USO10787712B2

( 12 ) United States Patent ( 10 ) Patent No .: US 10,787,712 B2 Sjoblom et al . ( 45 ) Date of Patent : * Sep . 29 , 2020

( 54 ) CONSENSUS CODING SEQUENCES OF ( 56 ) References Cited HUMAN BREAST AND COLORECTAL CANCERS U.S. PATENT DOCUMENTS 5,605,799 A 2/1997 White et al . ( 71 ) Applicant: The Johns Hopkins University , 8,741,573 B2 * 6/2014 Sjoblom C12Q 1/6886 Baltimore , MD (US ) 435 / 6.14 2001/0021502 Al 9/2001 Swift et al . ( 72 ) Inventors: Tobias Sjoblom , Uppsala ( SE ) ; Sian 2007/0017666 Al 1/2007 Song Jones , Baltimore , MD (US ); D. 2010/0316995 Al 12/2010 Sjoblom et al . Williams Parsons , Bellaire, TX ( US ) ; FOREIGN PATENT DOCUMENTS Laura D. Wood , Baltimore, MD ( US ) ; Jimmy Cheng - Ho Lin , Baltimore , MD EP 785216 7/1997 EP 2543739 1/2013 ( US ) ; Thomas Barber , Nobelsville , TN WO WO 199213103 8/1992 ( US ) ; Diana Mandelker , Baltimore , WO WO 200042436 7/2000 MD ( US ) ; Bert Vogelstein , Baltimore , WO WO 2001042504 6/2001 MD ( US ) ; Kenneth W. Kinzler , WO WO 2004082458 9/2004 Baltimore , MD (US ); Victor E. WO WO 2005113824 12/2005 Velculescu, Dayton , MD (US ) WO WO 2014110408 7/2014 ( 73 ) Assignee : The Johns Hopkins University , OTHER PUBLICATIONS Baltimore , MD (US ) Allen et al . , “ + A2 : D33The role of molecular markers in the adjuvant Subject to any disclaimer , the term of this treatment of colorectal cancer ,” European Journal of Cancer . Supple ( * ) Notice : ment, Pergamon , Oxfor, GB , vol . 3 , No. 3 , Oct. 1 , 2005 . patent is extended or adjusted under 35 Arai et al ., “ The inv ( 11 ) (p15222 ) chromosome translocation of de U.S.C. 154 ( b ) by 0 days. novo and therapy -related myeloid malignancies results in fusion of This patent is subject to a terminal dis the nucleoporin gene, NUP98 , with the putative RNA helicase gene , claimer. DDX10 . " , Blood 89 , 3936-3944 , 1997 . Bamford , et . al . , “ The COSMIC ( Catalog of Somatic Mutations in Cancer ) Database and Website , ” British Journal of Cancer, vol . 91 , ( 21 ) Appl. No .: 16 /824,052 No. 2 , Jul. 19 , 2004 , pp . 355-358 . Bardelli et al . , “ Mutational analysis of gene families in human ( 22 ) Filed : Mar. 19 , 2020 cancer ” , Curr Opin Genet Dev 15 , 5-12 , 2005 . Bardelli et al . , “ Mutational analysis of gene families in human ( 65 ) Prior Publication Data cancer , ” Current Opinion in Genetics & Development, Current US 2020/0239970 A1 Jul . 30 , 2020 Biology Ltd , XX , vol . 15 , No. 1 , Feb. 1 , 2005 , pp . 5-12 . Bardelli et al . , “ Mutational analysis of the tyrosine kinome in colorectal cancers . " , Science 300 , 949 , 2003 . Benvenuti et al . , “ Identification of cancer genes by mutational Related U.S. Application Data profiling of tumor genomes, ” Febs Letters, Elsevier , Amsterdam , ( 60 ) Continuation of application No. 16 / 664,505 , filed on NL , vol . 579 , No. 8 , Mar. 21 , 2005 , pp . 1884-1890 . Oct. 25 , 2019 , which is a continuation of application (Continued ) No. 15 / 413,903 , filed on Jan. 24 , 2017 , now abandoned , which is a division of application No. Primary Examiner James Martinell 14 / 224,102 , filed on Mar. 25 , 2014 , now Pat . No. 9,551,037 , which is a division of application No. ( 74 ) Attorney , Agent, or Firm — Fish & Richardson P.C. 12 / 377,073 , filed as application No. PCT /US2007 /017866 on Aug. 13 , 2007 , now Pat. No. ( 57 ) ABSTRACT 8,741,573 . Analysis of 13,023 genes in 11 breast and 11 colorectal cancers revealed that individual tumors accumulate an aver ( 60 ) Provisional application No. 60 / 836,944 , filed on Aug. age of ~ 90 mutant genes but that only a subset of these 11 , 2006 , provisional application No. 60 / 842,363 , contribute to the neoplastic process . Using stringent criteria filed on Sep. 6 , 2006 . to delineate this subset , we identified 189 genes ( average of 11 per tumor ) that were mutated at significant frequency. ( 51 ) Int . Ci . The vast majority of these genes were not known to be C12Q 1/68 ( 2018.01 ) genetically altered in tumors and are predicted to affect a GOIN 33/53 ( 2006.01 ) wide range of cellular functions, including transcription , C12Q 1/6886 ( 2018.01 ) adhesion , and invasion . These data define the genetic land ( 52 ) U.S. Cl . scape of two human cancer types , provide new targets for CPC C12Q 1/6886 ( 2013.01 ) ; C12Q 2600/106 diagnostic and therapeutic intervention and monitoring. ( 2013.01 ) ; C12Q 2600/156 ( 2013.01 ) ( 58 ) Field of Classification Search None 20 Claims , 36 Drawing Sheets See application file for complete search history . Specification includes a Sequence Listing . US 10,787,712 B2 Page 2

( 56 ) References Cited Hinginbotham et al . , “ Activating Point Mutation in Ki - ras Codon 63 in a Chemically Induced Rat Renal Tumor” , Molecular Carcinogenesis, 5 : 136-139 , 1992 . OTHER PUBLICATIONS Hirshman - Jax , et . al ., “ A Distinct ‘ Side Population of Cells with High Drug Efflux Capacity in Human Tumor Cells ,” Proceedings of Bluteau et al . , “ Bi - allelic inactivation of TCF1 in hepatic the National Academy of Sciences of USA , National Academy of adenomas ." , Nat Genet 32 , 312-315 , 2002 . Science , Washington, DC , vol . 101 , No. 39 , Sep. 28 , 2004 , pp . Bos et al . , “ Prevalence of ras gene mutations in human colorectal 14228-14233 . cancers . ” , Nature 327,293-297 , 1987 . Hollstein et al . , " p53 mutations in human cancers ” , Science 253 , Bos , “ RAS Oncogenes in Human Cancer: A Review ” , Jan. 15 , 2014 . 49-53 , 1991 . Brent , “ Genomic biology . ” , Cell 100 , 169-183 , 2000 . Ideker et al. , “ Integrated Genomic and Proteomic Analyses of a cancer.gov' [ online ] “ Table of TCGA Cancer Codes ” , 2017 , Retrieved Systematically Perturbed Metabolic Network ” , Science 292 , 929 from the Internet : URL < https://cancer.gov/research/key-initiatives/ 934 , 2001 . ras / ras -central /blog / 2017 /kras.pdf > . Janakiraman et al . , “ Genomic and biological characterization of Castagnola et al . , “ Mutant KRAS , chromosomal instability and exon 4 KRAS mutations in human cancer ” , Cancer Res ., 70 ( 14 ) : progo in colorectal cancer, Biochimica Biophysica Acta, 5901-5911 , 2010 . 1756 : 115-125 , ( 2005 ). Kem et al . , “ Elegance , silence and nonsense in the mutations Conlin et al . , “ The prognostic significance of K - ras , p53 , and APC literature for solid tumors ” , Cancer Biol Ther 5 , 349-359 , 2006 . mutations in colorectal carcinoma, ” Gut, 54 : 1283-1286 , 2005 . Kim et al . , “ Absence of FES exon 16 and 17 mutation in the Costello et al . , “ Aberrant CpG - island methylation has non - random colorectal carcinomas in Korean patients , ” Digestive and Liver and tumour - type - specific patterns .” , Nat Genet 24 , 132-138 , 2000 . Disease , W.B. , Saunders , GB , vol . 38 , No. 3 , Mar. 1 , 2006 , pp . Der et al . , “ rasH Mutations Deficient in GTP Binding ” , Molecular 213-214 . and Celluar Biology, 3291-3294 , 1986 . Kinzler et al . , “ Identification of an amplified , highly expressed gene Dulak et al . , “ Exome and whole genome sequencing of esophageal in a human glioma. " , Science 236 , 70-73 , 1987 . encarcinoma identifies recurrent driver events and mutatna Ku et al . , “ Genetic alterations of the TGF - b signaling pathway in complexity ” Nat. Genet ., 45 ( 5 ) : 478-486,213 . Duval et al. , “ Frequent frameshift mutations of the TCF - 4 gene in colorectal cancer cell lines : A novel mutation in Smad3 associated colorectal cancers with microsatellite instability .” , Cancer Res 59 , with the inactivation of TGF - b -induced transcriptional activation ” , 4213-4215 , 1999 . Cancer Lett, 247 : 283 ( 2007 ). Eddy, “ Multiple alignment using hidden Markov models . ” , 3 : Landis et al . , “ GTPase inhibiting mutations activate the alpha chain 114-120 , 1995 . of Gs and stimulate adenylyl cyclase in human pituitary tumours . ” , Edkins et al . , “ Recurrent KRAS Codon 146 Mutations in Human Nature 340 , 692-696 , 1989 . Colorectal Cancer Cancer Biology & Therapy, 5 : 8 , pp.228-936 , Lengauer et al . , “ Genetic instabilities in human cancers . ” , Nature Aug. 2006 . 396,643-649 , 1998 . Eppert et al . , “ MADR2 maps to 18q21 and encodes a TGFbeta Lievre et al . , “ KRAS Mutation Status is Predictive of Response to regulated MAD - related protein that is functionally mutated in Cetuximab Therapy in Colorectal Cancer ” , Cancer Res . 66 ( 8 ) , colorectal carcinoma . " , Cell 86,543-552 , 1996 . 2006 , pp . 3992-3995 , 2006 . Ewing et al . , “ Base - calling of automated sequencer traces using Lin et al . , “ A multidimensional analysis of genes mutated in rbeast phred . II . Error probabilities . ” , Genome Res 8 , 186-194 , 1998 . and colorectal cancers, " Genome Research , vol . 17 , No. 9 , Jul. 25 , Extended European Search Report dated Mar. 23 , 2010 in Appli 2007 , pp . 1304-1318 . cation No. 07811279.4 . Lin , et . al ., “ Discovery of Estrogen Receptor Alpha Target Genes Extended European Search Report issued in related European and Response Elements in Breast Tumor Cells , " Genome Biology Application No. 12176466.6 , dated Dec. 11 , 2012 . 2004 , vol . 5 , Issue 9 , Article R66, Aug. 12 , 2004 , 18 pages . Comic.com online ) Extract from the Comdatabase ( anger Loeb , “ A mutator phenotype in cancer . ” , Cancer Res 61 , 3230-3239 , Institute ) for mutation ID COSM28519 , [retrieved on Apr. 4 , 2019 ] , 2001 . available on or before Apr. 12 , 2018 , retrieved from : URL : https : // Maglott et al ., “ Entrez Gene : gene -centered information at NCBI” , cancer.sanger.ac.uk/cosmic/mutation/overview?id=87808808/ > . Nucleic Acids Res 33 , D54 - D58 , 2005 . Fang et al . , “ The MAPK signalling pathways and colorectal cancer ," Markowitz et al . , “ Inactivation of the type II TGF - beta receptor in Lancet Oncology, Lancet Publishing Group , London , GB , vol . 6 , colon cancer cells with microsatellite instability .” , Science 268 , No.5 , May1,205,322.327 1336-1338 , 1995 . Forbes, et . al . , " COSMIC 2005 , " British Journal of Cancer, vol . 94 , Merajver, et . al . , " Somatic Mutations in the BRCA 1 Gene in No. 2 , Jan. 2006 , pp . 318-322 . Sporadic Ovarian Tumours, ” Nature Genetics , Nature Publishing Futreal et al . , “ A census of human cancer genes .” , Nature Rev Group , New York , US , vol . 9 , No. 4 , Apr. 1 , 1995 , pp . 439-443 . Cancer 4 , 177-183 , 2004 . Notice of Opposition in Application No. EP2543739 , dated Apr. 22 , Gillet , et . al . , “ Macroarray -based Detection of Multidrug Resistance 2016 , 20 pages . in Human Tumor Cells by Expression Profiling of ATP - binding Notterman et al . , in Microarrays and Cancer Research , 2002 , Cassette Transporter Genes ,” Cancer Research , American Associa Warrington et al . ( eds . ) , Eaton Publishing, Westborough , MA , pp . tion for Cancer Research , Baltimore, MD , US , vol . 64 , Dec. 15 , 81-111 . 2004 , pp . 8987-8993 . Ogino Shuji et al . , " Sensitive Sequencing Method for KRAS Greenman et al . , “ Statistical analysis of pathogenicity of somatic Mutation Detection by Pyrosequencing ” , Journal of Molecular mutations in cancer . ” , Genetics 173 , 2187-2198 , 2006 . Diagnostics , vol . 7 , No. 3 , pp . 413-421 , 2005 . Grounds of Appeal in Appeal No. T0416 / 18-3.3.08 , dated Apr. 12 , Olivier et al ., “ TP53 mutation spectra and load : a tool for generating 2018 . hypotheses on the etiology of cancer . ” , IARC Sci Pub , 247-270 , Hafner et al . , “ Differential gene expression of Eph receptors and 2004 , Abstract only . ephrins in benign human tissues and cancers , " Clinical Chemistry , Onishi et al . , “ Overexpression of autocrine motility factor receptor American Associate for Clinical Chemistry, Washington , DC , vol . ( AMFR ) in NIH3T3 fibroblasts induces cell transformation . ", Clin 50 , No. 3 , Mar. 1 , 2004 , pp . 190 - f499 . Exp Metastasis 20 , 51-58 , 2003 . Handbook of Chemistry and Physics, 49th Edition , 1968 , Weast Ooi et al . , “ Global synthetic - lethality analysis and yeast functional ( ed . ) , The Chemical Rubber C., Cleveland,, p ^ -25. profiling . ” , Trends Genet 22 , 56-63 , 2006 . Higinbotham et al . , “ Activating Point Mutation in Ki - ras Codon 63 Orita et al . , " A Novel Point Mutation at Codon 146 of the K - ras in a Chemically Induced Rat Renal Tumor, ” Molecula Carcinogenesis, Gene in a Human Colorectal Cancer Identified by the Polymerase 5 : 136-139 , ( 1992 ) . Chain Reaction , " Virus Genes , 5 : 1 , 75-79 , 1991 . US 10,787,712 B2 Page 3

