DOCSLIB.ORG

A Novel Primer Targeted Gyrb Gene for the Identification of Cronobacter Sakazakii in Powdered Infant Formulas (PIF) and Baby Foods in Iran

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Novel Primer Targeted Gyrb Gene for the Identification of Cronobacter Sakazakii in Powdered Infant Formulas (PIF) and Baby Foods in Iran Received: 21 July 2018 Revised: 18 November 2018 Accepted: 26 November 2018 DOI: 10.1111/jfs.12609 ORIGINAL ARTICLE A novel primer targeted gyrB gene for the identification of Cronobacter sakazakii in powdered infant formulas (PIF) and baby foods in Iran Afsaneh Mashoufi1 |KiarashGhazvini2 | Mohammad Hashemi1 | Majid Ghayour Mobarhan1 | Vida Vakili3 | Asma Afshari1 1Department of Nutrition, Faculty of Medicine, Mashhad University of Medical Abstract Sciences, Mashhad, Iran The aim of this study was to perform a molecular identification and design a polymerase chain 2Department of Microbiology, Faculty of reaction (PCR) method based on a specific gene (gyrase subunit B [gyrB]) for rapid detection of Medicine, Mashhad University of Medical Cronobacter sakazakii. In this study, from February 2017 to January 2018, 100 powdered infant Sciences, Mashhad, Iran formula milks (PIF1-6) and 100 baby food items (BF1-8) (total number = 200 samples) were pur- 3Department of Social Medicine, Faculty of Medicine, Mashhad University of Medical chased from different commercial brands from different pharmacies of the Mashhad city, Iran Sciences, Mashhad, Iran from different pharmacies of the Mashhad city, Iran. Correspondence After isolation of Cronobacter, DNA extraction and PCR assay were performed to detect and Asma Afshari, Department of Nutrition, confirm genus and species of isolated bacteria with 16S ribosomal RNA (16S rRNA) and designed Faculty of Medicine, Mashhad University of gyrB primers, respectively. The abundance of C. sakazakii in PIFs and baby foods by culture Medical Sciences, Mashhad, Iran. Email: [email protected] method were 5/100 (5%) and 8/100 (8%), respectively; also, the final analysis based on gyrB Funding information primer pairs in PIF and baby food showed contamination rates of 0/100 (0%) and 3/100 (3%), Mashhad University of medical science, respectively. These findings indicated that Iranian baby foods were a real threat for children's Mashhad, Iran, Grant/Award Number: A-1062. health. It is also recommended that this designed primer could be used for detection of Crono- bacter sakazakii in these products. Practical application Cronobacter sakazakii is an opportunistic bacteria that is known worldwide as a foodborne path- ogen especially in Infant Formula and baby foods, therefore the quality of these products has to be evaluated by a rapid, sensitive and specific method. Our findings indicated that Iranian baby foods were a threat for children's health so implementation of adequate sanitary measures to prevent Cronobacter sakazakii illness is necessary. It was also recommended that the designed primer based on gyr B gene could be used for specific detection of Cronobacter sakazakii in these products. 1 | INTRODUCTION Cronobacteria classifies into seven species: Cronobacter sakazakii, Cronobacter muytjensii, Cronobacter malonaticus, Cronobacter Food safety considered as one of the most important worldwide universalis, Cronobacter condiment, Cronobacter dublinensis,&Crono- health issues; many microbes cause foodborne diseases, and are major bacter turicensis (Joseph, Hariri, & Forsythe, 2013). Among them, cause of morbidity and mortality throughout the world. According to C. malonaticus, C. turicensis and C. sakazakii are very common the reports, 1.8 million people died from diarrheal diseases in 2005, species that have been separated from human infections (Jackson, but the global incidence of foodborne disease remains unknown. Sonbol, Masood, & Forsythe, 2014; Zimmermann, Schmidt, Cronobacteria spp. are considered as emerging opportunistic Loessner, & Weiss, 2014). pathogens; and its infection