The PH/Myth4/Fermmolecule MAX-1 Inhibits UNC-5 Activity in Regulation of VD Growth Cone Protrusion in Caenorhabditis Elegans

Home , Growth cone

bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 The PH/MyTH4/FERM molecule MAX-1 inhibits UNC-5 activity in regulation of VD 2 growth cone protrusion in Caenorhabditis elegans 3 4 Snehal S. Mahadik and Erik A. Lundquist1 5 6 Program in Molecular, Cellular, and Developmental Biology 7 Department of Molecular Biosciences 8 The University of Kansas 9 1200 Sunnyside Avenue 10 5049 Haworth Hall 11 Lawrence, KS 66045 12 13 1Corresponding author ([email protected]) bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

14 Abstract 15 UNC-6/Netrin is a secreted conserved guidance cue that regulates dorsal-ventral axon 16 guidance of C. elegans and in the vertebral spinal cord. In the polarity/protrusion model 17 of VD growth cone guidance away from ventrally-expressed UNC-6 (repulsion), UNC-6 18 first polarizes the growth cone via the UNC-5 receptor such that filopodial protrusions 19 are biased dorsally. UNC-6 then regulates a balance of protrusion in the growth cone 20 based upon this polarity. UNC-5 inhibits protrusion ventrally, and the UNC-6 receptor 21 UNC-40/DCC stimulates protrusion dorsally, resulting in net dorsal growth cone 22 outgrowth. UNC-5 inhibits protrusion through the flavin monooxygenases FMO-1, 4, and 23 5 and possible actin destabilization, and inhibits pro-protrusive microtubule entry into 24 the growth cone utilizing UNC-33/CRMP. The PH/MyTH4/FERM myosin-like protein 25 was previously shown to act with UNC-5 in VD axon guidance utilizing axon guidance 26 endpoint analysis. Here, we analyzed the effects of MAX-1 on VD growth cone 27 morphology during outgrowth. We found that max-1 mutant growth cones were smaller 28 and less protrusive than wild-type, the opposite of the unc-5 mutant phenotype. 29 Furthermore, genetic interactions suggest that MAX-1 might normally inhibit UNC-5 30 activity, such that in a max-1 mutant growth cone, UNC-5 is overactive. Our results, 31 combined with previous studies suggesting that MAX-1 might regulate UNC-5 levels in 32 the cell or plasma membrane localization, suggest that MAX-1 attenuates UNC-5 33 signaling by regulating UNC-5 stability or trafficking. In summary, in the context of 34 growth cone protrusion, MAX-1 inhibits UNC-5, demonstrating the mechanistic insight 35 that can be gained by analyzing growth cones during outgrowth in addition to axon 36 guidance endpoint analysis. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

37 Introduction 38 Many guidance cues and receptors that control directed cell and growth cone 39 migrations have been identified, but the cellular mechanisms by which they influence 40 migration in vivo remain to be fully elucidated. UNC-6/Netrin is a conserved secreted 41 guidance cue that regulates dorsal-ventral axon guidance in metazoans, including C.

42 elegans and the vertebral spinal cord (HEDGECOCK et al. 1990; ISHII et al. 1992; LEUNG-

43 HAGESTEIJN et al. 1992; CHAN et al. 1996; LEONARDO et al. 1997; HONG et al. 1999;

44 MONTELL 1999; SHEKARABI AND KENNEDY 2002; MOORE et al. 2007). In C. elegans, UNC- 45 6/Netrin is required for both dorsal and ventral axon outgrowth. UNC-6/Netrin is

46 expressed in ventral cord motor neurons (WADSWORTH et al. 1996). Dorsally-directed 47 axons are repelled from UNC-6/Netrin, and ventrally directed axons attracted to it. 48 Classically, Netrin was thought to establish a ventral-to-dorsal gradient, which was 49 followed by growth cones growing up the gradient (attraction) or down the gradient

50 (repulsion) (SERAFINI et al. 1996; FAZELI et al. 1997; KENNEDY et al. 2006). Recent 51 studies in vertebrate spinal cord and our studies in C. elegans suggest a distinct

52 mechanism (DOMINICI et al. 2017; VARADARAJAN et al. 2017; YAMAUCHI et al. 2017;

53 MORALES 2018). In the spinal cord, floorplate Netrin1 was found to be dispensable for 54 ventral commissural axon guidance. Rather, ventricular zone Netrin1 expression was 55 required, suggesting a close-range, haptotactic mechanism. In C. elegans, we found

56 that UNC-6/Netrin controls growth cone polarity and growth cone protrusion (NORRIS

57 AND LUNDQUIST 2011; NORRIS et al. 2014; GUJAR et al. 2018; GUJAR et al. 2019). In the 58 VD motor neuron growth cones that grow dorsally away from the ventral nerve cord, 59 UNC-6/Netrin and its receptor UNC-5 polarize the growth cone in the dorsal-ventral 60 axis, such that growth cone filopodial protrusions are dorsally-biased. Based on this 61 polarity, UNC-5 then inhibits growth cone protrusion ventrally in response to UNC- 62 6/Netrin. The UNC-6/Netrin receptor UNC-40/DCC stimulates protrusion dorsally. This 63 polarity/protrusion model involves asymmetry of receptor function across the growth 64 cone in response to UNC-6/Netrin, rather than a gradient. Similar regulation of 65 polarization and protrusion was observed in growth cones attracted to UNC-6/Netrin

66 (the Statistically-Oriented Asymmetric Localization (SOAL) model) (LIMERICK et al. 67 2017). bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

68 UNC-6 mediates a balance of pro- and anti-protrusive forces in the VD growth

69 cone required for proper outgrowth (NORRIS AND LUNDQUIST 2011; GUJAR et al. 2018). In 70 unc-5 mutants, VD growth cones are overly-protrusive, with larger growth cone area

71 and longer growth cone filopodia (NORRIS et al. 2014), indicating that UNC-5 inhibits 72 protrusion. Indeed, constitutively-active MYR::UNC-5 results in small growth cones with

73 reduced filopodial protrusion (NORRIS AND LUNDQUIST 2011). UNC-40 is required for the

74 excess protrusion in unc-5 mutants (NORRIS AND LUNDQUIST 2011), suggesting that pro- 75 protrusive UNC-40 activity predominates in an unc-5 mutant. Our previous work shows 76 that UNC-5 inhibits protrusion through at least two distinct mechanisms. The flavin 77 monooxygenases FMO-1, FMO-4, and FMO-5 act downstream of UNC-5 to inhibit

78 protrusion (GUJAR et al. 2017), possibly by destabilizing the actin cytoskeleton similar to

