molecules

Article A Xylenol Orange-Based Screening Assay for the Substrate Specificity of Flavin-Dependent para-Phenol Oxidases

Tom A. Ewing 1, Aster van Noord 1, Caroline E. Paul 2 ID and Willem J. H. van Berkel 1,* ID

1 Laboratory of Biochemistry, Wageningen University & Research, Stippeneng 4, 6708 WE Wageningen, The Netherlands; [email protected] (T.A.E.); [email protected] (A.v.N.) 2 Laboratory of Organic Chemistry, Wageningen University & Research, Stippeneng 4, 6708 WE Wageningen, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +31-317-482861

Received: 15 December 2017; Accepted: 11 January 2018; Published: 14 January 2018

Abstract: Vanillyl alcohol oxidase (VAO) and eugenol oxidase (EUGO) are flavin-dependent enzymes that catalyse the oxidation of para-substituted phenols. This makes them potentially interesting biocatalysts for the conversion of lignin-derived aromatic monomers to value-added compounds. To facilitate their biocatalytic exploitation, it is important to develop methods by which variants of the enzymes can be rapidly screened for increased activity towards substrates of interest. Here, we present the development of a screening assay for the substrate specificity of para-phenol oxidases based on the detection of hydrogen peroxide using the ferric-xylenol orange complex method. The assay was used to screen the activity of VAO and EUGO towards a set of twenty-four potential substrates. This led to the identification of 4-cyclopentylphenol as a new substrate of VAO and EUGO and 4-cyclohexylphenol as a new substrate of VAO. Screening of a small library of VAO and EUGO active-site variants for alterations in their substrate specificity led to the identification of a VAO variant (T457Q) with increased activity towards vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol) and a EUGO variant (V436I) with increased activity towards chavicol (4-allylphenol) and 4-cyclopentylphenol. This assay provides a quick and efficient method to screen the substrate specificity of para-phenol oxidases, facilitating the enzyme engineering of known para-phenol oxidases and the evaluation of the substrate specificity of novel para-phenol oxidases.

Keywords: enzyme kinetics; flavoprotein; oxidase; screening assay; substrate specificity

1. Introduction Lignin, one of the major constituents of lignocellulosic biomass, is a heterogenous aromatic polymer, formed from the monolignols para-coumaryl alcohol, coniferyl alcohol and sinapyl alcohol through a radical coupling process [1,2]. It is obtained as a by-product during the processing of plant biomass in biorefineries and as such represents an attractive renewable feedstock of aromatic compounds. In order to harness the full potential of lignin as a renewable chemical feedstock, it is desirable to develop novel methods to depolymerise it to monomeric aromatic compounds and subsequently convert these to value-added compounds. One way in which lignin-derived aromatic molecules can be converted to value-added compounds is through the action of oxidative enzymes. Two such enzymes are the flavin-dependent oxidases vanillyl alcohol oxidase (VAO) from Penicillium simplicissimum and eugenol oxidase (EUGO) from Rhodococcus jostii RHA1 [3,4], which both belong to auxiliary activity family 4 (AA4) of the carbohydrate active enzyme (CAZy) database [5]. VAO (EC 1.1.3.38) and EUGO (EC 1.1.3.x) are members of the VAO/PCMH flavoprotein family, which includes flavoenzymes characterised by the presence of a conserved FAD-binding domain [6,7].

Molecules 2018, 23, 164; doi:10.3390/molecules23010164 www.mdpi.com/journal/molecules Molecules 2018, 23, 164 2 of 18

VAO and EUGO both catalyse the two-electron oxidation of para-substituted phenols at the Cα Molecules 2017, 22, x FOR PEER REVIEW 2 of 18 position of their substituent (Scheme1). Molecular oxygen acts as the electron acceptor for the reaction,position being converted of their substituent to hydrogen (Scheme peroxide. 1). Molecular Despite oxygen the fact acts that as the VAO electron and EUGO acceptor share for the significant sequencereaction, similarity being (45% converted identical) to hydrogen and very peroxide. similar Despite secondary the fact and that tertiary VAO structures, and EUGO they share differ in terms ofsignificant their oligomerisation sequence similarity state (45% and identical) substrate and specificity very similar [ 8secondary,9]. VAO and displays tertiary a structures, broad substrate they differ in terms of their oligomerisation state and substrate specificity [8,9]. VAO displays a broad specificity, catalysing the oxidation of alcohols to aldehydes, the oxidative deamination of amines, substrate specificity, catalysing the oxidation of alcohols to aldehydes, the oxidative deamination of the oxidativeamines, demethylationthe oxidative demethylation of ethers, of the ethers, dehydrogenation the dehydrogenation or hydroxylationor hydroxylation of of alkyl alkyl groups groups and the hydroxylationand the hydroxylation of allyl groups of allyl [10 groups,11]. EUGO [10,11]. displays EUGO displays a somewhat a somewhat narrower narrower substrate substrate specificity. Althoughspecificity. alcohols Although and 4-allylphenols alcohols and 4-allylphenols are good substrates are good substrates for the enzyme, for the enzyme, 4-alkylphenols 4-alkylphenols and ethers are hardlyand accepted ethers are [ hardly4]. In accepted terms of [4]. its In oligomerisation terms of its oligomerisation state, VAO state, is predominantly VAO is predominantly octameric in octameric in solution, though active dimers may also be present under certain conditions [3,12]. In solution, though active dimers may also be present under certain conditions [3,12]. In contrast, EUGO contrast, EUGO is exclusively dimeric in solution, with its structure strongly resembling that of a is exclusivelydimer of dimeric VAO [9]. in solution, with its structure strongly resembling that of a dimer of VAO [9].

Scheme 1. Examples of reactions catalysed by vanillyl alcohol oxidase (VAO) and/or eugenol oxidase Scheme 1. Examples of reactions catalysed by vanillyl alcohol oxidase (VAO) and/or eugenol oxidase (EUGO). Both enzymes can catalyse the oxidation of vanillyl alcohol (14) to the aldehyde vanillin and (EUGO).of Both eugenol enzymes (18) to can coniferyl catalyse alcohol. the oxidation VAO converts of vanillyl 4-ethylphenol alcohol ( (143) ) to to a the mixture aldehyde of products vanillin and of eugenolconsisting (18) to coniferyl of 4-vinylphenol alcohol. andVAO 1-(4´-hydroxyphenyl)ethanol. converts 4-ethylphenol ( 3 The) to ahydroxylation mixture of products reaction occurs consisting of 4-vinylphenolenantioselectively, and 1-(40-hydroxyphenyl)ethanol. predominantly yielding the ( TheR)-enantiomer hydroxylation of the reactionalcohol. In occurs contrast, enantioselectively, previous predominantlystudies failed yielding to reveal the any (R)-enantiomer activity towards of 3 the for alcohol.EUGO [13]. In contrast, previous studies failed to reveal any activity towards 3 for EUGO [13]. A number of the reactions catalysed by VAO and EUGO are of interest for potential industrial applications. The oxidation of vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol) or vanillyl A numberamine [4-(aminomethyl)-2-methoxyphenol] of the reactions catalysed by yields VAO vanillin and EUGO (4-hydroxy-3-methoxybenzaldehyde), are of interest for potential the industrial applications.main flavour The and oxidation fragrance of compound vanillyl in alcohol vanilla [14]. (4-hydroxy-3-methoxybenzyl VAO can also be used for the synthesis alcohol) of chiral or vanillyl amine [4-(aminomethyl)-2-methoxyphenol]secondary alcohols, with the oxidation yields of short-chain vanillin linear (4-hydroxy-3-methoxybenzaldehyde), 4-alkylphenols yielding the (R)- the enantiomers of the corresponding alcohols in high enantiomeric excess [15]. The hydroxylation of 4- main flavour and fragrance compound in vanilla [14]. VAO can also be used for the synthesis allylphenols by VAO or EUGO has been employed in multi-enzyme cascades for the synthesis of the of chiralplant secondary lignan pinoresinol alcohols, and with model the lignin oxidation compounds of short-chain[16–18]. The hydroxylation linear 4-alkylphenols of eugenol (4-allyl- yielding the (R)-enantiomers2-methoxyphenol) of the correspondingby VAO has also alcoholsgarnered interest in high as enantiomeric the first step in excessfermentation [15]. Theprocesses hydroxylation for of 4-allylphenolsthe conversion by of VAO eugenol or EUGO to ferulic has acid, been which employed can be used in as multi-enzyme a precursor for vanillin cascades [19–24]. for the synthesis of the plantUp lignan to now, pinoresinol the molecular and determinants model lignin of the compounds differences in [16 substrate–18]. The specificity hydroxylation between VAO of eugenol and EUGO are unclear. The differing oligomerisation states of the enzymes do not appear to be (4-allyl-2-methoxyphenol) by VAO has also garnered interest as the first step in fermentation processes for the conversion of eugenol to ferulic acid, which can be used as a precursor for vanillin [19–24]. Up to now, the molecular determinants of the differences in substrate specificity between VAO and EUGO are unclear. The differing oligomerisation states of the enzymes do not appear to be Molecules 2018, 23, 164 3 of 18 involved, as a VAO variant that exclusively forms dimers displayed similar catalytic properties to the wild-type enzyme [13]. To improve our understanding of the determinants of the substrate specificity of these para-phenol oxidases and to facilitate efforts to modify their reactivity by enzyme engineering, it would be beneficial to be able to rapidly screen variants of VAO and EUGO for activity towards multiple substrates. To enable this, we here describe a method for the rapid screening of the substrate specificity of para-phenol oxidases using the ferric-xylenol orange complex method for the detection of hydrogen peroxide. The ferric-xylenol orange complex method (xylenol orange assay) is a colorimetric method for the determination of the concentration of hydroperoxides. When an assay solution containing Fe2+ ions and xylenol orange is added to a sample containing a hydroperoxide under acidic conditions, the hydroperoxide will oxidise Fe2+ to Fe3+. The Fe3+ subsequently forms a complex with xylenol orange that can be quantified from its absorbance at 560 nm [25,26]. The assay has been applied to measure the concentration of lipid or protein hydroperoxides in biological samples and as an activity assay for the lipid hydroperoxide-forming enzyme lipoxygenase [27–29]. Detection of hydrogen peroxide via the ferric-xylenol orange complex method can be used to detect the activity of oxidases and has been applied in a biosensor for lactose and in an in-gel screening assay for L-amino acid oxidase activity [30,31]. Methods used previously to determine the activity of VAO or EUGO typically relied on the measurement of the absorption of reaction products or the consumption of oxygen [4,10]. These assays are not suitable for high-throughput substrate specificity screening as they are either dependent on the identity of the phenolic reaction product (measuring absorption of the product) or cannot easily be performed for multiple samples simultaneously (measuring consumption of oxygen). In contrast, the xylenol orange assay does not depend on the identity of the phenolic reaction product and multiple samples can be evaluated simultaneously by performing the assay in a 96-wells plate. The xylenol orange assay is also better suited for our purpose than assays based on the detection of hydrogen peroxide via the formation of a coloured compound by peroxidases, as the phenolic substrates converted by VAO and EUGO are typically also substrates for peroxidases [32]. The method reported here consists of an efficient benchtop purification of His-tagged versions of VAO and EUGO, followed by a rapid screening of their activity towards a set of twenty-four potential substrates using the xylenol orange assay. After developing the procedure using the wild-type enzymes, we applied the assay to screen fourteen active-site variants for alterations in their substrate specificity. This led to the identification of new substrates of the wild-type enzymes and two variants that displayed increased activity towards at least one substrate.

2. Results

2.1. Purification and Characterisation of His-VAOand EUGO-His To enable screening of the substrate specificity of multiple VAO and EUGO variants, we first needed a method for the rapid and efficient purification of the enzymes. To this end, we expressed the enzymes from new expression vectors containing genes encoding His-tagged variants of the enzymes. VAO was expressed as an N-terminally His-tagged protein, His-VAO, and EUGO was expressed as a C-terminally His-tagged protein, EUGO-His. To evaluate whether these constructs can be used for our study, we expressed and purified the His-tagged wild-type enzymes and evaluated whether their catalytic properties are similar to those of the non-His-tagged proteins. Both His-tagged enzymes were successfully expressed in E. coli and purified by a simple benchtop procedure consisting of a single affinity chromatography step using a Ni-NTA column followed by buffer exchange using a desalting column. The purified enzymes contained flavin, as determined from their characteristic flavin absorption spectra (Figures S1 and S2). Upon precipitation of the proteins using trichloroacetic acid, a yellow pellet and colourless supernatant were obtained, demonstrating that the flavin cofactor is covalently bound to the protein. To determine whether the presence of a His-tag Molecules 2018, 23, 164 4 of 18 on the protein affects catalysis, we determined the steady-state kinetic parameters for the oxidation of vanillyl alcohol by His-VAO and EUGO-His (Table1). This revealed that the catalytic properties of Molecules 2017, 22, x FOR PEER REVIEW 4 of 18 the His-tagged enzymes are highly similar to those of the non-His-tagged enzymes, demonstrating that thethat introductionthe catalytic properties of the His-tag of the does His-tagged not affect enzymes catalysis. are Therefore, highly similar these to His-taggedthose of the variants non-His- of VAOtagged and EUGO enzymes, provide demonstrating a suitable experimental that the introduction system to rapidly of the purify His-tag variants does not of the affect enzymes catalysis. and studyTherefore, their catalytic these properties.His-tagged variants of VAO and EUGO provide a suitable experimental system to rapidly purify variants of the enzymes and study their catalytic properties. Table 1. Steady-state kinetic parameters for the oxidation of vanillyl alcohol by vanillyl alcohol oxidase (VAO),Table His-tagged 1. Steady-state vanillyl kinetic alcohol parameters oxidase for (His-VAO), the oxidation eugenol of vanillyl oxidase alcohol (EUGO) by vanillyland His-tagged alcohol ◦ eugenoloxidase oxidase (VAO), (EUGO-His) His-tagged in vanillyl 50 mM alcohol potassium oxidase phosphate (His-VAO), buffer, eugenol pH 7.5, oxidase at 25 (EUGO)C. and His- tagged eugenol oxidase (EUGO-His) in 50 mM potassium phosphate buffer, pH 7.5, at 25 °C. −1 −1 −1 Enzyme kcat (s ) Km (µM) kcat/Km (s mM ) Enzyme kcat (s−1) Km (μM) kcat/Km (s-1 mM−1) a a VAO VAO 2.62.6 a 149 149 a 17 17 His-VAOHis-VAO 2.5 2.5± 0.1 ± 0.1 129 ± 15129 ± 15 19 19 a a EUGOEUGO 7.17.1 a 79 79 a 90 90 ± ± EUGOEUGO-His-His 8.0 8.00.2 ± 0.2 47 547 ± 5 170 170 a Dataa Data from from [13 [13].].