can be life threatening for humans C. sakazakii is an opportunistic pathogen that is known worldwide (Zhao et al., 2010b). According to the molecular identification, as a foodborne pathogen; also, it has the highest prevalence among J Food Saf. 2018;e12609. wileyonlinelibrary.com/journal/jfs © 2018 Wiley Periodicals, Inc. 1of6 https://doi.org/10.1111/jfs.12609 2of6 MASHOUFI ET AL. the mentioned species (Ye et al., 2018). This bacterium is gram-nega- One of the molecular methods which is used to identify Cronobac- tive, motile by peritrichous flagella, rod-shape, facultative anaerobe, teria species is analyzing 16S rRNA genomic sequences, this gene is and nonspore-forming (Feeney et al., 2014; Heperkan, Dalkilic-Kaya, & not able to differentiate some species such as C. sakazakii and Juneja, 2017). It causes infections among all age groups, including C. malanticus due to their genetic similarity (Kucerova et al., 2010; Ye, infants, children, and adults, especially the elderly and immunocom- Ling, Han, Cao, & Wu, 2015). Also, it has been observed that 16S rRNA promised persons; also, it is the most severe cause of infections gene sequences among the C. sakazakii group strains have high among newborns as well. According to these reports, this bacterium degrees of similarity (reaching 97.8–99.7%) (Iversen et al., 2008). with a mortality rate of 40–80%, has caused meningitis, septicemia, Therefore, it is essential to study other genes and primer for the and enterocolitis (Heperkan et al., 2017). Therefore, the International detection of C. sakazakii by molecular methods. There are many previ- Commission for Microbiological Specifications for Foods (ICMSF) clas- ous studies on various genes of C. sakazakii such as wzx (Jarvis et al., sifies Cronobacter spp. as a serious threat to the health of individuals 2011), rpoB (Stoop, Lehner, Iversen, Fanning, & Stephan, 2009), cgcA which can have significant effects over the long term (Shaker, Osaili, (Carter et al., 2013), gyrB (Huang, Chang, & Huang, 2013), dnaG Al-Omary, Jaradat, & Al-Zuby, 2007). (Seo & Brackett, 2005), wehI, wehC (Mullane et al., 2008). This bacterium has been identified in various food sources, In the same way, some studies have also been done on gluA, SG, although its relevance to powdered infant formula (PIF) and baby food zpx, and OmpA, but the results of Cronobacter spp. detection was not are major sources of concern (Biering et al., 1989; Teramoto et al., satisfactory (Chen et al., 2015). Based on rpoB sequences studies, dif- 2010; Yan et al., 2012). Raw materials of different origin or heat- ferent primer pairs were designed. But using this gene (rpoB) has a sensitive materials that are added to the PIF heating, extrinsic contam- flaw; the PCR should be repeated to distinguish C. sakazakii from ination of opened cans and carrier humans can be potential sources of other species. (Stoop et al., 2009). Studies targeting cgcA gene showed bacteria (Abdel-Galil, Abdel-Latif, Ammar, & Serry, 2015; Jaradat, Al the problem of nonspecific bands appearance on the agarose gels Mousa, Elbetieha, Al Nabulsi, & Tall, 2014; Mardaneh & Dallal, 2017). (Carter et al., 2013). The gyrB gene has also been used as a molecular In recent years, current detection methodologies on major food marker for C. sakazakii and C. dublinensis and the designed primer pairs borne pathogens like E. coli (Zhao et al., 2010), Salmonella (Zhao, showed acceptable results (Huang et al., 2013). Wang, et al., 2010b), Vibrio parahaemolyticus (Zhao et al., 2010c), Pseu- The aim of this study was to design a PCR method based on the domonas aeruginosa (Zhao et al., 2011), Staphylococcus aureus gyrB gene for the rapid detection of C. sakazakii in a variety of PIFs (Xu et al., 2012), Listeria monocytogenes (Wang, Li, Chu, Xu, & Zhong, and baby foods. Also, the quality of PIFs and baby foods regarding the 2012) have been developed. presence of C. sakazakii with culture and molecular methods were Of the diagnostic methods for the