( 56 ) References Cited Steinbach , et . al. , “ ABCA3 as a Possible Cause of Drug Resistance in Childhood Acute Myeloid Leukemia ,” Clinical Cancer Research , OTHER PUBLICATIONS vol . 12 , No. 14 , Jul. 15 , 2006 , pp . 4357-4663 . Stephems et al . , A screen of the complete protein kinase family Padmanabhan et al. , " Structural basis for defects of Keapl activity provoked by its point mutations in lung cancer ." , Mol Cell 2 I , identifies diverse patterns of somatic mutations in human breast 689-700 , 2006 . cancer , Nature Genetics, Jun . 2005 , vol . 37 , No. 6 , pp . 590-592 , see Parkin et al . , “ Global cancer statistics , 2002." , CA Cancer J Clin 55 , entire reference particularly p . 590 , right column , and Supplemen 74-108 , 2005 . tary Table 1 . Partial European Search Report issued in related European Appli Stephens et al . , “ A screen of the complete protein kinase gene cation No. 12176467.4 , dated Nov. 29 , 2012 . family identifies diverse patterns of somatic mutations in human Pauly et al . , “ Ki - ras Oncogene and p53 Tumour Suppressor Gene breast cancer . " , Nat Genet 37,590-592 , 2005 . Mutations in Colorectal Carcinomas from the European Saar Strausberg et al ., in Microarrays and Cancer Research , 2002 , Luxembourg Region are Less Frequent than Predicted by the Warrington et al . ( eds . ) , Eaton Publishing, Westborough MA , pp . Classic Adenoma - Carcinoma Sequence Model , ” European Journal xi - xvi . of Cancer, vol . 33 , No. 13 , pp . 2265-2272 , 1997 . Strohrnaieret et al . , " Human F - box protein hCdc4 targets cyclin E Pusztai , et . al ., “ Development of Pharmacogenomic Markers to for proteolysis and is mutated in a breast cancer cell line . ” , Nature Select Preoperative Chemotherapy for Breast Cancer , ” Breast Can 413 , 316-322 , 2001 . cer ( Tokyo, Japan ) 2005 , vol . 12 , No. 2 , pp . 73-85 . Tanaka et al . , “ Gelsolin : a candidate for suppressor of human Reynolds et al . , “ Activated Oncogenes in B6C3F1 Mouse Liver bladder cancer ." , Cancer Res 55 , 3228-3232 , 1995 . Tumors : Implications for Risk Assessment ” , Science , vol . 237 , Tang et al . , “ Coexpression of transcripts encoding EPHB receptor 1309-1316 , 1987 . protein tyrosine kinases and their ephrin - B ligands in human small Riggins et al . , “ Mad - related genes in the human ” , Nat Genet 13 , cell lung carcinoma . " , Clin Cancer Res 5 , 455-460 , 1999 . 347-349 , 1996 . Rogers et al . , “ Genomics: massively parallel sequencing . ” , Venter . Tisdale et al ., “GTP - Binding Mutants of Rabl and Rab2 are Potent Nature 437 , 326-327 , 2005 . Inhibitors of Vesicular Transport from the Endoplasmic Reticulum Ruault et al ., “ MLL3 , a new human member of the TRX /MLL gene to the Golgi Complex ” , The Journal of Cell Biology, vol . 119 , No. family, maps to 7q36 , a chromosome region frequently deleted in 4 , 749-761 , 1992 . myeloid leukemia ” , Gene 284 , 73-81 , 2002 . Van Putten, “ Of Tumours in Mice and Men the Different Roles of Salassidis et al . , “ Translocation t ( 10 ; 14 ) ( q11.2 : q22.1) fusing the Somatic Mutation in Treatment Failure ,” European Journal of kinetin to the RET gene creates a novel rearranged form (PTC ) of Cancer and Clinical Oncology, Oxford , GB , vol . 22 , No. 2 , Jul. 1 , the RET proto - oncogene in radiation - induced childhood papillary 1986 , pp . 753-755 . thyroid carcinoma . ” , Cancer Res 60 , 2786-2789 , 2000 . Vannus, “ The new era in cancer research . ” , Science 312 , 1162-1165 , Sasaki et al . , “ Filamin associates with Smads and regulates TGF - B 2006 . signaling " , J Biol Chem 276 , 17871 , 2001 . Vogelstein et al ., " Cancer genes and the pathways they control . ” , Sato et al . , “ Identification of chromosome arm 9p as the most Nature Med 10 , 789-799 , 2004 . frequent target of homozygous deletions in lung cancer . " , Genes Wajapeyee, et . al. , “ Pharmacogenomics in Breast Cancer : Current Chromosomes Cancer 44 , 405-414 , 2005 . Trends and Future Directions , " Current Opinion in Molecular Shanmugam et al . , “ Rosai- Dorfman Disease Harboring an Activat Therapeutics, Jun. 2004 , vol . 6 , No. 3 , pp . 296-601 . ing KRAS K117N Missense Mutation " , Head and Neck Pathol. , 10 : Wang et al . , " Prevalence of somatic alterations in the colorectal 394-399 , 2016 . cancer cell genome. ” , Proc Natl Acad Sci US A 99 , 3076-3080 , Sjoblom et . al . “ The Consensus Coding Sequences of Human Breast 2002 . and Colorectal Cancers , ” Science , vol . 314 , Oct. 13 , 2006 , pp . Wang et al ., “ Three classes of genes mutated in colorectal cancers 268-274 . with chromosomal instability . ” , Cancer Res 64 , 2998-3001 , 2004 . Soung et al . , “ Kinase domain mutation of MLK4 gene is uncommon Wu , et al. , “ Somatic Mutation and Gain of Copy Number of in gastric and hepatocellular carcinomas, ” Digestive and Liver PIK3CA in Human Breast Cancer, ” Breast Cancer Research , vol . 7 Disease , W.B. , Saunders, GB , vol . 38 , No. 4 , Apr. 1 , 2006 , p . 283 . No. 5 , pp . 609-613 . Soussi et al . , “ p53 mutation heterogeneity in cancer .” , Biochem " wikipedia.org " [ online ] “ Ras subfamily ”, May 19 , 2018 , [ retrieved Biophys Res Commun 331 , 834-842 , 2005 . on Jan. 2n , 2019 ] , Retrieved from the Internet: URL https : // en . Stanley, “ Molecular aspects of chemical carcinogenes: The roles of wikipedia.org/wiki/ras_subfamily. oncogenes and tumour suppressor genes , ” Toxicology, 96 : 173-194 , ( 1995 ) . * cited by examiner U.S. Patent Sep. 29 , 2020 Sheet 1 of 36 US 10,787,712 B2

HUMAN GENOME CONSENSUS CODING SEQUENCE 14,661 TRANSCRIPTS FROM 13,023 GENES EXTRACT PROTEIN CODING SEQUENCES 120,839 DIFFERENT EXONS DESIGN PRIMERS FOR PCRAMPLIFICATION AND SEQUENCING OF CODING EXONS 21 Mb TARGET SEQUENCE 135,483 PRIMER PAIRS AMPLIFY AND SEQUENCE TUMOR ONA FRACTION ( 11 BREAST TUMORS, 11 COLORECTAL TUMORS, 2 NORMAL SAMPLES) MUTATIONS 465 Mb TOTAL TUMOR SEQUENCE REMAINING ASSEMBLE SEQUENCE DATA AND IDENTIFY PUTATIVE MUTATIONS 816,986 PUTATIVE MUTATIONS OBSERVED 100 % DISCOVERY 259,957 SILENT CHANGES EXCLUDED 68.2 % SCREEN 163,006 CHANGES PRESENT IN NORMAL SAMPLE EXCLUDED 48.2 % 11,004 KNOWN POLYMORPHISMS EXCLUDED 46.9 % 353,738 CHANGES EXCLUDED UPON VISUAL INSPECTION -3.6 % RESEQUENCE TUMORDNATO CONFIRM REMAINING 29,281 MUTATIONS 9.295 UNCONFIRMED MUTATIONS EXCLUDED 2..4 % SEQUENCE PATIENT- MATCHED ONA FROM NORMAL CELLS TO DETERMINE WHETHER REMAINING 19,986 MUTATIONS WERE SOMATIC 18,414 GERMLINE VARIANTS EXCLUDED 0.19 % 265 CHANGES FROM HIGHLY RELATED REGIONS EXCLUDED 0.16 % 1,307 SOMATIC MUTATIONS IN 1,149 GENES

