ADAM11 Antibody

Total Page：16

File Type：pdf, Size：1020Kb

Product Datasheet ADAM11 Antibody Catalog No: #37308 Orders: [email protected] Description Support: [email protected] Product Name ADAM11 Antibody Host Species Rabbit Clonality Polyclonal Purification Antigen affinity purification. Applications WB IHC Species Reactivity Hu Ms Specificity The antibody detects endogenous levels of total ADAM11 protein. Immunogen Type Peptide Immunogen Description Synthetic peptide corresponding to a region derived from internal residues of human ADAM metallopeptidase domain 11 Target Name ADAM11 Other Names MDC Accession No. Swiss-Prot#: O75078 NCBI Gene ID: 4185Gene Accssion: NP_002381 SDS-PAGE MW 83kd Concentration 1.5mg/ml Formulation Rabbit IgG in pH7.4 PBS, 0.05% NaN3, 40% Glycerol. Storage Store at -20°C Application Details Western blotting: 1:200-1:1000 Immunohistochemistry: 1:50-1:200 Images Gel: 10%SDS-PAGE Lysates (from left to right): Hela and SKOV3 cell Amount of lysate: 50ug per lane Primary antibody: 1/500 dilution Secondary antibody dilution: 1/8000 Exposure time: 10 minutes Address: 8400 Baltimore Ave., Suite 302, College Park, MD 20740, USA http://www.sabbiotech.com 1 Immunohistochemical analysis of paraffin-embedded Human lung cancer tissue using #37308 at dilution 1/40. Background This gene encodes a member of the ADAM (a disintegrin and metalloprotease) protein family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene represents a candidate tumor supressor gene for human breast cancer based on its location within a minimal region of chromosome 17q21 previously defined by tumor deletion mapping. Note: This product is for in vitro research use only and is not intended for use in humans or animals. Address: 8400 Baltimore Ave., Suite 302, College Park, MD 20740, USA http://www.sabbiotech.com 2.

Copy Link

Recommended publications

Peking University-Juntendo University Joint Symposium on Cancer Research and Treatment ADAM28 (A Disintegrin and Metalloproteinase 28) in Cancer Cell Proliferation and Progression
Whatʼs New from Juntendo University, Tokyo Juntendo Medical Journal 2017. 63(5), 322-325 Peking University - Juntendo University Joint Symposium on Cancer Research and Treatment ADAM28 (a Disintegrin and Metalloproteinase 28) in Cancer Cell Proliferation and Progression YASUNORI OKADA＊＊Department of Pathophysiology for Locomotive and Neoplastic Diseases, Juntendo University Graduate School of Medicine, Tokyo, Japan A disintegrinandmetalloproteinase 28 (ADAM28) is overexpressedpredominantlyby carcinoma cells in more than 70% of the non-small cell lung carcinomas, showing positive correlations with carcinoma cell proliferation and metastasis. ADAM28 cleaves insulin-like growth factor binding protein-3 (IGFBP-3) in the IGF-I/IGFBP-3 complex, leading to stimulation of cell proliferation by intact IGF-I released from the complex. ADAM28 also degrades von Willebrand factor (VWF), which induces apoptosis in human carcinoma cell lines with negligible ADAM28 expression, andthe VWF digestionby ADAM28-expressing carcinoma cells facilitates them to escape from VWF-induced apoptosis, resulting in promotion of metastasis. We have developed human antibodies against ADAM28 andshown that one of them significantly inhibits tumor growth andmetastasis using lung adenocarcinoma cells. Our data suggest that ADAM28 may be a new molecular target for therapy of the patients with ADAM28-expressing non-small cell lung carcinoma. Key words: a disintegrin and metalloproteinase 28 (ADAM28), cell proliferation, invasion, metastasis, human antibody inhibitor Introduction human cancers 2). However, development of the synthetic inhibitors of MMPs andtheir application Cancer cell proliferation andprogression are for treatment of the cancer patients failed 3). modulated by proteolytic cleavage of tissue micro- On the other hand, members of the ADAM (a environmental factors such as extracellular matrix disintegrin and metalloproteinase) gene family, (ECM), growth factors andcytokines, receptors another family belonging to the metzincin gene andcell adhesionmolecules.