2.2. Development2.2. Development of the of Xylenolthe Xylenol Orange Orange Assay Assay Using Using His-VAOand His-VAO and EUGO-His EUGO-His To determineTo determine whether whether the xylenolthe xylenol orange orange assay assay can can be be used used to to accurately accurately measure measure the the activity activity of His-VAOof His-VAO and EUGO-His, and EUGO-His, we used we used it to it follow to follow the the oxidation oxidation of of vanillyl vanillyl alcohol alcohol andand eugenol by by the the enzymesenzymes in time. in time. To thisTo this end, end, 2 mM 2 mM vanillyl vanillyl alcohol alcohol or or eugenol eugenol was was allowedallowed to react with with EUGO-His EUGO-His or His-VAOor His-VAO for timefor time periods periods ranging ranging from from one one to to twenty twenty min, min, after after whichwhich the amount of of hydrogen hydrogen peroxideperoxide formed formed was was determined determined using using the the xylenol xylenol orange orange assay. assay. In In allall cases,cases, the measured measured hydrogen hydrogen peroxideperoxide concentration concentration was was found found to increaseto increase in in time. time. The The increase increase waswas linearlinear for the the first first ten ten min min of of the reactions,the reactions, with with the the exception exception of theof the oxidation oxidation of of vanillyl vanillyl alcohol alcohol byby EUGO-His,EUGO-His, where where the the increase increase was linear for the first 7.5 min of the reaction (Figure 1). was linear for the first 7.5 min of the reaction (Figure1).

Figure 1. Conversion of eugenol or vanillyl alcohol by His-tagged vanillyl alcohol oxidase (His-VAO) Figure 1. Conversion of eugenol or vanillyl alcohol by His-tagged vanillyl alcohol oxidase (His-VAO) or His-tagged eugenol oxidase (EUGO-His) followed in time using the xylenol orange assay. His- or His-tagged eugenol oxidase (EUGO-His) followed in time using the xylenol orange assay. His-VAO VAO ([●] for vanillyl alcohol, [♦] for eugenol) or EUGO-His ([■] for vanillyl alcohol, [▲] for eugenol) ([ ] for vanillyl alcohol, [] for eugenol) or EUGO-His ([] for vanillyl alcohol, [N] for eugenol) was was incubated with 2 mM substrate in 50 mM potassium phosphate buffer, pH 7.5, at room incubated with 2 mM substrate in 50 mM potassium phosphate buffer, pH 7.5, at room temperature temperature (19–20 °C). Reactions were allowed to proceed for the specified time, after which the (19–20 ◦C). Reactions were allowed to proceed for the specified time, after which the amount of amount of hydrogen peroxide formed was determined using the xylenol orange assay. Error bars hydrogen peroxide formed was determined using the xylenol orange assay. Error bars represent the represent the standard deviation of triplicate measurements. Broken lines are fits to the linear range standardof the deviation data that ofwere triplicate used to measurements. determine reaction Broken rates lines (see areTable fits 2). to the linear range of the data that were used to determine reaction rates (see Table2). Reaction rates were determined by fitting the linear range of the data. These rates (Table 2) were similar to the kcat values determined previously using other methods, as would be expected

Molecules 2018, 23, 164 5 of 18

Reaction rates were determined by fitting the linear range of the data. These rates (Table2) were similar to the kcat values determined previously using other methods, as would be expected considering that our reactions were performed using saturating substrate concentrations. Thus, determination of the amount of hydrogen peroxide formed using the xylenol orange assay is a suitable way to determine Molecules 2017,, 22,, xx FORFOR PEERPEER REVIEWREVIEW 5 5 ofof 1818 the ratesMolecules of reactions2017, 22, x FOR catalysed PEER REVIEW by His-VAO or EUGO-His. 5 of 18 Molecules 2017, 22, x FOR PEER REVIEW 5 of 18 Molecules 2017, 22, x FOR PEER REVIEW 5 of 18 considering that our reactions were performed using saturating substrate concentrations. Thus, consideringTable 2. Reaction that ourrates reactions for the oxidation were performed of 2 mM vanillyl using alcohol saturating oreugenol substrate by His-taggedconcentrations. vanillyl Thus, determinationconsidering that of our the amountreactions of were hydrogen performed peroxide using formed saturating using substrate the xylenol concentrations. orange assay Thus, is a determinationalcohol oxidase of (His-VAO) the amount or His-tagged of hydrogen eugenol peroxide oxidase formed (EUGO-His) using in the 50 mM xylenol potassium orange phosphate assay is a suitabledetermination way to ofdetermine the amount the rates of hydrogen of reactions◦ peroxide catalysed formed by His-VAO using the or EUGO-His. xylenol orange assay is a suitablebuffer, pH way 7.5, to atdetermine room temperature the rates of (19–20 reactionsC)as catalysed determined by His-VAO using the or xylenol EUGO-His. orange assay. The suitable way to determine the rates of reactions catalysed by His-VAO or EUGO-His. kcat values for the non-His-tagged enzymes measured previously using other methods are shown Table 2. ReactionReaction ratesrates forfor thethe oxidationoxidation ofof 22 mMmM vanillylvanillyl alcoholalcohol oror eugenoleugenol byby His-taggedHis-tagged vanillylvanillyl for comparison.Table 2. Reaction These ratesk forvalues the oxidation were measured of 2 mM under vanillyl identical alcohol experimentalor eugenol by conditions,His-tagged vanillyl with the alcoholTable 2. oxidaseReaction (His-VAO) ratescat for the or oxidation His-tagged of 2 mM eugenol vanillyl oxidase alcohol (EUGO-His) or eugenol inby 50His-tagged mM potassium vanillyl alcoholTable 2. oxidaseReaction (His-VAO) rates for the or oxidation His-tagged of◦ 2 mM eugenol vanillyl oxidase alcohol ◦ (EUGO-His) or eugenol inby 50His-tagged mM potassium vanillyl exceptionalcohol of oxidase the temperature, (His-VAO) which or His-tagged was 25 C insteadeugenol of oxidase 19–20 (EUGO-His)C. in 50 mM potassium phosphatealcohol oxidase buffer, (His-VAO) pH 7.5, at room or His-tagged temperature eugenol (19–20 oxidase °C) as determined (EUGO-His) using in 50the mMxylenol potassium orange phosphate buffer, pH 7.5, at room temperature (19–20 °C) as determined using the xylenol orange assay.phosphate The kbuffer,cat values pH for 7.5, the at non-His-tagged room temperature enzymes (19–20 measured °C) as determined previously using using the other xylenol methods orange are phosphateassay. The kbuffer,cat values pH for 7.5, the at non-His-tagged room temperature enzymes (19–20 measured °C) as determined previously using using the other xylenol methods orange are assay. The kcat values for the non-His-tagged(His)-VAO enzymes measured previously using EUGO-(His) other methods are shownassay. The for comparison.kcat values for These the non-His-tagged kcat values were enzymesmeasured measured under identical previously experimental using other conditions, methods with are assay.shown The for comparison.kcat values for These the non-His-tagged kcat values were enzymesmeasured measured under identical previously experimental using other conditions, methods with are shown for comparison. These kcat values were measured under identical experimental conditions, with theshown exception for comparison. of the temperature, These kVanillyl-alcoholcat values which were was 25measured °C instead Eugenol under of 19–20 identical °C. Vanillyl-alcoholexperimental conditions, Eugenol with theshownthe exceptionexception for comparison. ofof thethe temperature,temperature, These kcat values whichwhich were waswas 25measured25 °C°C insteadinstead under ofof 19–20 19–20identical °C.°C. experimental conditions, with the exception of the temperature, which was 25 °C instead of 19–20 °C. the exception of the temperature,−1 which± was 25 °C instead± of 19–20 °C. ± ± kobs Xylenol Orange Assay (s ) 1.5 0.1(His)(His)--VAO 8.0 0.3 6.6 EUGO0.1--(His)(His) 3.2 0.1 −1 a(His)-VAO a EUGOa -(His) a kcat (s ) Vanillyl2.6-alcohol(His)- VAOE ugenol11 Vanillyl-alcohol7.1EUGO -(His) Eugenol2.9 Vanillyl--alcohol(His)- VAO E ugenol Vanillyl--alcoholEUGO -(His) Eugenol −1 Vanillyla-alcohol Eugenol Vanillyl-alcohol Eugenol kobsobs Xylenol Orange Assay (s−1) Vanillyl1.5 ±- alcoholData0.1 taken fromE8.0ugenol [±13 0.3]. Vanillyl6.6 ±- alcohol0.1 E3.2ugenol ± 0.1 kobs Xylenol Orange Assay (s−1) Vanillyl1.5 ±- alcohol0.1 E8.0ugenol ± 0.3 Vanillyl6.6 ±- alcohol0.1 E3.2ugenol ± 0.1 kobs Xylenol Orange Assay (s−1) 1.5 ± 0.1 8.0 ± 0.3 6.6 ± 0.1 3.2 ± 0.1 k Xylenol Orange−1 Assay (s−1) 1.5 ± 0.1a 8.0 ± a0.3 6.6 ± 0.1a 3.2 ± 0.1a kobs Xylenol kOcatcatrange (s(s−1)) Assay (s−1) 1.52.6 ± 0.1a 8.011 ± a0.3 6.67.1 ± 0.1a 3.22.9 ± 0.1a kobs Xylenol kOcatrange (s−1) Assay (s ) 1.52.6 ± 0.1a 8.011 ± a0.3 6.67.1 ± 0.1a 3.22.9 ± 0.1a kcat (s−1) 2.6 a 11a 7.1 a 2.9 a kcat (s−1) 2.6a a 11a 7.1 a 2.9 a kcat (s−1) 2.6 aa Data Data takentaken fromfrom11 [13].a[13]. 7.1 a 2.9 a Subsequently, we used the xylenol orangea Data assay taken tofrom evaluate [13]. the conversion of a set of twenty-four a Data taken from [13]. a Data taken from [13]. (potential)Subsequently, substrates bywe used wild-type the xylenol His-VAO orange and assay EUGO-His. to evaluate The the conversion set of compounds of a set of contained twenty- Subsequently, we used the xylenol orange assay to evaluate the conversion of a set of twenty- variousfourfour 4-(cyclo)alkylphenols, Subsequently,(potential)(potential) substratessubstrates we used byby the4-hydroxybenzyl wild-typewild-type xylenol His-VAOHis-VAOorange assay alcohols, andand to EUGO-His.EUGO-His. evaluate 4-allylphenols the TheThe conversion setset andofof compoundscompounds a of 4-hydroxybenzylic a set of containedcontained twenty- four (potential) substrates by wild-type His-VAO and EUGO-His. The set of compounds contained amine.variousfour In (potential) addition 4-(cyclo)alkylphenols, substrates to these para by-substituted wild-type 4-hydroxybenzyl His-VAO phenols, alcohols, and 2-hydroxy- EUGO-His. 4-allylphenols and The 3-hydroxybenzyl set andof compounds a 4-hydroxybenzylic alcohol contained were various 4-(cyclo)alkylphenols, 4-hydroxybenzyl alcohols, 4-allylphenols and a 4-hydroxybenzylic includedamine.various in In the 4-(cyclo)alkylphenols, addition set of compounds to these para in 4-hydroxybenzyl-substituted-substituted order to screen phenols,phenols, alcohols, for 2-hydroxy-2-hydroxy- variants 4-allylphenols that andand no 3-hydroxybenzyl3-hydroxybenzyl longer and have a 4-hydroxybenzylic a strict alcoholalcohol specificity werewere amine. In addition to these para-substituted phenols, 2-hydroxy- and 3-hydroxybenzyl alcohol were for paraincludedamine.included-substituted In in inaddition thethe setset phenols. ofofto compounds compoundsthese For para a-substituted full inin order listorder of toto the phenols,screenscreen compounds forfor 2-hydroxy- variantsvariants and thatthat their and nono structural3-hydroxybenzyl longerlonger havehave formulae, aa strictstrict alcohol specificityspecificity see Tablewere3 . included in the set of compounds in order to screen for variants that no longer have a strict specificity forincludedfor para-substituted-substituted in the set of phenols.phenols. compounds ForFor a ain fullfull order listlist toofof screenthethe compoundscompounds for variants andand that theirtheir no structuralstructurallonger have formulae,formulae, a strict specificity seesee TableTable for para-substituted phenols. For a full list of the compounds and their structural formulae, see Table 3.for para-substitutedTable phenols. 3. Compounds For a full testedlist of inthe the compounds substrate specificity and their screening.structural formulae, see Table 3. 3. Table 3. CompoundsCompounds testedtested inin thethe substratesubstrate specificityspecificity screening.screening. Table 3. Compounds tested in the substrate specificity screening. EntryTable Compound 3. Compounds Name (Trivial tested in Name) the substrate specificity screening. Structure Entry Compound Name (T(Trivial Name)) Structure Entry Compound Name (Trivial Name) Structure Entry Compound Name (Trivial Name) Structure Entry1 1 Compound4-methylphenol4-methylphenol Name (T(pararivial-cresol) (para Name-cresol) ) Structure 1 4-methylphenol (para-cresol)-cresol) 1 4-methylphenol (para-cresol) HO 1 4-methylphenol (para-cresol) HO 1 4-methylphenol (para-cresol) HO HO 2 2 2-methoxy-4-methylphenol2-methoxy-4-methylphenol (para-creosol)-creosol) (para-creosol) 2 2-methoxy-4-methylphenol (para-creosol) 2 2-methoxy-4-methylphenol (para-creosol) 2 2-methoxy-4-methylphenol (para-creosol)

3 3 4-ethylphenol4-ethylphenol 3 4-ethylphenol 3 4-ethylphenol 3 4-ethylphenol

4 4-n-propylphenol-propylphenol 4 4 4-n-propylphenol4-n-propylphenol 4 4-n-propylphenol 4 4-n-propylphenol

5 4-isopropyphenol 5 4-isopropyphenol 5 5 4-isopropyphenol4-isopropyphenol 5 4-isopropyphenol

6 4-n-butylphenol-butylphenol 6 4-n-butylphenoln 6 6 4-n-butylphenol4- -butylphenol 6 4-n-butylphenol

7 4-sec-butylphenol 7 4-sec-butylphenol-butylphenol 7 4-sec-butylphenolsec 7 7 4-sec-butylphenol4- -butylphenol

8 4-n-pentylphenol 8 4-n-pentylphenol-pentylphenol 8 4-n-pentylphenol 8 8 4-n-pentylphenol4-n-pentylphenol

9 4-n-hexylphenol 9 4-n-hexylphenol-hexylphenol 9 4-n-hexylphenol 9 9 4-n-hexylphenol4-n-hexylphenol

10 4-n-nonylphenol 10 4-n-nonylphenol-nonylphenol 10 4-n-nonylphenol 10 4-n-nonylphenol

Molecules 2017, 22, x FOR PEER REVIEW 5 of 18

considering that our reactions were performed using saturating substrate concentrations. Thus, determination of the amount of hydrogen peroxide formed using the xylenol orange assay is a suitable way to determine the rates of reactions catalysed by His-VAO or EUGO-His.