C. sakazakii is the gold evaluated. standard based on the FDA-microbial culture but since this method is very time-consuming and has low sensitivity and accu- racy, molecular methods are used based on the nucleotide 2 | MATERIALS AND METHODS sequence such as PCR (Chen et al., 2015). The enzyme-linked immunosorbent assay (ELISA) and PCR-based methods are effi- This descriptive cross-sectional study was performed on 100 PIF sam- cient, rapid, and sensitive; however, they often give false results ples from six different commercial brands (PIF1-6) and 100 baby food either due to primer nonspecificity or residual target DNA in food samples from eight different baby food types (BF1-8) (brands names samples. To overcome these problems, LAMP method and real- were coded for their privacy protection). Samples were purchased time PCR-based methods have been used for rapid identification from different pharmacies of the Mashhad city, Iran, based on differ- of this bacteria. Generally, real-time PCR assays are not recom- ent brands and different production dates from February 2017 to mended for routine analysis of contaminated food samples January 2018. Control positive strain (C. sakazakii PTCC 1550) was because they require TaqMan, SYBR Green, probe and a thermal purchased from Iranian Research Organization for Science and Tech- cycler with an expensive fluorescence detector. Also, LAMP has nology (IROST) and four species of Entrobacteriacea including Serratia high risk of potential contamination during work (Cai et al., 2013; marcescens )PTCC 1187(, Shigella dysenteriae (PTCC 1188), Escherichia Shukla,Lee,Song,Park,&Kim,2016). coli (PTCC 1399) and Salmonella enteritidis (PTCC 1709) were pre- Another method for bacterial identification is PEGE; but its major pared from Microbiology Department, Faculty of Medicine, Mashhad – disadvantage is its low stability, and the time taken (2 4 days).
Load more

Recommended publications
  • Is It Essential to Sequence the Entire 16S Rrna Gene for Bacterial
    » INSTRUMENTATION » Is it Essential to Sequence Introduction Bacterial Identification in the biopharmaceutical industry, especially in the Entire 16S rRNA Gene manufacturing facilities, is very important because an occurrence of a problematic microorganism in the final product could be harmful for the end user and detrimental to a company’s finances and reputation. for Bacterial Identification? Environmental Monitoring (EM) programs are the cornerstone of understanding the microbial ecology in a manufacturing facility and have become a regulatory requirement for most manufacturers. The EM program is a biological surveillance system which enables companies to quickly identify organisms which are transient or resident in their facilities before these organisms have an opportunity to contaminate a product. A properly executed EM program provides an early warning of potential contamination problems due to Sunhee Hong, PhD and equipment failure, inadequate cleaning, or deficiencies in staff hygiene Christine E. Farrance, PhD training, for example, so that problems can be corrected to prevent Charles River adulteration of the end product. The Food and Drug Administration (FDA) has published guidelines for the production of sterile drugs by aseptic processing which includes a section on EM programs, and the USP general information chapter “Microbiological Control and Monitoring of Aseptic Processing Environments” also contains detailed information regarding EM programs1. The EM program is only effective if the organisms recovered from the facility are accurately identified, so the information gathered can be used to understand the microbial control through tracking and trending and dictate appropriate remediation activities. There are several different options available for bacterial identification; however, the use of 16S rRNA gene sequences has been considered the most powerful and accurate tool, while conventional phenotypic methods often show major weaknesses2-5.