79 MICAL (TERMAN et al. 2002). UNC-33/CRMP acts downstream of UNC-5 to inhibit

80 protrusion and might act by restricting microtubule entry into the growth cone (NORRIS et

81 al. 2014), which are pro-protrusive (GUJAR et al. 2018). 82 Previous studies showed that the PH/MyTH4/FERM myosin-like molecule MAX-1 83 (motor axon guidance-1) acts in the UNC-5 pathway in parallel to UNC-40 in VD/DD

84 commissural axon guidance (HUANG et al. 2002). Furthermore, MAX-1 interacts with the 85 cytoplasmic region of UNC-5 until it is SUMOylated, at which point it is displaced by the 86 ABP-3/AP-3 complex  molecule, which targets UNC-5 to the lysosome for degradation

87 (CHEN et al. 2018). Thus, MAX-1 might control UNC-5 levels in the cell. In support of 88 this idea, a study in zebrafish suggested that max-1 plays a role in regulating membrane 89 localization of Ephrin3b protein, which provides guidance cue for the migration of

90 endothelial cells during embryogenesis (ZHONG et al. 2006). In this model, MAX-1 is 91 constitutively bound to UNC-5 until it is SUMOylated, which allows ABP-3 to bind to

92 UNC-5 and target it for lysosomal degradation (CHEN et al. 2018). These previous C. 93 elegans studies relied on endpoint axon guidance analysis and did not assess the effect 94 of MAX-1 on growth cones during outgrowth. 95 In this study, we analyzed VD growth cones during outgrowth in max-1 mutants 96 and in double mutants with unc-5, unc-6, and unc-40 to understand the role of MAX-1 97 with regard to UNC-5 activity in the growth cone. We found that VD growth cones in 98 max-1 mutants were small and less-protrusive than wild-type, similar to constitutively- bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

99 active myr::unc-5. max-1 mutants did not show strong growth cone polarity defects, 100 suggesting it might specifically affect protrusion. unc-5 loss-of-function display the 101 opposite phenotype, with larger and more protrusive growth cones, suggesting that 102 UNC-5 and MAX-1 have opposing roles in growth cone protrusion. Double mutants of 103 max-1 with unc-5 hypomorphic mutants, which retain unc-5 function, displayed growth 104 cones that resembled the small, less-protrusive growth cones of max-1 alone. This 105 suppression of unc-5 hypomorphic mutants could be due to the fact that remaining 106 UNC-5 activity in these mutants is no longer attenuated by MAX-1, and thus inhibits 107 growth cone protrusion. This is consistent with a role of MAX-1 in controlling UNC-5 108 levels in the cell. Growth cone protrusion in unc-40; max-1 and unc-6; max-1 double 109 mutants did not suggest strong genetic interactions and are consistent with MAX-1 110 acting in the UNC-6 pathway. However, endpoint axon guidance analysis confirmed 111 that MAX-1 acts in parallel to UNC-40. 112 In sum, our results suggest that MAX-1 normally inhibits UNC-5 activity in the 113 growth cone, possibly by regulating UNC-5 levels in the cell or at the plasma 114 membrane. This is in contrast to these earlier studies which suggested that MAX-1 115 might stimulate or mediate UNC-5 activity. Clearly, there is more to learn about the 116 complex activity of MAX-1 and UNC-5 in the growth cone. In any case, analysis of 117 growth cone morphology during outgrowth can add mechanistic detail to the complex 118 roles of axon guidance molecules and a deeper understanding of how growth cone 119 outgrowth results in proper axon guidance and circuit formation. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

120 Material and Methods 121 Genetic Methods 122 Experiments were performed at 200C using standard C. elegans techniques

123 (BRENNER 1974). Mutations were used LGI: unc-40(n324); LGII: juIs76 [Punc-25::gfp]; 124 LGIV: unc-5(e791, ev480 and, e152); LGV: max-1(ju39, ju142 and lq148); LGX: unc- 125 6(ev400 and e78). The presence of mutations was confirmed by phenotype and 126 sequencing. Chromosomal locations not determined. myr::unc-5 [Punc-25::myr::unc- 127 5::gfp]. max-1(lq148) was identified by whole genome sequencing after EMS 128 mutagenesis. lq148 is a C to T transition that creates a glutamine to stop codon at 129 codon 857 (position 13,099,591 on LGV). lq148 failed to complement max-1(ju39) for 130 the Unc phenotype and VD/DD axon guidance defects (data not shown). 131 132 Imaging of Axon guidance defects

133 VD/DD neuron were visualized with Punc-25::gfp transgene, juIs76 (JIN et al. 134 1999), which is expressed in 19 GABAergic commissural motor neurons including DD1- 135 6 and VD1-13. The commissure on the left side (VD1) was not scored. The remaining 136 18 commissures extend processes on the right side of the animal. Due to the 137 fasciculation of some commissural processes, an average 16 VD/DD commissural 138 processes were apparent in wild-type. Total axon guidance defects were calculated by 139 counting the number of commissural processes that failed to reach the dorsal nerve 140 cord, wandered laterally at an angle of 450 before reaching the dorsal nerve cord, and

141 ectopic branching (GUJAR et al. 2017). Significance of difference between genotypes 142 was determined using Fisher’s exact test. 143 144 Growth cone imaging and quantification

145 VD growth cones were imaged as previously described (NORRIS AND LUNDQUIST

146 2011; NORRIS et al. 2014; GUJAR et al. 2017; GUJAR et al. 2018; GUJAR et al. 2019). 147 Briefly, wild-type animals were harvested 16-hour post-hatching at 200C and placed on 148 2% agarose pads with 5mM sodium azide in M9 buffer. For mutant animals, due to the 149 slower development the time point ranges between 17-21hour post hatching. Growth 150 cone were imaged with Qimagine Rolera mGi camera on a Leica DM5500 microscope. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

151 Projections less than 0.5m in width were scored as filopodia. Growth cone area and 152 filopodial length were quantified using ImageJ software. Quantification was done as

153 described previously (NORRIS AND LUNDQUIST 2011; NORRIS et al. 2014; GUJAR et al.

