DOCSLIB.ORG

Greater Prairie Chickens Have a Compact MHC-B with a Single Class IA Locus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Greater Prairie Chickens Have a Compact MHC-B with a Single Class IA Locus Author's personal copy Immunogenetics DOI 10.1007/s00251-012-0664-7 ORIGINAL PAPER Greater prairie chickens have a compact MHC-B with a single class IA locus J. A. Eimes & K. M. Reed & K. M. Mendoza & J. L. Bollmer & L. A. Whittingham & Z. W. Bateson & P. O. Dunn Received: 18 July 2012 /Accepted: 22 October 2012 # Springer-Verlag Berlin Heidelberg 2012 Abstract The major histocompatibility complex (MHC) Introduction plays a central role in innate and adaptive immunity, but relatively little is known about the evolution of the number The major histocompatibility complex (MHC) is a family of and arrangement of MHC genes in birds. Insights into the genes found in all jawed vertebrates (Trowsdale 1988)that evolution of the MHC in birds can be gained by comparing facilitates the adaptive immune response to foreign parasites the genetic architecture of the MHC between closely related and pathogens (Janeway et al. 2005). Comparisons across species. We used a fosmid DNA library to sequence a 60.9-kb distantly related taxa have revealed major differences in the region of the MHC of the greater prairie chicken (Tympanuchus size, number, and arrangement (i.e., architecture) of MHC loci cupido), one of five species of Galliformes with a physically (Kelley et al. 2005). For example, the MHC in galliform birds mapped MHC. Greater prairie chickens have the smallest core appears to be dramatically more compact than that of mam- MHC yet observed in any bird species, and major changes are mals. The core MHC-B of the domestic chicken (Gallus observed in the number and arrangement of MHC loci. In gallus) is 1/20th the size of the MHC in humans (HLA) and particular, the greater prairie chicken differs from other contains just 19 coding genes compared with over 60 in Galliformes in the deletion of an important class I antigen humans (Guillemot et al. 1988;Kelleyetal.2005). binding gene. Analysis of the remaining class IA gene in a The compact nature of the MHC in domestic chickens and population of greater prairie chickens in Wisconsin, USA strong associations between individual haplotypes and disease revealed little evidence for selection at the region responsible resistance led to the description of the chicken MHC as a for antigen binding. “minimal essential MHC” (Kaufman et al. 1995). Kaufman (1999) hypothesized that in birds, fewer antigen presenting molecules will recognize fewer pathogens, but with lessened Keywords MHC . Fosmidlibrary .Galliformes .Comparative risk of autoimmune disorders, while in mammals, the larger genomics . Tympanuchus cupido suite of expressed molecules protects against more pathogens but at the expense of greater risk of autoimmunity. For exam- ple, in humans, there are up to six expressed MHC class I genes, and several associations with diseases and specific loci have been described (reviewed by Shiina et al. 2004a). * : : : Domestic chickens, in contrast, have only two class I genes, J. A. Eimes ( :) J. L. Bollmer L. A. Whittingham Z. W. Bateson P. O. Dunn BF1 and BF2,andBF2 is dominantly expressed, and it has Department of Biological Sciences, been hypothesized that BF2 plays a role in resistance to Rous University of Wisconsin-Milwaukee, sarcoma virus and Marek's disease (Kaufman and Venugopal Milwaukee, WI, USA e-mail: [email protected] 1998; Wallny et al. 2006). : In addition to the domestic chicken, the core MHC-B has K. M. Reed K. M. Mendoza been sequenced in four additional species within the Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, Galliformes: domestic turkey (Meleagris gallopavo), golden St. Paul, MN, USA pheasant (Chrysolophus pictus), the black grouse (Tetrao Author's personal copy Immunogenetics tetrix, Genbank accession number AC:JQ028669), and overnight at 50 V using the Fosmid Control DNA (Epicentre) Japanese quail (Coturnix japonica), and the MHC has many (40 kb) as a size marker. The gDNA was additionally sheared fewer genes, less intergenic space and smaller introns than by vortexing for 40-s intervals until an intact, 40 kb fragment the mammalian MHC (Shiina et al. 2004a, b; Chaves et al. was generated. We increased the efficiency of the insert liga- 2009;Yeetal.2012). Assembled sequences of the Galliform tion (on which all subsequent cloning steps are dependent) by MHC-B suggest that even among closely related taxa the gene omitting further size selection of the gDNA. The MaxPlax number, order and orientation are variable. For example, the Lambda Packaging Extracts, EPI300-T1 Plating Strain MHC-B of the turkey and Japanese quail contain several BG (pCC1FOS, Epicentre) preferentially accepts inserts of 30– genes between Blec2 and BTN2, while the domestic chicken 40 kb and, thus, size selects the fragment during the packaging has just one (Shiina et al. 2004a, b; Chaves et al. 2009). The step. domestic chicken has two MHC-B class IIB genes (Kaufman et al. 1999), whereas the turkey and golden pheasant have at Cloning least three (Chaves et al. 2009;Yeetal.2012), and in the Japanese quail, block duplications have generated up to eight Single-copy gDNA fragments (~40 kb) were cloned using class IIB genes in some individuals (Shiina et al. 2004a, b; the CopyControl™ Fosmid Library Production Kit with Hosomichi et al. 2006). pCC1FOS Vector and Phage T-1 Resistant EPI300™-T1R To further examine variation in the MHC of the locally Escherichia coli Plating Strain (Epicentre). We end-repaired threatened species, the greater prairie chicken (Tympanuchus 15.0 μg of the DNA fragments using the Epicentre Fosmid cupido), we produced a physical map of the MHC-B region. kit according to the manufacturer's instructions, and 0.25 μg Previous work on this species (Eimes et al. 2011) had sug- of that DNA was ligated into 0.5 μg pCC1FOS vector DNA. gested variation in class II gene number between individuals, Transformed fosmids were packaged into MaxPlax Lambda and our efforts to amplify class I and other regions of the core Packaging Extract (Epicentre) and processed according to MHC failed, suggesting a different MHC-B genetic architec- the manufacturer's instructions followed by infection of ture than other Galliformes. The MHC-B assembly presented EPI300-T1R E. coli cells (Epicentre). Infected bacteria were here covers the region extending 60.9 kb from the BTN2 gene spread on 50 LB plates (22 cm) supplemented with 12.5 mg/ to the centromere protein gene CenpA. Our results show that mL chloramphenicol and incubated at 37 °C overnight. the genetic architecture of the MHC-B, while generally con- served in Galliformes, exhibits some important variations, Colony screening which is in part due to major inversions and deletions that have occurred between closely related species. In addition to a Colonies were harvested from each plate by flooding with physical map of the MHC in the greater prairie chicken, we 1.5 ml LBand gently scraping 700 μl of the mixture into investigated genetic variation and natural selection on the 1 ml microcentrifuge tubes supplemented with 20 % glycerol previously undescribed (in this species) class I peptide binding for immediate storage at −80 °C. The remaining mixture from gene. each plate was placed into a separate microcentrifuge tube for DNA extraction using the Epicentre FosmidMax Purification kit. Each extracted fosmid sub-library was then screened for Materials and methods MHC genes using the PCR primers Blex2F (Eimes et al. 2010) and E3R (Chaves et al. 2010), which together amplify a 279-bp Fosmid library construction fragment of the MHC class II gene encoding the β chain, and the primers pcTAP2F1 and pcTAP2R1 which amplify a 380- gDNA insert preparation bp fragment of the TAP2 antigen peptide transporter gene in the MHC class I (Table 1). The following PCR conditions were The library was constructed from DNA extracted from whole used: 50.0–100.0 ng fosmid DNA, 0.5 U of HotStar Taq blood from an adult female captured in Polk County, polymerase (Qiagen, USA), 4.0 μl of Q solution (Qiagen) Minnesota in 2008. High molecular weight genomic DNA and final concentrations of 0.5 μM of each primer, 200 μM was extracted using the Masterpure Complete DNA each dNTP and 1× of HotStar Taq PCR Buffer (Qiagen) and Purification Kit (Epicentre Biotechnologies, USA) and resus- water to a total volume of 25.0 μl. Cycling conditions were: pended in TE buffer at a concentration of 0.5 μg/μl. To 15minat95°Cinitialactivationfollowedby30cyclesof98° generate approximately 40 kb DNA fragments for insertion C for 20 s, 60 °C for 30 s, and 72 °C for 30 s. into the fosmid vector, 40 μg of purified gDNAwas randomly Positive sub-libraries were identified by sequencing the sheared by passing the sample through a 200-μl pipette tip 50 PCR amplicons and confirming homology to MHC genes in times. To confirm correct size of the insert, 1.0 μl of the the domestic turkey and chicken using BLAST. The resulting DNA was run on a 20-cm long, 0.8 % agarose gel corresponding glycerol stock (200 μl) from each positive Author's personal copy Immunogenetics Table 1 PCR primers and con- ditions used to amplify regions Locus/primer Primer sequence Product size (bp) Annealing temp (°C) Extension time of the prairie chicken MHC-B BTN2 F2 cacggctctgggtgctgtgg 2,850 58 4 m BLEC1 R3 cagaccgcttggcttggcga TAPBP F2 agtggggaggtggaggggga 4,250 65 6 m BRD2 R2 tgcagccaacgagaagcccg TAPBP 18 F ccagctgcgcttcccaacga 620 65 1 m TAPBP 18 R tgccgtcggtctcaccccaa IIB-2 15 F cacccggcccacccctatga 850 65 1 m IIB-2 15 R aggggacgccccatggactc DMB1Fa gaaggctgcagtgctcgcca 4,250 63 6 m DMB2Rab cgtcctctgcaacagccggg DMB2U tgggttgctgtggggcctct 2,450 60 3 m dmTAP2-Ra Tacgtgcccaccaagctgcg IAex2F gcggtacttctgcaccgcga 220 62 30 s IAex3R actgcctctggaactgccgc nTAP1-C4-F gggggtgggggcagtaggag 4,850 63 6 m nTAP1-C4-R cacagcgctcagcctgcact pcTAP1 F1 agggccatttttctcctcat 380 60 30 s pcTAP1 R1 tgattgctcagaaggtcac pcBG1F tggagcggcacagggtgagt 354 62 45 s pcBG1R gggctgcaaccaccccagtt pcBlec2F gacagagcaggcaggcagca 156 62 30 s pcBlec2r actgccctgagaccaacggga xTAPBpFalt ggcaggaacacggcgcagat 1,120 63 1.5 m xTAPBPR1 agtggtggttggcggcagtg pc1A ex3F gcttcaaccagagcggcggt 674 62 1 m pc1A ex3R acgatgggccgcgggtagaa sub-library (one TAP1 and one class II) was diluted with LB E.
Load more

Recommended publications
  • Sharp-Tailed Grouse (Tympanuchus Phasianellus) in a Resource Development Area at the Northern Edge of the Species' Range
    Sharp-tailed grouse (Tympanuchus phasianellus) in a resource development area at the northern edge of the species’ range by Joël Potié Department of Natural Resource Sciences McGill University, Macdonald Campus Montréal, Québec April 2020 A thesis submitted to McGill University in partial fulfilment of the requirements of the degree of Master of Science © Joël Potié 2020 i Table of Contents ABSRACT .................................................................................................................................................. iv RÉSUMÉ ..................................................................................................................................................... v LIST OF TABLES .................................................................................................................................... vii LIST OF FIGURES ................................................................................................................................... ix ACKNOWLEDGEMENTS ....................................................................................................................... x PREFACE AND CONTRIBUTION OF AUTHORS: ........................................................................... xii CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW ....................................................... 1 SHARP-TAILED GROUSE ECOLOGY ............................................................................................. 2 STGR in Yukon and Alaska ..................................................................................................................