TO FIG . 1B FIG . 1A U.S. Patent Sep. 29 , 2020 Sheet 2 of 36 US 10,787,712 B2

FROM FIG . 1A

ASSESS GENE MUTATION FREQUENCY AND SPECTRUM BY SEQUENCING 24 ADDITIONAL SAMPLES OF AFFECTED TUMOR TYPE 3 Mb TARGET SEQUENCE FRACTION MUTATIONS 77 Mb TOTAL TUMORS SEQUENCE REMAINING ASSEMBLE SEQUENCE DATA AND IDENTIFY POTENTIAL MUTATIONS 133,693 PUTATIVE MUTATIONS OBSERVED 100 % 41,586 SILENT CHANGES EXCLUDED 68.9 % 18,198 GERMLINE VARIANTS EXCLUDED 55.3 % 68,961 CHANGES EXCLUDED UPON VISUAL INSPECTION 3.7 % VALIDATION SCREEN RESEQUENCE TUMOR DNA TO CONFIRM REMAINNG 4,948 MUTATIONS 2,345 UNCONFIRMED MUTATIONS EXCLUDED 1.9 % SEQUENCE PATIENT- MATCHED DNA FROM NORMAL CELLS TO DETERMINE WHETHER REMAINING 2,603 MUTATIONS WERE SOMATIC 2042 GERMLINE VARIANTS EXCLUDED 0.42 % 196 CHANGES FROM HIGHLY RELATED REGIONS EXCLUDED 0.27 % 365 MUTATIONS IN 236 GENES FIG . 1B U.S. Patent Sep. 29 , 2020 Sheet 3 of 36 US 10,787,712 B2

100 O BREAST CANCERS 06 @ COLON CANCERS 08

70 FRACTIONOFTUMORSWITHMUTATION(PERCENT ) ä

30

20

10

RNA CELLULARADHESION ANDMOTILITY SIGNALTRANSDUCTION TRANSCRIPTIONALREGULATION TRANSPORT CELLULARMETABOLISM INTRACELLULARTRAFFICKING METABOLISME OTHER UNKNOWN FIG . 2 U.S. Patent Sep. 29 , 2020 Sheet 4 of 36 US 10,787,712 B2

0.3 o Total CCDS codons u Codons mutated in breast cancers 0.2 e Codons mutated in colon cancers Fractionoftotalcodons 0.1

0.0 lina Asp Cys Amino acid

Fig . 3 . U.S. Patent Sep. 29 , 2020 Sheet 5 of 36 US 10,787,712 B2

Duplicated genes 113 transcripts from 101 genes

CODINI0.1 SON GC034109.1 CSFZRA COSIAP COD1211 MRC 3:01 ES CCOSHIAMA coo21.1 OKFZPS COo814111.1 w CODS34,1 HST 21 COO $ 111121 COZA COD SKINS ESREBICOSTO :.15h cit.17 COSMI WIRA CCDS330.1 Fundo XOXON $ 141140 SU CCOSIS141 FLR ORQ1 RP3 co9140141 P2RY 8.7.1 OSP 900281 EFIS D $ 14116.6 OXY3154 09144.1 PLR 1034ti MC5170 51 4117.1 AT CCD920521 RABU 1001II LOCSI . $ 141101 61 COS200RANEPAL 0021 FLot 514111 COD cos934.1 LUS 1000 UI SULTA S1QHI LOCA62 CCOSRI00.1 crct 088.I LOC34017 SCRISS CcOS551.1 THP4 1 : 09.1 MOCH903 1121 GAGE SSX10 TEK CODS10101 CCL COSISI MAG : 04 3.1 CCRS OS 1311,1 OCL # 1 CODSUXI XGEI 9:00 . NDUFB DI TBC1D3 c00914J01 XGE1 -11 Heo CO91182.1 KALS CCOS1130 : XGEI St001PPPIR2 CODWIJ McC2 : 23 CC0914044 SS S - 22,1 UOBU CCO91178.1 PM COD610341680 SWIMS costi / INPE COO $ 11241TMER SWJ TROC ) COOS170.1 ACY Cuosi421 DIRICI $ 1751,1 BA CCO9172.1 SIRI COost 9.1 NXZ 690.1 coom2 ) COO8117941 PYCRI CCD ST5921 POPPY S45.0 TR 50C coo $ 117.1 PYCRI COOS10.51.1 ML2705 S.S* 0.1 Port06100 CC0571931.1 ICEASC COO61471.1 SAW Coos 0,1 DE 010 : CODST.21.1 GS12 COS1107U I SPAN QODS NO.1 D & BIOR 231 € 1931 PCD 461. VIAGENS COD417,1 LOC : 122 514100 DOO CODSVORI MAGEVA OGATI 141091 P2 COSIVIMAGE 2 CU 14100 Sex COD SW101 LOCINI cCOscO1 MIROID 00514 01 OANI CC09709.1 OK7P0171710 CODA LI CTADID CODS1001 SPY COUSO 70.1 Sye ! COOSION.ILOR CODS1478.1CODS1TBRICO12 VCY COD17001 HSFY CC091471IHFYZ COO614792 REMA CCD $ 14700 1 REMYF CCO9147391 PAY CC091 48001 BOY2 coo $ 14001,1 COM CODA21 COY Y chromosome genes 31 transcripts from 27 genes

ESSICooli RPM C9011 TOFZLY COSTUI PCOHUY Ost.1 PCOHDIY CO059781 MAY COostITBIY CC06707891 PRKY COD6108LI V &PYY cc0514702I OOTY CODS14703 I UTY COSTTILI UTY COS1 UNY COost 47001 TSBY cost.IVCY OSMORI NUON AY 08021 BOOM2 0031001 CY CCD149UISMY Cosi 6705 EF AY COD 914707.1 m

Fig . 4 . U.S. Patent Sep. 29 , 2020 Sheet 6 of 36 US 10,787,712 B2

Mutation trequency )mutations/Mb( 2.8 3.5 3.1 6.2 5,5 5.8 3.2 3.8 3.5 Nucleotides Successfully analyzed Mb() 208.5 209.2 417.7 28.7 34.3 63.0 243.5 (0.3) (0.5) (0.5) (0.6) (0.0) (0.3) 0.4() UTR* 4 Mutationsinnon-coding 2 4 8 1 0 1 sequences (3.0) 5.0)( (4.1) (5.1) (4.3) (4.7) Splice sitet 17 37 54 8

(1.5) (6.4) )4.1( (3.7)3.510.4237.250.7202.728263 17(3.0) 0.3()2 (1.77

Duplication 19 3 12 15

(6.5) (5,6) 6.9() 6.3)( 18(3.1) (5.0)66 11491353(80.9)108480,716725.34.20.40.62.06.5789 Delation 48 10 13 23 (4.9)92174580.95.10.51.545475616.614 mutationswithin4bpofexon/intronboundary."Mutationsinadditionaltumorsamplestheaffectedtype*IntronicGenesmutateddiscoveryscreenweresequenced24 Nonsynonymousmutationsincodingsequences (0.5) )0.4( (0.5) (1.1) (1.1) 11colorectalandbreastcancers.*NumbersinparenthosasrefertopercentageoftotalmutationsCodingadjacentnon-codingregions13,023CCDSgenesweresequenced Insertion 3 3 6 10

(6.1) (5.3) (5.7) 8.1)( Non. sense 4271174.2)34(9.3 126(71.2)2614.72 145(77.1)4.328 qualityscoreofatleast20,untranslatedregions(UTR)within4bp5'initiationcodonor3termination.NucleotideswithPhred 482(84,0)35 600(81.9)39 1082(82.8)74 Mis gense 608(81.0)61755 Numberof mutations 574 733 1307 177 188 365 Numberof mutated genes 519 673 1149 105 137 236 mutationsSummarysomatic*ofFig.5.Table1. 519Colon Breast673 Tumor Calon Breast Total Calon Breast Total Total Screen Discovery Screen' Prevalence Screen Bothscreens combined U.S. Patent Sep. 29 , 2020 Sheet 7 of 36 US 10,787,712 B2

Table 2 Spectrum of single base substitutions * Substitutions at * pecific Screen Total number of Subathudons st G : G base pairs Substitutions at T : A base pairs dinucleotidest Tumor substitutionio CGT : : A C : GG : C C : G + A : T T : A- C : G T : A 6.c T : A - A : T 6.CpG . 6 -TACS Discovery Colon 535 325 (60.77 ( 6.7 ) 70 ( 13.1 ) 42 (7.9 ) 24 ( 4.5 ) 254 (47,5 ) 54 ( 10.1 ) Screon Breast 678 230 ( 33.9 ) 207 ( 30.6 ) 110 ( 16.2 ) ( 2.0 ) ( 4.4 ) 47 ( 6.9 ) 115 ( 17.0 ) 235 ( 34.7 ) 1213 555 (45.8 ) 243 ( 20.0 ) 180 ( 14.8 ) ( 7.9 ) ( 5,6 ) 71 ( 5,9 ) 369 ( 30.4 ) 289 (23.8 )

Provalenco Colon 161 88 ( 54.7 ) 12 ( 7.5 ) ( 14.3 ) ( 8.7 ) ( 8.1 ) ( 6.8 ) 55 ( 342 ) 25 ( 15.5 ) Screen Breast 160 59 ( 38.9 ) 32 ( 20.0 ) 38 ( 23.8 ) ( 11.3 ) 6 ( 3.1) 8 ( 6.0 ) 24 ( 15.0 ) 22 ( 13.8 ) Totat 321 147 ( 45.8 ) (13.77 61 ( 10.0 ) 32 ( 10.0 ) 18 ( 5.6 ) 19 ( 5.9 ) 79 ( 24.6 ) 47 ( 14.6 ) Coton Both screens 413 ( 52.3 ) 48 " (6.9 ) ( 13.4 ) ( 6.0 ) ( 5.0 ) 309 ( 44.4 ) 78 ( 11.4) combined Brest 28g ( 34.5 ) 239 ( 28.5 ) 148 ( 17.7 ) ( 8.6 ) 35 ( 4.2 ) 55 ( 6.6 ) 130 ( 18.6 ) 257 " ( 30.77 Toted 1534 702 ( 45.8 ) 287 (18.7 ) 241 ( 15.7) 128 ( 8.3 ) es ( 5.6 ) ( 5.9 ) 448 ( 28.2 ) 338 ( 21.9 ) * Basa substitutions in coding sequences tesutng in nonsynonymous changes well as substations in noncoding sequences are included ( 800 Table 11 Numbers in parenthaos indicato percentage of total hastions . Indicates that the values in this catogory Woro wigilicandy different between brbast and colorecta Cancon (P0.0001 ) . Includes substitutions at the corGo the 5 - CPGJ diruckkide the cathe 5 - TPC - 3 dn.diaouch , or the Gofthe 5 GAJ- Ainudtootide .