[Show full text]
Gene Symbol Category ACAN ECM ADAM10 ECM Remodeling-Related ADAM11 ECM Remodeling-Related ADAM12 ECM Remodeling-Related ADAM15 E
Supplementary Material (ESI) for Integrative Biology This journal is (c) The Royal Society of Chemistry 2010 Gene symbol Category ACAN ECM ADAM10 ECM remodeling-related ADAM11 ECM remodeling-related ADAM12 ECM remodeling-related ADAM15 ECM remodeling-related ADAM17 ECM remodeling-related ADAM18 ECM remodeling-related ADAM19 ECM remodeling-related ADAM2 ECM remodeling-related ADAM20 ECM remodeling-related ADAM21 ECM remodeling-related ADAM22 ECM remodeling-related ADAM23 ECM remodeling-related ADAM28 ECM remodeling-related ADAM29 ECM remodeling-related ADAM3 ECM remodeling-related ADAM30 ECM remodeling-related ADAM5 ECM remodeling-related ADAM7 ECM remodeling-related ADAM8 ECM remodeling-related ADAM9 ECM remodeling-related ADAMTS1 ECM remodeling-related ADAMTS10 ECM remodeling-related ADAMTS12 ECM remodeling-related ADAMTS13 ECM remodeling-related ADAMTS14 ECM remodeling-related ADAMTS15 ECM remodeling-related ADAMTS16 ECM remodeling-related ADAMTS17 ECM remodeling-related ADAMTS18 ECM remodeling-related ADAMTS19 ECM remodeling-related ADAMTS2 ECM remodeling-related ADAMTS20 ECM remodeling-related ADAMTS3 ECM remodeling-related ADAMTS4 ECM remodeling-related ADAMTS5 ECM remodeling-related ADAMTS6 ECM remodeling-related ADAMTS7 ECM remodeling-related ADAMTS8 ECM remodeling-related ADAMTS9 ECM remodeling-related ADAMTSL1 ECM remodeling-related ADAMTSL2 ECM remodeling-related ADAMTSL3 ECM remodeling-related ADAMTSL4 ECM remodeling-related ADAMTSL5 ECM remodeling-related AGRIN ECM ALCAM Cell-cell adhesion ANGPT1 Soluble factors and receptors
[Show full text]
Conservation and Divergence of ADAM Family Proteins in the Xenopus Genome
Wei et al. BMC Evolutionary Biology 2010, 10:211 http://www.biomedcentral.com/1471-2148/10/211 RESEARCH ARTICLE Open Access ConservationResearch article and divergence of ADAM family proteins in the Xenopus genome Shuo Wei*1, Charles A Whittaker2, Guofeng Xu1, Lance C Bridges1,3, Anoop Shah1, Judith M White1 and Douglas W DeSimone1 Abstract Background: Members of the disintegrin metalloproteinase (ADAM) family play important roles in cellular and developmental processes through their functions as proteases and/or binding partners for other proteins. The amphibian Xenopus has long been used as a model for early vertebrate development, but genome-wide analyses for large gene families were not possible until the recent completion of the X. tropicalis genome sequence and the availability of large scale expression sequence tag (EST) databases. In this study we carried out a systematic analysis of the X. tropicalis genome and uncovered several interesting features of ADAM genes in this species. Results: Based on the X. tropicalis genome sequence and EST databases, we identified Xenopus orthologues of mammalian ADAMs and obtained full-length cDNA clones for these genes. The deduced protein sequences, synteny and exon-intron boundaries are conserved between most human and X. tropicalis orthologues. The alternative splicing patterns of certain Xenopus ADAM genes, such as adams 22 and 28, are similar to those of their mammalian orthologues. However, we were unable to identify an orthologue for ADAM7 or 8. The Xenopus orthologue of ADAM15, an active metalloproteinase in mammals, does not contain the conserved zinc-binding motif and is hence considered proteolytically inactive. We also found evidence for gain of ADAM genes in Xenopus as compared to other species.
[Show full text]
ADAM11 (NM 002390) Human Recombinant Protein Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP320941 ADAM11 (NM_002390) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human ADAM metallopeptidase domain 11 (ADAM11) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 83.2 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_002381 Locus ID: 4185 UniProt ID: O75078 RefSeq Size: 4402 Cytogenetics: 17q21.31 RefSeq ORF: 2307 Synonyms: MDC This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 ADAM11 (NM_002390) Human Recombinant Protein – TP320941 Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease) protein family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease.