    [Show full text]
  • Prevalence, Distribution, and Phylogeny of Type Two Toxin-Antitoxin Genes Possessed by Cronobacter Species Where C. Sakazakii Homologs Follow Sequence Type Lineages
    microorganisms Article Prevalence, Distribution, and Phylogeny of Type Two Toxin-Antitoxin Genes Possessed by Cronobacter Species where C. sakazakii Homologs Follow Sequence Type Lineages Samantha Finkelstein, Flavia Negrete, Hyein Jang, Jayanthi Gangiredla, Mark Mammel, Isha R. Patel, Hannah R. Chase, JungHa Woo, YouYoung Lee, Caroline Z. Wang, Leah Weinstein, Ben D. Tall * and Gopal R. Gopinath Center of Food Safety and Applied Nutrition, U. S. Food and Drug Administration, 8301 MuirKirk Rd, Laurel, MD 20708, USA; sfi[email protected] (S.F.); [email protected] (F.N.); [email protected] (H.J.); [email protected] (J.G.); [email protected] (M.M.); [email protected] (I.R.P.); [email protected] (H.R.C.); [email protected] (J.W.); [email protected] (Y.L.); [email protected] (C.Z.W.); [email protected] (L.W.); [email protected] (G.R.G.) * Correspondence: [email protected] Received: 4 October 2019; Accepted: 9 November 2019; Published: 12 November 2019 Abstract: Cronobacter species are a group of foodborne pathogenic bacteria that cause both intestinal and systemic human disease in individuals of all age groups. Little is known about the mechanisms that Cronobacter employ to survive and persist in foods and other environments. Toxin–antitoxin (TA) genes are thought to play a role in bacterial stress physiology, as well as in the stabilization of horizontally-acquired re-combinatorial elements such as plasmids, phage, and transposons. TA systems have been implicated in the formation of a persistence phenotype in some bacterial species including Escherichia coli and Salmonella.
    [Show full text]
  • International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/Ijsem.0.001485
    International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/ijsem.0.001485 Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Mobolaji Adeolu,† Seema Alnajar,† Sohail Naushad and Radhey S. Gupta Correspondence Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Ontario, Radhey S. Gupta L8N 3Z5, Canada [email protected] Understanding of the phylogeny and interrelationships of the genera within the order ‘Enterobacteriales’ has proven difficult using the 16S rRNA gene and other single-gene or limited multi-gene approaches. In this work, we have completed comprehensive comparative genomic analyses of the members of the order ‘Enterobacteriales’ which includes phylogenetic reconstructions based on 1548 core proteins, 53 ribosomal proteins and four multilocus sequence analysis proteins, as well as examining the overall genome similarity amongst the members of this order. The results of these analyses all support the existence of seven distinct monophyletic groups of genera within the order ‘Enterobacteriales’. In parallel, our analyses of protein sequences from the ‘Enterobacteriales’ genomes have identified numerous molecular characteristics in the forms of conserved signature insertions/deletions, which are specifically shared by the members of the identified clades and independently support their monophyly and distinctness. Many of these groupings, either in part or in whole, have been recognized in previous evolutionary studies, but have not been consistently resolved as monophyletic entities in 16S rRNA gene trees. The work presented here represents the first comprehensive, genome- scale taxonomic analysis of the entirety of the order ‘Enterobacteriales’.
    [Show full text]
  • Phage S144, a New Polyvalent Phage Infecting Salmonella Spp. and Cronobacter Sakazakii
    International Journal of Molecular Sciences Article Phage S144, a New Polyvalent Phage Infecting Salmonella spp. and Cronobacter sakazakii Michela Gambino 1 , Anders Nørgaard Sørensen 1 , Stephen Ahern 1 , Georgios Smyrlis 1, Yilmaz Emre Gencay 1 , Hanne Hendrix 2, Horst Neve 3 , Jean-Paul Noben 4 , Rob Lavigne 2 and Lone Brøndsted 1,* 1 Department of Veterinary and Animal Sciences, University of Copenhagen, 1870 Frederiksberg C, Denmark; [email protected] (M.G.); [email protected] (A.N.S.); [email protected] (S.A.); [email protected] (G.S.); [email protected] (Y.E.G.) 2 Laboratory of Gene Technology, KU Leuven, 3001 Leuven, Belgium; [email protected] (H.H.); [email protected] (R.L.) 3 Department of Microbiology and Biotechnology, Max Rubner-Institut, Federal Research Institute of Nutrition and Food, 24103 Kiel, Germany; [email protected] 4 Biomedical Research Institute and Transnational University Limburg, Hasselt University, BE3590 Diepenbeek, Belgium; [email protected] * Correspondence: [email protected] Received: 25 June 2020; Accepted: 21 July 2020; Published: 22 July 2020 Abstract: Phages are generally considered species- or even strain-specific, yet polyvalent phages are able to infect bacteria from different genera. Here, we characterize the novel polyvalent phage S144, a member of the Loughboroughvirus genus. By screening 211 Enterobacteriaceae strains, we found that phage S144 forms plaques on specific serovars of Salmonella enterica subsp. enterica and on Cronobacter sakazakii. Analysis of phage resistant mutants suggests that the O-antigen of lipopolysaccharide is the phage receptor in both bacterial genera. The S144 genome consists of 53,628 bp and encodes 80 open reading frames (ORFs), but no tRNA genes.