Fig . 6 U.S. Patent Sep. 29 , 2020 Sheet 8 of 36 US 10,787,712 B2

Table 3. Functional classification of CAN - genes Breast cancers Colorectal cancers CAN - Jones and CaMP scores CARgans and CaMP scords

Cellular adhesion and moulty ( uxamples : cytostdetail protein binding Go0000092 , 0 ndalon 20.0007165 . metoperdere actry Co.0004237 ) FUNB TMPRSS6 2.0 RAPH1 PKHDT 3.5 CVTN4 1.8 MYH1 2.7 COL11A1 1.0 PCCWB16 1.4 ADAMTSL ) 3.3 CHL1 1.3 SPTAN1 2.8 ONAH9 1.7 CMYA1 1.4 OASCN 3.0 MAPUNT 1,2 DONT 2.5 OBSCN 1.7 HACF1 1.3 ADAMTS18 2.7 MGC3407 1.2 TECTA 2.4 COLZAT 1.5 SYNE2 1.3 MMP2 2.3 WAP2 1.0 ADAM 12 2,3 MAGEES 1.5 NRCAM 1.1 TILL 2.2 GSN 2.2 COH10 1.5C OL 19A1 1,5 EV 2.0 COH20 2.2 SUFZ 1.5 SEMASA 1.1 ADAM29 2.0 BON 2.1 CNTNO ITGA ! CSMO 1.0 ICAMS 2.1 MBS ADAMTS15 1.8 Signaltransduction ( amates : bredt utg hande GO.0007242 receptor actty GO : 0004972 . GTPre regulator GO.0030695 ) VERHI 2.1 PFC 1.5 PRPF48 1.3 APC > 10 PTPRD 2.2 SONOT 2.1 GAB1 1.5 CENTGT 1.3 KRAS > 10 MCP 2.1 DNASELJ 1.8 ARHGEF MAPKO 1.3 EPHAJ NF1 1.9 RAPIGAI 1.6 NALP8 1.4 APC2 1.3 GUCY1A2 3.5 PTPRU 1.4 EGFL8 1.8 RGLT 1.4 STARDB 1.2 EPHBG 3.5 CD109 AMFR 1.7 PPH1E 1.4 PTPN14 TGFBR2 2.9 PHP12 CENTB1 PRORE IRTA2 GNAS 2.8 GPWMB 1.7 CNNM4 RASGRF2 1.1 RET 23 INHBE ALS2CL 1.3 MTMRJ P2RY16 2.2 FW10458 1.8 RASAL2 1.3 LGRÉ 2.2 Tramcriptional rogutation ( numpta : nautidon oftmtetption GO.0045449 , ne torrger 22 -notype PROO7036 ) TP53 > 10 CHOS 1.8 ZFPS 1.4 TP50 > 10 ZNF442 1 .. F219670 CIC 1.7 ZNF569 1.4 SMALL 4.8 SMADU 1.9 SOX 2.5 KEAP 1.8 EHMTT 1.3 MLLS 3.7 EYA 1.5 KIAA0934 2.5 HOXAJ 1.6 ZFYVE26 1.2 TEX22 3.3 PKNOXs LRRFIP1 2 . TCF1 1.6 OCL11A 1.1 SMAO2 3.1 NKRNJ 1.3 GUT 2.3 HDACA 1.6 ZNFJ 18 TCF72 2.8 REX2 2.1 AYOD1 1.5 HIST1H18 2.5 ZCSLJ 1.8 NCOA6 1.5 RUNX1T1 2.4 Transport ( enamples : len traportar activity GO.0015078 , igand pated lon channel activity Q0 :0015276 , carrier acthtty GO.0005386 ) ATPa81 3.1 ABCB8 1.7 ABCA 10 1 . ABCAT 2.8 Cbon29 1.1 CUBN 2.5 KPNA6 1.7 SCNN 18 1.3 SLC29AT 1.0 GRIN2D 2.4 ABCAJ 1.7 NUP133 1.1 SCNSB 1.9 HOLBP 2.2 SLCYA2 1.8 PZRX 1.3 NUP714 1.8 SLC & AJ 1.5 KCNQ5 1.2 Callular motobollom ( amples : aromate compound castbollar 00 : 0008725 , generation ol precursor motabottes GO : 0018145 , biosynthesis GO : 2009038 ) ACADM 2.0 MCOSOR 1.7 PHACS UQCRCZ PRPS1 1.8 ASL 1.8 XOH 1.3 ACSLS 1.8 CYPIAT 1.7 GALNT5 GALNS 1.2 Intracellular tanlcking (orampla : endoplotne rotatum torpedro sequena PROO0388 . membrane toplon GO : 0006944 ) OTOF 2-2 PLEKHAS KTN1 1.5 SYNET 2.3 PRXD1 1.9 LABA 2.1 LOC283949 1,7 GGAL SECALI 2.2 LRP2 1.2 AEGP 1.8 SORLI 1.7 SDBCAG 2.2 RNA motabollam ( examples : RIK processing 00.0008353, RNA aptico de selection GO : 0004376 ) C140 - t155 RNUSIP2 1.7 KIAA0427 1.5 SFR $ 6 1.3 SP110 1.6 C22019 1.5 ODX10 1.310:51 Othey ( anmplo : ftpone to ONA dogo KAKO G0,0008974 . protien ubiquitraton 20.0016367 ) FW40869 2.1 SERPINB1 1.4 FOUXWI 5.1 KURSU 1.2 ARCAT 20 UHRFZ 1.5 CD248 1.2 MRELIA 1.8 1 LMO7 1.3 ERCC6 1,0 Unknown

KIAA 1832 2.4 KIAA0999 1.3 C 100-13T 2.1 KIAA 1409 1.0 MGC24047 2.1 LOC157607 2.0 C150rz 1.0 * CAN - gondo woo osolynod to funcional dassos usno Gano Ontology (GO ) groups , INTERPRO domains and Avaltabla utoraturo . Ropresentativo GO groups and INTERPRO domains to ested for each dass . Fig . 7 U.S. Patent Sep. 29 , 2020 Sheet 9 of 36 US 10,787,712 B2