[Show full text]
The Microrna Mir-3174 Suppresses the Expression of ADAM15 and Inhibits the Proliferation of Patient-Derived Bladder Cancer Cells
OncoTargets and Therapy Dovepress open access to scientific and medical research Open Access Full Text Article ORIGINAL RESEARCH The microRNA miR-3174 Suppresses the Expression of ADAM15 and Inhibits the Proliferation of Patient-Derived Bladder Cancer Cells This article was published in the following Dove Press journal: OncoTargets and Therapy Chunhu Yu1 Background: Bladder cancer is a major urinary system cancer, and its mechanism of action Ying Wang1 regarding its progression is unclear. The goal of this study was to examine the expression of ADAM Tiejun Liu1 panel in the clinical specimens of bladder cancer and to investigate the role of miR-3174/ADAM15 Kefu Sha1 (a disintegrin and metalloprotease 15) axis in the regulation of bladder cancer cell proliferation. Zhaoxia Song1 Methods: The expression of an ADAM gene panel (including ADAM8, 9, 10, 11, 12, 15, 17, 19, 22, 23, 28, and 33), including 30 pairs of bladder tumor and non-tumor specimens, was Mingjun Zhao1 examined by Ion AmpliSeq Targeted Sequencing. A microRNA (miRNA) that could potentially Xiaolin Wang 2 target the ADAM with the highest expression level in the tumor tissue was identified using the 1Department of Urinary Surgery, Beijing online tool miRDB. Next, the interaction between the miRNA and ADAM15 was identified by Rehabilitation Hospital of Capital Medical Western blot. Finally, the proliferation of bladder cancer cells was examined using MTT University, Beijing 100144, People’s Republic of China; 2The Third District of (3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide) experiments (cell prolif- Airforce Special Service Sanatorium, eration examining) and subcutaneous tumor models by using nude mice.
[Show full text]
Adam22 Is a Major Neuronal Receptor for Lgi4-Mediated Schwann Cell Signaling
The Journal of Neuroscience, March 10, 2010 • 30(10):3857–3864 • 3857 Cellular/Molecular Adam22 Is a Major Neuronal Receptor for Lgi4-Mediated Schwann Cell Signaling Ekim O¨zkaynak,1* Gina Abello,1* Martine Jaegle,1 Laura van Berge,1 Diana Hamer,1 Linde Kegel,1 Siska Driegen,1 Koji Sagane,2 John R. Bermingham Jr,3 and Dies Meijer1 1Department of Cell Biology and Genetics, Erasmus University Medical Center, 3015 GE Rotterdam, The Netherlands, 2Tsukuba Research Laboratories, Eisai Co. Ltd., Tokodai 5-1-3, Tsukuba, Ibaraki 300-2635, Japan, and 3McLaughlin Research Institute, Great Falls, Montana 59405 The segregation and myelination of axons in the developing PNS, results from a complex series of cellular and molecular interactions between Schwann cells and axons. Previously we identified the Lgi4 gene (leucine-rich glioma-inactivated4) as an important regulator of myelination in the PNS, and its dysfunction results in arthrogryposis as observed in claw paw mice. Lgi4 is a secreted protein and a member of a small family of proteins that are predominantly expressed in the nervous system. Their mechanism of action is unknown but may involve binding to members of the Adam (A disintegrin and metalloprotease) family of transmembrane proteins, in particular Adam22. We found that Lgi4 and Adam22 are both expressed in Schwann cells as well as in sensory neurons and that Lgi4 binds directly to Adam22 without a requirement for additional membrane associated factors. To determine whether Lgi4-Adam22 function involves a paracrine and/or an autocrine mechanism of action we performed heterotypic Schwann cell sensory neuron cultures and cell type- specific ablation of Lgi4 and Adam22 in mice.
[Show full text]
The Expression of ADAM12 (Meltrin Α) in Human Giant Cell Tumours of Bone B L Tian, J M Wen, M Zhang, D Xie,Rbxu,Cjluo
394 SHORT REPORT Mol Path: first published as 10.1136/mp.55.6.394 on 1 December 2002. Downloaded from The expression of ADAM12 (meltrin α) in human giant cell tumours of bone B L Tian, J M Wen, M Zhang, D Xie,RBXu,CJLuo ............................................................................................................................. J Clin Pathol: Mol Pathol 2002;55:394–397 lian spermatocytes. They are thought to mediate sperm–egg α Aims: To examine the expression of ADAM12 (meltrin ), binding and fusion by interacting with integrin α6β1onthe a member of the disintegrin and metalloprotease (ADAM) egg surface,2 16–18 although human fertilin α is thought to be family, in human giant cell tumours of the bone, skeletal non-functional.19 20 muscle tissue from human embryos, and human adult skel- In addition to sperm–egg binding and fusion in fertilisa- etal muscle tissue. tion, the process of cell fusion occurs in myotube formation, Methods: ADAM12 mRNA was detected by reverse tran- multinucleated giant cell formation, and placenta syncytiotro- scription polymerase chain reaction and in situ hybridisa- phoblast formation. All these processes of cell fusion appear to tion. be similar. Yagami-Hiromasa et al identiﬁed meltrin α Results: ADAM12 mRNA was detected in 14 of the 20 (ADAM12) when they searched for homologues of fertilin in a giant cell tumours of bone and in three of the six tumour mouse myogenic cell line in 1995.21 Gilpin et al identiﬁed cell cultures. The expression of ADAM12 in cells cultured human ADAM12 in 1998.22 The human ADAM12 gene is from the tumour was linked to the presence of located at 10q26.3 and has typical ADAM family structure multinucleated giant cells.