    [Show full text]
  • Infectious Agents of Prairie Grouse (Tympanuchus Spp.) (PG) Mirrored Trends in How North American Wildlife Scientists Perceived Host–Para- Site Interactions
    05-SC_Peterson x.qxd 4/6/04 12:09 PM Page 35 SPECIAL COVERAGE 35 Parasites and infectious diseases of prairie grouse: should managers be concerned? by Markus J. Peterson Abstract Historically, interest in the infectious agents of prairie grouse (Tympanuchus spp.) (PG) mirrored trends in how North American wildlife scientists perceived host–para- site interactions. Increased ecological interest in host–parasite interactions since the 1980s led to increased awareness of PG–parasite interactions beginning in the 1990s. Prairie grouse are hosts to parasitic arthropods (e.g., lice, mites, ticks) and helminths (e.g., nematodes, cestodes, trematodes), as well as microparasites such as protozoa, bacteria, fungi, and viruses. Although many of these infectious agents cause disease in individual PG, few data address their potential influence on host population dynamics. Based on existing data on the parasites of PG, studies of other grouse species, and the- oretical perspectives, the macroparasites Dispharynx nasuta and Trichostrongylus cramae; the microparasites Eimeria dispersa, E. angusta, Leucocytozoon bonasae, and Plasmodium pedioecetii; and the infectious bronchitis and reticuloendotheliosis viruses exhibit characteristics that suggest they have the potential to regulate PG pop- ulations. Infectious agents such as Histomonas meleagridis, Pasteurella multocida, E. dispersa, E. angusta, and other microparasites that cause high mortality across a broad range of galliform hosts have the potential to extirpate small, isolated PG popu- lations. Nonparasitic diseases caused by mycotoxins, pesticides, and other toxic com- pounds also have the potential to influence population dynamics. Because there appears to be a behavioral component to PG population extinction, the fact that para- sites might influence breeding behavior also requires further evaluation.
    [Show full text]
  • Alpha Codes for 2168 Bird Species (And 113 Non-Species Taxa) in Accordance with the 62Nd AOU Supplement (2021), Sorted Taxonomically
    Four-letter (English Name) and Six-letter (Scientific Name) Alpha Codes for 2168 Bird Species (and 113 Non-Species Taxa) in accordance with the 62nd AOU Supplement (2021), sorted taxonomically Prepared by Peter Pyle and David F. DeSante The Institute for Bird Populations www.birdpop.org ENGLISH NAME 4-LETTER CODE SCIENTIFIC NAME 6-LETTER CODE Highland Tinamou HITI Nothocercus bonapartei NOTBON Great Tinamou GRTI Tinamus major TINMAJ Little Tinamou LITI Crypturellus soui CRYSOU Thicket Tinamou THTI Crypturellus cinnamomeus CRYCIN Slaty-breasted Tinamou SBTI Crypturellus boucardi CRYBOU Choco Tinamou CHTI Crypturellus kerriae CRYKER White-faced Whistling-Duck WFWD Dendrocygna viduata DENVID Black-bellied Whistling-Duck BBWD Dendrocygna autumnalis DENAUT West Indian Whistling-Duck WIWD Dendrocygna arborea DENARB Fulvous Whistling-Duck FUWD Dendrocygna bicolor DENBIC Emperor Goose EMGO Anser canagicus ANSCAN Snow Goose SNGO Anser caerulescens ANSCAE + Lesser Snow Goose White-morph LSGW Anser caerulescens caerulescens ANSCCA + Lesser Snow Goose Intermediate-morph LSGI Anser caerulescens caerulescens ANSCCA + Lesser Snow Goose Blue-morph LSGB Anser caerulescens caerulescens ANSCCA + Greater Snow Goose White-morph GSGW Anser caerulescens atlantica ANSCAT + Greater Snow Goose Intermediate-morph GSGI Anser caerulescens atlantica ANSCAT + Greater Snow Goose Blue-morph GSGB Anser caerulescens atlantica ANSCAT + Snow X Ross's Goose Hybrid SRGH Anser caerulescens x rossii ANSCAR + Snow/Ross's Goose SRGO Anser caerulescens/rossii ANSCRO Ross's Goose
    [Show full text]
  • Non-Defendable Resources Affect Peafowl Lek Organization: a Male
