively, using a nick translation kit (Roche, stages of development (4, 5). In myeloid and lymphoid Mannheim, Germany). Interphase nuclei were fixed in methanol leukemias, RUNX1 is a frequent target of chromosomal and acetic acid (3:1) and dropped onto microscope slides. One ÌL translocations, as well as mutations. Chromosomal of Cot-1 was added to 9 ÌL of probe hybridization solution. The final mixture was denatured at 75ÆC for 10 min, cooled on ice for 5 translocations result in truncation and fusion of RUNX1 to min, then mixed with an equal volume of 4x SSC containing 20% heterologous proteins (6, 7) which inhibit normal RUNX1 dextran sulfate. The hybridization mixture was placed on denatured function, perturb lineage differentiation, and predispose to slides, covered with Parafilm, and incubated in a humidified box for leukemia (8, 9). RUNX2 is essential for bone formation (10- 16 to 24 h. After being washed in 50% formamide/2x SSC, 2x SSC, 13). Oncogenic activity of this gene has been demonstrated and 1x SSC, slides were counterstained with DAPI (1 Ìg/mL) and in a mouse model, where RUNX2 functioned as a dominant mounted in an antifade solution containing p-phenylenediamine oncogene in T-cell lymphoma (14, 15). CBF‚/PEBP2‚ is (PPD). Fluorescence images were captured with a Zeiss axiophot microscope equipped with a charge-coupled device camera. important target of TGF‚ superfamily signaling and play crucial roles in mammalian development. CBF‚/PEBP2‚ is Real-time quantitative RT-PCR. cDNA was produced from total RNA also involved in acute myelogenous leukemia (16-19). by using a Superscript preamplification system (BRL, Bethesda, MD, Recently, we reported a causal relationship between loss of USA) and following the procedures suggested by the manufacturer. RUNX3 expression and gastric cancer (20). RNA was heated to 70ÆC for 10 min in 14 Ìl of diethylpyrocarbonate- Previous genetic analysis indicated that one of the treated water containing 0.5 Ìg oligo (dT). Synthesis buffer (10x), 2 Ìl 10 mM dNTP mix, 2 Ìl 0.1 M DTT, and reverse transcriptase putative tumor suppressor genes assumed to be located on (Superscript RT; 200 U/ÌL GIBCO BRL, Gaithersburg, MD, USA) chromosome 1p may be involved in an early step in were added to the sample. The resulting reaction mixture was hepatocarcinogenesis (21). RUNX3, which we recently incubated at 42ÆC for 50 min, and the reaction was terminated by reported to be involved in gastric carcinogenesis (20), has incubating the mixture at 90ÆC for 5 min. Quantitative PCR was been mapped to chromosome 1p36 (22) and is a locus of performed using real-time “Taqman TM” technology and analyzed multiple tumor suppressor genes for many cancers on a Model 5700 Sequence Detector (Applied Biosystems Corp., including HCC (23, 24). Genetic alterations in HCC Foster City, CA, USA) as described previously (25). RUNX3 RT-PCR primers were 5’-AAGCACAGCCATCAGGATT suggest that RUNX3 may be involved in hepato- CA-3’ and 5’-TGGACATGCTTGCGGATATAAG-3’. Hybridization carcinogenesis. Furthermore, other RUNX family proteins probes, which bind to PCR products, were labeled with a reporter also are expressed in normal hepatocytes, where they share dye, FAM, on the 5’ nucleotide and a quenching dye, TAMRA, on the same binding sites. Hence, it is necessary to study the 3’nucleotide. Sequences of hybridization probes were RUNX3: possible roles of these members of the RUNX family in 5’-(FAM) CATCTGGAACTTCTCCTGGTCTCTC AGC (TAMRA)- growth and differentiation of hepatocytes and development 3’. Other sets of primers and hybridization probes for RUNX1, -2, of hepatocellular carcinoma. We therefore examined CBF‚, ‚-actin RNA were purchased from Applied Biosystems. Fifty Ìl reactions contained: 1.25 units Amp-Taq DNA expression and copy number changes in RUNX1, -2 and -3, polymerase, 1x PCR reaction buffer, 180 ng of each primer, 200 as well as CBF‚/PEBP2‚ in normal and cirrhosis liver mM dNTP, 400 mM dNTP, 100 nM Taqman probe and 0.5 U tissue in addition to HCCs. Amplirase (Applied Biosystems Corp.). The Ct value corresponding to the cycle number at which the real-time Materials and Methods fluorescence emission reaches a threshold of ten standard deviations above the mean base line emission from cycle 1 to 40 Primary tumor specimens. The study population consisted of 35 was measured against serial dilutions of control cDNA, analyzed patients with primary HCC undergoing surgery at Kyoto for each target. These target genes were used as standard curves to Prefectural University of Medicine, Japan, during 1999 to 2003. determine the rate of change in Ct value.