Table 2. Reaction rates for the oxidation of 2 mM vanillyl alcohol or eugenol by His-tagged vanillyl alcohol oxidase (His-VAO) or His-tagged eugenol oxidase (EUGO-His) in 50 mM potassium phosphate buffer, pH 7.5, at room temperature (19–20 °C) as determined using the xylenol orange assay. The kcat values for the non-His-tagged enzymes measured previously using other methods are

shown for comparison. These kcat values were measured under identical experimental conditions, with the exception of the temperature, which was 25 °C instead of 19–20 °C.

(His)-VAO EUGO-(His)

Vanillyl-alcohol Eugenol Vanillyl-alcohol Eugenol kobs Xylenol Orange Assay (s−1) 1.5 ± 0.1 8.0 ± 0.3 6.6 ± 0.1 3.2 ± 0.1 kcat (s−1) 2.6 a 11a 7.1 a 2.9 a a Data taken from [13]. Subsequently, we used the xylenol orange assay to evaluate the conversion of a set of twenty- four (potential) substrates by wild-type His-VAO and EUGO-His. The set of compounds contained various 4-(cyclo)alkylphenols, 4-hydroxybenzyl alcohols, 4-allylphenols and a 4-hydroxybenzylic amine. In addition to these para-substituted phenols, 2-hydroxy- and 3-hydroxybenzyl alcohol were included in the set of compounds in order to screen for variants that no longer have a strict specificity for para-substituted phenols. For a full list of the compounds and their structural formulae, see Table 3. Table 3. Compounds tested in the substrate specificity screening.

Entry Compound Name (Trivial Name) Structure

1 4-methylphenol (para-cresol) HO

2 2-methoxy-4-methylphenol (para-creosol)

3 4-ethylphenol

4 4-n-propylphenol

5 4-isopropyphenol

6 4-n-butylphenol

Molecules 20187 , 23, 164 4-sec-butylphenol 6 of 18

8 4-n-pentylphenol Table 3. Cont.

Molecules9 Entry 2017, 22, x FOR PEER Compound4- REVIEWn-hexylphenol Name (Trivial Name) Structure 6 of 18 Molecules 2017, 22, x FOR PEER REVIEW 6 of 18 Molecules 2017, 22, x FOR PEER REVIEW 6 of 18 Molecules 2017,, 22,, xx FORFOR PEERPEER REVIEWREVIEW 6 6 ofof 1818 Molecules 2017, 22, x FOR PEER REVIEW 6 of 18 Molecules10 102017, 22, x FOR PEER4- REVIEWn-nonylphenol4-n-nonylphenol 6 of 18 Table 3.. Cont.. Table 3. Cont. Table 3. Cont. Table 3. Cont. Table 3. Cont. 11 2-hydroxybenzyl alcohol 11 11 2-hydroxybenzyl2-hydroxybenzyl alcohol alcohol 11 2-hydroxybenzyl alcohol 11 2-hydroxybenzyl alcohol 11 2-hydroxybenzyl alcohol 11 2-hydroxybenzyl alcohol

12 3-hydroxybenzyl alcohol 12 12 3-hydroxybenzyl3-hydroxybenzyl alcohol alcohol 12 3-hydroxybenzyl alcohol 12 3-hydroxybenzyl alcohol 12 3-hydroxybenzyl alcohol 13 4-hydroxybenzyl alcohol 13 13 4-hydroxybenzyl4-hydroxybenzyl alcohol alcohol 13 4-hydroxybenzyl alcohol 13 4-hydroxybenzyl alcohol 13 4-hydroxybenzyl alcohol 13 4-hydroxybenzyl alcohol 4-hydroxy-3-methoxybenzyl alcohol (vanillyl 14 4-hydroxy-3-methoxybenzyl alcohol (vanillyl 14 4-hydroxy-3-methoxybenzyl4-hydroxy-3-methoxybenzyl alcohol (vanillyl alcohol 14 14 4-hydroxy-3-methoxybenzylalcohol) alcohol (vanillyl 14 4-hydroxy-3-methoxybenzylalcohol)(vanillyl alcohol alcohol) (vanillyl 14 4-hydroxy-3-methoxybenzylalcohol) alcohol (vanillyl 14 alcohol) alcohol)

15 4-hydroxy-3,5-dimethoxybenzyl alcohol 15 4-hydroxy-3,5-dimethoxybenzyl alcohol 15 15 4-hydroxy-3,5-dimethoxybenzyl4-hydroxy-3,5-dimethoxybenzyl alcohol alcohol 15 4-hydroxy-3,5-dimethoxybenzyl alcohol 15 4-hydroxy-3,5-dimethoxybenzyl alcohol 15 4-hydroxy-3,5-dimethoxybenzyl alcohol

16 4-hydroxy-2-methoxybenzyl alcohol 16 4-hydroxy-2-methoxybenzyl alcohol 16 4-hydroxy-2-methoxybenzyl alcohol 16 16 4-hydroxy-2-methoxybenzyl4-hydroxy-2-methoxybenzyl alcohol alcohol 16 4-hydroxy-2-methoxybenzyl alcohol

17 4-allylphenol (chavicol) 17 4-allylphenol (chavicol) 17 4-allylphenol (chavicol) 17 17 4-allylphenol4-allylphenol (chavicol) (chavicol) 17 4-allylphenol (chavicol) 17 4-allylphenol (chavicol)

18 4-allyl-2-methoxyphenol (eugenol) 18 4-allyl-2-methoxyphenol (eugenol) 18 4-allyl-2-methoxyphenol (eugenol) 18 4-allyl-2-methoxyphenol (eugenol) 18 18 4-allyl-2-methoxyphenol4-allyl-2-methoxyphenol (eugenol) (eugenol) 18 4-allyl-2-methoxyphenol (eugenol)

19 4-allyl-2,6-dimethoxyphenol 19 4-allyl-2,6-dimethoxyphenol 19 4-allyl-2,6-dimethoxyphenol 19 4-allyl-2,6-dimethoxyphenol 19 19 4-allyl-2,6-dimethoxyphenol4-allyl-2,6-dimethoxyphenol