    [Show full text]
  • Enterobacter Sakazakii)
    J. Microbiol. Biotechnol. (2011), 21(5), 509–514 doi: 10.4014/jmb.1007.07059 First published online 3 March 2011 The Phenotypic and Genotypic Characterization of Korean Isolates of Cronobacter spp. (Enterobacter sakazakii) Kim, Jung-Beom1, Suk-Ho Kang1, Yong-Bae Park1, Jae-Ho Choi2, Sung-Jin Park2,3, Seung-Hak Cho4, Mi-Sun Park4, Hae Kyung Lee5, Na-Jung Choi2, Ha-Na Kim2, and Deog-Hwan Oh2* 1Division of Health Research and Planning, Gyeonggi-do Research Institute of Health and Environment, Suwon 440-290, Korea 2School of Bioscience and Biotechnology, Kangwon National University, Chuncheon 200-701, Korea 3Center of Senior Industry, Youngdong University, Youngdong-gun, Chungbuk 370-701, Korea 4Division of Enteric Bacterial Infections, Center for Infectious Diseases, National Institute of Health, Seoul 122-701, Korea 5Department of Laboratory Medicine, Catholic University College of Medicine, Uijongbu 480-130, Korea Received: July 30, 2010 / Revised: February 8, 2011 / Accepted: February 11, 2011 This study was conducted to investigate the phenotypic and was initially known as yellow-pigmented Enterobacter genotypic characteristics of Korean isolates of Cronobacter cloacae and reclassified based on biochemical characteristics, spp. (Enterobacter sakazakii). A total of 43 Cronobacter DNA-DNA hybridization, and antibiotic susceptibility spp., including 5 clinical isolates, 34 food isolates, 2 patterns in 1980 [5, 18]. Cronobacter spp. infection, which environmental isolates, and 2 reference strains (C. sakazakii causes life-threatening meningitis, septicemia, and necrotizing ATCC 29004 and C. muytjensii ATCC51329) were used in enterocolitis in infants, has been implicated in foodborne this study. Korean isolates of Cronobacter spp. were outbreaks worldwide [17, 22]. The pathogen has been divided into 11 biogroups according to their biochemical isolated from a variety of food, clinical, and environmental profiles and 3 genomic groups based on the analysis of sources including cheese, vegetables, grains, soil, and powdered their 16S rRNA gene sequences.