Load more

Recommended publications
  • Jdp2 Downregulates Trp53 Transcription to Promote Leukaemogenesis in the Context of Trp53 Heterozygosity
    Oncogene (2013) 32, 397 --402 & 2013 Macmillan Publishers Limited All rights reserved 0950-9232/13 www.nature.com/onc SHORT COMMUNICATION Jdp2 downregulates Trp53 transcription to promote leukaemogenesis in the context of Trp53 heterozygosity L van der Weyden1, AG Rust1,4, RE McIntyre1,4, CD Robles-Espinoza1, M del Castillo Velasco-Herrera1, R Strogantsev2, AC Ferguson-Smith2, S McCarthy1, TM Keane1, MJ Arends3 and DJ Adams1 We performed a genetic screen in mice to identify candidate genes that are associated with leukaemogenesis in the context of Trp53 heterozygosity. To do this we generated Trp53 heterozygous mice carrying the T2/Onc transposon and SB11 transposase alleles to allow transposon-mediated insertional mutagenesis to occur. From the resulting leukaemias/lymphomas that developed in these mice, we identified nine loci that are potentially associated with tumour formation in the context of Trp53 heterozygosity, including AB041803 and the Jun dimerization protein 2 (Jdp2). We show that Jdp2 transcriptionally regulates the Trp53 promoter, via an atypical AP-1 site, and that Jdp2 expression negatively regulates Trp53 expression levels. This study is the first to identify a genetic mechanism for tumour formation in the context of Trp53 heterozygosity. Oncogene (2013) 32, 397--402; doi:10.1038/onc.2012.56; published online 27 February 2012 Keywords: p53; Jdp2; transposon; heterozygosity; lymphoma; mice INTRODUCTION targeted by transposon insertion events leading to upregulated Genetic alterations of TP53 are frequent events in tumourigenesis Jdp2 expression and a decrease in Trp53 expression levels. Further and promote genomic instability, impair apoptosis, and contribute we illustrate that Jdp2 regulates the Trp53 promoter via an atypical to aberrant self-renewal.1--4 The spectrum of mutations that occur AP-1 binding site.
    [Show full text]
  • A Dissertation Entitled the Androgen Receptor
    A Dissertation entitled The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit Submitted to the Graduate Faculty as partial fulfillment of the requirements for the PhD Degree in Biomedical science Dr. Manohar Ratnam, Committee Chair Dr. Lirim Shemshedini, Committee Member Dr. Robert Trumbly, Committee Member Dr. Edwin Sanchez, Committee Member Dr. Beata Lecka -Czernik, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2011 Copyright 2011, Mesfin Gonit This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit As partial fulfillment of the requirements for the PhD Degree in Biomedical science The University of Toledo August 2011 Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of gene activation by AR, ligand activated AR signals through binding to the androgen response elements (AREs) in the target gene promoter/enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of androgen.
    [Show full text]
  • Regulation of Runx2 Accumulation and Its Consequences
    Regulation of Runx2 Accumulation and Its Consequences Junko Shimazu Submitted in partial fulfillment of the requirement for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2016 ©2016 Junko Shimazu All Rights Reserved ABSTRACT Regulation of Runx2 Accumulation and Its Consequences Junko Shimazu Osteoblasts are bone-forming cells and therefore they are responsible of the synthesis of type I collagen, the main component of bone matrix. However, there is an apparent disconnect between the regulation of osteoblast differentiation and bone formation since the synthesis of Type I collagen precedes the expression of Runx2, the earliest determinant of osteoblast differentiation. Recently, genetic experiments in the mouse have revealed the existence of an unexpected cross-regulation between bone and other organs. In particular this body of work has highlighted the importance of osteoblasts as endocrine cells to regulate whole-body glucose homeostasis by secretion of a hormone, osteocalcin. However, the fundamental question of why bone regulates glucose homeostasis remained to be answered. Therefore, in my thesis, considering that bone is a metabolically demanding organ that constantly renews itself, I hypothesized that characterizing the connection between the need of glucose as a main nutrient in osteoblasts and bone development will provide a key to deeper understanding of why bone regulates glucose homeostasis. My work shows here that glucose uptake through GLUT1 in osteoblasts is needed for osteoblast differentiation by suppressing the AMPK-dependent activation by phosphorylation at S148 of Smurf1 that targets Runx2 for degradation. I also uncovered the mechanism of action of Smurf1 in this setting.