20 5-indanol 20 Molecules 2017, 225-indanol, x FOR PEER REVIEW 7 of 19 20 Molecules 2017, 225-indanol, x FOR PEER REVIEW 7 of 19 20 Molecules 2017, 225-indanol, x FOR PEER REVIEW 7 of 19 20 5-indanol 20 20 5-indanol5-indanol The rate of conversion of these compoundsTable by 3 . Cont His-VAO. and EUGO-His at a substrate The rate of conversion of these compoundsTable by 3. Cont His-VAO. and EUGO-His at a substrate The rate of conversion of these compoundsTable by 3 . Cont His-VAO. and EUGO-His at a substrate concentrationThe rate of of 2 conversionmM was determined of these compoundsby allowing the by enzymes His-VAO to and react EUGO-His with the substrate at a substrate for ten concentrationThe rate of of 2 conversionmM was determined of these compoundsby allowing the by enzymes His-VAO to and react EUGO-His with the substrate at a substrate for ten concentrationThe21 rate of of 2 conversionmM21 5,6,7,8-tetrahydro-2-naphtholwas determined of5,6,7,8-tetrahydro-2-naphthol these compoundsby allowing the by enzymes His-VAO to and react EUGO-His with the substrate at a substrate for ten concentrationmin and measuring of 2 mM21 the wasamount determined5,6,7,8-tetrahydro-2-naphthol of hydrogen by allowing peroxide the formed enzymes using to thereact xylenol with the orange substrate assay. for Rates ten concentrationmin and measuring of 2 mM21 the wasamount determined5,6,7,8-tetrahydro-2-naphthol of hydrogen by allowing peroxide the formed enzymes using to thereact xylenol with the orange substrate assay. for Rates ten minof the and reactions measuring of His-VAO the amount and of EUGO-His hydrogen withperoxide the tested formed substrates, using the calculatedxylenol orange by assuming assay. Rates that minof the and reactions measuring of His-VAO the amount and of EUGO-His hydrogen withperoxide the tested formed substrates, using the calculated xylenol orange by assuming assay. Rates that minof the and reactions measuring of His-VAO the amount and of EUGO-His hydrogen withperoxide the tested formed substrates, using the calculated xylenol orange by assuming assay. Rates that ofthe the formation reactions of of hydrogen His-VAO peroxide and EUGO-His in time is with linear the during tested thesubstrates, reaction calculatedperiod, are by shown assuming in Figure that ofthe the formation reactions22 of of hydrogen His-VAO22 peroxide4-cyclopentylphenol and EUGO-His4-cyclopentylphenol in time is with linear the during tested thesubstrates, reaction calculatedperiod, are by shown assuming in Figure that the2. For formation substrates of hydrogen where22 a peroxidekcat value4-cyclopentylphenol in has time been is linear determined during forthe reaction the non-His-tagged period, are shown enzymes in Figure under the2. For formation substrates of hydrogen where22 a peroxidekcat value4-cyclopentylphenol inhas time been is linear determined during forthe thereaction non-His-tagged period, are shown enzymes in Figure under the2. For formation substrates of hydrogen where a peroxidekcat value inhas time been is linear determined during forthe thereaction non-His-tagged period, are shown enzymes in Figure under 2.similar For substratesexperimental where conditions, a kcat value this valuehas been is shown determined for comparison. for the non-His-tagged enzymes under 2.similar For substratesexperimental where conditions, a kcat value this valuehas been is shown determined for comparison. for the non-His-tagged enzymes under 2.similar For substratesexperimental where conditions, a kcat value this valuehas been is shown determined for comparison. for the non-His-tagged enzymes under similarThe experimental reaction rates conditions, measured this using value the is xylenolshown fororange comparison. assay are generally in good agreement similarThe experimental reaction rates conditions, measured this using value the is xylenol shown fororange comparison. assay are generally in good agreement similarThe experimental reaction rates23 conditions, measured this 4-cyclohexylphenolusing value the is xylenol shown fororange comparison. assay are generally in good agreement with Thepreviously23 reaction obtained rates23 measured data4-cyclohexylphenol regarding 4-cyclohexylphenolusing the substratexylenol orange specificity assay of areVAO generally and EUGO. in good For compounds agreement with Thepreviously reaction obtained rates23 measured data regarding 4-cyclohexylphenolusing the substratexylenol orange specificity assay of areVAO generally and EUGO. in good For compounds agreement withfor which previously the k catobtained had previously data regarding been determined the substrate and specificity found toof VAOlie above and EUGO.the detection For compounds limit, the withfor which previously the kcat obtained had previously data regarding been determined the substrate and specificity found toof VAOlie above and EUGO.the detection For compounds limit, the withfor which previously the kcat obtained had previously data regarding been determined the substrate and specificity found toof VAOlie above and EUGO.the detection For compounds limit, the forreaction which rates the measuredkcat had previously with the xylenolbeen determined orange assay and typically found to lie lie close above to thethe k detectioncat values. limit,This is the to forreaction which rates the measuredkcat had previously with the xylenolbeen determined orange assay and typically found to lie lie close above to thethe k detectioncat values. limit,This is the to forreaction which rates the measuredkcat had previously with the xylenolbeen determined orange assay and typically found to lie lie close above to thethe k detectioncat values. limit,This is the to forreaction which rates the measuredk had previously with4-(aminomethyl)-2-methoxyphenol the xylenolbeen determined orange assay and typically found to lie lie close above to thethe k detectioncat values. limit,This is the to reactionbe expected, rates as measured the24 substrate with4-(aminomethyl)-2-methoxyphenol concentrationthe xylenol orange used assayfor the typically xylenol lieorange close assay to the (2 k catmM) values. is at This least is ten to reactionbe expected, rates as measured the substrate4-(aminomethyl)-2-methoxyphenol with4-(aminomethyl)-2-methoxyphenol concentrationthe xylenol(vanillyl orange amine) used assayfor the typically xylenol lieorange close assay to the (2 k catmM) values. is at This least is ten to reactionbe expected,24 rates as measured the2424 substrate with concentrationthe xylenol(vanillyl orangeamine) used assayfor the typically xylenol lieorange close assay to the (2 k catmM) values. is at This least is ten to betimes expected, the K mas for the allsubstrate these compoundsconcentration(vanillyl(vanillyl amine) andamine) used as for such the thexylenol measurements orange assay were (2 mM) performed is at least under ten betimes expected, the K mas for the allsubstrate these compoundsconcentration(vanillyl amine) and used as for such the thexylenol measurements orange assay were (2 mM) performed is at least under ten betimes expected, the K mas for the allsubstrate these compoundsconcentration and used as for such the thexylenol measurements orange assay were (2 mM) performed is at least under ten timessaturating the substrateKm for all concentrations. these compounds The only and cases as such where the no measurements activity was observed were performed with the xylenol under timessaturating the substrateKm for all concentrations. these compounds The only and cases as such where the no measurements activity was observed were performed with the xylenol under timessaturating the substrateKm for allThe concentrations. these rate of compounds conversion The of only andthese cases ascompounds such where the noby measurements His-VAOactivity wasand EUGO-Hisobserved were performed atwith a substrate the xylenol under timessaturating the substrateK for allThe concentrations. theserate of compounds conversion The of only andthese cases ascompounds such where the byno measurements His-VAOactivity wasand EUGO-Hisobserved were performed atwith a substrate the xylenol under saturatingorange assay substrate despiteconcentrationThe concentrations. the rate kcatcat of oflyinglying 2 conversionmM aboveabove was The determined ofthetheonly these detectiondetection cases compoundsby allowing where limitlimit thenoby werewere enzymesactivityHis-VAO thethe oxidationoxidationto wasand react observedEUGO-His with ofof the 4-4- substraten withat-butylphenol a substrate the for xylenolten (6) saturatingorange assay substrate despiteconcentration concentrations. the kcat of lying 2 mM above was The determined theonly detection cases by allowing where limit theno were enzymesactivity the oxidationto was react observed with of the 4- substraten with-butylphenol the for xylenolten (6) saturatingorange assay substrate despiteconcentration concentrations. the kcat of lying 2 mM above was The determined theonly detection cases by allowing where limit theno were enzymesactivity the oxidationto was react observed with of the 4- substraten with-butylphenol the for xylenolten (6) orangeby His-VAO assay anddespiteminconcentration 5-indanol and the measuring kcat of (lying20 2 mM) theby above was amountEUGO-His. determined the of hydrogendetection The by allowing peroxidekcatcat limit for the the wereformed enzymes oxidation the using oxidation to thereact of xylenol with4-n of-butylphenol the orange 4- substraten-butylphenol assay. for Rates by ten VAO (6) orangeby His-VAO assay anddespitemin 5-indanol and the measuring kcat (lying20) theby above amountEUGO-His. the of hydrogendetection The kperoxidecat limit for the wereformed oxidation the using oxidation the of xylenol 4-n of-butylphenol orange 4-n-butylphenol assay. Rates by VAO (6) orangebyThe His-VAO rate assay of anddespite conversionmin 5-indanol and the measuring kcat ( oflying20) these theby above amount EUGO-His. compounds the of hydrogen detection The peroxidek bycat limit for His-VAO thewereformed oxidation the using andoxidation the of EUGO-Hisxylenol 4-n of-butylphenol orange 4-n-butylphenol assay. at a Rates by substrate VAO (6) by His-VAO−1 andofmin 5-indanolthe and reactions measuring ( 20of His-VAO) theby amountEUGO-His. and of EUGO-His hydrogen The withkperoxidecat for the thetested formed oxidation substrates, using the −1 ofcalculated xylenol 4-n-butylphenol orange by assuming assay. Rates bythat VAO by(1.2 His-VAO s−1) is only and slightlyof 5-indanolthe reactions higher ( 20of than )His-VAO by theEUGO-His. anddetection EUGO-His The limit withkcat of for the the thetested assay oxidation substrates, (0.83 s −1of calculated) 4-andn-butylphenol therefore by assuming it is by that not VAO too by(1.2 His-VAO s−1) is only and slightlyof 5-indanolthe reactions higher ( 20of than His-VAO) by theEUGO-His. anddetection EUGO-His The limit withkcat of forthe the thetested assay oxidation substrates, (0.83 s of−1calculated) and4-n-butylphenol therefore by assuming it is bythat not VAO too concentrationby(1.2 His-VAO s−1) is only of and 2 slightlytheof mM 5-indanolthe formation reactions was higher determined of( 20of hydrogen than )His-VAO by theEUGO-His. peroxide detectionand by EUGO-His allowing in timeThe limit is withk linearcat of the for the the during enzymesthetested assay oxidation thesubstrates, (0.83reaction to s react−1of calculatedperiod,) and4-n with-butylphenol thereforeare by shown theassuming substratein it Figure is by that not VAO too for (1.2 s−1) is only slightlythe formation higher of hydrogen than the peroxide detection in time limit is linear of the during assay the (0.83reaction s−1 period,) and thereforeare shown in it Figure is not too (1.2surprising s−1) is only that slightly nothe formationactivity higher ofwas hydrogen than detected the peroxide detection for itsin time oxidation limit is linear of the duringusing assay thethe (0.83reaction xylenol s−1 period,) and orange aretherefore shown assay. in it FigureHowever, is not too (1.2surprising s−1) is only that slightly no2.the For formationactivity substrates higher wasof hydrogen thanwhere detected the a peroxidek catdetection valuefor its inhas timeoxidation limitbeen is linear determinedof the duringusing assay forthethe (0.83 thereaction xylenol non-His-tagged s−1 period,) and orange thereforeare shown enzymesassay. in it However,Figure underis not too ten min(1.2surprising s and) is measuringonly that slightly no2. For activity substrates the higher amount was thanwhere detected ofthea k hydrogen catdetection valuefor its has oxidation limitbeen peroxide determinedof the using formedassay forthe (0.83the xylenol using non-His-tagged s ) and the orange xylenoltherefore enzymesassay. orange it However, underis not assay. too surprisingthe kcat for thatthe oxidationno2. For activity substrates of was 5-indanol where detected a kcat by valuefor EUGO its has oxidation been (2.4 determined s−1 ) usinglies wellfor the the xylenolabove non-His-tagged the orange detection enzymes assay. limit However,under of the surprisingthe kcat for thatthe oxidationnosimilar2. For activity substratesexperimental of was 5-indanol where detected conditions, a k catby valuefor EUGOthis its has value oxidation been (2.4 is shown determineds−1) usinglies for comparison.well forthe the abovexylenol non-His-tagged The the orangereaction detection enzymesratesassay. measured limit However,under of the surprisingthe kcat for thatthe oxidationnosimilar activity experimental of was 5-indanol detected conditions, by for thisEUGO its value oxidation (2.4 is shown s−1) using liesfor comparison.well the abovexylenol The the orangereaction detection ratesassay. measured limit However, of the thexylenol kcat fororange the oxidationassay.usingsimilar the Toexperimental xylenol investigateof 5-indanol orange conditions, this assay by discrepancy EUGOarethis generallyvalue (2.4 is shown further, ins−1 good) lies for agreementthe comparison.well rate above of with oxidation The thepreviously reaction detection of rates obtained2 mM measured limit 5-indanol data of the thexylenol kcat fororange the oxidationassay.using the To xylenol investigateof 5-indanol orange this assay by discrepancy EUGOare generally (2.4 further, ins−1 good) lies agreementthe well rate above of with oxidation thepreviously detection of obtained2 mM limit 5-indanol data of the thexylenol kcat fororange the oxidationassay.usingusing thethe To xylenolxylenol investigateof 5-indanol orangeorange this assayassay by discrepancy areEUGOare generallygenerally (2.4 further, inins −1 goodgood) lies agreementagreementthe well rate above of withwith oxidation thepreviouslypreviously detection of obtainedobtained2 mM limit 5-indanol datadata of the xylenolby EUGO-His orange wasassay.regarding determined To theinvestigate substrate by monitoring specificitythis discrepancy of theVAO consumption and further, EUGO. the For rateof compounds oxygen of oxidation during for which of the 2 mMthe reaction. k cat5-indanol had The xylenolby EUGO-His orange wasassay.regarding determined To theinvestigate substrate by monitoring specificitythis discrepancy of theVAO consumption and further, EUGO. the For rateof compounds oxygen of oxidation during for which of the 2 themM reaction. k cat5-indanol had The xylenolby EUGO-His orange wasassay. determined To investigate by monitoring this discrepancy the consumption further, the rateof oxygen of oxidation during of the 2 mM reaction. cat5-indanol The xylenolby EUGO-His orange wasassay.previouslyregarding determined To theinvestigatebeen substrate determined by monitoring specificitythis and discrepancy found of the VAOto lie consumption above andfurther, EUGO. the detectionthe For rateof compounds oxygen limit, of oxidation the during reactionfor which of therates 2 mMthe reaction. measured k 5-indanol had The by EUGO-His waspreviously determined been determined by monitoring and found the to lie consumption above the detection of oxygen limit, the during reaction ratesthe reaction.measured The by EUGO-His waswithpreviously determined the xylenol been determined orange by monitoring assa andy typically found the to lie lie consumption close above to the the detection kcat ofvalues. oxygen limit, This the isduring reaction to be expected, therates reaction. measured as the The by EUGO-His waswith determined the xylenol orange by monitoring assay typically the lie consumption close to the kcat ofvalues. oxygen This isduring to be expected, the reaction. as the The with the xylenol orange assay typically lie close to the kcat values. This is to be expected, as the with the xylenol orange assay typically lie close to the kcat values. This is to be expected, as the substrate concentration used for the xylenol orange assay (2 mM) is at least ten times the Km for all substrate concentration used for the xylenol orange assay (2 mM) is at least ten times the Km for all thesesubstrate compounds concentration and usedas such for thethe xylenolmeasurements orange assay were (2 performed mM) is at leastunder ten saturating times the Ksubstratem for all these compounds and as such the measurements were performed under saturating substrate concentrations.these compounds The andonly ascases such where the nomeasurements activity was observedwere performed with the xylenolunder orangesaturating assay substrate despite concentrations. The only cases where no activity was observed with the xylenol orange assay despite concentrations.cat The only cases where no activity was observed with the xylenol orange assay despite the kcat lying above the detection limit were the oxidation of 4-n-butylphenol (6) by His-VAO and 5- the kcat lying above the detection limit were the oxidation of 4-n-butylphenol (6) by His-VAO and 5- indanolthe kcat lying (20) aboveby EUGO-His. the detection The limkcat itfor were the the oxidation oxidation of of4- n4--butylphenoln-butylphenol by ( 6VAO) by His-VAO (1.2 s−1) is and only 5- indanol (20) by EUGO-His. The kcat for the oxidation of 4-n-butylphenol by VAO (1.2 s−1 ) is only indanol (20) by EUGO-His. The kcat for the oxidation of 4-n-butylphenol by VAO (1.2 s −1) is only slightlyindanol higher(20) by than EUGO-His. the detection The limitkcat for of thethe assayoxidation (0.83 of s− 14-) andn-butylphenol therefore it byis not VAO too (1.2surprising s ) is onlythat slightly higher than the detection limit of the assay (0.83 s−1 ) and therefore it is not too surprising that slightlyslightly higherhigher thanthan thethe detectiondetection limitlimit ofof thethe assayassay (0.83(0.83 ss−1)) andand thereforetherefore itit isis notnot tootoo surprisingsurprising thatthat no activity was detected for its oxidation using the xylenol orange assay. However, the kcat for the no activity was detected for its oxidation using the xylenol orange assay. However, the kcat for the oxidationno activity of was 5-indanol detected by for EUGO its oxidation (2.4 s−1) usinglies well the above xylenol the orange detection assay. limit However, of the xylenol the kcat orangefor the oxidation of 5-indanol by EUGO (2.4 s−1 ) lies well above the detection limit of the xylenol orange oxidation of 5-indanol by EUGO (2.4 s −1) lies well above the detection limit of the xylenol orange assay.oxidation To investigateof 5-indanol this by discrepancy EUGO (2.4 further,s ) lies thewell rate above of oxidation the detection of 2 mM limit 5-indanol of the xylenol by EUGO-His orange assay. To investigate this discrepancy further, the rate of oxidation of 2 mM 5-indanol by EUGO-His wasassay. determined To investigate by monitoring this discrepancy the consumption further, the ofrate oxygen of oxidation during of the 2 mMreaction. 5-indanol The rate by EUGO-His of oxygen was determined by monitoring the consumption of oxygen during the reaction. The rate of oxygen consumptionwas determined was by found monitoring to be 0.064 the consumption s−1, significantly of oxygen lower thanduring the the detection reaction. limit The forrate the of xylenoloxygen consumption was found to be 0.064 s−1 , significantly lower than the detection limit for the xylenol consumption was found to be 0.064 s −1, significantly lower than the detection limit for the xylenol orangeconsumption assay. Thiswas foundis in reasonab to be 0.064le agreement s , significantly with the lower rate of than oxidation the detection of 2 mM limit 5-indanol for the by xylenol EUGO orange assay. This is in reasonable agreement with the rate of oxidation of 2 mM 5-indanol by EUGO determinedorange assay. by This Nguyen is in reasonab et al. (0.18le agreements−1; the higher with activity the rate may of oxidation be attributable of 2 mM to 5-indanolthe addition by ofEUGO 10% determined by Nguyen et al. (0.18 s−1 ; the higher activity may be attributable to the addition of 10% determined by Nguyen et al. (0.18 s −1; the higher activity may be attributable to the addition of 10% DMSOdetermined as a co-solvent).by Nguyen Therefore,et al. (0.18 sat ;a the substrate higher concentrationactivity may be of attributable2 mM, the rate to the of conversionaddition of of10% 5- DMSO as a co-solvent). Therefore, at a substrate concentration of 2 mM, the rate of conversion of 5- indanolDMSO as by a EUGO-His co-solvent). is Therefore, significantly at alower substrate than concentrationthe detection limitof 2 mM,of the the xylenol rate of orange conversion assay. of For 5- indanolindanol byby EUGO-HisEUGO-His isis significantlysignificantly lowerlower thanthan ththee detectiondetection limitlimit ofof thethe xylenolxylenol orangeorange assay.assay. ForFor all substrates where the previously determined kcat value is lower than the detection limit, no activity all substrates where the previously determined kcat value is lower than the detection limit, no activity wasall substrates observed where using the previouslyxylenol orange determined assay. kcat value is lower than the detection limit, no activity was observed using the xylenol orange assay.

Molecules 2018, 23, 164 7 of 18

Rates of the reactions of His-VAO and EUGO-His with the tested substrates, calculated by assuming that the formation of hydrogen peroxide in time is linear during the reaction period, are shown in Figure2. For substrates where a kcat value has been determined for the non-His-tagged enzymes under similar experimental conditions, this value is shown for comparison. The reaction rates measured using the xylenol orange assay are generally in good agreement with previously obtained data regarding the substrate specificity of VAO and EUGO. For compounds for which the kcat had previously been determined and found to lie above the detection limit, the reaction rates measured with the xylenol orange assay typically lie close to the kcat values. This is to be expected, as the substrate concentration used for the xylenol orange assay (2 mM) is at least ten times the Km for all these compounds and as such the measurements were performed under saturating substrate concentrations. The only cases where no activity was observed with the xylenol orange assay despite the kcat lying above the detection limit were the oxidation of 4-n-butylphenol (6) by His-VAO −1 and 5-indanol (20) by EUGO-His. The kcat for the oxidation of 4-n-butylphenol by VAO (1.2 s ) is only slightly higher than the detection limit of the assay (0.83 s−1) and therefore it is not too surprising Moleculesthat no 2017 activity, 22, x FOR was PEER detected REVIEW for its oxidation using the xylenol orange assay. However, the kcat for 7 of 18 the oxidation of 5-indanol by EUGO (2.4 s−1) lies well above the detection limit of the xylenol orange rateassay. of oxygen To investigate consumption this discrepancy was found further, to be 0.064 the rate s−1 of, significantly oxidation of lower 2 mM 5-indanolthan the detection by EUGO-His limit for thewas xylenol determined orange by assay. monitoring This is in the reasonable consumption agreement of oxygen with during the rate the reaction.of oxidation The of rate 2 mM of oxygen 5-indanol byconsumption EUGO determined was found by Nguyen to be 0.064 et al. s− 1(0.18, significantly s−1; the higher lower activity than the may detection be attributable limit for theto the xylenol addition oforange 10% DMSO assay. as This a co-solvent). is in reasonable Therefore, agreement at a withsubstrate the rate concentration of oxidation of 22 mMmM, 5-indanol the rate of by conversion EUGO ofdetermined 5-indanol by by EUGO-His Nguyen et al.is significantly (0.18 s−1; the lower higher than activity the maydetection be attributable limit of the to thexylenol addition orange of 10% assay. ForDMSO all substrates as a co-solvent). where the Therefore, previously at a substratedetermined concentration kcat value ofis lower 2 mM, than the rate the ofdetection conversion limit, of no activity5-indanol was by observed EUGO-His using is significantlythe xylenol orange lower than assay. the detection limit of the xylenol orange assay. For all substrates where the previously determined kcat value is lower than the detection limit, no activity was observed using the xylenol orange assay.