    Behavioural Processes 74 (2007) 64–70 Non-defendable resources affect peafowl lek organization: A male removal experiment Adeline Loyau a,b,∗, Michel Saint Jalme b, Gabriele Sorci a,1 a Laboratoire de Parasitologie Evolutive, Universit´e Pierre et Marie Curie, Paris, France b Conservation des Esp`eces, Restauration et Suivi des Populations, Mus´eum National d’Histoire Naturelle, Paris, France Received 19 December 2005; received in revised form 15 September 2006; accepted 22 September 2006 Abstract A lekking mating system is typically thought to be non-resource based with male providing nothing to females but genes. However, males are thought to clump their display sites on areas where they are more likely to encounter females, which may depend on non-defendable resource location. We tested this hypothesis on a feral population of peacocks. In agreement, we found that, within the lek, display site proximity to food resources had an effect on female visitation rate and male mating success. The attractiveness of display sites to male intruders was explained by the distance to the feeding place and by the female visitation rate. We randomly removed 29 territorial males from their display sites. Display sites that were more attractive to male intruders before removal remained highly attractive after removal and display sites closer to the feeding area attracted the attention of intruders significantly more after removal. Similarly, display sites that were more visited by females before removal remained more visited after removal, suggesting again that the likelihood of encountering females is determined by the display site location. Overall, these results are in agreement with non-defendable resources affecting lek spatial organization in the peafowl.
    [Show full text]
  • Exploring the Evolutionary History of North American Prairie Grouse (Genus: Tympanuchus) Using Multi-Locus Coalescent Analyses
    EXPLORING THE EVOLUTIONARY HISTORY OF NORTH AMERICAN PRAIRIE GROUSE (GENUS: Tympanuchus) USING MULTI-LOCUS COALESCENT ANALYSES Stephanie J. Galla, B.S. Thesis Prepared for the Degree of MASTER OF SCIENCE UNIVERSITY OF NORTH TEXAS May 2013 APPROVED: Jeff A. Johnson, Major Professor Steve Wolverton, Committee Member Qunfeng Dong, Committee Member Sam Atkinson, Chair of the Department of Biological Sciences Mark Wardell, Dean of the Toulouse Graduate School Galla, Stephanie J. Exploring the evolutionary history of North American prairie grouse (Genus: Tympanuchus) using multi-locus coalescent analyses. Master of Science (Biology), May 2013, 74 pp., 13 tables, 19 figures, references, 144 titles. Conservation biologists are increasingly using phylogenetics as a tool to understand evolutionary relationships and taxonomic classification. The taxonomy of North American prairie grouse (sharp-tailed grouse, T. phasianellus; lesser prairie- chicken, T. pallidicinctus; greater prairie-chicken, T. cupido; including multiple subspecies) has been designated based on physical characteristics, geography, and behavior. However, previous studies have been inconclusive in determining the evolutionary history of prairie grouse based on genetic data. Therefore, additional research investigating the evolutionary history of prairie grouse is warranted. In this study, ten loci (including mitochondrial, autosomal, and Z-linked markers) were sequenced across multiple populations of prairie grouse, and both traditional and coalescent-based phylogenetic analyses were used to address the evolutionary history of this genus. Results from this study indicate that North American prairie grouse diverged in the last 200,000 years, with species-level taxa forming well-supported monophyletic clades in species tree analyses. With these results, managers of the critically endangered Attwater’s prairie-chicken (T.