    [Show full text]
  • Effects of Estrogen Receptor and Wnt Signaling Activation On
    International Journal of Molecular Sciences Article Effects of Estrogen Receptor and Wnt Signaling Activation on Mechanically Induced Bone Formation in a Mouse Model of Postmenopausal Bone Loss 1, , 1, 1 1 Astrid Liedert * y, Claudia Nemitz y, Melanie Haffner-Luntzer , Fabian Schick , Franz Jakob 2 and Anita Ignatius 1 1 Institute of Orhopedic Research and Biomechanics, Trauma Research Center Ulm, University Medical Center Ulm, 89081 Ulm, Germany; [email protected] (C.N.); melanie.haff[email protected] (M.H.-L.); [email protected] (F.S.); [email protected] (A.I.) 2 Orthopaedic Center for Musculoskeletal Research, University of Würzburg, 97074 Würzburg, Germany; [email protected] * Correspondence: [email protected]; Tel.: +49-731-500-55333; Fax: +49-731-500-55302 These authors contributed equally to the study. y Received: 14 September 2020; Accepted: 31 October 2020; Published: 5 November 2020 Abstract: In the adult skeleton, bone remodeling is required to replace damaged bone and functionally adapt bone mass and structure according to the mechanical requirements. It is regulated by multiple endocrine and paracrine factors, including hormones and growth factors, which interact in a coordinated manner. Because the response of bone to mechanical signals is dependent on functional estrogen receptor (ER) and Wnt/β-catenin signaling and is impaired in postmenopausal osteoporosis by estrogen deficiency, it is of paramount importance to elucidate the underlying mechanisms as a basis for the development of new strategies in the treatment of osteoporosis. The present study aimed to investigate the effectiveness of the activation of the ligand-dependent ER and the Wnt/β-catenin signal transduction pathways on mechanically induced bone formation using ovariectomized mice as a model of postmenopausal bone loss.
    [Show full text]
  • Supplementary Information
    Osa et al Supplementary Information Clinical implications of monitoring nivolumab immunokinetics in previously treated non– small cell lung cancer patients Akio Osa, Takeshi Uenami, Shohei Koyama, Kosuke Fujimoto, Daisuke Okuzaki, Takayuki Takimoto, Haruhiko Hirata, Yukihiro Yano, Soichiro Yokota, Yuhei Kinehara, Yujiro Naito, Tomoyuki Otsuka, Masaki Kanazu, Muneyoshi Kuroyama, Masanari Hamaguchi, Taro Koba, Yu Futami, Mikako Ishijima, Yasuhiko Suga, Yuki Akazawa, Hirotomo Machiyama, Kota Iwahori, Hyota Takamatsu, Izumi Nagatomo, Yoshito Takeda, Hiroshi Kida, Esra A. Akbay, Peter S. Hammerman, Kwok-kin Wong, Glenn Dranoff, Masahide Mori, Takashi Kijima, Atsushi Kumanogoh Supplemental Figures 1 – 8 1 Osa et al Supplemental Figure 1. The frequency of nivolumab-bound T cells was maintained in patients who continued treatment. Nivolumab binding in CD8 and CD4 T cells was analyzed at two follow-up points, as indicated, in fresh peripheral blood from three representative cases from protocol 1 that continued treatment. 2 Osa et al Supplemental Figure 2. Long-term follow-up of nivolumab binding to T cells from fresh whole blood. Nivolumab binding was followed up in fresh peripheral blood from an additional case, Pt.7. 3 Osa et al Supplemental Figure 3. Long-term duration of nivolumab binding is due to sustained circulation of residual nivolumab in plasma. (A) PBMCs acquired from Pt.8 and 9 at pretreatment (pre PBMCs) and after a single dose (post 1 PBMCs) were cultured in regular medium without nivolumab (top and middle). Pre PBMCs were also incubated with 10 µg/ml nivolumab in vitro before the cultures were started (bottom). Nivolumab binding status was monitored at the indicated time points.