154 2017; GUJAR et al. 2018; GUJAR et al. 2019). Significance of difference between two 155 genotypes was determined by two sided t- tests with unequal variance. 156 Polarity of growth cone filopodial protrusion was determined as previously

157 described (NORRIS AND LUNDQUIST 2011; NORRIS et al. 2014; GUJAR et al. 2017; GUJAR

158 et al. 2018; GUJAR et al. 2019). Briefly, growth cones were imaged as above, and 159 divided into dorsal and ventral halves relative to the ventral nerve cord. Filopodial 160 protrusions from the dorsal and ventral halves were counted and expressed as a 161 percentage of dorsal protrusions (# dorsal protrusions/# all protrusions). Significance of 162 difference between genotypes was determined using Fisher’s exact test. 163 164 Strains and plasmids are available upon request. The authors affirm that all data 165 necessary for confirming the conclusions of the article are present within the article, 166 figures, and tables. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

167 Results 168 MAX-1 is required for robust VD growth cone protrusion 169 MAX-1 is a member of the PH/MyTH4/FERM myosin-like family and contains an 170 N-terminal coiled-coil region, followed by two pleckstrin homology domains (PH), a 171 myosin tail homology region, and a FERM domain (Figure 1A). max-1 alleles were first 172 identified in a screen for abnormal synapse formation and axon guidance defects in the

173 GABAergic VD/DD motor neurons (HUANG et al. 2002). max-1(ju39) is a 28-nucleotide 174 deletion within the second exon which cause a frameshift after amino acid 58, max- 175 1(ju142) is an 81-nucleotide deletion at the exon/intron boundary of the fourth exon

176 (HUANG et al. 2002), and max-1(lq148) is a C to T transition in the penultimate max-1 177 exon resulting in a premature stop codon at glutamine 857 (Figure 1A and B). All three 178 alleles are predicted to be strong loss-of-function or null alleles. 179 MAX-1 was previously shown to act with the UNC-6/Netrin receptor UNC-5 in 180 dorsal VD/DD motor neuron axon guidance, and in parallel to the UNC-40/DCC Unc-

181 6/Netrin receptor (HUANG et al. 2002). These studies involved endpoint axon guidance 182 analysis, but did not assay the growth cone during outgrowth. At the growth cone level, 183 UNC-5 controls polarity of GABAergic growth cone protrusion as well as extent of

184 protrusion (the polarity/protrusion model) (NORRIS AND LUNDQUIST 2011; NORRIS et al.

185 2014; GUJAR et al. 2018). Given the genetic interaction of max-1 with unc-5, we 186 endeavored to understand the role of MAX-1 in GABAergic growth cone polarity and 187 protrusion. 188 We first confirmed the GABAergic dorsal axon guidance defects in max-1 189 mutants. The 19 VD/DD motor neurons cell bodies resides in the ventral nerve cord 190 (Figure 1C). Axons of the VD and DD neurons first extend anteriorly in the ventral nerve 191 cord, and then turn dorsally to extend commissural to the dorsal nerve cord (Figure 1C 192 and Figure 2A). In wild-type animals, on average 16 commissures were observed, due 193 to the fasciculation of some processes as single commissures (Figure 1D). As

194 previously reported (HUANG et al. 2002), max-1 mutants display VD/DD axon guidance 195 defects (21-25%), including axon wandering, failure to reach the dorsal nerve cord, and 196 ectopic axon branching (Figure 2B-D and Figure 3). bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

197 We next analyzed VD growth cone morphology in max-1 mutants. In the early L2 198 larval stage, VD axons extend anteriorly in the ventral nerve cord, and then turn dorsally 199 to extend a commissure to the dorsal nerve cord (Figure 1C). During this commissural 200 extension, between the lateral midline and the ventral and dorsal nerve cords, wild-type 201 VD growth cones display a robust growth cone body and filopodial protrusions (Figure 202 1C and Figure 4A, B, and D), with an average growth cone area of 4.6m2, and an 203 average filopodial length of 0.95m (Figure 4A and B). Furthermore, filopodial 204 protrusions were biased to the dorsal half of the growth cone (Figure 4C and D). In max- 205 1 mutants, VD growth cones were significantly smaller than wild-type, and filopodial 206 protrusions were significantly shorter (2-3m2 and 0.7-0.75m, respectively; Figure 4A, 207 B, and F-H). Filopodial protrusions were still biased to the dorsal, but less so than wild- 208 type in all three alleles, and significantly less so in ju142 (Figure 4C). In sum, these data 209 indicate that MAX-1 is required for robust growth cone protrusion, with a lesser effect on

210 growth cone polarity. As previously reported (NORRIS et al. 2014), similar small growth 211 cone phenotype was observed by expression of constitutively-active, ligand- 212 independent myr::unc-5 in the VD neurons (Figure 4A-C, and E), consistent with a role 213 of UNC-5 in inhibiting growth cone protrusion. 214 215 max-1 suppresses excessive growth cone protrusion in hypomorphic unc-5 216 mutants 217 Our results suggest that the effect of loss of MAX-1 on VD growth cones 218 resembles constitutive UNC-5 activity (small growth cones with reduced protrusion). 219 unc-5(e152) and unc-5(ev480) are hypomorphic, incomplete loss-of-function mutations

220 with weaker Unc phenotypes than null alleles (MERZ et al. 2001; KILLEEN et al. 2002). 221 VD/DD axon guidance defects in unc-5(e152) and unc-52(ev480) were significantly 222 weaker than those in the null allele unc-5(e791) (Figure 3). The hypomorphic nature of 223 unc-5(e152) and unc-5(ev480) suggests that some UNC-5 function is retained in these 224 mutants. VD growth cones in unc-5(e152) and unc-5(ev480) were more protrusive than 225 wild-type (Figure 5A, B, and D), with increased growth cone area and filopodia length, 226 consistent with the previously-described role of UNC-5 in inhibiting VD growth cone

227 protrusion (NORRIS AND LUNDQUIST 2011; NORRIS et al. 2014; GUJAR et al. 2018). unc-5 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

228 hypomorph growth cones were also unpolarized (Figure 5C), with loss of dorsal bias of 229 growth cone protrusion as previously reported for unc-5 mutants. 230 VD growth cones of max-1(lq148); unc-5(e152) and max-1(lq148); unc-5(ev480) 231 double mutants displayed reduced protrusion relative to unc-5(e152) and unc-5(ev480) 232 alone (Figure 5A, B, and E) and in fact resembled the small growth cones of max-1 233 alone. Growth cones of max-1; unc-5(null) double mutants could not be scored because 234 no VD growth cones emerged from the ventral nerve cord in these animals (data not 235 shown). These results indicate that loss of max-1 suppressed the excessive VD growth 236 cone protrusion observed in hypomorphic unc-5 mutants. max-1 did not suppress unc-5 237 growth cone polarization defects, as max-1; unc-5 growth cones displayed loss of dorsal 238 bias of protrusion as seen in unc-5 alone (Figure 5C). These data are consistent with 239 the idea that MAX-1 is required for growth cone protrusion but not growth cone polarity, 240 suggested by the max-1 loss-of-function phenotype. 241 The UNC-6/Netrin receptor UNC-40/DCC has a dual role in controlling growth 242 cone protrusion. It acts as a heterodimer with UNC-5 to inhibit protrusion, and as a