Fig. 8 Table $ 1 . Primers used for PCR amplification and sequencing *

CCD6 Coding on Forward primer Rani prtiner accanalan Numbos Ganonla portion posion ' Soqueica postioneReative Sequena " FLKzas chr : 801042860434 113GCCCTTCCACCCTAGTTCTTC CCCACTACTGCTT GCTGAGG 254 113 CYGTTGGGTGTCTACCTTCEC TGGGMATTAGGCITCTGCTG CODSV1 014632-914883 75 41 GTGCCTGGAGUACCTCICAC GCCTCAGCACAGGAATGG to1.916893-910829 CACCICAGTGTTCT ACGCCAG +88 N13AGAGCTGAACACAGTGCGG UN 01.017658-17774 .183 CCCCGCCGAGATTAATTG +74 MCCCTACCCGGTCCGTCTC cs8+ M13 GAGACGGACCCGGT AGGG 182 GGTCAGCACCAGCAGGG * 6 1,812081-818531 CTGCGGAGCAGMACCIG 400 M1GOCCACCIGTGTGGAAGTAG 905 CACAGATGGCTOGGAAGAC +121 MIXCTCCTGAOOGTCGTGTGC c?1 -177 M15 - CTAGATCCTTCCAGAGGGCAC CCATCCTTTCCASGGASGTAG # 1 : 8102200o33 .134 M13 CCTCACACTCAAACCCAACAC GACAAGGGCTGCTCTCCTG 1818078 GAGTGAGGTCAGGGTCTCCAG M13 ACOGAWAGA MATAWAGCGGTG DXFZPS0AC60 chr : # 34737-934783 GAGAACCATAGAGCCACTOGG M13MAGCOCGANGCTAGGMACTC ht : 834451-834004 97 113.GTGGGTGTCTGTAICCAGGG +176 CCTGCCTAGGACAGAGTTTGG waUNwellava 1 :92821-542788 HISTGMGGGAGTAGACTGAOCCTG +58 CTTCCTGCACAGAAAGGCTG am1.942410 - S2548 128 GGAGAGCTCTGAGGAGGAGAS +183 MISTTGTCAÇTTGCGCT GAAGAG t? :517-18 -70 M13CCAACCTCTGCCCTATCTCIG +52 AAAGGCCTCGATGTACTCACG C194488 113 - AGTGCTGAGGCCACMTG TTGCCATGTCTCTGTCCT AGC ch : 928628.82.605 AGTOGTAGAGGCT ATGCTGGC M13.GTCTCCCACINGACAGGAGCC 1:29:15 -123 13.TCGGCCATACAGGTGCTATTC +164 GACI GCCTGAGACAGAOC ch1 : 020807-6ca11 AGOTGCTITGCGMGAGCTG +141 WAGGTGCICTGTGAGACATTCG 10 : 28.933 89 MIS ANGGOCCACGTOTT CACAG +147 GTCTCNCCIATOCACCIC 11 du 2. AGGALATCATTCCTGTCCCG MIS TCCAGAAT CCAGAGCATCTCC 12 1:09:30 * 724 MISACGFGCCTTGTCCTGCITTAG 173 GTGAGACCOGTGACAAGGAG chm : 2406 2.024728 TATCTCTTGTTTCGGGTTGGG +85 MZUGTCCATGCTTGMCTTGGAGG think this -150 M1ATCGACCICATGGTCT COC +70 ACMAGGCCACCTCCTACCAG 16 dhn : 921824922089 MI CAACAGCTATGCACTTGAGOC GTCAGOTTCTCCCAGGCTTC 18 ch : 921e9s -021809 -190 GASCAGCAGGCAGTGGTTAG MICGCCCTGGICTCAAGTCAT AG +7 ch : 921040-921178 -161 MACTTGGACGATCGCITTGTG MCTCGTGCCTCTGGGAAGTC 18 ch : 970979020669 -187 M13AGIGMGGCCTACTGGGATTG +12 TGCCAGAGAACAGAGCATTTG 18 cha : 920x1602873 -137 M13GCCMATGCTCTGTTCTCTGG +100 AAGCCTGTCCCGTGTCTACTG CODS41 DOP434H2010 chri : 94107a 942061 -13 NI3CTCT TCCAGMAGGCICCACC # 766 TAGTGGKAGAGCTTGTTGGCG 2 chr : 04160_042250 200 M12 AGACTTCCCGAC GTACGAC +70 GGAASACOCT GAGCTGCAC 1.945722-945870 GTCCTGT AGCTGTGTGGATGC MIS -GIACCAGTCGCTGACATCCTG chota -146 H13 MAAGTTGTGCATTACGCCAAG +141 AACACCTGTGATCTGGAAGGC ch : 948122-948205 -154 113 CTGCTACCTGGAGCTATTCCC +75 ACACATACACACACGTGCTCC CM :940325.046453 85 CCTGACCCAGGACTTGGAG # 165 MICICGAGGCACAGACAGCAC 7 chat : 94665848455 ITTACCACCTCGKGANGCAGAC +78 MIZCACGCGATGAGGGAACTG du1.340770-945851 -185 NIS.GCAGTGCTGTCTGTGCCTC +68 CGARATACACGTTCCTCCTGC do1 : 947571-847597 -112 MICCAGCTCTCCAAGTACCCNS +17 TGUNSTAGRACGIANGCG 10 chr1 : 047734047871 GACGCCOGACTCTTTAGTGG MIVAOGTCGGTCAGGCTGATCTC 11 du1.948307-048457 118 MISGCGACAGATAVGACTTCGTCC + 103 MACTCTCIGACGC GCVAGG 12 ?? : 48 N13 - MACTCAGACT GGAGGGAGCG +118 GCT AGACAGCCTAGGCCAC 13 ch : 948949087 M13LCAGTTGTOCI GGAGCCAOC +00 CIGAACAGACCTCAGGCTTGG 14 chr : 848778-848488 MISCARGCCTGAGGTCTGTTGAGG TCCCTCAGAGT CCCMAGAGG 15 d : 80 % -272 CTCAGCTTGTGAGTAGCAGO M13 - GGTAGGGAAGGCAGAGAYGTG 10 cn1 : 840888-960022 80 MISTGCCTGTGACAGGTGAGTAAGG +78 TGGGTICAGACCCTGACTTG CUDS5.1 HESA 1 cht: 076312976420 167 AGGCCITAATAGGGAWAOGO +78 MISATGASCGGCTTGGAGGAC cut.974072-975060 -146 M16.CCGAGCGCGTATTAACGAG GACACAGGAGGAGAGGTCGG 4 cht : 974505974878 142 GAGATGACOGTGAGACACCTG M13 - TCTGCTACAGTCTCGGCAAG OCO90.1 G1P 1 chn : 9820-8 & urs -110 NISCITATAATAGGGCCGGTGCTG 182 CCCCITT ACCT GCTAGGGTG 2 chu1.989430.813 ACOCTAGCAGGTAAAGGGAGG 351 MIS GTCAGOCAGAACAGGTCGTC 03 ATGTOGGTGT CAGAGCTGAAG +57 MSGAGGOGGCCATTTCTCTTTAC CODS7.5 FLJ20684 chr : 10624 41.1062481 -128 M13CTCGCTTTCATATTTCCGTCC 200 TACCCCCCITTAGAGATGTGG d?ngn? TCAGGCATGTTGAGAGAGCAG M1SACTCCAGTCTGAGGCCCATC 9 cht : 1068783.10saacg 207 113.GAATGTGGCAGGACCGAG CAGAGT GAGGACTCGGGATG cht.105827-1058880 CGAGTCCTCACTCTGCCTTTC MISCACTCAGCCTGTGTCTGTGG 23 TCTGGATCICAGCTGGATTTG 151 MISCUGATGGAGAMCGGTCTGTC 6 o 1.1050186.1058290 -138 M13 CCCACCTCGTCAGAGTAARCAG +62 CAACACTTTGTCCTGGTTCCC C058.1 FLO910 1 ch : 1166058 1166843 MIS - AGTGGGCAGCTCCCGTAG AGTAGGAGCTGATGCTGOGAG 2 ctn 1155785 1166904 118 113 - GGTCCCACTGMT CCCAC +748 GAGGAGCTTGTTGTTGGGAAG 3 ct 1 : 1156003.1166163 M13.CACAGGGCAGGTTGGAGG TAMGGACAGGTGGAAGGTGG 1 : 15431012 -121 MISTCCTCCACCACACTCACAG +112 TGGOTGAACCTCTGACT CT AGC 6 dy1 : 11670 1137748 MIS - ACAGGCTGGGCCTCAAAC + 117 CTTCCTGACCACCTCGICIC chat : 1158178-316030 -124 NGGGCCAAGGTTGGIATG +52 M13GCTGACTGCACCAGIGGG 1 :116022-189394 126 113 GAGGTCACACCTGGGACAGAG +10 TACITCCAGGCCTGAGACACC cm ,110027-1100445 AGCCAGTCTCCAGGCACC M1.CACACGGTCAGGTCACACTIC CS1 THFRSF98 1 don : 1181887.1181874 -177 M13CTCCTCACACGCACTICAOC +3 CCTCCTTABACCTCAGCNCG 2 ct01 : 1180072-1780785 M13.GAGAACGCACAACCTCACTCC GAGALAG CAGGGACACGACAC $ ctu 1 : 1179701-1178789 TTCTACICAGCAOCCAGACCC + 16A M13 ACTGGGTGCAGCTGGAAT AC ctv1: 1178893-1170263 AGCTTGCACTGCACATCTGG MISACCATGCATCCACTCAGGTC CODS10.1 TNFRS18 4 ch ; Ta- tin M13GAGGMAGGGTCCTCTCCIGTC +84 AGCAGCAGCTGGGTCICTG 5 chr1.1178140-11707 ACATCTGGCAGTGAGGAGTC 108 M13 - TCCTGCACCCACTTCTGC COD $ 11,1 TNFRSF4 chan : 11607285.1188430 88 M13CTCCTCTGCCCTCCTCCC +28 CGTCOTTGTAGAAGCCCG 2 tr1: 41 26-11EB88 CCMAGCCTGGCAGAGGAG MISLOTTGAGGTTCGTTTCTGCG o1 : 1188294-3188599 84 CHACCTGTCCTCCAGTGCC M19 - ACAAAGATAGGGTGGTCAGOG c1: 11878 * 0.116000 MIS AGAGGOCAMACOCACCAC 154 CAACCAGGTCCAGCCACATAG 6 cht : 1187244-1187441 -109 TGTGGTAGATGCTGCCTGTG M13_CTACAGGGCCAGCAGGATC e ann : 1107000-1187195 -76 MI3CAACCCGAATAGGAGNAGGG ATCTTGGCCAGGGTGGAG 7 cut : 1185967-11 & 8929 283 COCGMTAGGAGAAGGG +110 M13.GCACCTAGAACGGTGCAGAG Wen multiplo CcOS anles aedeived tom to samo gene the primarsta chared oxane aeftated under the CCDS entry with the lowest ordinol Funbor . Coding oxong lager Utan 350 bpworo amplidod and sequenced wo muito pa no pale position a the 5 and at tawad PCR prima relative to the firm based the ean . 41 denotes the universal sequencing primar 5 . GTAALACGACGGOCAGT - 5 . "Unsigned abors Indicato pastan a to send a totevase PCR amerdatvo s the first base of the exon Plue ogns indiato position of the F and of tho toverso tumaPCR primer sorpos teledve analyzed to the in lost the basoDiscovery a no Scroon exon . ." The pulmas pak dd na moct au quality aiela nhat 280 % af bases by to targa region have a Phied quality score of at least 200 tra questes of the U.S. Patent Sep. 29 , 2020 Sheet 10 of 36 US 10,787,712 B2

Fig . 9. Table S2A . Characteristics of the colorectal cancer samples Patent Clinical age Sex Tissue derivation Location of original Sample type Screen (years ) tumor Stage C074 35 Llver metastasis Sigmoid Cell line Discovery Co92 46 Liver metastasis Right colon I Cell line Discovery Co108 77 F Liver metastasis Right colon Cell line Discovery MX22 66 Liver metastasis Unknown IV Xenograft Discovery MX27 74 Liver metastasis Right colon IV Xenograft Discovery Mx30 62 F Liver metastasis Sigmoid TV Xenograft Discovery Mx32 56 F Liver metastasis Right colon IV Xenograft Discovery Mx38 67 Liver metastasis Rectum Xenograft Discovery Mx41 57 3S Liver metastasis Right colon Xenograft Discovery MX42 72 Liver metastasis Left colon N Xenograft Discovery MX43 72 Liver metastasis Sigmoid Xenograft Discovery Co79 81 M Lymph node metastasis Right colon Cell line Validation Co82 80 Primary colorectal tumor Right colon Cell line Validation Co84 Lymph node metastasis Right colon Cell line Validation Co94 46 Lymph node metastasis Rectum Cell line Validation Mx3 64 Primary colorectal tumor Right colon Xenograft Validation Mx8 65 *TI3 Primary colorectal tumor rectal ZZZS Xenograft Validation MX26 45 Liver metastasis Right colon Xenograft Validation Mx29 51 Liver metastasis Left colon N Xenograft Validation MX31 50 Liver metastasis Rectum Xenograft Validation MX34 82 Lymph node metastasis Right colon IV Xenograft Validation Mx35 57 Lung metastasis Rectum IV Xenograft Validation MX40 75 Lymph node metastasis Right colon Xenograft Validation MX45 67 F Liver metastasis Transverse colon M Xenograft Validation Hx005 62 F Liver metastasis Splenic flexure Xenograft Validation Hx169 68 M Liver metastasis Rectum IV Xenograft Validation Hx172 69 Liver metastasis Unknown IV Xenograft Validation Hx174 73 Liver metastasis Sigmoid IV Xenograft Validation Hx185 39 They3TIn3I1m3 Liver metastasis Rectosigmoid Xenograft Valldation Hx188 60 Liver metastasis Left Xenograft Validation Hx189 72 Liver metastasis Left Xenograft Validation Hx190 73 Liver metastasis Right Xenograft Validation Hx206 54 Llver metastasis Rectum Xenograft Validation Hx218 56 Liver metastasis Left IV Xenograft Validation HX219 69 Liver metastasis Cecum IV Xenograft Validation Hx220 83 Liver metastasis Right IV Xenograft Validation Hx223 45 Liver metastasis Rectosigmoid Xenograft Validation U.S. Patent Sep. 29 , 2020 Sheet 11 of 36 US 10,787,712 B2