    [Show full text]
  • RUNX2 Regulates Leukemic Cell Metabolism and Chemotaxis in High-Risk T Cell Acute Lymphoblastic Leukemia
    RUNX2 regulates leukemic cell metabolism and chemotaxis in high-risk T cell acute lymphoblastic leukemia Filip Matthijssens, … , Pieter Van Vlierberghe, Ksenia Matlawska-Wasowska J Clin Invest. 2021;131(6):e141566. https://doi.org/10.1172/JCI141566. Research Article Oncology Graphical abstract Find the latest version: https://jci.me/141566/pdf The Journal of Clinical Investigation RESEARCH ARTICLE RUNX2 regulates leukemic cell metabolism and chemotaxis in high-risk T cell acute lymphoblastic leukemia Filip Matthijssens,1,2 Nitesh D. Sharma,3,4 Monique Nysus,3,4 Christian K. Nickl,3,4 Huining Kang,4,5 Dominique R. Perez,4,6 Beatrice Lintermans,1,2 Wouter Van Loocke,1,2 Juliette Roels,1,2 Sofie Peirs,1,2 Lisa Demoen,1,2 Tim Pieters,1,2 Lindy Reunes,1,2 Tim Lammens,2,7 Barbara De Moerloose,2,7 Filip Van Nieuwerburgh,8 Dieter L. Deforce,8 Laurence C. Cheung,9,10 Rishi S. Kotecha,9,10 Martijn D.P. Risseeuw,2,11 Serge Van Calenbergh,2,11 Takeshi Takarada,12 Yukio Yoneda,13 Frederik W. van Delft,14 Richard B. Lock,15 Seth D. Merkley,5 Alexandre Chigaev,4,6 Larry A. Sklar,4,6 Charles G. Mullighan,16 Mignon L. Loh,17 Stuart S. Winter,18 Stephen P. Hunger,19 Steven Goossens,1,2,20 Eliseo F. Castillo,5 Wojciech Ornatowski,21 Pieter Van Vlierberghe,1,2 and Ksenia Matlawska-Wasowska3,4 1Department of Biomolecular Medicine, Ghent University, Ghent, Belgium. 2Cancer Research Institute Ghent (CRIG), Ghent, Belgium. 3Department of Pediatrics, Division of Hematology-Oncology, University of New Mexico Health Sciences Center, Albuquerque, New Mexico, USA.
    [Show full text]
  • BMP9 Prevents Induction of Osteopontin in JNK-Inactivated
    International Journal of Biochemistry and Cell Biology 116 (2019) 105614 Contents lists available at ScienceDirect International Journal of Biochemistry and Cell Biology journal homepage: www.elsevier.com/locate/biocel BMP9 prevents induction of osteopontin in JNK-inactivated osteoblasts via Hey1-Id4 interaction T ⁎ Joji Kusuyamaa,b, , Changhwan Seonga,c, Toshiaki Nakamurad, Tomokazu Ohnishia, Muhammad Subhan Amira,c,e, Kaori Shimaf, Ichiro Sembaf, Kazuyuki Noguchid, Tetsuya Matsuguchia a Department of Oral Biochemistry, Field of Developmental Medicine, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima, 890-8544, Japan b Section on Integrative Physiology and Metabolism, Joslin Diabetes Center, Department of Medicine, Harvard Medical School, One Joslin Place, Boston, MA, 02215, USA c Department of Oral and Maxillofacial Surgery, Field of Oral and Maxillofacial Rehabilitation, Kagoshima University Graduate School of Medical and Dental Sciences, 8- 35-1 Sakuragaoka, Kagoshima, 890-8544, Japan d Department of Periodontology, Field of Oral and Maxillofacial Rehabilitation, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima, 890-8544, Japan e Department of Oral and Maxillofacial Surgery, Faculty of Dentistry, Airlangga University, Campus A UNAIR, JL. Mayjen Professor Doktor Moestopo No. 47, Pacar Kembang, Tambaksari, Kota SBY, Surabaya, Jawa Timur, 60132, Indonesia f Department of Oral Pathology, Field of Oncology, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima, 890-8544, Japan ARTICLE INFO ABSTRACT Keywords: Osteopontin (OPN) is an osteoblast-derived secretory protein that plays a role in bone remodeling, osteoblast BMP9 responsiveness, and inflammation. We recently found that osteoblast differentiation is type-specific, with con- Osteopontin ditions of JNK inactivation inducing osteoblasts that preferentially express OPN (OPN-type).