243 homodimer to stimulate protrusion (NORRIS AND LUNDQUIST 2011; NORRIS et al. 2014;

244 GUJAR et al. 2018). unc-40(n324) null mutants displayed similar growth cone area 245 compared to wild-type, but shortened growth cone filopodial protrusions (Figure 6A-C). 246 This moderate phenotype likely reflects the dual role of UNC-40 in protrusion. max- 247 1(lq148); unc-40(n324) double mutant growth cones resembled max-1(lq148) alone, 248 with reduced filopodial length similar to unc-40 and max-1, and reduced growth cone 249 area (Figure 6A-C). unc-40(n324) growth cones displayed robust dorsal bias of 250 filopodial protrusion similar to wild-type which was not affected by max-1 (Figure 5C) 251 VD growth cones of max-1; unc-6(ev400) null double mutants could not be 252 scored because none emerged from the ventral nerve cord. The hypomorphic allele 253 unc-6(e78) is a substitution of cysteine to tyrosine in V-3 domain, which disrupts the

254 interaction between UNC-6 and UNC-5 (LIM AND WADSWORTH 2002; NORRIS AND

255 LUNDQUIST 2011). Dorsal growth is more strongly affected than ventral growth in unc- 256 6(e78). Previous results showed that unc-6(e78) mutants displayed unpolarized VD

257 growth cones with excessive protrusion (NORRIS AND LUNDQUIST 2011). When scored for 258 this work, unc-6(e78) VD growth cones did not show excessive protrusion (Figure 7A, B, bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

259 and C), but were still unpolarized as found previously (Figure 5C). max-1(lq148); unc- 260 6(e78) VD growth cone protrusion resembled max-1(lq148) alone, with reduced growth 261 cone area and filopodia length compared to wild-type and unc-6(e78) (Figure 7A, B, and 262 D). max-1 did not affect loss of growth cone polarity of unc-6(e78) (Figure 5C). 263 264 max-1 enhances VD/DD axon guidance defects of unc-5, unc-6, unc-40 265 Previous studies demonstrated strong genetic interactions between max-1 and

266 unc-5, unc-6, and unc-40 in endpoint axon guidance analyses (HUANG et al. 2002). max- 267 1 mutations enhanced hypomorphic unc-5 alleles, and synergized with unc-40(null) for 268 VD/DD axon guidance defects. unc-5 and unc-6, but not unc-40, were dominant 269 enhancers of max-1. Overexpression of unc-5 and unc-6 but not unc-40 could suppress 270 max-1. Finally, overexpression of max-1 caused axon guidance defects that could be 271 suppressed by overexpression of unc-5 and unc-6 but not unc-40. Together, these data 272 suggest that MAX-1 acts in the UNC-6 and UNC-5 pathway, possibly in parallel to UNC- 273 40. 274 We repeated VD/DD axon guidance endpoint analysis using the alleles in which 275 VD growth cones were analyzed here. max-1 double mutants with unc-5 and unc-6 null 276 alleles showed a complete failure of VD/DD axon guidance (Figure 2 and 3), consistent

277 with previous results (HUANG et al. 2002) and with our observation of no VD growth 278 cones exiting the ventral nerve cord in these double mutants. max-1; unc-6(e78) also 279 showed almost complete axon guidance failure (Figure 2, 3). max-1 enhanced VD/DD 280 axon guidance defects of the unc-5(e152) and unc-5(ev480) hypomorphic alleles, with 281 the max-1; unc-5(ev480) enhanced synergistically (Figure 2 and 3). This is also

282 consistent with previous results (HUANG et al. 2002). Axon guidance defects of unc- 283 40(n324) were synergistically enhanced by max-1 (Figure 2 and 3), consistent with

284 previous results (HUANG et al. 2002). Together, these axon guidance endpoint analyses 285 support previous axon guidance analyses showing that MAX-1 acts in the UNC-5 and 286 UNC-6 pathway, possibly in parallel to UNC-40. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

287 Discussion 288 MAX-1 regulates VD growth cone protrusion, but not polarity 289 Previous results using VD/DD dorsal axon guidance endpoint analysis indicated that 290 MAX-1 acts with UNC-5 and UNC-6, and in parallel to UNC-40. Our VD/DD axon 291 guidance endpoint analysis presented here supports this conclusion. However, our 292 analysis of VD growth cone morphology during dorsal outgrowth suggests that max-1 293 and unc-5 might have opposing roles. The VD growth cones of unc-5 hypomorphic 294 mutants displayed excessive protrusion. The growth cones were larger than wild-type 295 with longer filopodial protrusions. This is consistent with the known role of UNC-5 in

296 inhibiting VD growth cone protrusion (NORRIS AND LUNDQUIST 2011; NORRIS et al. 2014;

297 GUJAR et al. 2018). max-1 growth cones displayed an opposite phenotype. They were 298 smaller than wild-type with shorter filopodial protrusions, suggesting that MAX-1 was 299 required for robust growth cone protrusion. Thus, in at least some aspects of growth 300 cone outgrowth during axon guidance, UNC-5 and MAX-1 might have opposing roles. 301 MAX-1 might specifically affect growth cone protrusion and not polarity, as max-1 302 mutants had only weak polarity defects on their own and did not suppress polarity 303 defects of unc-5 mutants. 304 305 MAX-1 might attenuate UNC-5 signaling in growth cone protrusion 306 unc-5 hypomorphic VD growth cones displayed excessive protrusion, consistent 307 with the role of UNC-5 normally inhibiting growth cone protrusion. However, these 308 hypomorphic alleles retain some UNC-5 activity, as the VD/DD axon guidance defects 309 are significantly less severe than unc-5 null mutants. VD growth cones of max-1; unc- 310 5(hypomorphic) resembled the small, less protrusive growth cones of max-1 alone. This 311 suggests that MAX-1 is required for the large, overly-protrusive growth cones in unc-5 312 mutants. It is possible that MAX-1 acts in a parallel pathway to drive protrusion, such as 313 UNC-40, but genetic analyses suggest that MAX-1 acts in parallel to UNC-40 in the 314 UNC-5 pathway. Rather, we speculate that MAX-1 normally attenuates UNC-5 signaling 315 in growth cone protrusion (Figure 8). In a max-1 mutant, UNC-5 might be overly-active, 316 leading to reduced growth cone protrusion. In an unc-5 hypomorph, MAX-1 might be 317 attenuating what little UNC-5 function remains, resulting in large, protrusive growth bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