    [Show full text]
  • Columbian Sharp-Tailed Grouse (Tympanuchus Phasianellus Columbianus): a Technical Conservation Assessment
    Columbian Sharp-tailed Grouse (Tympanuchus phasianellus columbianus): A Technical Conservation Assessment Prepared for the USDA Forest Service, Rocky Mountain Region, Species Conservation Project August 17, 2007 Richard W. Hoffman1 and Allan E. Thomas2 11804 Wallenberg Drive, Fort Collins, Colorado 80526 25001 Decatur Drive, Boise, Idaho 83704 Peer Review Administered by Society for Conservation Biology Hoffman, R.W. and A.E. Thomas. (2007, August 17). Columbian Sharp-tailed Grouse (Tympanuchus phasianellus columbianus): a technical conservation assessment. [Online]. USDA Forest Service, Rocky Mountain Region. Available: http://www.fs.fed.us/r2/projects/scp/assessments/columbiansharptailedgrouse.pdf [date of access]. ACKNOWLEDGEMENTS The authors thank K.J. Eichhoff and H.E. Vermillion of the Colorado Division of Wildlife for their assistance in preparing the figures and C.E. Soldati, a student at Colorado State University, for her help in preparing the References section. J.A. Boss, librarian for the Colorado Division of Wildlife, was extremely helpful in locating and obtaining many of the references used to prepare this assessment. T.P. Woolley, biologist with the Wyoming Game and Fish Department, provided lek survey data and answered many questions regarding the distribution and management of Columbian sharp-tailed grouse in Wyoming. This assessment also benefited from information provided by A.D. Apa, M.A. Schroeder, and A.W. Spaulding. D.P. McDonald of the University of Wyoming conducted the lifecycle model analyses and prepared the summary of the results. C.E. Braun and an anonymous reviewer provided constructive comments that substantially improved the quality of the assessment. Finally, the authors are extremely grateful to G.D.
    [Show full text]
  • Investigation Into the Decline of Populations of Administered by the Bureau of Land Management, Carlsbad Field Office, New Mexic
    INVESTIGATION INTO THE DECLINE OF POPULATIONS OF THE LESSER PRAIRIE-CHICKEN (Tympanuchuspallidicinctus) ON LANDS ADMINISTERED BY THE BUREAU OF LAND MANAGEMENT, CARLSBAD FIELD OFFICE, NEW MEXICO Cooperative Agreement GDAO 10007 FINAL REPORT Submitted 30 June 2004 Submitted to John Sherman and Steve Belinda Bureau of Land Management, Carlsbad Field Office 620 E. Greene Street, Carlsbad, New Mexico 88220 John L. Hunt and Troy L. Best Department of Biological Sciences, 331 Funchess Hall, Auburn University, AL 36849-541 4 TABLE OF CONTENTS EXECUTIVE SUMMARY .............................................................................................. 1 CHAPTER 1: BIOLOGY OF THE LESSER PRAIRIE-CHICKEN (Tympanuchus pallidicinctus) WITH EMPHASIS ON POPULATIONS IN NEW MEXICO .... 5 Taxonomy and Nomenclature ................................................................... 5 Evolution................................................................................................... 6 Diagnosis .................................................................................................. 7 General Characters and Morphology ........................................................ 8 Distribution ............................................................................................. 10 Ontogeny and Reproduction ................................................................... 12 Breeding ...................................................................................... 12 Nesting .......................................................................................
    [Show full text]
  • HABITAT REQUIREMENTS of RING-NECKED PHEASANT HENS (Phasianus Colchicus)
    HABITAT REQUIREMENTS OF RING-NECKED PHEASANT HENS (Phasianus colchicus) ON FARMLAND IN LOWER AUSTRIA DURING NESTING AND BROOD REARING by THOMAS HOESMAN BLISS (Under the Direction of John P. Carroll) ABSTRACT Ring-necked pheasants (Phasianus colchicus) are an important game species in Austria where populations have declined precipitously during the last half century. Given the lack of knowledge of populations within Austria, this research was conducted to determine habitat use and survival of pheasant hens during the breeding season and for broods during the first 21 days after hatching. Hen pheasants establish home ranges around set-aside and wetland habitats and nest in set aside. Brooding hens prefer to use set aside habitat and that game crop positively affects brood survival. Predation is the main reason for loss of hens and broods. Therefore, in order to increase the population of pheasants I suggest increasing the availability of set aside, wetland, and game crop habitats while incorporating supplemental feeding and predator control. INDEX WORDS: Ring-necked pheasant, Austria, Brood, Habitat Use, Home Range, Survival HABITAT REQUIREMENTS OF RING-NECKED PHEASANT HENS (Phasianus colchicus) ON FARMLAND IN LOWER AUSTRIA DURING NESTING AND BROOD REARING by THOMAS HOESMAN BLISS B.S., University of Tennessee: Chattanooga, 1997 A Thesis Submitted to the Graduate Faculty of The University of Georgia in Partial Fulfillment of the Requirements for the Degree MASTER OF SCIENCE ATHENS, GEORGIA 2004 © 2004 Thomas Hoesman Bliss All Rights Reserved HABITAT REQUIREMENTS OF RING-NECKED PHEASANT HENS (Phasianus colchicus) ON FARMLAND IN LOWER AUSTRIA DURING NESTING AND BROOD REARING by THOMAS HOESMAN BLISS Major Professor: John P.