Flg . 10. Table S2B . Characteristics of the breast cancer samples Patent ER PR Adenocorcinoma Tissue derivation Stage Hor - nou Sample type Screen (years ) Type status status atatus * HCC1008 67 Ducta ! Lymph node IIA Ce ! One Discovery HCC1954 61 Ducta ) Primary breast tumor JIA NA Ceft line Discovery HCC38 50 Ductal Primary breast tumor Cen line Discovery HCC1143 52 Primary breast tumor JIA Cel me Discovery HCC1187 Ductat Primary breast tumor IA Ceð hne Discovery HCC1395 43 Ductat Primary breast tumor Cell line Discovery HCC1 599 Ductal Primary breast tumor TIA Cel line Discovery HCC1937 24 Ductal Primary breast tumor VIB Cell line Discovery HCC2157 48 Ductal Primary breast tumor IIIA Cel line Discovery HCC2218 38 Ductat Primary breast tumor TIA Cell line Discovery H8578T 74 Carcinosarcoma Primary breast tumor NIA + Cen line Discovery HCC2713 25 Ductal Primary breast tumor 1 NA Cell line Validation BB1T 51 Ductal Primary breast tumor ( 11C . Microdissected tumor tissue Validation BB2Y Oucta ! Primary breast tumor IIA Microdissected tumor tissue Validation BB3T 56 Ductal Primary breast tumor Microdissected tumor tissue Valldaton BBAT 52 Lobular Primary breast tumor ITIA Microdissected tumor tissue Validation BB5T 42 Ductat Primary breast tumor Microdissected tumor tissue Validation BB7T 59 Ductal Primary breast tumor IIA Microdissected tumor tissue Valldaton BBST Ductal Pomary breast tumor IA Microdiasedad tumor tissue Validation B010T 55 Ductal Primary breast tumor Microdissected tumor tsue Validation BB12T 58 Ductal Pamary breast tumor DLA Microdlasected tumor tissue Validation 8313T 83 Ducts ! Primary breast tumor INIC Microdissected tumor tissue Validation 8814T 74 Ductat Primary breast tumor IIA Microdissected tumor tissue Validation 0815T 79 Ductal Primary breast tumor UIB Microdissected tumor tissue Varldation BB 16T Ductat Primary breast tumor 11B Microdissected tumor tissue Validation 8B18T 53 Ductal Primary breast tumor IA Microwdissected humor tissue Validation BB20T 83 Ductat Primary breast tumor HA Microdissected tumor tissue Validation BB2 11 Ductal Primary breast tumor IIIA Microdissected tumor tissue Validation BB22T 50 Ductat Primary breast tumor Microdissected tumor tissue Validation BA237 46 Ductolubular Primary breast tumor Microdissected tumor tissue Validation BB24T 08 Ductal Primary breast tumor IIA Microdissected tumor tissue Validation BBZ7T 46 Ductal Primary breast tumor WA Microdissected tumor tissue Validation BB28T Ductat Primary breast tumor IIIA Microdissected tumor tissue Validation BA29T 54 Ductal Primary breast tumor IA + Microdissected tumor tissue Validation BA3OT 60 Ductal Primary breast tumor 11B Microdissected tumor issue Validation BB31T 56 Ductal Primary breast tumor JIA Microdissected tumor tissue Validation BB32T 52 Ductal Primary broast tumor NA + Microdissected tumor tissue Validation BB33T Ductal Primary breast tumor Mlerodissected tumor tissue Valldation BB34T 36 Ductoiubutar Primary breast tumor ILA Microdissected tumor tissue Vaildation ABUST 67 Ductal Primary breast tumor IV NA Microdissected tumor tissue Valldation BB36T 60 Dructat Primary breast tumor Microdissacted tumor tissue Validation BB37T 47 Ductat Primary breast tumor IA Microdissected tumor tissue Validation BB38T 39 Ducta ) Primary breagt tumor + Microdissected tumor tissue Validation BB39T 39 Lobular Primary breast tumor UB Mlcrodissected tumor tissue Validation BB4OT 43 Ductal Primary broast tumor HA Microdissocted tumor tissue Validation 8842T 56 Ducta ! Primary breast tumor Microdissected tumor tissue Validation BB43T 54 Ducto?ubular Primary breast tumor NA Microdissected tumor tissue Validation AB441 46 Ductofubular Primary breast tumor 1 Microdissected tumor Ussua Validation Estrogen receptor ( ER ) and progesterone receptor ( PR ) status as determined by immunohistochemistry . , negative ; , positive ; * Her - 2 / neu status ; - , tegative ; , low positive , ++ , moderately positive or +++ strongly positive ; NA , data not avallabie . U.S. Patent Sep. 29 , 2020 Sheet 12 of 36 US 10,787,712 B2

Nucleoddes successfully sequanced(Kbyt 18,447 10,003 18,023 18,031 10,100 18,084 18,421 18,158 19,132 10,162 18,851 10,105 19,141(0.0) 18,070(2.2) (0.0)18,832 10,122(0.0) (0.0)18,0820 18,0810(0.0) (2.6) (1.7) (0.0) (8.5) (4.3) (2.1) (5.8) (0.0) 12.03 (2.0) 11.118,878()3.771 Duplication 2 1 O 2 1 O 1 (8.2)0,00.0919,021O (1.3) 6,8) (10.4) (1.3) (1.7) (0.01 (0.0) (8,5) (3.5) (2.8) (2.0)

1 1 (0.0)13.66 (0.0)0 Datation 1 NNNNOWO 11.1()22219,0381.90.01216

(0,0)5 (0.010 (0.01) (0.0) (0.0) (2.3) (0.0) (2.1) (0,0) (0.0) (2.0) (0.0) (0.01 (0.0) (125)12.53.827

1 0 OOOO ON Insertion 0 1 1 0 0 0

15.8)( (0.5) (6.0) (6.4) (18.1) (4.3) (11.8) 14.3() (5.9) (6.0) TAC 18,970(11.9)65,10.90,00.011O01.80.085.513 3 (38.8)13.6 (25.0)8.312 Substationsspecificat 12 5 2 3 S 2 6 10 (48.6) dinudootidos (20.8) (47.5) (58.a) 53.2)( (65.3) (20.0) 51.0() 29.4 (47.11 (58.0) (1.4)2 Cpo (30.8)11.23.110.31110 16 26 25 25 26 8 24 15 28 (32.1)1.818 18.5()8.3310 (15.6)4.41328.872.28.90.01021

(8.3) (7.8) (1.77 (6.8) (0.0) (2.1) (32) (0.0) (5.9) (4.3) (7.8) (4.0) 12.7(59.1)17.318229.1167so (4.5)1.1134.1B.B1636.824

1 3 0 1 1 O 3 3 2

TAGT:A,ACGC inaudosCAN.gonts,candidatoancaganes'percentageoflotemutationw.*1)NumbersinparenthesesindicadacodingsequencesaroInduded(naeTablechangaaaawolassubstitutionanon-soquercosneplatingnonsynonymoutBedsnubstitutionsincoding (8.4) (3.8) (4.3) (2.0) (4.0) (5.4) SubstitutionsatTAbusapalm 13.0)( 8.8)( (9.1) (8.5) (10.6) (5.5)7.811.82107 (25.7)10.0134.32B11.42.918027.125.720.0912914 3(0.3)8.3 10 4 2 3 2 5 2 3 1N 2

mutatlanaBosasubstitution (10.4) )8.5( (0.1) (2.1) (0.0) 10.6)( (13.7) (3.0) (4.0) 22.2(11.1)18.55623

T: 8 1 3 5 7 5 2 29.8)2 (20.8) (12.6) (2.3) 14.6() (9.7) (8.5) (13.7) (15.7) 9.8)( (10,0) (9.1)

(30.6)11.2154 8 1 3 7 3 7 11 5 0GCC:Q-AUT 10 25.020.821.4()915212 Phoedqualityscoreofatleast20.-3'dinudeotideWudlootideswithCpG3'anudoolda3'dinudeotide,ortheGSGPACof5TOCTubstitutionsatthoCofS

(4.3) (7.8) (3.9) (20) Substitutions&C:bikepalis (13.0) (6.8) 2.3)( (8.5) (6.5) (5.77 20.827.110()20.B13 (44.0)3935.81311.046

1 4 2 2 2 4 2 1 (28.5)27.312135 (30.2)23.813521 10 (80.0)6.7273 29.1()37.837

(22.2)1 131.2) (59.3) (88.2) (83.8) 58.6)( (58.1) (58.6) (43.1) (80.0) 827() 172.0) 30(30.6)30 20.4)(11 C:G-TA

24 35 so 28 10 28 42 32 38 6

7 9 9 @ 10 5 19 12 Fig.11.TableS3Distributionofmutationsinindividualcancers* Nunborof mutatodCAN ganes 16 11 6 3 10 15 9 TO 23 11 11 23 16

Numberof mutubong 77 58 31 51 70 $1 50 45 65 58 127 70 109 27 Cororoctalcancer Boostcondon Tumor namo C074 Co92 C0108 MX2 M27 MAIO MX32 MAS MX41 MX42 MX43 Avenge HCC1006 HCC1954 HCM8 HCC1143 HCC1167 HCC1395 HCC1589 HCC1937 MCN157 HCC2218 M2.78T Avongo U.S. Patent Sep. 29 , 2020 Sheet 13 of 36 US 10,787,712 B2