318 cones. In a max-1; unc-5(hypomorphic) double mutant, max-1 is no longer attenuating 319 residual UNC-5 activity, which inhibits growth cone protrusion, resulting in suppression 320 of excessive protrusion in unc-5(hypomorphic) mutations. If this was the case, we 321 expect that max-1 would not suppress unc-5(null), because there would be no residual 322 UNC-5 activity. However, we were unable to score VD growth cones in these double 323 mutants, as none emerged from the ventral nerve cord. The phenotypic resemblance of 324 max-1(null) mutants and constitutively-active myr::unc-5 growth cones is consistent with 325 an opposing role of MAX-1 and UNC-5. Furthermore, previous work showing that 326 overexpression of UNC-5 can compensate for overexpression of MAX-1 in VD/DD axon

327 guidance (HUANG et al. 2002) is consistent with opposing roles, which we discovered in 328 growth cone protrusion. 329 Previous studies suggest that SUMOylated MAX-1 controls the interaction of the 330 ABP-3/AP-3 complex  molecule with UNC-5, which targets UNC-5 to the lysosome for

331 degradation (CHEN et al. 2018). In this model, MAX-1 is constitutively bound to UNC-5 332 until it is SUMOylated, which allows ABP-3 to bind to UNC-5 and target it for lysosomal 333 degradation. This model predicts that loss of MAX-1 would result in reduced UNC-5 334 activity, yet we show evidence here of increased UNC-5 activity in max-1 mutants. 335 Possibly, SUMOylated MAX-1 also participates in lysosomal trafficking such that in a 336 max-1 mutant, UNC-5 is not degraded, resulting in high levels of UNC-5 in the growth 337 cone and inhibited growth cone protrusion. 338 Too much protrusion, as in an unc-5 loss-of-function mutant, and too little 339 protrusion, as in max-1 mutants and constitutively-active myr::unc-5 animals, both result 340 in qualitatively similar endpoint axon guidance defects. MAX-1 might fine-tune 341 protrusive activity by carefully regulating the activity of UNC-5. 342 343 The relationship of growth cone morphology to endpoint axon guidance 344 phenotypes

345 Previous results (HUANG et al. 2002) and results presented here using endpoint 346 axon guidance analysis indicate that MAX-1 and UNC-5 act in the same pathway in a 347 positive manner (i.e. max-1 and unc-5 have similar phenotypes that are enhanced in 348 double mutant combinations). Our results analyzing growth cone morphology suggest bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

349 that MAX-1 and UNC-5 might have opposing roles in growth cone protrusion, with MAX- 350 1 normally attenuating UNC-5 signaling to allow for growth cone protrusion. How these 351 interactions in the growth cone translate to endpoint axon guidance errors remains to be 352 fully elucidated. However, they do point to multiple and complex roles for these 353 molecules in growth cones as they extend. While max-1 suppresses excessive 354 protrusion in unc-5(hypomorphic) mutants, the endpoint axon guidance phenotype is 355 synergistically enhanced in the double mutant. This could be because we only analyzed 356 VD growth cones and effects are different in DD growth cones. More likely is the 357 possibility the roles of these molecules in the growth cone is complex, and that some 358 effects of these mutants on growth cone morphology are not being assayed in this 359 analysis. For example, speed of outgrowth and internal cytoskeletal and endosomal 360 organization was not being assessed here. In any event, these results suggest that in 361 growth cone protrusion, MAX-1 normally inhibits UNC-5 activity, allowing for robust 362 growth cone protrusion necessary for proper VD axon guidance. 363 364 An UNC-6/Netrin-mediated balance of protrusive forces in the growth cone 365 Previous studies demonstrated that UNC-6/Netrin signaling mediates a balance 366 of protrusive forces in the growth cone. UNC-5 homodimers and UNC-40/UNC-5 367 heterodimers inhibit growth cone protrusion in response to UNC-6, whereas UNC-40

368 homodimers stimulate protrusion in response to UNC-6 (NORRIS AND LUNDQUIST 2011;

369 NORRIS et al. 2014; GUJAR et al. 2018). UNC-5 and UNC-40/UNC-5 inhibit protrusion 370 through the FMO flavin monooxygenases that might destabilize actin and through UNC- 371 33/CRMP, which prevents microtubule + end entry into the growth cone thus preventing 372 entry of pro-protrusive vesicles. The Rac GTPases CED-10 and MIG-2 are involved in 373 both pathways. UNC-40 stimulates protrusion, possibly through the TIAM-1 GEF, the 374 Rac GTPases CED-10 and MIG-2, and actin regulators such as the Arp2/3 complex and

375 UNC-34/Enabled (NORRIS et al. 2009; NORRIS AND LUNDQUIST 2011; DEMARCO et al. 376 2012). This balance is demonstrated by the observation that the excess growth cone

377 protrusion in unc-5 mutants requires functional UNC-40 (NORRIS AND LUNDQUIST 2011) 378 (i.e. in an unc-5 mutant, UNC-40-driven protrusion is not counterbalanced by UNC-5 379 inhibition of protrusion, resulting in overly-protrusive growth cones). bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

380 Work presented here suggests that the PH/MyTH4/FERM myosin-like protein 381 MAX-1 regulates growth cone protrusion by inhibiting UNC-5. max-1 growth cones are 382 smaller and less protrusive than wild-type, similar to constitutively-activated myr::unc-5. 383 Furthermore, max-1 suppressed the excess growth cone protrusion in unc-5 384 hypomorphic mutants, possibly by allowing residual UNC-5 function in these mutants to 385 inhibit protrusion. That too little growth cone protrusion, observed in max-1 mutants and 386 myr::unc-5 animals, and too much protrusion, observed in unc-5 mutants, leads to 387 qualitatively-similar endpoint axon guidance defects underscores the importance of 388 analyzing growth cones during outgrowth to elucidate the molecular and cellular 389 mechanisms that guidance cues and their receptors engage to mediate proper axon 390 guidance and circuit formation. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