    [Show full text]
  • Phasianinae Species Tree
    Phasianinae Blood Pheasant,Ithaginis cruentus Ithaginini ?Western Tragopan, Tragopan melanocephalus Satyr Tragopan, Tragopan satyra Blyth’s Tragopan, Tragopan blythii Temminck’s Tragopan, Tragopan temminckii Cabot’s Tragopan, Tragopan caboti Lophophorini ?Snow Partridge, Lerwa lerwa Verreaux’s Monal-Partridge, Tetraophasis obscurus Szechenyi’s Monal-Partridge, Tetraophasis szechenyii Chinese Monal, Lophophorus lhuysii Himalayan Monal, Lophophorus impejanus Sclater’s Monal, Lophophorus sclateri Koklass Pheasant, Pucrasia macrolopha Wild Turkey, Meleagris gallopavo Ocellated Turkey, Meleagris ocellata Tetraonini Ruffed Grouse, Bonasa umbellus Hazel Grouse, Tetrastes bonasia Chinese Grouse, Tetrastes sewerzowi Greater Sage-Grouse / Sage Grouse, Centrocercus urophasianus Gunnison Sage-Grouse / Gunnison Grouse, Centrocercus minimus Dusky Grouse, Dendragapus obscurus Sooty Grouse, Dendragapus fuliginosus Sharp-tailed Grouse, Tympanuchus phasianellus Greater Prairie-Chicken, Tympanuchus cupido Lesser Prairie-Chicken, Tympanuchus pallidicinctus White-tailed Ptarmigan, Lagopus leucura Rock Ptarmigan, Lagopus muta Willow Ptarmigan / Red Grouse, Lagopus lagopus Siberian Grouse, Falcipennis falcipennis Spruce Grouse, Canachites canadensis Western Capercaillie, Tetrao urogallus Black-billed Capercaillie, Tetrao parvirostris Black Grouse, Lyrurus tetrix Caucasian Grouse, Lyrurus mlokosiewiczi Tibetan Partridge, Perdix hodgsoniae Gray Partridge, Perdix perdix Daurian Partridge, Perdix dauurica Reeves’s Pheasant, Syrmaticus reevesii Copper Pheasant, Syrmaticus
    [Show full text]
  • Management of Galliformes
    38_Galliforms.qxd 8/24/2005 10:02 AM Page 861 CHAPTER 38 Management of Galliformes GARY D. BUTCHER, BS, MS, DVM, P hD, D ipl ACPV Members of the order Galliformes are found on every continent except Antarctica. The red junglefowl, com- mon turkey and helmeted guinea fowl have been domesticated for centuries. Their descendants, through selective breeding, are of considerable economic impor- tance today. Some varieties are very plentiful in the wild, while others like the Japanese quail (Coturnix japonica) and various pheasants are approaching a level of com- plete domestication. Many Galliformes are commonly maintained as game and food (meat and/or eggs) birds. Some are stable in captivity under variable ambient conditions, easy to breed and inexpensive. Other species are from niches with specific environmental requirements and need spe- cialized diets, humidity and temperature ranges to sur- vive. Currently, commercial production of chickens and turkeys in the USA for food has surpassed that of the Greg J. Harrison Greg J. Fig 38.1 | In warm climates, game cocks are housed on “string beef, pork and fish industries. In 1900, per capita con- walks”. A leg leash, just long enough for the bird to reach a sumption of chicken was 1 pound and had risen to 80 shelter but not to fight with other birds, allows group confine- pounds by the year 2000! ment. Fighting of cocks is considered inhumane and illegal in some countries; however, it is a part of the culture in others. In this chapter, “domestic fowl” means Gallus gallus, forma domestica (domestic form of the red junglefowl); “domestic turkey” is Meleagris gallopavo, forma domes- tica (domestic form of the common turkey) and “domes- tic guinea fowl” is Numida meleagris, forma domestica (domestic form of the helmeted guinea fowl) (Table 38.1).