Fig . 12. Table S4 . Somatic mutations identified in breast or colorectal cancers CCDS Tumor coulon Nucleotide fenomka Nurchmetdu (CONA Amino acid ( protein CCD97.1 FL20581 HCC1005 g.ch:103:27011055271dokGCTACOTC 683 AgodaGCTACGTC CCDS8.1 FLB8118 Cot08 ochr1 : 11555253 > A 4. 169GA PLASTT CC 12.1 Cabs chr1 : 1199158GA PA3481 CCES37.1 PRKOZ g.ch:1:21388800T p.8514F CD 12.1 PNO MW g.ctot : 24780180A p.475X CCOS $ 1,1 KM 1183 Mod2 p.chr1 : 373581DAT 6.579AT p . 1030 CCOS $ 7.1 CNDS BB BOUT ht:6142550CA 139A D.V45W CCDS $ 7.1 HCC1008 . : 6383890A 3550 P.D $ 39N CCS $ 7.1 CHD BR231 cy :8138193 > G 1994 P.R8876 TNRSF25 Droost HC1143 ochr ; 84.589710 > T 3700T p.61244 TARBED acrt : 7913180AG A 749A > G AE2503 CO3142.1 PLOOT HC02157 ochrt : 115447466 > p.1234 CCD3184.5 SPEN ABTT 0.9 : 18001008 + 2988CC CC03104.1 SPEN Braon HCC11B7 ct: 18002504OT 4483G - T P.R14 ** co9189.7 MOC24047 Bro - *** 8912T .cht: 180777810T 4. 164GT p.GW CCOS100.1 M1017 BAR HCC1385 g.cto 1 : 180778330 - T thomozypous ) € 29BGST DG 100W CC09172.7 LOC74955 Boon 578T w.ch:18403737T PP249 CCD8179.1 HCC1589 cht: 1734864TQXChromozygous ) < 1525G C D.GOOOR CCO31821 FW1052t Colorado p.chr 1 : 17073257CT 287C - T PASSV MGC15730 Cooruc Co g.ch:184591220Thomaryo ) c.14000T PT4871 CCD9189.5 RBAF8oo HCC1107 Schr : 197374090A 4181G AR130H CCDS189.1 RBAF800 Brdo BASIT acant : 1917850119178501dup Thomazypous ) € 12281 ht CcO3710.5 RAPIC1 H3701 9.c1: 21693425T > p.57R CCDS216.1 PAPIGA 1 Orcast BB2OT o.chr1 : 21070252ANG C1820A . p.Yenec CCD6228,5 CIQB Bkvant HCC138 % ht: 227577906 » A thororypoun ) 3876 P.A1237 CCES33.1 ZNF430 H 370T g.chrt : 23434593TG 5891 p.C 1960 CCOS233 Doeflt Colorecta M41 D.chri :2508155GA 4 1849GA 940177 CCDSX44.1 FUCAT HCC - 1000 g.cht : 23839685dec 6203480 CCD73.1 HCC1003 gd :21432214CT 4620CST RHD Braast Bicht: 253545360 P.S1036 CCOS283 . FW3483 ) Calama M2 g.chrt : 2804207 > A CROA CcOS28.1 MAP3KB Broast ch : 273716510A MGA CCD8299.1 HCG100S B.1: 27309223CA c.260SCSA p.PASST CCOS310.1 TXIZ Breast HCC1395 0.ch:2700-2800 p.POOR PYPRU Cotondo 1.1: 29439136CT c.248BCT p.X630Y ccc3354.1 PTPRU Colorocta MB o . 1 : 28439191CT c . 25000T P.RB35W ccc9334.1 PTPRU Colorecta o.chr : 204510420T c.25880T P.RBSEC CC0837.1 SPOCO HCC1854 Qahr1310331930T c.2011CT P.ROTIW ZUTBO Colorado Qchr1 : 32805359G A homonymous ) p.2101K CC09368.1 22 Colardan M190 0.ch1 : 35518081dal 4. 1290detA CCOO3O9.1 Cobretot 0 : 35550377CST # 728CT D.R1410XY CCD9392.1 NCON Coloractat 276 ch1: 35807116C > T G 1174G > T p . 38ZL MCON Cotorocta Qdh1: 35007117T > A 4 1175TA p VYZE CSPN HCC1054 ca - s838890 C1318AG PHAIR CCOSA 18.1 GRIK Colorectory 1 : 370069700A GOHGA p.12154 CCD9410.1 GRIKS Breast HCC1000 g.ch:3698835OG>C 1171G C A D391H CC09420.1 DNUT Colorocta COS Ochr1 : 37884153CG CCD0438.1 MAC 1 Bron # 1 o.c :39416255A Y P.EXORV CCD3435.1 MCFT BOTT Qart: 3857213838572130TLA AB458246nsh CCD9435.1 MACFA HOC 39 oot: 39 :597270G € 12510G P.E.S040 CCD3433.1 MACF1 Braort BET ochr1 : 39593705A . 184046 p.G3135E NFYC Brdas HCC2218 g.chrt: 40892093GC p.Q165H Colorado Co74 ach : 41718112CA c.14300 p.V48MM CCCX300 . GC89 HCC 1999 p.chrt : 43407800CT p.A107 CCOSSO3.1 ATPEVOB Breant HCC 1599 g.chr1 : 44141853GA P.V1551 CCD9523.1 MUFA Brom HCC 1000 g.ch:16475314C-T 4.298CT p.a100X CCOS.33.1 FAAH Brent HCC 1637 w.chrt : 46506733CA 10340 PA345D C0083771 Bromst HCC 393 g.chri : S31382030 A PA155D CCO3574,1 OLCIAT Cotured Co74 o.ch:533zpozzo c121C5T P.R410 CCD9504,1 D107 A 10,1 Cordoctor 30 o.chr4049012C > T 4.4750T p.R159x Dreast HCC1500 p.8103Y CCDsoo5.1 PRKM2 Broaut HCC1187 Q.ch/1:56.1987CA 4 1191CA P.P371T cosos . PRKUA2 Brosu HCC2157 g.chart : 58805315APO p.33230 co9808 . ONAS Colorectat p.c1: 5871425BC 4.87800 D.LV CC03017.1 MOX1 Broost HCC1395 ochr 1 :60038176C > T P. & 4331 CCD $$ 14.1 MGCA WC2157 9.1: 80218718 A.Q1S1E Ccos 20.1 ROR ) BTOR HCC 1008 g.ch 1 :0435501G > T 1838G > T DESED CCOS $ 45.1 RRCT HCC1037 D.ch:1:70163976C>A (homozygous ) 4.7030A p.L7351 NO.1 LRACT Biro BB1T g.ch:70183992:04 C.715de CCD8884,1 TNX Color Cotoa g.ch:74817201CG c18asCG P.R $ 290 CLOS868_1 Brod HC216 . : 7550240A > G 1ANG wknow ACAD Brdo # 68ST q.or1 :73912904 438 $ CG p.P132R CCDS877.1 2 Colorectal C974 Ochr1 : 7780885CT 4.136CT P.P4588 CCD9707.1 F20720 Colorecta motic500397 D.L45 CC097081 CUCA Brast HCC1393 Q.cst :6631170GA 916 > A A0734E CCO3715.1 QTFZD Colorectat D.ch:6903705->A P.R1320 cco9731.1 ZNFOR w.chr1: 911187750 > 1576 P.E. CCD9747.1 ABCM PDAT HCC1589 p.chrt : 9442784BBCT 407107 AT224N cco9740.1 PARGI Brons 9.043004400 1055CO p . 8553C CC09748.1 PARO1 Bay w.chr1 : 368412T> C 1812 > CCD9789.1 Colorectas 9.crt: 4000705810T 14770 - T ADABY CCD9778.1 COL11A1 Broant g.ch:tagoo 100CT 0.3977CY PA1328V CC0977a , 1 COLIAI 67 Ochrt : 101001204CA c . 38820 p.Q14.28X CC09778.1 COLITA1 Brest w.chr 1 : 103091283AT 3991T p.Q1328L CCO9783,1 Bron Ayt: 1000101110T < 11510T p.2385x cco9704.4 KMA1324 w.chyt: 109.45332240 024BSAC p.8KOR AMPO g.ch:100003704G-A ( homozygous ) 22050 > A P.R782H U.S. Patent Sep. 29 , 2020 Sheet 14 of 36 US 10,787,712 B2

Figure 12 - Continued

ccT38051 AMPD2 Bria KCC1395 Achm : 1098756870A C. 1OCA CCD3821,1 KCNC Colocco Hoc13 .chrt: 110469245_1104602 47da1CAQ C.B2_4to AG P.E28cal COS024,1 HEXIP W220 Ochr1 : 110881000 110681007do CA c.317_318doXCA 13 CCOgazo , 1 KCNA10 Colorecta ! Co74 chri: 1107726530 > A 65986A P.R2009 CCoSa34.5 OVGP1 Corrocta Co 103 adot: 1116881BOTA € 1985T > p.1682 CCD8.32.1 AD028 Colorectal MX30 p.chr : 111757700GA 4.313G > A P.A 105T CCOSB 3.1 KCN3 Cobrada ochr 1 : 1122371110A c780GA p.YOU CCD9874,1 8C482 Colorstad Co82 g.chr1 : 1144302501 c.418 p.N1398 CCD9878.7 AMPDI Colorocta Mr42 p.chr : 1149280480A 1B9 &OA APSK3H CCD9889.7 Breast HCC1187 O.chm1 : 1170191BG > A 4.850GMA p.02174 CCD9599,1 Cotorocta Co82 Ochr : 110240128T > O 65121T * p.D1707E CcOS938.1 HOSTAA HCC1008 :18 RA Q.1976 P.A53T CCOS889.1 TCFLI HCC1008 Qar1 : 747902336A > 0.852AG p . 18V CCOS 1071,1 ADUR HCC1395 gart : 151375812AT c.2417A > T p . EROSV CCD31074,5 PEXP Colorecta Cot08 ger : 1517338320T 6493CT p.R 105W CCES1099 , MUT Colorecta M42 Qchrt : 1316727BOGA g.chrt: 151978710161978702de GGMACGGTGTGAGGA CCO91090,1 TH093 ( homozygous ) 2860_2074da GGMAGGGTGTGAGGA P.G954 X857de ! CC081080.1 TH083 Bron 8840T gunt : 151978713A > 2062A > p.78553 C10-12 Broen g.ch:152033577CT c . 1073T P.SUS8F CCDRt108.1 HCNO Broen HCCI 143 0.cht: 15208683SCT 1820T SP CcDg11e5.1 IRTA Broent HCO2 157 dut: 154307371CG 2080CG p . $ 8a7c CC091185.1 IRTA BOTT o.c : 154290031CM V818 - CG IP CCD81107.1 FCRIO HCCZ 157 Acx : 16178270CA p.H 45W CCD91120,1 Broaut HCC1143 .chrt : 1503713700 > A 4.4216 P.G1418 CCOS1100.1 108F9 Mox43 chyt: 150717774C > T c.2001OT P.R611W CCD31207.1 SLAMP HCC1000 0.01: 157420228CT c.241CT p.la1F CCD31277.1 FW12770 Colorecta Ca 100 g.ch:1580105200>A 4.298G > p.D100N CCD91259 . POU21 Brdan KCC210 g.ch:184077881CT c.2630T P.SABF CC091281.1 FS Calooctal M32 w.chr1 : 16A243863T > 4.2023T > G p.9775A ccda171.1 RASAL Colowoda ! C982 .chrt : $75143548T > A 055TA p.C3189 CCD91371.1 RABAL2 HCC1743 g.ch:175148409G>C 4. 15276 p.65090 CCD91321 , RASAL ? 2833T ocht: 175152460AT 18994 > T P.KS : 7X CCD91335 LAPID Bren 1 : 1705001196 > A A.V1901 cco91351.1 LANCI Colore det M22 poht: 1758312020 33476 - A P.R111811 CCD91358.1 RGLI rosa HCC1305 D.ch:180581502A-C p.Y2039 CCD31359.1 ROLI Draat BB12T p.chr : 180823 103G > A 022006 A 07341 CCD91360.1 GLT25D2 HCC1187 Q.chat:180B413330A 1423G > A p.v475 < CO $ 13721 PLACA HC1187 p.chot : 103051507C > 1328CXG BH4420 cco31384.1 SLX HC195 Q.chat:1931031270A c.976 CCO313871 CFHS Broan HC1295 chat : 1838805VG p.12189 CCD91390.6 CRDI Colorectal Mb Dicht: 194128346CT 0.2234CT P.77454 CC081397.1 HCC1143 g.chr : 185107SZSAC P.E2224 CCD91397.1 PTPRC Breast Q.chr : 18 $ 4430400 > A + -2587GA p.6883R CC031402.1 ZNF281 Brooxt HCC1954 ..chyt : 197108911T > * 15BOTC P.1527T CC091403.5 DXCP58481023 Brcoat MC2218 Ochrt : 107387297CA P.PTT CCO37404,1 KIAA 1070 Colorado ! g.ct1: 187545828T > A c . 1081T > p.L3801 LGR : Colorado M27 D.com:199001881_199001989dupGAAGATCGO 4.734_7420WGAACUATCGG CCO3 1424.1 LGRO Colorado 1 : 1890192810T c.2017G > T P.66730 CD 1424,1 LGRO Cotorocel C079 . : 189010071C ( homorypous) 4.2627CA p.P670H CC091434.1 ADORAT Colomdat ca 108 g.ch:1998662120 0.5000 p . 170K CCDS 1477.1 CABPA Colorado N12 g.ch:1:203705858T>A 0.1545TA p.Y515X CCOO 1479.1 MCP Cotoradat g.chrt :204328782G > A 08830A D.228Y CCO91478.1 MCP Colorado C079 O.chrt : 204346841CT 986CT CCOS 1487.1 LAM3 Colorectal M43 Q.ch:2001892BOCST 6.13480T P.R450C CCOS 1489.1 HS01181 HCC 3.8 o.ch 1 : 208288704T > c . 143T A D.V1485 CCD8 1490.1 T3 Colorat M_38 1 :2083430170 T 6 152SCT p.P $ OUS CCO31504,1 FL10874 Braut HCC 218 w.chrt : 208028097G > C c . 1008 p.KON CC091514.1 PTPN14 HCC100 . 0.01:210973437CS 647500 D.Q159E CCUS 1514.1 PTPN14 Broda 0827T g.cher1 :210946514 c . 10784 CCOS 1591.1 PARP Broatt HCC1008 g.ch 1 : 222874438AT C. 148WT P.E4BBV CC091570.1 DESCN BA3OT O.ch : 224737780do / G c.3101det CC09 1570.1 QOSCN Corterocted Co Ochr1 : 224730833CT 6.3407CT P -A11361 ccos 1970.1 09SCN Colorectat Hoa D.chr1 : 2247683230A c.:25SGA p.W1752x CCD3 1570.1 Q8SCN Co100 Och 1 : 2247604130 > A 5375G > P.R17921 CCOS 1570.1 088CN Cokwactat CO100 p.chrt :2247891120mA c.5789G > A p . 118301 CCO31970 , OBECN Coloroctat Ht74 g.cht: 224770933G > * 68708G P.E2030K CC091570.1 OBSCN Broot1 B013T chri : 224773206C > T 6.6841CT 0.82314F CC031670.1 OBECH Cokoracle ochr1 :224801350G > A c . 194BGA AR39830 CCD3 1570.1 089CH Colocar odi: 224012011G > A € 133730A p.R4559H ÇC0315T0.1 ORSCH HC 137 ng , 1249178A • 144296A p.R48100 CCOO 1570.7 OBSCN Broast BB7T chr1 : 2248184B8G > A c . 152116A p.A5071T CC081570.1 OBNOX Brdas 88T D.chrt :224033341CT c . 171370 > T p.Q5713X C0031679.1 NUP13 Oroza BB14T a.chr1 : 2268360460 - T tomorygous ) 0.077G > T p.Q326V CCD91979 . 1 MUP ) Breda g.chat:225829940GA 41342A p.G4A8R cCOS 1580.1 ABC310 BB2UT o.ch.2758832380A p CCO91380.1 ABCO 10 HCC 38 Dicht: 2259741410 > C 14126 * C PR471T CCOS 1909.1 ARVI Erba MCC1854 g.chr1 : 227438310_227438310chupa < 39_e1 CC091392,1 GNPAT HCC1395 D.cr:227718412GT 616120 T p.E39X CcOS 1000.1 BOGANTZ Broant HCC1399 Q.chat:23198945480 0.8OBANG D.N2009 CCD91808.1 NID Coloretat g.chrt :232471072T > C 3107TC p.F10309 CCD1825.1 MGC3370 Brdost HCC1399 .chr1 : 241071146C > T • 1958CT p.TOSS CCOSTA32.1 TTC15 Proost HCC2210 och 2 : 50714580 c.21490C p.27170 CCDS 1894,1 CP8F3 Broog HCC210 Q.c # 2 : 95502910A 017320 p.05761 HCC 38 2: 95837430 c.205GC p.XASSS CCO91677.1 FLA33 MX27 2 :5121 108YGA BAGA D.R1270 CCOS1802.1 Cade MAO O.ch12 : 110584326A c 107GA p .GSE CO091690.1 8181 HCA 157 och 2 : 17841217040 4.24e ho CCO31890.1 SMOSLI HOC1034 o.chez : 17823005OT 08750T P.A282y CCX1891.1 FL086 BOOT Oct2: 17874168 07874185dac 4.785 7950oC CCD91801,1 fWk0a89 HC02157 2.42: 17875530C > T 4.8240 D.R2751 U.S. Patent Sep. 29 , 2020 Sheet 15 of 36 US 10,787,712 B2