391 Figure Legends 392 Figure 1. MAX-1 and VD/DD axon guidance. (A) The MAX-1 molecule with functional 393 domains indicated. PH = pleckstrin homology domain. The locations of max-1 mutants 394 are indicted. (B) Sequence comparison of lq148 allele to the wild-type. lq148 shows 395 change from C to T shown in red, at position 13,099591 on LG V, resulting in a 396 premature stop codon at glutamine 857. (C) Diagram of an early L2 larva (Dorsal is up, 397 and anterior is left). The blue lines represent the dorsal and ventral body wall muscle 398 quadrants. The DD cell bodies (red) and axons (black) are shown. VD7 and VD8 are 399 also shown (green). While migrating toward the dorsal nerve cord, VD8 exhibits a 400 growth cone with dorsally-polarized protrusive morphology and dynamic filopodial 401 protrusions. VD7 indicates the final structure of VD neurons in wild-type. The 402 fluorescent micrograph shows a DD commissure (arrow) and a VD growth cone 403 (arrowhead). The growth cone displays dorsally-directed filopodial protrusions. CB, cell 404 body; DNC, dorsal nerve cord; VNC, ventral nerve cord. Scale bar represents 5m. (D) 405 Diagram of an L4 hermaphrodite after VD/DD axon outgrowth is complete. VD1 is not 406 shown. The 18 right-side commissures shown. Some commissural axons extend as a 407 single fascicle (e.g. DD1 and VD2) resulting in an average of 16 commissures per wild- 408 type animal. 409 410 Figure 2. VD/DD endpoint axon guidance defects. Fluorescent micrographs of L4 411 animals of different genotypes are shown. Dorsal is up, and anterior is to the left. The 412 scale bar in A represents 10m for all micrographs. The dashed line indicates the dorsal 413 nerve cord, and the dotted line the lateral midline. 414 415 Figure 3. Quantification of VD/DD endpoint axon guidance defects. (A) 416 Quantification of total axon guidance defects in wild-type and mutants (failure to reach 417 the dorsal nerve cord, axon wandering, and branching). N = 100 animals/1600 418 commissural processes. Error bars represents 2X standard error of proportion; single 419 asterisks (*) represents significance compared to respective single mutant; double 420 asterisks (**) indicates a significant with regards to predicted additive effect bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

421 (synergistic). The additive effect was calculated as p = p1 + p2 – (p1*p2). Fishers exact 422 test was used to determine the p value (p 0.001). 423 424 Figure 4. VD growth cone area, filopodia length, and polarity in max-1 mutants. 425 (A, B) Quantification of VD growth cone area (in m2) and filopodial length (in m) (see 426 materials and methods). Each point represents the score for a single growth cone or 427 filopodium. The mean (line) and standard error of the mean (error bars). Significance of 428 difference between genotypes was determined by a two-sided t-test with unequal 429 variance. (C) A graph showing the percent of dorsally- directed filopodial protrusions in 430 VD growth cones of different genotypes. In wild-type majority of filopodia (78%) 431 extended from the dorsal half of the growth cone. Single asterisks (*) indicates the 432 significant compared to wild-type (p  0.05). Error bar represents 2x standard error of 433 proportion. Significance is determined by Fisher’s exact test. n = number of growth 434 cones. (D-H) Fluorescence micrographs of wild-type and mutant VD growth cones. 435 Dorsal is up, anterior is left. The scale bar in D represents 5m for all micrographs. The 436 arrow in D indicates a filopodial protrusion in wild-type. The arrowheads in E-H point to 437 shortened filopodial protrusions. 438 439 Figure 5. VD growth cone area, filopodia length, and polarity in max-1; unc-5 440 double mutants. (A, B) Quantification of VD growth cone area and filopodial length as 441 described in Figure 4. (C) Quantification of growth cone polarity as described in Figure 442 4. ns = not significant. (D, E) Fluorescence micrographs of mutant VD growth cones as 443 described in Figure 4. The arrow in D indicates an excessively-long growth cone 444 filopodium, and the arrowhead in E indicates a shortened filopodial protrusion. 445 446 Figure 6. VD growth cone area and filopodia length in max-1; unc-40 double 447 mutants. (A, B) Quantification of VD growth cone area and filopodial length as 448 described in Figure 4. (C, D) Fluorescence micrographs of mutant VD growth cones as 449 described in Figure 4. Arrowheads point to filopodial protrusions. 450 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

451 Figure 7. VD growth cone area and filopodia length in max-1; unc-6 double 452 mutants. (A, B) Quantification of VD growth cone area and filopodial length as 453 described in Figure 4. (C, D) Fluorescence micrographs of mutant VD growth cones as 454 described in Figure 4. The arrow in C indicates standard-length filopodial protrusion. 455 The arrowhead in D indicates a shortened filopodial protrusion. 456 457 Figure 8. MAX-1 attenuates UNC-5 signaling in VD growth cones. (A) In wild-type, 458 MAX-1 normally attenuates UNC-5 signaling, resulting in less inhibition of protrusion 459 and the balanced growth cone protrusion required for proper growth cone outgrowth. 460 (B) In max-1 mutants, UNC-5 is not attenuated and so excessively inhibits protrusion, 461 resulting in small growth cones with limited protrusion. This results in failure of growth 462 cone outgrowth and axon guidance defects. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

463 Acknowledgements 464 This work was supported by NIH grants R01040945, R56NS095682, and 465 R03NS114554 to E.A.L. Next generation sequencing was conducted at the KU Genome 466 Sequencing Core, supported by the Center for Molecular Analysis of Disease Pathways 467 P20GM103638 (S. Lunte, P.I., E.A.L. co-I.). This work was also supported by the 468 Kansas Infrastructure Network of Biomedical Excellence P20GM103418 (D. Wright, 469 P.I.). bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