Figure 2. Rate of the reactions of His-tagged vanillyl alcohol oxidase (His-VAO) and His-tagged Figure 2. Rate of the reactions of His-tagged vanillyl alcohol oxidase (His-VAO) and His-tagged eugenol oxidase (EUGO-His) with the compounds used in the substrate specificity screening in 50 mM eugenol oxidase (EUGO-His) with the compounds used in the substrate specificity screening in 50 potassium phosphate buffer, pH 7.5, at room temperature (19–20 ◦C) as determined using the xylenol mM potassium phosphate buffer, pH 7.5, at room temperature (19–20 °C) as determined using the orange assay. Solid bars give the reaction rates measured with the xylenol orange assay for His-VAO xylenol orange assay. Solid bars give the reaction rates measured with the xylenol orange assay for (green) and EUGO-His (blue). Error bars represent the standard deviation of duplicate measurements. His-VAO (green) and EUGO-His (blue). Error bars represent the standard deviation of duplicate Striped bars give kcat values measured previously by other methods with the non-His-tagged enzymes. cat measurements.These kcat values Striped were measuredbars give k under values identical measured experimental previously conditions, by other with methods the exception with theof non-His- the taggedtemperature, enzymes. which These was k 25cat values◦C instead were of measured 19–20 ◦C.The under striped identical horizontal experimental line indicates conditions, the detection with the −1 exceptionlimit of the of xylenol the temperature, orange assay, which which correspondswas 25 °C insteadto a reaction of 19–20 rate of °C. 0.83 The s .striped The kcat values horizontal were line indicatesfrom the the following detection sources. limit VAO:of the compounds xylenol orange1, 4 [33 assay,], 5–8 ,which20, 21 [corresponds11], 2, 24 [14], to3 ,a14 reaction, 18 [13], rate17 [ 34of]. 0.83 s−1EUGO:. The kcat20 ,values24 [4], 19were[9], from14, 18 the[13 following]. Numbering sources. is according VAO: tocompounds Table3. 1, 4 [33], 5–8, 20, 21 [11], 2, 24 [14], 3, 14, 18 [13], 17 [34]. EUGO: 20, 24 [4], 19 [9], 14, 18 [13]. Numbering is according to Table 3.

Interestingly, our substrate specificity screening revealed that a number of compounds not previously described as substrates of VAO or EUGO are converted by the enzymes. Chavicol (17), which had previously been shown to be a substrate for VAO, was also converted by EUGO-His, though at a lower rate than by His-VAO. More surprisingly, both His-VAO and EUGO-His were active with 4-cyclopentylphenol (22), which had not previously been shown to be a substrate for either enzyme. Particularly with His-VAO, 4-cyclopentylphenol was quite efficiently converted, with the observed rate of 3.9 s−1 being higher than that observed for all other substrates except eugenol and chavicol. The ability of His-VAO and EUGO-His to convert 4-cyclopentylphenol was confirmed by allowing 1 μM His-VAO or EUGO-His to react with 2 mM 4-cyclopentylphenol at 25 °C and analysing the reaction products by GC and GC/MS (Figures S3 and S4). With both enzymes, the substrate was almost completely converted after two h (> 99% conversion). The reaction yielded a single product, which was identified as 4-(1-cyclopenten-1-yl)phenol by GC/MS and 1H-NMR (25, Scheme 2, Figures S4 and S5). The rate of oxidation of 2 mM 4-cyclopentylphenol by His-VAO and EUGO-His was also determined by monitoring oxygen consumption during the reaction. This yielded rates of 3.7 s−1 for His-VAO and 1.7 s−1 for EUGO-His, in good agreement with the rates determined using the xylenol orange assay (3.9 s−1 and 1.3 s−1 for His-VAO and EUGO-His, respectively).

Molecules 2018, 23, 164 8 of 18

Interestingly, our substrate specificity screening revealed that a number of compounds not previously described as substrates of VAO or EUGO are converted by the enzymes. Chavicol (17), which had previously been shown to be a substrate for VAO, was also converted by EUGO-His, though at a lower rate than by His-VAO. More surprisingly, both His-VAO and EUGO-His were active with 4-cyclopentylphenol (22), which had not previously been shown to be a substrate for either enzyme. Particularly with His-VAO, 4-cyclopentylphenol was quite efficiently converted, with the observed rate of 3.9 s−1 being higher than that observed for all other substrates except eugenol and chavicol. The ability of His-VAO and EUGO-His to convert 4-cyclopentylphenol was confirmed by allowing 1 µM His-VAO or EUGO-His to react with 2 mM 4-cyclopentylphenol at 25 ◦C and analysing the reaction products by GC and GC/MS (Figures S3 and S4). With both enzymes, the substrate was almost completely converted after two h (>99% conversion). The reaction yielded a single product, which was identified as 4-(1-cyclopenten-1-yl)phenol by GC/MS and 1H-NMR (25, Scheme2, Figures S4 and S5). The rate of oxidation of 2 mM 4-cyclopentylphenol by His-VAO and EUGO-His was also determined by monitoring oxygen consumption during the reaction. This yielded rates of 3.7 s−1 for His-VAO and 1.7 s−1 for EUGO-His, in good agreement with the rates determined using the xylenol orange assay (3.9Molecules s−1 and 2017 1.3, 22 s,− x1 FORfor PEER His-VAO REVIEW and EUGO-His, respectively). 8 of 18

SchemeScheme 2. Oxidation2. Oxidation of of 4-cyclopentylphenol 4-cyclopentylphenol ((2222)) toto 4-(1-cyclopenten-1-yl)phenol (25 (25) by) by His-tagged His-tagged vanillylvanillyl alcohol alcohol oxidase oxidase (His-VAO) (His-VAO) or His-taggedor His-tagged eugenol eugenol oxidase oxidase (EUGO-His), (EUGO-His), as as catalysed catalysed in in 50 50 mM potassiummM potassium phosphate phosphate buffer, buffer, pH 7.5, pH at 7.5, 25 ◦atC. 25 °C.

TakenTaken together, together, these these results results demonstrate demonstrate that that thethe xylenol orange orange assay assay can can be be used used to toaccurately accurately measure the activity of His-VAO and EUGO-His towards a range of substrates and to identify measure the activity of His-VAO and EUGO-His towards a range of substrates and to identify hitherto hitherto unknown substrates of the enzymes. Therefore, it is a suitable assay for use in screening the unknown substrates of the enzymes. Therefore, it is a suitable assay for use in screening the substrate substrate specificity of His-VAO and EUGO-His variants. Having established this, we set out to use specificity of His-VAO and EUGO-His variants. Having established this, we set out to use the assay to the assay to screen a small library of His-VAO and EUGO-His variants for changes in their substrate screen a small library of His-VAO and EUGO-His variants for changes in their substrate specificity. specificity. 2.3. Analysis of the Substrate-Binding Pockets of VAOand EUGO 2.3. Analysis of the Substrate-Binding Pockets of VAO and EUGO ToTo design design the the variants, variants, we we examined examined the the active active sites sites of theof the proteins proteins to identifyto identify residues residues that that differ betweendiffer thembetween and them therefore and therefore may be responsible may be responsible for the observed for the observed differences differences in substrate in substrate specificity. Bothspecificity. enzymes Both contain enzymes a solvent-inaccessible contain a solvent-inaccessible substrate-binding substrate-binding pocket on the pocketsi-side on of the the si-side FAD of cofactor. the ThisFAD pocket cofactor. is lined This by pocket 19 residues is lined of by which 19 residues 12 are identicalof which in12 both are identical enzymes in (Figure both enzymes3). The conserved(Figure residues3). The include conserved all residues those known include to all be those directly known involved to be directly in catalysis, involved including in catalysis, Arg-504 including (numbering Arg- of amino504 (numbering acids is as of in amino non-His-tagged acids is as VAO), in non-His-tagged which is thought VAO), to which stabilise is thought the negative to stabilise charge the that developsnegative at charge the N1–C2=O2 that develops locus at of the FAD N1–C2=O2 upon its locus reduction, of FAD Tyr-108 upon its and reduction, Tyr-503, Tyr-108 which stabiliseand Tyr- the deprotonated503, which formstabilise of phenolicthe deprotonated substrates form in theof phenolic active site, substrates Asp-170, in whichthe active promotes site, Asp-170, flavin reductionwhich by stabilisingpromotes flavin the reduced reduction FAD by cofactorstabilising through the reduced hydrogen FAD bondingcofactor through with the hydrogen protonated bonding N5 atom, with and His-422,the protonated to which N5 the atom, FAD cofactorand His-422, is covalently to which boundthe FAD [8 cofactor,34,35]. Theis covalently seven differing bound [8,34,35]. residues formThe a clusterseven on differing the side ofresidues the substrate form a oppositecluster on the the flavin side cofactor. of the substrate Interestingly, opposite the the competitive flavin cofactor. inhibitor isoeugenolInterestingly, binds the in competitive a different orientation inhibitor isoeugenol in each enzyme. binds in Ina different EUGO, itorientation is flipped in 180 each◦ as enzyme. compared In to EUGO, it is flipped 180° as compared to in VAO. This is likely due to the presence of Gly-392 in in VAO. This is likely due to the presence of Gly-392 in EUGO instead of the bulky Phe-424 found at EUGO instead of the bulky Phe-424 found at this position in VAO. Based on these observations, we this position in VAO. Based on these observations, we hypothesised that differences in the cluster of hypothesised that differences in the cluster of differing residues may be responsible for the observed differing residues may be responsible for the observed differences in substrate specificity between VAO differences in substrate specificity between VAO and EUGO. To investigate this, we made seven His- andVAO EUGO. and Toseven investigate EUGO-His this, variants, we made exchanging seven His-VAO each of the and differing seven residues EUGO-His for the variants, amino exchangingacid that eachis of found thediffering at this position residues in for the the other amino enzyme acid that and is set found out at to this study position their activityin the other and enzyme substrate and specificity using the xylenol orange assay (for a list of the residues and variants see Table 4, numbering as in the sequences of non-His-tagged VAO and EUGO).

Molecules 2017, 22, x FOR PEER REVIEW 8 of 18

Scheme 2. Oxidation of 4-cyclopentylphenol (22) to 4-(1-cyclopenten-1-yl)phenol (25) by His-tagged vanillyl alcohol oxidase (His-VAO) or His-tagged eugenol oxidase (EUGO-His), as catalysed in 50 mM potassium phosphate buffer, pH 7.5, at 25 °C.

Taken together, these results demonstrate that the xylenol orange assay can be used to accurately measure the activity of His-VAO and EUGO-His towards a range of substrates and to identify hitherto unknown substrates of the enzymes. Therefore, it is a suitable assay for use in screening the substrate specificity of His-VAO and EUGO-His variants. Having established this, we set out to use the assay to screen a small library of His-VAO and EUGO-His variants for changes in their substrate specificity.

2.3. Analysis of the Substrate-Binding Pockets of VAO and EUGO To design the variants, we examined the active sites of the proteins to identify residues that differ between them and therefore may be responsible for the observed differences in substrate specificity. Both enzymes contain a solvent-inaccessible substrate-binding pocket on the si-side of the FAD cofactor. This pocket is lined by 19 residues of which 12 are identical in both enzymes (Figure 3). The conserved residues include all those known to be directly involved in catalysis, including Arg- 504 (numbering of amino acids is as in non-His-tagged VAO), which is thought to stabilise the negative charge that develops at the N1–C2=O2 locus of FAD upon its reduction, Tyr-108 and Tyr- 503, which stabilise the deprotonated form of phenolic substrates in the active site, Asp-170, which promotes flavin reduction by stabilising the reduced FAD cofactor through hydrogen bonding with the protonated N5 atom, and His-422, to which the FAD cofactor is covalently bound [8,34,35]. The seven differing residues form a cluster on the side of the substrate opposite the flavin cofactor. Interestingly, the competitive inhibitor isoeugenol binds in a different orientation in each enzyme. In EUGO, it is flipped 180° as compared to in VAO. This is likely due to the presence of Gly-392 in EUGO instead of the bulky Phe-424 found at this position in VAO. Based on these observations, we hypothesised that differences in the cluster of differing residues may be responsible for the observed Moleculesdifferences2018, 23 in, 164 substrate specificity between VAO and EUGO. To investigate this, we made seven His-9 of 18 VAO and seven EUGO-His variants, exchanging each of the differing residues for the amino acid that is found at this position in the other enzyme and set out to study their activity and substrate setspecificity out to study using their the activity xylenol and orange substrate assay specificity (for a list using of the the residues xylenol andorange variants assay see(for Table a list of 4, the residuesnumbering and variantsas in the seesequences Table4 ,of numbering non-His-tagged as in theVAO sequences and EUGO). of non-His-tagged VAO and EUGO).

Figure 3. Structures of the substrate-binding pockets of vanillyl alcohol oxidase (VAO) and eugenol oxidase (EUGO) with the competitive inhibitor isoeugenol bound. Structures are shown in stick representation with residues that are identical in each protein shown in grey, residues that are different in each protein shown with green (VAO) or cyan (EUGO) carbon atoms, the FAD cofactor shown with yellow carbon atoms and isoeugenol shown with magenta carbon atoms. The VAO and EUGO structures were downloaded from the PDB website (PDB identifiers: 2VAO [8] and 5FXD [9] respectively). Figure was prepared using PyMOL v. 1.3 (Schrödinger LLC, New York, NY, USA).

Table 4. List of residues forming part of the substrate-binding pocket that are different in vanillyl alcohol oxidase (VAO) and eugenol oxidase (EUGO) and of the His-tagged vanillyl alcohol oxidase (His-VAO) and His-tagged eugenol oxidase (EUGO-His) variants that were made during this study. The residues are numbered according to their position in the non-His-tagged wild-type proteins.