[Show full text]
A Genomic Analysis of Rat Proteases and Protease Inhibitors
A genomic analysis of rat proteases and protease inhibitors Xose S. Puente and Carlos López-Otín Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Instituto Universitario de Oncología, Universidad de Oviedo, 33006-Oviedo, Spain Send correspondence to: Carlos López-Otín Departamento de Bioquímica y Biología Molecular Facultad de Medicina, Universidad de Oviedo 33006 Oviedo-SPAIN Tel. 34-985-104201; Fax: 34-985-103564 E-mail: [email protected] Proteases perform fundamental roles in multiple biological processes and are associated with a growing number of pathological conditions that involve abnormal or deficient functions of these enzymes. The availability of the rat genome sequence has opened the possibility to perform a global analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into five catalytic classes: 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. Overall, this distribution is similar to that of the mouse degradome, but significatively more complex than that corresponding to the human degradome composed of 561 proteases and homologs. This increased complexity of the rat protease complement mainly derives from the expansion of several gene families including placental cathepsins, testases, kallikreins and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in the rat and mouse genomes and may contribute to explain some functional differences between these two closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with the mouse protease inhibitor complement and the marked expansion of families of cysteine and serine protease inhibitors in rat and mouse with respect to human.
[Show full text]
Insights Into the Mechanisms of Epilepsy from Structural Biology of LGI1–ADAM22
Cellular and Molecular Life Sciences (2020) 77:267–274 https://doi.org/10.1007/s00018-019-03269-0 Cellular andMolecular Life Sciences REVIEW Insights into the mechanisms of epilepsy from structural biology of LGI1–ADAM22 Atsushi Yamagata1,2,3,4 · Shuya Fukai1,2,3 Received: 20 May 2019 / Revised: 5 August 2019 / Accepted: 9 August 2019 / Published online: 20 August 2019 © Springer Nature Switzerland AG 2019 Abstract Epilepsy is one of the most common brain disorders, which can be caused by abnormal synaptic transmissions. Many epilepsy-related mutations have been identifed in synaptic ion channels, which are main targets for current antiepileptic drugs. One of the novel potential targets for therapy of epilepsy is a class of non-ion channel-type epilepsy-related proteins. The leucine-rich repeat glioma-inactivated protein 1 (LGI1) is a neuronal secreted protein, and has been extensively studied as a product of a causative gene for autosomal dominant lateral temporal lobe epilepsy (ADLTE; also known as autosomal dominant partial epilepsy with auditory features [ADPEAF]). At least 43 mutations of LGI1 have been found in ADLTE families. Additionally, autoantibodies against LGI1 in limbic encephalitis are associated with amnesia, seizures, and cog- nitive dysfunction. Although the relationship of LGI1 with synaptic transmission and synaptic disorders has been studied genetically, biochemically, and clinically, the structural mechanism of LGI1 remained largely unknown until recently. In this review, we introduce insights into pathogenic mechanisms of LGI1 from recent structural studies on LGI1 and its receptor, ADAM22. We also discuss the mechanism for pathogenesis of autoantibodies against LGI1, and the potential of chemical correctors as novel drugs for epilepsy, with structural aspects of LGI1–ADAM22.