    [Show full text]
  • Ecography ECOG-04871
    Ecography ECOG-04871 Rotenberry, J. T. and Balasubramaniam, P. 2020. Connecting species’ geographical distributions to environmental variables: range maps versus observed points of occurrence. – Ecography doi: 10.1111/ecog.04871 Supplementary material Appendix 1 Supplementary Material Appendix Table A1. Data downloaded from Global Biodiversity Information Facility, 16 January – 4 May 2018. Each file can be accessed at https://www.gbif.org/occurrence/download/<GBIF ID as indicated in the first column>. Each file was generated by searching for the taxa indicated. Taxonomy of species downloaded from GBIF was reconciled with IOC 7.3 taxonomy (Gill and Donsker 2017); this principally involved updating recent species’ genera changes that had yet to be incorporated in all data from GBIF. See text for how data were cleaned. GBIF ID Taxon (GBIF search field) 0001404-180412121330197 Acryllium vulturinum 0001407-180412121330197 Afropavo congensis 0001410-180412121330197 Alectoris 0001415-180412121330197 Ammoperdix 0001413-180412121330197 Perdix 0001416-180412121330197 Arborophila 0001417-180412121330197 Argusianus argus 0002656-180412121330197 Argusianus argus 0002659-180412121330197 Bambusicola 0002667-180412121330197 Chrysolophus 0002663-180412121330197 Callipepla 0002665-180412121330197 Bonasa 0002670-180412121330197 Colinus 0002672-180412121330197 Coturnix 0003685-180412121330197 Excalfactoria chinensis 0003686-180412121330197 Excalfactoria adansonii 0003688-180412121330197 Synoicus 0003814-180412121330197 Megapodius 0003818-180412121330197 Megapodiidae
    [Show full text]
  • Evaluation of a Chicken 600K SNP Genotyping Array in Non-Model Species of Grouse Received: 19 October 2018 Piotr Minias 1, Peter O
    www.nature.com/scientificreports OPEN Evaluation of a Chicken 600K SNP genotyping array in non-model species of grouse Received: 19 October 2018 Piotr Minias 1, Peter O. Dunn 1,2, Linda A. Whittingham2, Jef A. Johnson3 & Accepted: 11 April 2019 Sara J. Oyler-McCance4 Published: xx xx xxxx The use of single nucleotide polymorphism (SNP) arrays to generate large SNP datasets for comparison purposes have recently become an attractive alternative to other genotyping methods. Although most SNP arrays were originally developed for domestic organisms, they can be efectively applied to wild relatives to obtain large panels of SNPs. In this study, we tested the cross-species application of the Afymetrix 600K Chicken SNP array in fve species of North American prairie grouse (Centrocercus and Tympanuchus genera). Two individuals were genotyped per species for a total of ten samples. A high proportion (91%) of the total 580 961 SNPs were genotyped in at least one individual (73–76% SNPs genotyped per species). Principal component analysis with autosomal SNPs separated the two genera, but failed to clearly distinguish species within genera. Gene ontology analysis identifed a set of genes related to morphogenesis and development (including genes involved in feather development), which may be primarily responsible for large phenotypic diferences between Centrocercus and Tympanuchus grouse. Our study provided evidence for successful cross-species application of the chicken SNP array in grouse which diverged ca. 37 mya from the chicken lineage. As far as we are aware, this is the frst reported application of a SNP array in non-passerine birds, and it demonstrates the feasibility of using commercial SNP arrays in research on non-model bird species.
    [Show full text]