Position Residue in His-VAO Residue in EUGO-His His-VAO Variant EUGO-His Variant 1 Leu-316 Met-282 L316M M282L 2 Trp-413 Leu-381 W413L L381W 3 Phe-424 Gly-392 F424G G392F 4 Thr-457 Gln-425 T457Q Q425T 5 Thr-459 Ile-427 T459I I427T 6 Ile-468 Val-436 I468V V436I 7 Cys-470 Leu-438 C470L L438C

2.4. Substrate Specificity Screening of His-VAOand EUGO-His Variants All fourteen variants were successfully expressed in E. coli and purified as described for the wild-type enzymes. A single variant, F424G His-VAO, did not contain any flavin after purification, as judged from the lack of a yellow colour and of the distinctive flavin absorption spectrum. Attempts to incorporate flavin into this variant by incubating it with FAD failed and it was not studied further. The other six His-VAO variants and all seven EUGO-His variants contained flavin as determined from their characteristic flavin absorption spectra (Figures S1 and S2). Upon precipitation of the proteins using trichloroacetic acid, a yellow pellet and colourless supernatant were obtained, demonstrating that the flavin cofactor is covalently bound to the protein. The absorption spectra of all seven EUGO-His variants had a similar shape to that of wild-type EUGO-His. A number of the His-VAO variants, most notably T457Q and C470L, displayed a somewhat altered flavin absorption spectrum, suggesting that in these variants the electronic environment of the flavin is slightly altered by the introduced mutations. The variants were screened for changes in their substrate specificity using the xylenol orange assay. The results of this screening assay are shown in Figure4. Molecules 2018, 23, 164 10 of 18 Molecules 2017, 22, x FOR PEER REVIEW 10 of 18

FigureFigure 4. Rates 4. Rates of the of the reactions reactions of His-taggedof His-tagged vanillyl vanillyl alcohol alcohol oxidase oxidase (His-VAO)(His-VAO) and His-tagged His-tagged eugenoleugenol oxidase oxidase (EUGO-His) (EUGO-His) variants variants with with the the compounds compounds used used in in thethe substratesubstrate specificity specificity screening screening in 50 mM potassium phosphate buffer, pH 7.5, at room temperature (19-20 °C) as determined using in 50 mM potassium phosphate buffer, pH 7.5, at room temperature (19-20 ◦C) as determined using the the xylenol orange assay. Error bars represent the standard deviations of duplicate measurements. xylenol orange assay. Error bars represent the standard deviations of duplicate measurements. For all For all compounds that are not included in the graphs, no variants gave a signal above the detection compounds that are not included in the graphs, no variants gave a signal above the detection limit limit of the assay. The F424G His-VAO variant was not studied, as it did not contain any flavin of the assay. The F424G His-VAO variant was not studied, as it did not contain any flavin cofactor. cofactor. For the L381W, G392F and I427T EUGO-His variants, no response higher than the detection For the L381W, G392F and I427T EUGO-His variants, no response higher than the detection limit was limit was measured for any compound. measured for any compound. For His-VAO, all six remaining variants displayed activity with at least some of the tested compounds.For His-VAO, Two all of sixthe remainingvariants, L316M variants and T459I, displayed displayed activity substrate with specificity at least some profiles of that the were tested compounds.similar to Two that ofof thethe variants,wild-type L316M enzyme. and The T459I, I468V displayed and C470L substrate variants specificitydisplayed similar profiles activity that were to similarthe to wild-type that of the enzyme wild-type with enzyme. the substrates The I468V vanillyl andC470L alcohol variants (14), chavicol displayed (17 similar) and eugenol activity to(18 the). wild-typeHowever, enzyme these with variants the substrates did not display vanillyl any alcohol activity (14 ), towards chavicol linear (17) and4-alkylphenols. eugenol (18 The). However, T457Q thesevariant variants was did the not only display variant any to activity have towardssignificantly linear increased 4-alkylphenols. activity withThe T457Q vanillyl variant alcohol was as the a onlysubstrate, variant to displaying have significantly a reaction increased rate that was activity approximately with vanillyl threefold alcohol higher as a substrate, than that of displaying the wild- a type enzyme. However, with all other substrates the T457Q variant displayed a decrease in activity. reaction rate that was approximately threefold higher than that of the wild-type enzyme. However, The only variant for which activity was detected with a compound for which no activity was detected with all other substrates the T457Q variant displayed a decrease in activity. The only variant for which for wild-type His-VAO was W413L. This variant displayed activity towards 4-cyclohexylphenol (23), activity was detected with a compound for which no activity was detected for wild-type His-VAO was a compound that so far had not been described as a substrate for VAO or EUGO. In addition to this W413L. This variant displayed activity towards 4-cyclohexylphenol (23), a compound that so far had novel reactivity, the W413L variant displayed activity towards 4-cyclopentylphenol (22), eugenol, not beenchavicol described and 4-isopropylphenol as a substrate for (5). VAO No activity or EUGO. was In detected addition with to thislinear novel 4-alkylphenols reactivity, or the vanillyl W413L variantalcohol. displayed activity towards 4-cyclopentylphenol (22), eugenol, chavicol and 4-isopropylphenol (5). No activityTo confirm was detectedthat W413L with His-VAO linear 4-alkylphenols oxidises 4-cyclohexylphenol, or vanillyl alcohol. 1 μM enzyme was incubated withTo confirm 2 mM 4-cyclohexylphenol that W413L His-VAO for oxidises4 h at 25 4-cyclohexylphenol,°C and the reaction products 1 µM enzyme were analysed was incubated by GC and with ◦ 2 mMGC/MS 4-cyclohexylphenol (Figures S6 and for S7). 4 This h at revealed 25 C and that the 4-cyclohexylphenol reaction products is were indeed analysed converted by GC by the and enzyme GC/MS (Figuresyielding S6 and a single S7). This product, revealed though that the 4-cyclohexylphenol degree of conversion is indeed was only converted 27%. GC/MS by the analysis enzyme revealed yielding a singlethat product, the product though displays the degree a molecular of conversion ion at wasm/z only 174.1, 27%. suggesting GC/MS that analysis it is revealed formed by that the the productdehydrogenation displays a molecular of the substrate. ion at Asm/z VAO174.1, typically suggesting dehydrogenates that it is formed the Cα-Cβ by thebond dehydrogenation of alkyl groups, of thethe substrate. product As of 4-cyclohexylphenolVAO typically dehydrogenates oxidation is presumably the Cα-Cβ bond 4-(1-cyclohexen-1-yl)phenol. of alkyl groups, the product Similar of 4-cyclohexylphenol oxidation is presumably 4-(1-cyclohexen-1-yl)phenol. Similar experiments were Molecules 2018, 23, 164 11 of 18 performed using wild-type His-VAO and EUGO-His to evaluate whether they are also capable of converting 4-cyclohexylphenol. This revealed that after a 4 h incubation period, wild-type His-VAO had converted 51% of the substrate yielding the same product as observed with W413L His-VAO. In contrast, no conversion of 4-cyclohexylphenol by wild-type EUGO-His was observed under these reaction conditions. The substrate specificity screening of the EUGO-His variants revealed that three of the seven variants, L381W, G392F and I427T, did not display measurable activity towards any of the tested compounds. One of the four remaining variants, M282L, displayed a substrate specificity profile that was similar to that of wild-type EUGO-His. Another variant, Q425T, displayed similar activity to the wild-type enzyme with vanillyl alcohol, but did not display measurable activity towards any other compounds. The L438C variant displayed lowered activity towards all substrates as compared to the wild-type enzyme. The V436I variant displayed lowered activity towards vanillyl alcohol and eugenol. However, this variant had significantly increased activity towards chavicol and 4-cyclopentylphenol and also displayed activity towards the dimethoxylated substrate 2,6-dimethoxy-4-allylphenol (19). This compound had previously been described to be a substrate for EUGO [9], but the kcat value for its oxidation (0.49 s−1) is lower than the detection limit of our assay, explaining the lack of activity detected for wild-type EUGO-His. No variants were identified that displayed activity towards compounds that had previously been identified as substrates for VAO, but not for EUGO, such as linear 4-alkylphenols. In summary, the majority of the studied variants displayed similar or significantly reduced activity towards all tested compounds when compared to the corresponding wild-type enzyme. Two variants were identified that had significantly (more than twofold) increased activity towards one or more substrates.

3. Discussion Here, we describe the development of a method for the efficient screening of variants of VAO and EUGO for alterations in their substrate specificities. The method is based on a facile benchtop purification of His-tagged versions of the enzymes, followed by a substrate specificity screening using a xylenol orange assay. After demonstrating that this method allows accurate determination of reaction rates of the wild-type enzymes with a range of substrates, we used it to screen a library of fourteen His-VAO or EUGO-His variants towards a set of twenty-four (potential) substrates. The use of the xylenol orange assay, a spectrophotometric detection method for the oxidase product hydrogen peroxide, allows the simultaneous measurement of activity towards a range of substrates in a high-throughput fashion. This compares favourably to previous methods for measuring the activity of VAO and EUGO. These either relied on measuring the absorption of the product of the reaction, making the detection method dependent on the substrate used and on prior knowledge of the identity of the product, or on measuring the consumption of oxygen, which is not practical for high-throughput screening purposes. Although generic methods for the high-throughput screening of oxidase activity have been developed in the past, they typically rely on peroxidase-coupled activity assays, where a peroxidase uses the formed hydrogen peroxide to catalyse the production of a coloured product [36]. This type of assay is not suitable for use with VAO or EUGO, as their phenolic substrates are typically also converted by peroxidases [32]. Although the number of substrates and variants used in our screen is relatively small, the xylenol orange assay is highly scalable, particularly when robotic pipetting systems are available. In our case, the limiting factor for the number of variants that can be screened is the protein purification method, which relies on the use of gravity-flow Ni-NTA columns. However, we did demonstrate that this single purification step allowed us to obtain sufficiently pure His-VAO and EUGO-His variants. High-throughput methods for the production and purification of His-tagged proteins using E. coli expression systems have been described [37]. Such a system could be used to achieve the purification of a large number of His-VAO or EUGO-His variants for use in the substrate specificity screening. Alternatively, cell free extracts of E. coli expressing the variants could be used for the assay. However, Molecules 2018, 23, 164 12 of 18 in our hands this gave poor results, most likely due to degradation of the formed hydrogen peroxide by catalase present in the E. coli extracts. The substrate specificity profiling of wild-type His-VAO and EUGO-His led to the identification of 4-cyclopentylphenol as a substrate of the enzymes. Its conversion yielded 4-(1-cyclopenten- 1-yl)phenol as the sole product. This is in agreement with the previous finding that while VAO can catalyse both the hydroxylation and the dehydrogenation of 4-alkylphenols, the dehydrogenation reaction is preferred when the alkyl side chain is relatively large [11]. Our results also revealed that His-VAO and the W413L His-VAO variant catalyse the dehydrogenation of 4-cyclohexylphenol, presumably to 4-(1-cyclohexen-1-yl)phenol. However, this reaction was not catalysed by EUGO-His. Although the substrate specificity profiling of fourteen His-VAO or EUGO-His variants did not lead us to a thorough understanding of the molecular determinants of the differing substrate specificities of the enzymes, it did give some interesting insights into the importance of certain non-catalytic active site residues for enzyme activity. One interesting finding was that the F424G His-VAO variant did not contain any FAD when purified from E. coli and attempts to incorporate FAD into the protein failed. Possibly, the extra flexibility conferred by the introduction of a glycine residue in this variant destabilises the structure of the active site, leading to impaired flavin binding. Three of the seven EUGO-His variants, L381W, G392F and I427T, did not display any activity in the substrate specificity profiling, despite containing covalently bound flavin. Presumably, the introduced mutations affect the structure of the active site in such a way that the substrate is no longer bound in an orientation that is productive for catalysis. The I468V and C470L His-VAO variants also displayed interesting changes in substrate specificity, maintaining similar reaction rates to the wild-type enzyme with vanillyl alcohol, chavicol and eugenol, but displaying no activity towards linear 4-alkylphenols. Ile-468 and Cys-470 are positioned close together at the top of the substrate-binding pocket (Figure3). Possibly, the identity of these two residues is important for maintaining VAO’s reactivity with linear 4-alkylphenols. As the ability to convert linear 4-alkylphenols is one of the main differences between VAO and EUGO in terms of substrate specificity, it would be interesting to investigate whether further mutagenesis at these positions could create a EUGO variant that is capable of catalysing this reaction. Only two variants that displayed significantly increased activity towards a compound for which activity was also detected with the wild-type enzymes were identified. T457Q His-VAO had a threefold increased reaction rate for the oxidation of vanillyl alcohol compared to wild-type His-VAO and I436V EUGO-His had three- and fourfold increased reaction rates for the oxidation of chavicol and 4-cyclopentylphenol respectively when compared to wild-type EUGO-His. It also displayed increased activity towards 4-allyl-2,6-dimethoxyphenol, though the magnitude of the increase could not be quantified as the reaction rate of wild-type EUGO-His with this compound is below the detection limit of the assay. In summary, we developed an efficient method for screening variants of VAO and EUGO for changes in their substrate specificity consisting of the benchtop purification of His-tagged versions of the enzymes followed by substrate specificity screening using a xylenol orange assay. This method was employed for the substrate specificity profiling of the wild-type enzymes and of fourteen enzyme variants, leading to the identification of 4-cyclopentylphenol as a new substrate for both wild-type enzymes and of 4-cyclohexylphenol as a new substrate for wild-type His-VAO. Two variants, T457Q His-VAO and V436I EUGO-His were found to display significant increases in activity towards certain substrates. This method has the potential to be used to screen larger variant libraries in future, facilitating efforts to design VAO and EUGO variants for biocatalytic applications. Molecules 2018, 23, 164 13 of 18

4. Materials and Methods

4.1. Materials 4-Hydroxy-3,5-dimethoxybenzyl alcohol was from Alfa Aesar (Haverhill, MA, USA). 4-n-Butylphenol and 4-n-nonylphenol were from Lancaster Synthesis (Haverhill, MA, USA). Ferrous sulphate heptahydrate was from Merck (Burlington, MA, USA). 4-Allylphenol (chavicol) was from Quest International (Naarden, The Netherlands). 4-Allylphenol-2,6-dimethoxyphenol, 4-allyl-2-methoxyphenol (eugenol), 4-(aminomethyl)-2-methoxyphenol hydrochloride (vanillyl amine), 4-sec-butylphenol, 4-cyclohexylphenol, 4-cyclopentylphenol, 4-ethylphenol, 4-n-hexylphenol, 2-hydroxy-benzyl alcohol, 3-hydroxybenzyl alcohol, 4-hydroxybenzyl alcohol, 4-hydroxy-2-methoxybenzyl alcohol, 4-hydroxy-3-methoxybenzyl alcohol (vanillyl alcohol), 5-indanol, 4-isopropylphenol, 2-methoxy-4-methylphenol (para-creosol), 4-methylphenol (para-cresol), 4-n-pentylphenol, 4-n-propylphenol, 5,6,7,8-tetrahydronaphthol and xylenol orange tetrasodium salt were from Sigma-Aldrich (St. Louis, MO, USA). All other chemicals were from commercial sources and of the purest grade available. The pJ404-His-VAO and pBAD-EUGO-His plasmids were a kind gift from Prof. Dr. Marco Fraaije (University of Groningen).