[Show full text]
Metalloproteinases and Their Associated Genes Contribute to the Functional Integrity and Noise-Induced Damage in the Cochlear Sensory Epithelium
The Journal of Neuroscience, October 24, 2012 • 32(43):14927–14941 • 14927 Neurobiology of Disease Metalloproteinases and Their Associated Genes Contribute to the Functional Integrity and Noise-Induced Damage in the Cochlear Sensory Epithelium Bo Hua Hu,1 Qunfeng Cai,1 Zihua Hu,2 Minal Patel,1 Jonathan Bard,3 Jennifer Jamison,3 and Donald Coling1 1Center for Hearing and Deafness, 2Center for Computational Research, New York State Center of Excellence in Bioinformatics and Life Sciences, Departments of Ophthalmology, Biostatistics, and Medicine, State University of New York Eye Institute, and 3Next-Generation Sequencing and Expression Analysis Core, Center of Excellence in Bioinformatics and Life Sciences, State University of New York at Buffalo, Buffalo, New York 14214 Matrix metalloproteinases (MMPs) and their related gene products regulate essential cellular functions. An imbalance in MMPs has been implicated in various neurological disorders, including traumatic injuries. Here, we report a role for MMPs and their related gene products in the modulation of cochlear responses to acoustic trauma in rats. The normal cochlea was shown to be enriched in MMP enzymatic activity, and this activity was reduced in a time-dependent manner after traumatic noise injury. The analysis of gene expres- sion by RNA sequencing and qRT-PCR revealed the differential expression of MMPs and their related genes between functionally specialized regions of the sensory epithelium. The expression of these genes was dynamically regulated between the acute and chronic phases of noise-induced hearing loss. Moreover, noise-induced expression changes in two endogenous MMP inhibitors, Timp1 and Timp2, in sensory cells were dependent on the stage of nuclear condensation, suggesting a specific role for MMP activity in sensory cell apoptosis.
[Show full text]
The Adams Family of Metalloproteases: Multidomain Proteins with Multiple Functions
Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW The ADAMs family of metalloproteases: multidomain proteins with multiple functions Darren F. Seals and Sara A. Courtneidge1 Van Andel Research Institute, Grand Rapids, Michigan 49503, USA The ADAMs family of transmembrane proteins belongs diseases such as arthritis and cancer (Chang and Werb to the zinc protease superfamily. Members of the family 2001). Adamalysins are similar to the matrixins in their have a modular design, characterized by the presence of metalloprotease domains, but contain a unique integrin metalloprotease and integrin receptor-binding activities, receptor-binding disintegrin domain (Fig. 1). It is the and a cytoplasmic domain that in many family members presence of these two domains that give the ADAMs specifies binding sites for various signal transducing pro- their name (a disintegrin and metalloprotease). The do- teins. The ADAMs family has been implicated in the main structure of the ADAMs consists of a prodomain, a control of membrane fusion, cytokine and growth factor metalloprotease domain, a disintegrin domain, a cyste- shedding, and cell migration, as well as processes such as ine-rich domain, an EGF-like domain, a transmembrane muscle development, fertilization, and cell fate determi- domain, and a cytoplasmic tail. The adamalysins sub- nation. Pathologies such as inflammation and cancer family also contains the class III snake venom metallo- also involve ADAMs family members. Excellent reviews proteases and the ADAM-TS family, which although covering various facets of the ADAMs literature-base similar to the ADAMs, can be distinguished structurally have been published over the years and we recommend (Fig.
[Show full text]
ADAM11 (NM 002390) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG220941 ADAM11 (NM_002390) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ADAM11 (NM_002390) Human Tagged ORF Clone Tag: TurboGFP Symbol: ADAM11 Synonyms: MDC Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 ADAM11 (NM_002390) Human Tagged ORF Clone – RG220941 ORF Nucleotide >RG220941 representing NM_002390 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGCTGCTGCGGCGCTGGGCGTTCGCGGCTCTGCTGCTGTCGCTGCTCCCCACGCCCGGTCTTGGGA CCCAAGGTCCTGCTGGAGCTCTGCGATGGGGGGGCTTACCCCAGCTGGGAGGCCCAGGAGCCCCTGAGGT CACGGAACCCAGCCGTCTGGTTAGGGAGAGCTCCGGGGGAGAGGTCCGAAAGCAGCAGCTGGACACAAGG GTCCGCCAGGAGCCACCAGGGGGCCCGCCTGTCCATCTGGCCCAGGTGAGTTTCGTCATCCCAGCCTTCA ACTCAAACTTCACCCTGGACCTGGAGCTGAACCACCACCTCCTCTCCTCGCAATACGTGGAGCGCCACTT CAGCCGGGAGGGGACAACCCAGCACAGCACCGGGGCTGGAGACCACTGCTACTACCAGGGGAAGCTCCGG GGGAACCCGCACTCCTTCGCCGCCCTCTCCACCTGCCAGGGGCTGCATGGGGTCTTCTCTGATGGGAACT TGACTTACATCGTGGAGCCCCAAGAGGTGGCTGGACCTTGGGGAGCCCCTCAGGGACCCCTTCCCCACCT CATTTACCGGACCCCTCTCCTCCCAGATCCCCTCGGATGCAGGGAACCAGGCTGCCTGTTTGCTGTGCCT
[Show full text]