470 References 471 Brenner, S., 1974 The genetics of Caenorhabditis elegans. Genetics 77: 71-94. 472 Chan, S. S., H. Zheng, M. W. Su, R. Wilk, M. T. Killeen et al., 1996 UNC-40, a C. elegans 473 homolog of DCC (Deleted in Colorectal Cancer), is required in motile cells responding to 474 UNC-6 netrin cues. Cell 87: 187-195. 475 Chen, S. Y., C. T. Ho, W. W. Liu, M. Lucanic, H. M. Shih et al., 2018 Regulation of axon 476 repulsion by MAX-1 SUMOylation and AP-3. Proc Natl Acad Sci U S A 115: E8236- 477 E8245. 478 Demarco, R. S., E. C. Struckhoff and E. A. Lundquist, 2012 The Rac GTP exchange factor 479 TIAM-1 acts with CDC-42 and the guidance receptor UNC-40/DCC in neuronal 480 protrusion and axon guidance. PLoS Genet 8: e1002665. 481 Dominici, C., J. A. Moreno-Bravo, S. R. Puiggros, Q. Rappeneau, N. Rama et al., 2017 Floor- 482 plate-derived netrin-1 is dispensable for commissural axon guidance. Nature 545: 350- 483 354. 484 Fazeli, A., S. L. Dickinson, M. L. Hermiston, R. V. Tighe, R. G. Steen et al., 1997 Phenotype of 485 mice lacking functional Deleted in colorectal cancer (Dcc) gene. Nature 386: 796-804. 486 Gujar, M. R., A. M. Stricker and E. A. Lundquist, 2017 Flavin monooxygenases regulate 487 Caenorhabditis elegans axon guidance and growth cone protrusion with UNC-6/Netrin 488 signaling and Rac GTPases. PLoS Genet 13: e1006998. 489 Gujar, M. R., A. M. Stricker and E. A. Lundquist, 2019 RHO-1 and the Rho GEF RHGF-1 490 interact with UNC-6/Netrin signaling to regulate growth cone protrusion and microtubule 491 organization in Caenorhabditis elegans. PLoS Genet 15: e1007960. 492 Gujar, M. R., L. Sundararajan, A. Stricker and E. A. Lundquist, 2018 Control of Growth Cone 493 Polarity, Microtubule Accumulation, and Protrusion by UNC-6/Netrin and Its Receptors 494 in Caenorhabditis elegans. Genetics 210: 235-255. 495 Hedgecock, E. M., J. G. Culotti and D. H. Hall, 1990 The unc-5, unc-6, and unc-40 genes guide 496 circumferential migrations of pioneer axons and mesodermal cells on the epidermis in C. 497 elegans. Neuron 4: 61-85. 498 Hong, K., L. Hinck, M. Nishiyama, M. M. Poo, M. Tessier-Lavigne et al., 1999 A ligand-gated 499 association between cytoplasmic domains of UNC5 and DCC family receptors converts 500 netrin-induced growth cone attraction to repulsion. Cell 97: 927-941. 501 Huang, X., H. J. Cheng, M. Tessier-Lavigne and Y. Jin, 2002 MAX-1, a novel 502 PH/MyTH4/FERM domain cytoplasmic protein implicated in netrin-mediated axon 503 repulsion. Neuron 34: 563-576. 504 Ishii, N., W. G. Wadsworth, B. D. Stern, J. G. Culotti and E. M. Hedgecock, 1992 UNC-6, a 505 laminin-related protein, guides cell and pioneer axon migrations in C. elegans. Neuron 9: 506 873-881. 507 Jin, Y., E. Jorgensen, E. Hartwieg and H. R. Horvitz, 1999 The Caenorhabditis elegans gene unc- 508 25 encodes glutamic acid decarboxylase and is required for synaptic transmission but not 509 synaptic development. J Neurosci 19: 539-548. 510 Kennedy, T. E., H. Wang, W. Marshall and M. Tessier-Lavigne, 2006 Axon guidance by 511 diffusible chemoattractants: a gradient of netrin protein in the developing spinal cord. J 512 Neurosci 26: 8866-8874. 513 Killeen, M., J. Tong, A. Krizus, R. Steven, I. Scott et al., 2002 UNC-5 function requires 514 phosphorylation of cytoplasmic tyrosine 482, but its UNC-40-independent functions also 515 require a region between the ZU-5 and death domains. Dev Biol 251: 348-366. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

516 Leonardo, E. D., L. Hinck, M. Masu, K. Keino-Masu, S. L. Ackerman et al., 1997 Vertebrate 517 homologues of C. elegans UNC-5 are candidate netrin receptors. Nature 386: 833-838. 518 Leung-Hagesteijn, C., A. M. Spence, B. D. Stern, Y. Zhou, M. W. Su et al., 1992 UNC-5, a 519 transmembrane protein with immunoglobulin and thrombospondin type 1 domains, 520 guides cell and pioneer axon migrations in C. elegans. Cell 71: 289-299. 521 Lim, Y. S., and W. G. Wadsworth, 2002 Identification of domains of netrin UNC-6 that mediate 522 attractive and repulsive guidance and responses from cells and growth cones. J Neurosci 523 22: 7080-7087. 524 Limerick, G., X. Tang, W. S. Lee, A. Mohamed, A. Al-Aamiri et al., 2017 A Statistically 525 Oriented Asymmetric Localization (SOAL) Model for Neuronal Outgrowth Patterning by 526 Caenorhabditis elegans UNC-5 (UNC5) and UNC-40 (DCC) Netrin Receptors. Genetics. 527 Merz, D. C., H. Zheng, M. T. Killeen, A. Krizus and J. G. Culotti, 2001 Multiple signaling 528 mechanisms of the UNC-6/netrin receptors UNC-5 and UNC-40/DCC in vivo. Genetics 529 158: 1071-1080. 530 Montell, D. J., 1999 The genetics of cell migration in Drosophila melanogaster and 531 Caenorhabditis elegans development. Development 126: 3035-3046. 532 Moore, S. W., M. Tessier-Lavigne and T. E. Kennedy, 2007 Netrins and their receptors. Adv 533 Exp Med Biol 621: 17-31. 534 Morales, D., 2018 A new model for netrin1 in commissural axon guidance. J Neurosci Res 96: 535 247-252. 536 Norris, A. D., J. O. Dyer and E. A. Lundquist, 2009 The Arp2/3 complex, UNC-115/abLIM, and 537 UNC-34/Enabled regulate axon guidance and growth cone filopodia formation in 538 Caenorhabditis elegans. Neural Dev 4: 38. 539 Norris, A. D., and E. A. Lundquist, 2011 UNC-6/netrin and its receptors UNC-5 and UNC- 540 40/DCC modulate growth cone protrusion in vivo in C. elegans. Development 138: 4433- 541 4442. 542 Norris, A. D., L. Sundararajan, D. E. Morgan, Z. J. Roberts and E. A. Lundquist, 2014 The 543 UNC-6/Netrin receptors UNC-40/DCC and UNC-5 inhibit growth cone filopodial 544 protrusion via UNC-73/Trio, Rac-like GTPases and UNC-33/CRMP. Development 141: 545 4395-4405. 546 Serafini, T., S. A. Colamarino, E. D. Leonardo, H. Wang, R. Beddington et al., 1996 Netrin-1 is 547 required for commissural axon guidance in the developing vertebrate nervous system. 548 Cell 87: 1001-1014. 549 Shekarabi, M., and T. E. Kennedy, 2002 The netrin-1 receptor DCC promotes filopodia 550 formation and cell spreading by activating Cdc42 and Rac1. Mol Cell Neurosci 19: 1-17. 551 Terman, J. R., T. Mao, R. J. Pasterkamp, H. H. Yu and A. L. Kolodkin, 2002 MICALs, a family 552 of conserved flavoprotein oxidoreductases, function in plexin-mediated axonal repulsion. 553 Cell 109: 887-900. 554 Varadarajan, S. G., J. H. Kong, K. D. Phan, T. J. Kao, S. C. Panaitof et al., 2017 Netrin1 555 Produced by Neural Progenitors, Not Floor Plate Cells, Is Required for Axon Guidance in 556 the Spinal Cord. Neuron 94: 790-799 e793. 557 Wadsworth, W. G., H. Bhatt and E. M. Hedgecock, 1996 Neuroglia and pioneer neurons express 558 UNC-6 to provide global and local netrin cues for guiding migrations in C. elegans. 559 Neuron 16: 35-46. bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457713; this version posted August 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