4.2. Site-Directed Mutagenesis Plasmids encoding for the His-VAO and EUGO-His variants were created by linear whole-plasmid amplification from the pJ404-His-VAO and pBAD-EUGO-His plasmids respectively. The pJ404-His-VAO plasmid contains a version of the vaoA gene from P. simplicissimum that is codon-optimised for expression in E. coli behind the IPTG-inducible T5 promoter. The gene is extended with a sequence that encodes an N-terminal 6x-His-tag followed by a single glycine residue. The pBAD-EUGO-His plasmid contains the eugo gene from Rhodococcus jostii RHA1 with an extension that encodes the polypeptide sequence GKLGPEQKLISEEDLNSAVDHHHHHH at the C-terminus of the protein. The extension contains both a C-terminal 6x-His tag and a Myc-tag (EQKLISEEDL). This construct is placed behind the L-arabinose inducible pBAD promoter. Constructs encoding variants of the enzymes were amplified from the corresponding plasmid using the mutagenic primers listed in Table5. Following the amplification reaction, remaining template DNA was digested with DpnI and the mutated plasmids were transformed into DH5α E. coli. Subsequently, plasmid DNA was isolated and the introduction of the correct mutations was confirmed by sequencing. The mutated plasmids were transformed into BL21 (for His-VAO) or TOP10 (for EUGO-His) E. coli for protein expression.

Table 5. List of primers used for site-directed mutagenesis in this study. Sites in italics indicate the position of the mutations introduced to achieve the amino acid substitution. Underlined sites indicate the position of mutations introduced to remove or introduce a restriction site to enable screening for the introduction of the correct mutations by restriction enzyme digestion (these are either the same mutations used for the amino acid substitution or silent mutations close to this site). The identity of the used restriction enzymes is given in the third column (+ indicates that a restriction site for this enzyme was introduced, − indicates that a restriction site for this enzyme was removed). His-VAO: His-tagged vanillyl alcohol oxidase, EUGO-His: His-tagged eugenol oxidase.

Variant Primer Restriction Site L316M His-VAO ATCCGCCATATTCTGATGGATGCTGCAGTGCTGGGTGACAAG +PstI W413L His-VAO TATGATGAACTGAAGCTTATTGATTGGTTGCCG +HindIII F424G His-VAO AATGGTGCCCACCTGGGTTTCAGCCCGATTGCGAAGGTGTCTGGT −PvuI T457Q His-VAO TGCCAGGAAGCAGGTCTAGACTTCATTGGTCAATTCACTGTTGGTATG +XbaI T459I His-VAO TTCATTGGTACGTTCATTGTTGGTATGCGTGAG None I468V His-VAO ATGCGTGAGATGCATCATGTTGTTTGCATCGTGTTT +NsiI C470L His-VAO ATGCGTGAGATGCATCATATTGTTTTAATCGTGTTTAACAAG +NsiI M282L EUGO-His CTGCGCAACATCTTCTTGGACGCGGCCGCGGTG None L381W EUGO-His CTGGACGAACTGCAGTGGCTGGACTGGGTGCCC +PstI G392F EUGO-His AACGGCGGGCACATCTTTTTCTCACCGGTGTCGGCGCCG +AgeI Q425T EUGO-His AAGGACTACGCCGCGACATTCATCATCGGGCTC None I427T EUGO-His TACGCCGCGCAATTCACGATCGGGCTCCGCGAG +PvuI V436I EUGO-His CGCGAGATGCACCACATATGCCTGTTCATCTAC +NdeI L438C EUGO-His CTCCGCGAGATGCATCACGTGTGCTGCTTCATCTACGACACG +NsiI Molecules 2018, 23, 164 14 of 18

4.3. Protein Expression and Purification For the expression of His-VAO and its variants, BL21 E. coli containing the correct plasmid was grown in 100 mL LB medium (Duchefa Biochemie, Haarlem, The Netherlands) containing 100 µg/mL ◦ ampicillin at 37 C until the OD600 was 0.6. Subsequently, protein expression was induced by adding IPTG to a final concentration of 0.8 mM and cells were grown overnight at 25 ◦C. Next, cells were harvested by centrifugation (4200× g, 15 min, 4 ◦C) and resuspended in 50 mM potassium phosphate TM buffer, pH 7.5, containing 500 mM NaCl, 5% glycerol (v/v), 0.5 mM MgSO4 and one cOmplete protease inhibitor pill (Roche, Basel, Switzerland) and 1 mg DnaseI (Roche) per 50 mL. Cells were lysed by sonication using 6 cycles of 30 s at maximum power with an MSE sonication probe. Samples were cooled on ice during sonication. Following this, cell debris was removed by centrifugation (39,000× g, 45 min, 4 ◦C) and the supernatant was loaded onto a gravity flow column containing 2 mL HisPur Ni-NTA resin (Thermo Scientific, Waltham, MA, USA) equilibrated in 50 mM potassium phosphate buffer, pH 7.5, containing 500 mM NaCl and 5% glycerol. The column was washed with this buffer until all unbound proteins had eluted as judged from the absorption of the flow-through at 280 nm. Subsequently, His-VAO was eluted using 50 mM potassium phosphate buffer, pH 7.5, containing 500 mM NaCl, 5% glycerol (v/v) and 200 mM imidazole. Fractions containing His-VAO were pooled and transferred to 50 mM potassium phosphate buffer, pH 7.5, containing 150 mM NaCl and 10% glycerol by passing them over an Econo-Pac 10DG desalting column (Bio-Rad, Hercules, CA, USA) equilibrated in this buffer. This procedure typically yielded 1–3 mg protein from 100 mL E. coli culture. After purification of F424G His-VAO, the protein did not contain any flavin cofactor. In an attempt to obtain flavin-containing protein, the purified F424G His-VAO variant was incubated with 1 mM FAD in 50 mM potassium phosphate buffer, pH 7.5, containing 75 mM NaCl and 5% glycerol at room temperature for 4 h. Subsequently, free FAD was removed by passing the mixture over an Econo-Pac 10DG desalting column (Bio-Rad) equilibrated in 50 mM potassium phosphate buffer, pH 7.5, containing 150 mM NaCl and 10% glycerol. Fractions containing the protein were collected and analysed for flavin content by measuring their absorption spectra. This revealed that the protein did not contain any FAD. No further attempts were made to incorporate FAD into the F424G His-VAO variant. For the expression of EUGO-His and its variants, TOP10 E. coli containing the correct plasmid was grown in 100 mL TB medium (Difco, Becton Dickinson, Franklin Lake, NJ, USA) containing ◦ 100 µg/mL ampicillin at 37 C until the OD600 was 0.6. Subsequently, protein expression was induced by adding L-arabinose to a final concentration of 0.02% (w/v) and cells were grown overnight at 30 ◦C. Next, cells were harvested by centrifugation (4200× g, 15 min, 4 ◦C) and resuspended in 50 mM TM potassium phosphate buffer, pH 7.5, containing 20 mM imidazole, 0.5 mM MgSO4 and one cOmplete protease inhibitor pill (Roche) and 1 mg DnaseI (Roche) per 50 mL. Cells were lysed by sonication using 6 cycles of 30 s at maximum power with an MSE sonication probe. Samples were cooled on ice during sonication. Following this, cell debris was removed by centrifugation (39,000× g, 45 min, 4 ◦C) and the supernatant was loaded onto a gravity flow column containing 2 mL HisPur Ni-NTA resin (Thermo Scientific) equilibrated in 50 mM potassium phosphate buffer, pH 7.5, containing 20 mM imidazole. The column was washed with this buffer until all unbound proteins had eluted as judged from the absorption of the flow-through at 280 nm. Subsequently, EUGO-His was eluted using 50 mM potassium phosphate buffer, pH 7.5, containing 500 mM imidazole. Fractions containing EUGO-His were pooled and transferred into 50 mM potassium phosphate buffer, pH 7.5, by passing them over an an Econo-Pac 10DG desalting column (Bio-Rad) equilibrated in this buffer. This procedure typically yielded 5–10 mg protein from 100 mL E. coli culture.

4.4. Analytical Methods All experiments were performed in 50 mM potassium phosphate buffer, pH 7.5, unless indicated otherwise. Absorption spectra were recorded on a Hewlett Packard 8453 photodiode array spectrophotometer (Agilent Technologies, Santa Clara, CA, USA). Protein concentrations of His-VAO and its variants were determined using the extinction coefficient of non-His-tagged VAO at 439 nm Molecules 2018, 23, 164 15 of 18

−1 −1 (ε439 = 12,500 M cm [3]) and concentrations of EUGO-His and its variants were determined −1 −1 using the extinction coefficient of non-His-tagged EUGO at 441 nm (ε441 = 14,200 M cm [4]). For trichloroacetic acid precipitations, 10 µL 50% (w/v) trichloroacetic acid solution was added to 90 µL 11 µM enzyme solution in 50 mM potassium phosphate buffer, pH 7.5, (EUGO-His and variants) or 50 mM potassium phosphate buffer, pH 7.5, containing 150 mM NaCl and 10% glycerol (His-VAO and variants) to yield final concentrations of 5% (w/v) trichloroacetic acid and 10 µM enzyme. Mixtures were incubated on ice for 30 min, after which the precipitate was pelleted by centrifugation (21,000× g, 15 min, 4 ◦C). The presence of flavin in the pellet or supernatant was judged from their colour and fluorescence upon irradiating them with UV-light. Steady-state kinetic parameters for the oxidation of vanillyl alcohol to vanillin by His-VAO and EUGO-His were determined by following the −1 −1 absorption of the product at 340 nm (ε340 = 14,000 M cm ) and fitting the obtained reaction rates to the Michaelis-Menten equation using IGOR Pro v. 6.10A (Wavemetrics, Lake Oswego, OR, USA). Oxygen consumption measurements were performed using a Hansatech Oxytherm system (Hansatech Instruments, King’s Lynn, UK).

4.5. Enzymatic Reactions for the Xylenol Orange Assay Enzymatic reactions were performed in 96-wells plates. Substrate solution (180 µL) was added to 20 µL enzyme solution to give a reaction mixture containing 20 nM enzyme and 2 mM substrate in 50 mM potassium phosphate buffer, pH 7.5. For measurements where the oxidation of eugenol or vanillyl alcohol was followed in time, the reaction mixtures were incubated for the desired time (ranging from 1–20 min) at room temperature (19–20 ◦C), after which 20 µL of the reaction mixture was removed and the hydrogen peroxide concentration was determined using the xylenol orange assay as described below. Reaction rates were determined by fitting a curve to the linear range of the data using IgorPRO. For substrate specificity screening, the reaction mixtures were incubated for 10 min at room temperature (19–20 ◦C), after which a 20 µL sample was taken and the hydrogen peroxide concentration was determined using the xylenol orange assay as described below. Three of the tested compounds, 4-n-nonylphenol, 4-hydroxybenzyl alcohol and 4-cyclohexylphenol, were poorly soluble in water at the used concentration and therefore were added to the reaction mixtures as (partial) suspensions. Reaction rates were estimated by assuming that there is a linear increase in hydrogen peroxide concentration during the reaction time.

4.6. Xylenol Orange Assay Twenty µL of the sample to be analysed was added to 180 µL xylenol orange assay mix in a 96-wells plate. This yielded a final assay mixture containing 100 µM xylenol orange, 250 µM ferrous sulphate, 25 mM sulfuric acid and the tenfold diluted analyte solution. This mixture was incubated in the dark at room temperature (19–20 ◦C) for 30 min, after which the absorption at 560 nm was measured using an xMark microplate spectrophotometer (Bio-Rad). A calibration curve of hydrogen peroxide solutions with known concentrations in the range 10–200 µM (concentration prior to addition to the xylenol orange assay mixture) was used to convert the measured absorbance values to the hydrogen peroxide concentration in the analyte solution. To ensure that the measured hydrogen peroxide concentrations reflect actual hydrogen peroxide formed during the enzymatic reaction, a detection limit of 10 µM hydrogen peroxide, which corresponds to the lowest point of the calibration curve, was used. All samples where the measured hydrogen peroxide concentration was lower than this were deemed to have had no significant formation of hydrogen peroxide during the reaction period.

4.7. Conversion of 4-cyclopentylphenol and 4-cyclohexylphenol and Identification of the Reaction Products For GC and GC/MS analysis, reaction mixtures (100 µL) containing 2 mM substrate and 1 µM enzyme in 50 mM potassium phosphate buffer, pH 7.5, (EUGO-His) or 50 mM potassium phosphate buffer, pH 7.5, containing 30 mM NaCl and 2% (w/v) glycerol (His-VAO), were incubated for 2 h (4-cyclopentylphenol) or 4 h (4-cyclohexylphenol) at 25 ◦C under shaking (500 rpm). Subsequently, the Molecules 2018, 23, 164 16 of 18 reactions were stopped by extracting the reaction mixtures twice with 100 µL ethyl acetate. The ethyl acetate layers were combined and dried over Na2SO4. Reaction products were analysed by GC and GC/MS. GC was performed on an Agilent 6890 GC system equipped with an Agilent 7673 injector using a 60 m × 0.25 mm × 0.25 µm DB-1 column (Agilent Technologies). The injector temperature was 220 ◦C and the FID temperature was 250 ◦C. The split ratio was 10:1. Samples from reactions with 4-cyclopentylphenol were run at a flow rate of 1.7 mL/min using the following temperature programme: 100 ◦C for 5 min, followed by a temperature gradient to 230 ◦C with an increment of 10 ◦C per min, followed by 3 min at 230 ◦C. Samples from reactions with 4-cyclohexylphenol were run at a flow rate of 1.7 mL/min using the following temperature programme: 100 ◦C for 4 min, followed by a temperature gradient to 160 ◦C with an increment of 10 ◦C per min, followed by 10 min at 160 ◦C, followed by a temperature gradient to 230 ◦C with an increment of 10 ◦C per min, followed by 3 min at 230 ◦C. Reported conversion percentages are average values from duplicate experiments. GC/MS was performed on an Agilent 6890 GC system equipped with an Agilent 7975C MS detector and an Agilent 7683B injector using a 30 m × 0.25 mm × 0.25 µm HP-5MS column (Agilent Technologies). The injector temperature was 275 ◦C. The split ratio was 100:1. Samples were run at a flow rate of 1.1 mL/min using the following programme: 50 ◦C for 3 min, followed by a temperature gradient to 100 ◦C with an increment of 5 ◦C per min, followed by a temperature gradient to 250 ◦C with an increment of 10 ◦C per min, followed by 3 min at 250 ◦C. For 1H-NMR analysis, a reaction mixture (25 mL) containing 2.5 mM 4-cyclopentylphenol and 0.5 µM EUGO-His was incubated in 50 mM potassium phosphate buffer, pH, 7.5, at 25 ◦C for 16 h under shaking (500 rpm). Following this, reaction products were extracted twice with 25 mL ethyl acetate. The ethyl acetate layers were combined and dried over Na2SO4. Subsequently, ethyl 1 acetate was removed by evaporation and the remaining solid was dissolved in CDCl3. H-NMR spectra were recorded on an Avance III 400 MHz NMR spectrometer (Bruker, Billerica, MA, USA) at 400 MHz. This revealed that the obtained product was a mixture of 40% 4-cyclopentylphenol and 60% 4-(1-cyclopenten-1-yl)phenol. Chemical shifts (δ) are reported in parts per million (ppm) relative to CDCl3. Data is reported as follows: br = broad, s = singlet, d = doublet, m = multiplet, ap = apparent; coupling constant(s) (J) in Hz and integration.