    [Show full text]
  • Cronobacter: an Emerging Opportunistic Pathogen Associated with Neonatal Meningitis, Sepsis and Necrotizing Enterocolitis
    Journal of Perinatology (2013) 33, 581–585 & 2013 Nature America, Inc. All rights reserved 0743-8346/13 www.nature.com/jp STATE-OF-THE-ART Cronobacter: an emerging opportunistic pathogen associated with neonatal meningitis, sepsis and necrotizing enterocolitis CJ Hunter1,2 and JF Bean1 Members of the genus Cronobacter are an emerging group of opportunist Gram-negative pathogens. This genus was previously thought to be a single species, called Enterobacter sakazakii. Cronobacter spp. typically affect low-birth-weight neonates, causing life-threatening meningitis, sepsis and necrotizing enterocolitis. Outbreaks of disease have been associated with contaminated infant formula, although the primary environmental source remains elusive. Advanced understanding of these bacteria and better classification has been obtained by improved detection techniques and genomic analysis. Research has begun to characterize the virulence factors and pathogenic potential of Cronobacter. Investigations into sterilization techniques and protocols for minimizing the risk of contamination have been reviewed at national and international forums. In this review, we explore the clinical impact of Cronobacter neonatal and pediatric infections, discuss virulence and pathogenesis, and review prevention and treatment strategies. Journal of Perinatology (2013) 33, 581–585; doi:10.1038/jp.2013.26; published online 28 March 2013 Keywords: Cronobacter sakazakii; meningitis; necrotizing enterocolitis; neonatal infections; infant formula INTRODUCTION single clinical setting.10 Cronobacter neonatal infection rates Cronobacter is an emerging genus of opportunistic Gram-negative remain low and are reported in the USA as one Cronobacter pathogens associated with potentially fatal neonatal infections, infection per 100 000 infants, 8.7 per 100 000 low-birth-weight including meningitis, sepsis and necrotizing enterocolitis (NEC).1 neonates, and one Cronobacter infection per 10 660 very low- 13 These infections typically affect our smallest and most vulnerable birth-weight neonates.
    [Show full text]
  • Isolation of Cronobacter Spp.(Formerly Enterobacter Sakazakii) from Infant
    BMC Microbiology BioMed Central Research article Open Access Isolation of Cronobacter spp. (formerly Enterobacter sakazakii) from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing Ziad W Jaradat*†, Qotaiba O Ababneh†, Ismail M Saadoun, Nawal A Samara and Abrar M Rashdan Address: Department of Biotechnology and Genetic Engineering, Jordan University of Science and Technology, P. O. Box 3030, Irbid-22110, Jordan Email: Ziad W Jaradat* - [email protected]; Qotaiba O Ababneh - [email protected]; Ismail M Saadoun - [email protected]; Nawal A Samara - [email protected]; Abrar M Rashdan - [email protected] * Corresponding author †Equal contributors Published: 27 October 2009 Received: 10 March 2009 Accepted: 27 October 2009 BMC Microbiology 2009, 9:225 doi:10.1186/1471-2180-9-225 This article is available from: http://www.biomedcentral.com/1471-2180/9/225 © 2009 Jaradat et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Cronobacter spp. (formerly Enterobacter sakazakii), are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. Results: In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp.
    [Show full text]
  • High-Throughput 16S Rrna Gene Sequencing of Butter Microbiota Reveals a Variety of Opportunistic Pathogens
    foods Article High-Throughput 16S rRNA Gene Sequencing of Butter Microbiota Reveals a Variety of Opportunistic Pathogens Mikhail Y. Syromyatnikov 1,2,*, Anastasia V. Kokina 1,2, Sergey A. Solodskikh 1,2, Anna V. Panevina 1, Evgeny S. Popov 3 and Vasily N. Popov 1,2 1 Department of Genetics, Cytology and Bioengineering, Voronezh State University, 394018 Voronezh, Russia; [email protected] (A.V.K.); [email protected] (S.A.S.); [email protected] (A.V.P.); [email protected] (V.N.P.) 2 Laboratory of Metagenomics and Food Biotechnology, Voronezh State University of Engineering Technologies, 394036 Voronezh, Russia 3 Department of Service and Restaurant Business, Voronezh State University of Engineering Technologies, 394036 Voronezh, Russia; [email protected] * Correspondence: [email protected]; Tel.: +7-(473)-239-92-81 Received: 8 April 2020; Accepted: 8 May 2020; Published: 9 May 2020 Abstract: Microbial contamination of dairy products with a high fat content (e.g., butter) has been studied insufficiently. No studies using modern molecular methods to investigate microbial communities in butter have been conducted so far. In this work, we used high-throughput sequencing and Sanger sequencing of individual bacterial colonies to analyze microbial content of commercially available butter brands. A total of 21 samples of commercially available butter brands were analyzed. We identified a total of 94 amplicon sequence variants corresponding to different microbial taxa. The most abundant lactic acid bacteria in butter were Lactobacillus kefiri, Lactobacillus parakefiri, Lactococcus taiwanensis and Lactococcus raffinolactis. A large amount of Streptococcus spp. bacteria (87.9% of all identified bacteria) was found in one of the butter samples.