    [Show full text]
  • The Role of P53-Induced Mir-145A in Senescence and Osteogenesis of Mesenchymal Stem Cells
    The Role of p53-induced miR-145a in Senescence and Osteogenesis of Mesenchymal Stem Cells Chao Xia Shanghai Jiaotong University School of Medicine Xinhua Hospital Tianyuan Jiang Shanghai Jiaotong University School of Medicine Xinhua Hospital Yonghui Wang Shanghai Jiaotong University School of Medicine Xinhua Hospital Xiaoting Chen Shanghai Jiaotong University School of Medicine Xinhua Hospital Yan Hu Shanghai Jiaotong University School of Medicine Xinhua Hospital Yanhong Gao ( [email protected] ) https://orcid.org/0000-0003-4173-4855 Research Keywords: microRNAs, osteogenesis, senescence, mesenchymal stem cells, p53, Cbfb Posted Date: March 17th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-17497/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/21 Abstract Background: The osteogenic differentiation capacity of senescent bone marrow mesenchymal stem cells (MSCs) is diminished. However, little is known about the mechanisms. p53 not only regulates cellular senescence but also, as a negative regulator, is involved in bone formation. This study investigated the molecular mechanism of p53 in cellular senescence and osteogenesis. Methods: The expression of p53 and its downstream gene p21 were measured during cellular senescence and osteogenesis differentiation of primary bone marrow MSCs. Then miR-145a was picked out from those p53-induced miRNAs as its expression change in bone marrow MSCs senescence and osteogenesis induced by H2O2 and BMP-9, respectively. The function of p53 induced miR-145a was analyzed by transfected with miRNA mimic in osteogenic differentiation of MSCs. Western blot and luciferase reporter assay were used for validating the target of miR-145a.
    [Show full text]
  • Estrogen Promotes Mandibular Condylar Fibrocartilage
    www.nature.com/scientificreports OPEN Estrogen Promotes Mandibular Condylar Fibrocartilage Chondrogenesis and Inhibits Received: 27 November 2017 Accepted: 18 May 2018 Degeneration via Estrogen Published: xx xx xxxx Receptor Alpha in Female Mice Jennifer L. Robinson 1,3, Paola Soria2, Manshan Xu2, Mark Vrana1, Jefrey Luchetti1, Helen H. Lu3, Jing Chen2 & Sunil Wadhwa2 Temporomandibular joint degenerative disease (TMJ-DD) is a chronic form of TMJ disorder that specifcally aficts people over the age of 40 and targets women at a higher rate than men. Prevalence of TMJ-DD in this population suggests that estrogen loss plays a role in the disease pathogenesis. Thus, the goal of the present study was to determine the role of estrogen on chondrogenesis and homeostasis via estrogen receptor alpha (ERα) during growth and maturity of the joint. Young and mature WT and ERαKO female mice were subjected to ovariectomy procedures and then given placebo or estradiol treatment. The efect of estrogen via ERα on fbrocartilage morphology, matrix production, and protease activity was assessed. In the young mice, estrogen via ERα promoted mandibular condylar fbrocartilage chondrogenesis partly by inhibiting the canonical Wnt signaling pathway through upregulation of sclerostin (Sost). In the mature mice, protease activity was partly inhibited with estrogen treatment via the upregulation and activity of protease inhibitor 15 (Pi15) and alpha-2- macroglobulin (A2m). The results from this work provide a mechanistic understanding of estradiol on TMJ growth and homeostasis and can be utilized for development of therapeutic targets to promote regeneration and inhibit degeneration of the mandibular condylar fbrocartilage. Temporomandibular joint degenerative disease (TMJ-DD) is marked by degradation and premature calcifcation of the extracellular matrix (ECM) of the articular mandibular condylar fbrocartilage.