1 4-cyclopentylphenol. H-NMR (400 MHz, CDCl3) δ 7.12 (ap d, J = 8.5 Hz, 2H), 6.77 (ap d, J = 8.5 Hz, 2H), 4.66 (s, 1H), 2.93 (m, 1H), 2.14–1.96 (m, 2H), 1.87–1.72 (m, 2H), 1.75–1.59 (m, 2H), 1.61–1.46 (m, 2H).

1 4-(1-cyclopenten-1-yl)phenol. H-NMR (400 MHz, CDCl3) δ 7.33 (ap d, J = 8.6 Hz, 2H), 6.78 (ap d, J = 8.9 Hz, 2H), 6.04 (m, 1H), 4.80 (br s, 1H), 2.73–2.56 (m, 2H), 2.56–2.45 (m, 2H), 2.09–1.96 (m, 2H).

Supplementary Materials: The following are available online. Figure S1: Absorption spectra of His-VAO and its variants, Figure S2: Absorption spectra of EUGO-His and its variants, Figure S3: GC chromatograms of the reaction products of the conversion of 4-cyclopentylphenol by His-VAO and EUGO-His; Figure S4: GC/MS chromatograms and mass spectra of the reaction products of the conversion of 4-cyclopentylphenol by His-VAO and EUGO-His, Figure S5: 1H-NMR spectra of 4-cyclopentylphenol and the reaction products of its conversion by EUGO-His, Figure S6: GC chromatograms of the reaction products of the conversion of 4-cyclohexylphenol by His-VAO, EUGO-His and W413L His-VAO, Figure S7: GC/MS chromatograms and mass spectra of the reaction products of the conversion of 4-cyclohexylphenol by His-VAO, EUGO-His and W413L His-VAO. Acknowledgments: We thank Sigrid Berglund for technical assistance and Marco Fraaije and Mohamed Habib (both from University of Groningen) for providing the pJ404-His-VAO and pBAD-EUGO-His plasmids and expression and purification protocols for His-VAO and EUGO-His. This research was supported by the European Union through the INDOX project (FP7-KBBE-2013-7-613549). Author Contributions: T.A.E. and W.J.H.v.B. conceived and designed the experiments; T.A.E., A.v.N. and C.E.P. performed the experiments; T.A.E., A.v.N., C.E.P. and W.J.H.v.B. analysed the data; T.A.E. wrote the paper. Conflicts of Interest: The authors declare no conflict of interest. The funding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results. Molecules 2018, 23, 164 17 of 18

References

1. Ragauskas, A.J.; Beckham, G.T.; Biddy, M.J.; Chandra, R.; Chen, F.; Davis, M.F.; Davison, B.H.; Dixon, R.A.; Gilna, P.; Keller, M.; Langan, P.; et al. Lignin valorization: Improving lignin processing in the biorefinery. Science 2014, 344, 1246843. [CrossRef][PubMed] 2. Rinaldi, R.; Jastrzebski, R.; Clough, M.T.; Ralph, J.; Kennema, M.; Bruijnincx, P.C.A.; Weckhuysen, B.M. Paving the way for lignin valorisation: Recent advances in bioengineering, biorefining and catalysis. Angew. Chem. Int. Ed. 2016, 55, 8164–8215. 3. De Jong, E.; Van Berkel, W.J.H.; Van der Zwan, R.P.; Bont, J.A.M. Purification and characterization of vanillyl-alcohol oxidase from Penicillium simplicissimum: A novel aromatic alcohol oxidase containing covalently bound FAD. Eur. J. Biochem. 1992, 208, 651–657. [CrossRef][PubMed] 4. Jin, J.; Mazon, H.; Van den Heuvel, R.H.H.; Janssen, D.B.; Fraaije, M.W. Discovery of a eugenol oxidase from Rhodococcus sp. strain RHA1. FEBS J. 2007, 274, 2311–2321. [CrossRef][PubMed] 5. Levasseur, A.; Drula, E.; Lombard, V.; Coutinho, P.M.; Henrissat, B. Expansion of the enzymatic repertoire of the CAZy database to integrate auxiliary redox enzymes. Biotechnol. Biofuels 2013, 6, 41. [CrossRef] [PubMed] 6. Fraaije, M.W.; Van Berkel, W.J.H.; Benen, J.A.E.; Visser, J.; Mattevi, A. A novel oxidoreductase family sharing a conserved FAD-binding domain. Trends Biochem. Sci. 1998, 23, 206–207. [CrossRef] 7. Ewing, T.A.; Fraaije, M.W.; Mattevi, A.; Van Berkel, W.J.H. The VAO/PCMH flavoprotein family. Arch. Biochem. Biophys. 2017, 632, 104–117. [CrossRef][PubMed] 8. Mattevi, A.; Fraaije, M.W.; Mozzarelli, A.; Olivi, L.; Coda, A.; Van Berkel, W.J.H. Crystal structures and inhibitor binding in the octameric flavoenzyme vanillyl-alcohol oxidase: The shape of the active-site cavity controls substrate specificity. Structure 1997, 5, 907–920. [CrossRef] 9. Nguyen, Q.-T.; De Gonzalo, G.; Binda, C.; Rioz-Martínez, A.; Mattevi, A.; Fraaije, M.W. Biocatalytic properties and structural analysis of eugenol oxidase from Rhodococcus jostii RHA1: A versatile oxidative biocatalyst. ChemBioChem 2016, 17, 1359–1366. [CrossRef][PubMed] 10. Fraaije, M.W.; Veeger, C.; Van Berkel, W.J.H. Substrate specificity of flavin-dependent vanillyl-alcohol oxidase from Penicillium simplicissimum: Evidence for the production of 4-hydroxycinnamyl alcohols from 4-allylphenols. Eur. J. Biochem. 1995, 234, 271–277. [CrossRef][PubMed] 11. Van den Heuvel, R.H.H.; Fraaije, M.W.; Laane, C.; Van Berkel, W.J.H. Regio- and stereospecific conversion of 4-alkylphenols by the covalent flavoprotein vanillyl-alcohol oxidase. J. Bacteriol. 1998, 180, 5646–5651. [PubMed] 12. Fraaije, M.W.; Mattevi, A.; Van Berkel, W.J.H. Mercuration of vanillyl-alcohol oxidase from Penicillium simplicissimum generates inactive dimers. FEBS Lett. 1997, 402, 33–35. [CrossRef] 13. Ewing, T.A.; Gygli, G.; Van Berkel, W.J.H. A single loop is essential for the octamerization of vanillyl alcohol oxidase. FEBS J. 2016, 283, 2546–2559. [CrossRef][PubMed] 14. Van den Heuvel, R.H.H.; Fraaije, M.W.; Laane, C.; Van Berkel, W.J.H. Enzymatic synthesis of vanillin. J. Agric. Food Chem. 2001, 49, 2954–2958. [CrossRef][PubMed] 15. Drijfhout, F.P.; Fraaije, M.W.; Jongejan, H.; Van Berkel, W.J.H.; Franssen, M.C.R. Enantioselective hydroxylation of 4-alkylphenols by vanillyl alcohol oxidase. Biotechnol. Bioeng. 1998, 59, 171–177. [CrossRef] 16. Ricklefs, E.; Girhard, M.; Koschorreck, K.; Smit, M.S.; Urlacher, V.B. Two-step one-pot synthesis of pinoresinol from eugenol in an enzymatic cascade. ChemCatChem 2015, 7, 1857–1864. [CrossRef] 17. Ricklefs, E.; Girhard, M.; Urlacher, V.B. Three-steps in one-pot: Whole-cell biocatalytic synthesis of enantiopure (+)- and (−)-pinoresinol via kinetic resolution. Microb. Cell Fact. 2016, 15, 78. [CrossRef] [PubMed] 18. Habib, M.H.M.; Deuss, P.J.; Lonˇcar, N.; Trajkovic, M.; Fraaije, M.W. A biocatalytic one-pot approach for the preparation of lignin oligomers using an oxidase/peroxidase cascade enzyme system. Adv. Synth. Catal. 2017, 359, 3354–3361. [CrossRef] 19. Overhage, J.; Steinbüchel, A.; Priefert, H. Highly efficient biotransformation of eugenol to ferulic acid and further conversion to vanillin in recombinant strains of Escherichia coli. Appl. Environ. Microbiol. 2003, 69, 6569–6576. [CrossRef][PubMed] Molecules 2018, 23, 164 18 of 18

20. Overhage, J.; Steinbüchel, A.; Priefert, H. Harnessing eugenol as a substrate for production of aromatic compounds with recombinant strains of Amycolatopsis sp. HR167. J. Biotechnol. 2006, 125, 369–376. [CrossRef] [PubMed] 21. Plaggenborg, R.; Overhage, J.; Loos, A.; Archer, J.A.C.; Lessard, P.; Sinskey, A.J.; Steinbüchel, A.; Priefert, H. Potential of Rhodococcus strains for biotechnological vanillin production from ferulic acid and eugenol. Appl. Microbiol. Biotechnol. 2006, 72, 745–755. [CrossRef][PubMed] 22. Zucca, J.; Lambert, F.; Mane, J.; Ness, F.; Aigle, M. System for Producing Aromatic Molecules by Bioconversion. U.S. Patent 8,404,472, 26 March 2013. 23. Lambert, F.; Zucca, J.; Ness, F.; Aigle, M. Production of ferulic acid and coniferyl alcohol by conversion of eugenol using a recombinant strain of Saccharomyces cerevisiae. Flavour Fragr. J. 2014, 29, 14–21. [CrossRef] 24. Zhou, R.; Xiaodan, Y. Methods of Making Vanillin via the Microbial Fermentation of Ferulic Acid from Eugenol Using a Plant Dehydrogenase. International Patent Application WO/2015/066722, 7 May 2015.

25. Gupta, B.L. Microdetermination techniques for H2O2 in irradiated solutions. Microchem. J. 1973, 18, 363–374. [CrossRef] 26. Gay, C.; Collins, J.; Gebicki, J.M. Hydroperoxide assay with the ferric-xylenol orange complex. Anal. Biochem. 1999, 273, 149–155. [CrossRef][PubMed] 27. Nourooz-Zadeh, J.; Tajaddini-Sarmadi, J.; Wolff, S.P. Measurement of plasma hydroperoxide concentrations by the ferrous oxidation-xylenol orange assay in conjunction with triphenylphosphine. Anal. Biochem. 1994, 220, 403–409. [CrossRef][PubMed] 28. Waslidge, N.B.; Hayes, D.J. A colorimetric method for the determination of lipoxygenase activity suitable for use in a high throughput assay format. Anal. Biochem. 1995, 231, 354–358. [CrossRef][PubMed] 29. Gay, C.A.; Gebicki, J.M. Measurement of protein and lipid hydroperoxides in biological systems by the ferric-xylenol orange method. Anal. Biochem. 2003, 315, 29–35. [CrossRef] 30. Yu, Z.; Wang, J.; Zhou, N.; Zhao, C.; Qiu, J. A highly sensitive method for quantitative determination of L-amino acid oxidase activity based on the visualization of ferric-xylenol orange formation. PLoS ONE 2013, 8, e82483. [CrossRef][PubMed] 31. Jasti, L.S.; Dola, S.R.; Fadnavis, N.W.; Addepally, U.; Daniels, S.; Ponrathnam, S. Co-immobilized glucose oxidase and β-galactosidase on bovine serum albumin coated allyl glycidyl ether (AGE)-ethylene glycol dimethacrylate (EGDM) copolymer as a biosensor for lactose determination in milk. Enzyme Microb. Technol. 2014, 64–65, 67–73. [CrossRef][PubMed] 32. BRENDA Enzyme Database EC 1.11.1.7: Peroxidases. Available online: https://www.brenda-enzymes.org/ enzyme.php?ecno=1.11.1.7 (accessed on 11 December 2017). 33. Fraaije, M.W.; Van den Heuvel, R.H.H.; Roelofs, J.C.A.A.; Van Berkel, W.J.H. Kinetic mechanism of vanillyl-alcohol oxidase with short-chain 4-alkylphenols. Eur. J. Biochem. 1998, 253, 712–719. [CrossRef] [PubMed] 34. Ewing, T.A.; Nguyen, Q.-T.; Allan, R.C.; Gygli, G.; Romero, E.; Binda, C.; Fraaije, M.W.; Mattevi, A.; Van Berkel, W.J.H. Two tyrosine residues, Tyr-108 and Tyr-503, are responsible for the deprotonation of phenolic substrates in vanillyl-alcohol oxidase. J. Biol. Chem. 2017, 292, 14668–14679. [CrossRef][PubMed] 35. Van den Heuvel, R.H.H.; Fraaije, M.W.; Mattevi, A.; Van Berkel, W.J.H. Asp-170 is crucial for the redox properties of vanillyl-alcohol oxidase. J. Biol. Chem. 2000, 275, 14799–14808. [CrossRef][PubMed] 36. Holt, A.; Palcic, M.M. A peroxidase-coupled continuous absorbance plate-reader assay for flavin monoamine oxidases, copper-containing amine oxidases and related enzymes. Nat. Protoc. 2006, 1, 2498–2505. [CrossRef] [PubMed] 37. Scheich, C.; Sievert, V.; Büssow, K. An automated method for high-throughput protein purification applied to a comparison of His-tag and GST-tag affinity chromatography. BMC Biotechnol. 2003, 3, 12. [CrossRef] [PubMed]

Sample Availability: Samples of the compounds 1–24 are available from the authors.

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).