    [Show full text]
  • Isolation and Partial Characterization of Cronobacter Sakazakii by 16S
    International Journal of Scientific & Engineering Research, Volume 5, Issue 4, April-2014 671 ISSN 2229-5518 Isolation and partial characterization of Cronobacter sakazakii by 16S rRNA sequence analysis isolated from milk of dairy cows with Mastitis in Chikmagalur, Karnataka, INDIA Vineeth B, Priyanka B, Ramesh B S, Makari Hanumanthappa K*, Vinay Suvarna M N and Vivek Chandramohan Abstract Mastitis is a chronic inflammation of milk glands which is caused by the bacteriological variations in the milk and other changes in the glandular tissue. Mastitis occurs throughout the world wherever dairy farms are found. Cronobacter sakazakii is one of the causative organism and also it is known as Enterobacter sakazakii. Cronobacter sakazakii enters the cattle through the udder, where the cattle are reared in the unhygienic condition. The bacteria were isolated from Mastitis infected raw milk around the Chikmagalur District. Bacteria were isolated with the standard protocols and were maintained in Lowry broth (LB) media. All the isolates were subjected to RAPD analysis. Further DNA of the bacteria was isolated by CTAB method and subjected to 16s ribosomal sequence analysis using 16S rRNA FU8 universal primers (16s rRNA F-5’AGAGTTTGATCCTGGCTCAG 3’, 16s rRNA R- 5’ACG GCTACCTTGTTA3’) and phylogenetic analysis were used to molecular relatedness of the isolated animal pathogenic bacteria.16S rRNA sequences were submitted to GenBank, NCBI and accession number was allotted. The obtained 16S rRNA sequences were subjected in-silico analysis by genomics workbench software for Sequence information, atomic composition, nucleic acid distribution, nucleotide distribution, histogram and secondary structure prediction. The findings of this research greatly anticipated for the identification and characterization of the animal pathogen Cronobacter sakazakii was first time reported in Chikmagalur, Karnataka, India.
    [Show full text]
  • Cronobacter Sakazakii in Foods and Factors Affecting Its Survival, Growth, and Inactivation
    International Journal of Food Microbiology 136 (2009) 204–213 Contents lists available at ScienceDirect International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro Cronobacter sakazakii in foods and factors affecting its survival, growth, and inactivation Larry R. Beuchat a,⁎, Hoikyung Kim b, Joshua B. Gurtler c, Li-Chun Lin a, Jee-Hoon Ryu d, Glenner M. Richards e a Center for Food Safety and Department of Food Science and Technology, University of Georgia, 1109 Experiment Street, Griffin, Georgia 30223-1797, USA b Division of Human Environmental Science, College of Life Science, Wonkwang University, 344-2 Shinyong-dong, Iksan, Jeonbuk 570-749, Republic of Korea c United States Department of Agriculture, Agricultural Research Service, Eastern Regional Research Center, 600 East Mermaid Lane, Wyndmoor, Pennsylvania 19038-8598, USA d Graduate School of Life Sciences and Biotechnology, Korea University, Anam-dong, Sungbuk ku, Seoul 136-701, Republic of Korea e Department of Science and Technology, Evangel University, 1111 North Glenstone, Springfield, Missouri 65802, USA article info abstract Keywords: Cronobacter sakazakii has been isolated from a wide range of environmental sources and from several foods of Cronobacter sakazakii animal and plant origin. While infections caused by C. sakazakii have predominantly involved neonates and Enterobacter sakazakii infants, its presence on or in foods other than powdered infant formula raises concern about the safety risks Foodborne illness these foods pose to immunocompromised consumers. We have done a series of studies to better understand Infant formula the survival and growth characteristics of C. sakazakii in infant formula, infant cereal, fresh-cut produce, and juices made from fresh produce.