    [Show full text]
  • Identification of Shared and Unique Gene Families Associated with Oral
    International Journal of Oral Science (2017) 9, 104–109 OPEN www.nature.com/ijos ORIGINAL ARTICLE Identification of shared and unique gene families associated with oral clefts Noriko Funato and Masataka Nakamura Oral clefts, the most frequent congenital birth defects in humans, are multifactorial disorders caused by genetic and environmental factors. Epidemiological studies point to different etiologies underlying the oral cleft phenotypes, cleft lip (CL), CL and/or palate (CL/P) and cleft palate (CP). More than 350 genes have syndromic and/or nonsyndromic oral cleft associations in humans. Although genes related to genetic disorders associated with oral cleft phenotypes are known, a gap between detecting these associations and interpretation of their biological importance has remained. Here, using a gene ontology analysis approach, we grouped these candidate genes on the basis of different functional categories to gain insight into the genetic etiology of oral clefts. We identified different genetic profiles and found correlations between the functions of gene products and oral cleft phenotypes. Our results indicate inherent differences in the genetic etiologies that underlie oral cleft phenotypes and support epidemiological evidence that genes associated with CL/P are both developmentally and genetically different from CP only, incomplete CP, and submucous CP. The epidemiological differences among cleft phenotypes may reflect differences in the underlying genetic causes. Understanding the different causative etiologies of oral clefts is
    [Show full text]
  • Impact of RUNX2 on Drug-Resistant Human Pancreatic Cancer Cells with P53 Mutations
    Ozaki et al. BMC Cancer (2018) 18:309 https://doi.org/10.1186/s12885-018-4217-9 REVIEWARTICLE Open Access Impact of RUNX2 on drug-resistant human pancreatic cancer cells with p53 mutations Toshinori Ozaki1*†, Meng Yu2†, Danjing Yin3, Dan Sun4, Yuyan Zhu4, Youquan Bu5 and Meixiang Sang3 Abstract Background: Despite the remarkable advances in the early diagnosis and treatment, overall 5-year survival rate of patients with pancreatic cancer is less than 10%. Gemcitabine (GEM), a cytidine nucleoside analogue and ribonucleotide reductase inhibitor, is a primary option for patients with advanced pancreatic cancer; however, its clinical efficacy is extremely limited. This unfavorable clinical outcome of pancreatic cancer patients is at least in part attributable to their poor response to anti-cancer drugs such as GEM. Thus, it is urgent to understand the precise molecular basis behind the drug-resistant property of pancreatic cancer and also to develop a novel strategy to overcome this deadly disease. Review: Accumulating evidence strongly suggests that p53 mutations contribute to the acquisition and/or maintenance of drug-resistant property of pancreatic cancer. Indeed, certain p53 mutants render pancreatic cancer cells much more resistant to GEM, implying that p53 mutation is one of the critical determinants of GEM sensitivity. Intriguingly, runt-related transcription factor 2 (RUNX2) is expressed at higher level in numerous human cancers such as pancreatic cancer andosteosarcoma,indicatingthat,inadditiontoits pro-osteogenic role, RUNX2 has a pro-oncogenic potential. Moreover, a growing body of evidence implies that a variety of miRNAs suppress malignant phenotypes of pancreatic cancer cells including drug resistance through the down-regulation of RUNX2.
    [Show full text]
  • Retinoblastoma Binding Protein-1 (RBP1) Is a Runx2 Coactivator and Promotes Osteoblastic Differentiation BMC Musculo- Skeletal Disorders 2010, 11:104
    Monroe et al. BMC Musculoskeletal Disorders 2010, 11:104 http://www.biomedcentral.com/1471-2474/11/104 RESEARCH ARTICLE Open Access RetinoblastomaResearch article binding protein-1 (RBP1) is a Runx2 coactivator and promotes osteoblastic differentiation David G Monroe*, John R Hawse, Malayannan Subramaniam and Thomas C Spelsberg Abstract Background: Numerous transcription factors are involved in the establishment and maintenance of the osteoblastic phenotype, such as Runx2, osterix and Dlx5. The transcription factor retinoblastoma binding protein-1 (RBP1) was recently identified as an estrogen regulated gene in an osteosarcoma cell model. Since the function of RBP1 in osteoblastic differentiation and mineralization is unknown, we investigated the role of RBP1 in these processes. Methods: To create a cell model with suppressed RBP1 expression, primary calvarial osteoblasts were infected with a shRNA lentiviral vector specific for mouse RBP1 (CalOB-ΔRBP1) or a scrambled control shRNA lentivirus (CalOB-Control). Stable cell lines were generated and their mineralization potential was determined using osteoblastic differentiation medium, Alizarin Red staining, and quantitative PCR (QPCR) analyses. Runx2 coactivation by RBP1 was determined through the use of transient transfection assays. Results: Stable expression of the RBP1 shRNA lentivirus in CalOB-ΔRBP1 cells resulted in a 65-70% suppression of RBP1 expression. Osteoblastic mineralization assays demonstrated that suppression of RBP1 results in a potent delay in osteoblastic nodule formation in the CalOB-ΔRBP1 cells with a concomitant decrease in the expression of the osteogenic transcription factors Runx2 and osterix, along with decreases in BMP2, alkaline phosphatase, osteocalcin and bone sialoprotein. Regulation of Runx2 expression by RBP1 was shown to be mediated through the proximal P2 Runx2 promoter.
    [Show full text]