560 Yamauchi, K., M. Yamazaki, M. Abe, K. Sakimura, H. Lickert et al., 2017 Netrin-1 Derived 561 from the Ventricular Zone, but not the Floor Plate, Directs Hindbrain Commissural 562 Axons to the Ventral Midline. Sci Rep 7: 11992. 563 Zhong, H., X. Wu, H. Huang, Q. Fan, Z. Zhu et al., 2006 Vertebrate MAX-1 is required for 564 vascular patterning in zebrafish. Proc Natl Acad Sci U S A 103: 16800-16805. 565 A ju39 ju142 lq148 1099 coiled coil PH PH MyTH4 FERM

B LG V, position 13,099,591 wild-type cgacaaccaaataattttcagACTCCAAATCAATTCAAACTGGAGTGAACT

lq148 cgacaaccaaataattttcagACTC*TAAATCAATTCAAACTGGAGTGAACT

C EARLY L2 :

DD4 VD7 VD8

DNC

CB CB CB VNC

D L4/ADULT : DD1 VD2 VD10 VD12 VD3 DD5 VD11 DD6 VD13 DD2 VD4 VD9 VD5 VD6 VD8 DD3 VD7 DD4

Figure 1 A B

wild-type 10um max-1(lq148) C D

max-1(ju39) max-1(ju142) E F max-(lq148); unc-5(e152)

unc-5(e152) G unc-40(n324) H

max-(lq148); unc-40(n324)

I unc-6(e78) J max-(lq148); unc-6(e78) Figure 2 max-1(lq148); unc-6(ev400) unc-6(ev400) * max-1(lq148); unc-6(e78) unc-6(e78) * max-1(lq148); unc-40(n324) unc-40(n324) ** max-1(lq148); unc-5(e791) unc-5(e791) * max-1(lq148); unc-5(ev480) unc-5(ev480) ** max-1(lq148); unc-5(e152) unc-5(e152) * myr::unc-5 max-1(ju142) max-1(ju39) max-1(lq148) wild-type

0 20 40 60 80 100 percent defective axons

Figure 3 N =100 p< 0.001 * significant compared to respective single mutants ** significant with regard to predicted additive effect (synergistic) A 8 B 3.0 7 **

) 2.5 2 * * * * ** 6 m ) * * * *

µ ** ** ** m 2.0 5 µ

4 1.5 3 1.0 filopodia ( Average area of of area Average

2 of length Average growth cone ( 0.5 1 0 0.0 n ≥ 50 wild-type wild-type myr::unc-5 myr::unc-5 max-1(ju39) max-1(ju39) 100 max-1(lq148) max-1(ju142) max-1(lq148) max-1(ju142) p < 0.001 compared to * wild-type, ** myr::unc-5 C 80 100 wild-type myr::unc-5 60 * 80 * 40 60 20 40 percent dorsal filopodia n ≥ 50 0 20 5µm percent dorsal filopodia percent dorsal filopodia D E wild-type0 myr::unc-5 max-1(ju39) max-1(lq148) max-1(ju142)

max-1(ju39) max-1(ju142) max-1(lq148)

Figure 4 F G H A 12 B 4 * ) 10 * 2 * ) 3 m ** m µ * 8 * µ * * ** ** * 6 * 2 * ** 4 filopodia ( Average area of of area Average

Average length of of length Average 1 growth cone ( 2

0 0

wild-type wild-type unc-5(e152) unc-5(e152) max-1(lq148) unc-5(ev480) max-1(lq148) unc-5(ev480) n ≥ 50

max-1(lq148); unc-5(e152) max-1(lq148); unc-5(e152) 100 max-1(lq148); unc-5(ev480) max-1(lq148); unc-5(ev480) p < 0.001 compared to * wild-type, ** single unc-5 mutant C 10080 ns

8060 ns ns 6040 ns

percent dorsal filopodia 4020 n ≥ 50

ns = not significant compared to single unc mutant percent dorsal filopodia percent dorsal filopodia 200

wild-type unc-6(e78) 0 unc-5(e152) max-1(lq148) unc-5(ev480) unc-40(n324)

wild-type max-1(lq148);unc-6(e78) unc-6(e78) max-1(lq148);unc-5(e152) unc-5(e152) max-1(lq148) max-1(lq148);unc-5(ev480) unc-5(ev480) max-1(lq148);unc-40(n324) unc-40(n324)

unc-5(ev480) unc-5(ev480); D E max-1(lq148); unc-6(e78) max-1(lq148); unc-5(e152) max-1(lq148); unc-5(ev480)max-max-1(lq148);1(lq148) unc-40(n324)

5µm C unc-5(ev480) Figure 5 A 10 B 4 )

2 8 ) 3 m m µ * µ * 6 * * ** 2 * 4 filopodia ( Average area of of area Average

Average length of of length Average 1 growth cone ( 2

0 0

wild-type n ≥ 50 wild-type max-1(lq148)unc-40(n324) max-1(lq148)unc-40(n324)

max-1(lq148); unc-40(n324) max-1(lq148); unc-40(n324) p < 0.001 compared to * wild-type, ** single unc-40 mutant

C D max-1(lq148); unc-40(n324) unc-40(n324)

5um

Figure 6 4 A 10 B )

2 8 ) 3 m m µ ** µ * 6 * 2 ** 4 filopodia ( Average area of of area Average Average length of of length Average 1 growth cone ( 2

0 0 n ≥ 50

wild-type wild-type unc-6(e78) unc-6(e78) max-1(lq148) max-1(lq148)

max-1(lq148); unc-6(e78) max-1(lq148); unc-6(e78) p < 0.001 compared to * wild-type, ** single unc-6 mutant

C D

max-1(lq148); 5µm unc-6(e78)

unc-6(e78) 5um Figure 7 A) wild-type VD growth cone

UNC-5

MAX-1

B) max-1 mutant VD growth cone

UNC-5

Figure 8 MAX-1