    [Show full text]
  • Enterobacter Sakazakii)
    International Journal of Research in Pharmacy and Biosciences Volume 6, Issue 4, 2019, PP 4-14 ISSN 2394-5885 (Print) and ISSN 2394-5893 (Online) Cronobacter Sakazakii (Enterobacter Sakazakii) Mohamed M. Amer1*, Hoda M. Mekky2 1Department of Poultry Diseases, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt 2Poultry Diseases Department, Veterinary Research Division, National Research Centre, Giza, Egypt *Corresponding Author: Mohamed M. Amer, Department of Poultry Diseases, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt, Email: [email protected] ABSTRACT Enterobacter sakazakii (E. sakazakii) is an opportunistic pathogen gram-negative, motile with peritrichous flagella, nonspore-forming, gram-negative, belonging to the family of Enterobacteriaceae. It considered being a food borne pathogen causing meningitis, septicemia and enterocolitis in neonates, cerebral infarcts with resulting in a premature infant. In poultry industry the organism was reported to contaminate fertilized eggs and may result in weak chicks, poor chick growth and low FCR, increased mortality of embryos, lower hatchability and increased early chick mortality. Pathogenicity of E. sakazakii to broiler chickens in the form of clinical signs, mortality, pathological lesions and decreased FCR was reported. Conclusion: As poultry remains a vehicle of important pathogens to human as well as the possible economic losses a strategy must be considered in the evaluation, prevention, and control of this infections. Keywords: E. sakazakii, food borne pathogen, Pathogenicity, chicks, clinical signs, pathological lesions. INTRODUCTION introduced as a new species (E. Sakazakii). Recently, a taxonomic reclassification of this Enterobacter spp. is the sixth most common pathogen to consist of 5 species within a new cause of nosocomial infection and antibiotic genus ''Cronobacter'' was proposed resistant strains are observed with increasing (Baumgartner et al., 2009).
    [Show full text]
  • Cronobacter Species
    Culture 31-1.qxd:Layout 1 15/3/10 13:24 Page 1 Volume 31 No 1 March 2010 ISSN 0 9 6 5 - 0 9 8 9 Cu lture Cronobacter species Steve Forsythe few exceptions, the former biotypes and genomogroups School of Science and Technology, Nottingham Trent University corresponded with the new species; as shown in Table 1 . The Nottingham, UK division between C. sakazakii and C. malonaticus has been problematic, as the organisms are so closely related that differentiation was not always feasible, even using 16S Introduction sequencing. The definition of the two species does include the The newly designated genus, Cronobacter, is composed of Gram- biotype profiles and recently has been re-examined using multilocus negative, facultative anaerobic rods which are members of the sequence typing (MLST) based on 7 housekeeping genes. Some Enterobacteriaceae family and closely related to Enterobacter and confusion between the species may have been caused by the Citrobacter . It is composed of C. sakazakii, C. malonaticus, previous use of biotyping, with the results that a few biotype index C. turicensis, C. muytjensii and C. dublinensis, plus an unnamed strains were assigned the wrong species. MLST has also revealed sixth genome species. The organism has come to prominence due a strong clonal nature in these species, as will be considered later. 2 to its association with severe neonatal infections; necrotizing enterocolitis, septicaemia and meningitis, which can be fatal. Since members of the Cronobacter genus were formerly known as However, these are rare in infants, and infections occur in all age the single species Enterobacter sakazakii, this name was used in groups, though fortunately with less severe clinical outcomes.
    [Show full text]