Figure 12 - Continued

CCD1881.1 FW4008 Bront BA31T 0.02: 17882982_17852882dupT 1374_ouT CCD31700.1 APOB Colorscal Cosa 0.012211438310T 07558CT 5 CCD91709,5 APOB Colorata H185 .ch 221143701T > G 67891T > O +30 cco91703.1 FUJ21945 HCC1395 g.ch:241728580 1380CT p.P4549 CCD81722.1 HADHB Ben HCC1937 g.ct2 : 28411593CT 435ACT PA119V ccca1724,3 OTOF Brom BD32T 2.0 288051890A C 16 ° OGA PESSOK CCD91724.1 .ch / 226800351AG 62332 p.1780V CCO91724.1 OTO Bruas HCC1383 g.chr2 : 28592847T > Chomonygous ) FL121829 Broust HCC1187 p.ch/2:271012386-G ( homozygous ) c . 184G . P.R395P CCD91742 . CAD Colored 2 D.72-27337072GA P.R1770 CC091742.1 Colombo g.ch/227381398AO c22AAG p.7725C CCD91755 , 1 SLB Colkodtal C974 g.chr22701178000 1280CG P.14278 CCD31775.1 XD Breast B043T ChY2 : 31501220T C2207C - T p.1763F CCD81778,2 XOM Proa HCC1395 g.ch:1500378Com XYCAPS ) CZ370CG p.R7916 CCD91778. HCC1143 0.42: 222733040 - T 41287GT p.VAZ3L CC081782.1 MYADML Colorectal D.cz:9004Z4CT PR CCD31024.1 PRKCE Colorecta 9.02401152330A 0427GA p.E43K CCO31842.1 LICOR HCC1187 .chr248828897G > A € 1800A p.5584N CCC31852.1 RTN4 Coloro at Ex 43 p.chr2 : 55165801CG 6.887CG D.LZ23V cco81891.1 BCL11A OTOOR HCC2218 9.com:808075800T p.8142F CCDS1801.1 BCL1JA Oros # t BB24T o.ch:80800210.608002074 DAGGAAGAAGAG < 1480 149 de QAGGAAGAAGAG P.E493_E496det CCDS160,1 FL12 Colorectal M2 .ch2:8108882C > T 1451CT CCOS 1888 . AHSW Dout HOC1008 g.ch:6132545T>C 4.257TC p.MOOT CC031072.1 ENBPI MCC2157 O.ch.830132120C P.R385T CC081602,3 ETAIG V8 g.ch2.675363810 C £ 150G P.ESOD CC091891,1 GX HOC 38 g.ch:801177801-C D.K104T CC081918.5 DYSF KC18 g.ch:71750101CG 111225M CCD91910,1 DYSF HCC130 $ B.chr2 : 717502880-0 Domaxymous ) p.L1349V CCOS 1971.1 TC711 Brou HCC1000 p.chr2 :85273230C > A 440C > A D. ?1471 CC081900.1 MUDIA Broast HC02216 g.ch:B593225GC 0.0187H MCM17010 Broan HCC1305 g.ch/26498240STA p.2728 CCDs2013.1 CSEN Aranit H * 578T ochr2: 0-5469278G > T c.50837 P.A17BS CCD92013.1 CSEN Breast HC18 Ach2 :85469305G > T D.D1794 CCOS 2020.1 ASCOLI Colorocta C074 2.2.913083360 - G c.5208CNG p.F1738L CIMA Brda HCC1008 m.ar988401540G p . 134V CCB024.1 CNA Doar BAST oth : 30030900CT c . 204401 p.Q882X CO082040 . LOC129501 Calorectat Mt2 g.ch:9248023_0924682106AAO c . 226 228dGWAG p.K76dol CCD920 * 0.3 FL5273 Colorectat MX 9.2: 100 % 8B202C > T c.955CT p.R319W CCOS2051.1 RNF 149 Dros HCC1394 ch2101335500A a 18G > A D.E7K Ccos2032.1 BLGBA2 Broast BB JT g.ch:102740219C-0 6.8980G P.T2088 22 SLCOA2 Broost HCC1954 g.chr2 : 10278.3444QA 4.24170A P.R8O6Q CCO92003.1 MGC11332 MCC1500 Ochr2 : 102807376G > C 0176G C P.GSSA cc087000 . MGC11332 HCC1395 g.ct2102807301T » C p . VAA CCO92000.1 GPR4 BOR HCC1598 chy 1053 188530G PSC DOY10 Broant HCC1187 0.1182912859A 1210 p.O4IR cc092121.1 FW10888 Colorectal C $ 74 0.cr2 : 116452232A > 6776AG p.11259R chr 119320385_119320330dacCGGCCGCGGCGGCAGTGGCGG 6.609_844doGGCGGCCOCQGCGGCAGTGGCGG CCD82123.1 EN : Cotonds Co92 CGGCCCCoacCOC ( homoxygoun ) ccocGGCOGCGGC ERCO MCC1907 g.chr2 : 127780599AC 61252A p.K4100 CC52183.1 ARHCEF4 Breed 0877T o.chr2 : 131572501AG P.K100R CCD92105 . 1 ARHGEF # Brunat KCC 107 0.42: 131832752Ctomozygous ) ¢ 1322 p . THIR CCD92168.1 ZFX18 Calorecta p.chr2 : 1440078316A 29476A A.DE3N CCD921045 RLF1 Achr2 : 1521408820A 350GMA p.E1784K CCOS2104,1 RIFI Boast HC2212 02: 13214740SQ > C p . 01935H CCDS2203.1 GALNTS Burgast BA27T g.ct215796838BAT C 1521A > T P.ESO7D GANTS Broast HCC1837 g.chr2 : 1570818410T c . 20740 T p.L682F CC082221.5 FIGN Calorocta Co92 od : 164283050_184283050dupo 0.439_aupG Coloractat Co108 7 : 100301433CT € 14210T p.7474L LRPZ Colorecta or2169460016CT c . 1019 50T: AR2309x CCD8232.1 LRP ? 109 02: 169877930G € 1281 G p.M4272 CcO2222.1 LRP2 Colar dilo g.ch:10981107CT 137500T D.R4505X CCD92245.5 MAT : Colordata Co92 2 : 171258872BG > C C9400C DA317P COS2255.0 PTDOO HCC1008 .2174832707G >Chomnyyppu ) 6502Gc p . E1880 CCO32258 . CIR Colorecta Cooz .ch : 175039081GT CCDS2282.9 ATF2 Broan HCC1395 q.ct2 : 17578727GC C10546 p.0352H CCC32204.1 89FA2 Breast g.ch:18Z00477 187808492dAGTGTTCCCAACATAT 42604_2019do AGTGTTCCCAACATAT ccog2291.1 Cocorocta N27 g.ch:185826800A>G p.13249 CCOXZ207.1 COXA1 18 O.ch:180884529A 1258GA p .04209 CCOS2207 . COLI Colorsciat o.ch:1897018050T p.R14C CCD87309.1 STATI Broset HCC1395 g.ch:10187272CG 2. 1471CG P.PH9A CCOS2310.1 STATE Ords # HOC2157 0.ct2: 191788497QC p.E1120 CcO02311.1 MYO1B Colorocta N20 w.chr2 : 1920604920 p . Vas MYO18 Colorado cy : 1020804931 P.VOBIC CCD32348.1 AL82CR12 Bros HCC1399 o.ch:202020752G>C MV97-19 * AL8ZCR11 Colorectal Q.cr2 :202203455A - T 308A > T A.X123M 5 RAPH : Pronut BBT 0.hr2 : 204130748G > T c.287167 DA.918 CCOS7250.1 RAPHI HCC1143 2.62: 204129737AG C , 3002ANG p.712284 ccns2372.1 CPO Coloroca Cos2 0.0207858534G - T 0.0190 - T p.XV273N ACOS2381.1 IDH1 Q.chr2: 208938818CT 39 -CT PR12C 94 MAP2 Cetorociat # 189 pic22103a3z31G > T 6.831QT p.E277D CCD92394.1 MAPY Colorado B.chr2 : 210484914CT 6.21140T RP7051 CCD97393.1 Broan HCC19 0.221124897700T CC082399.1 FNT Ardagi 8823T o.ch2 : 216093435 A thomozygous ) C.2018CA 0940 cec 2299.1 FN1 Broad HCC1008 p.dra :218000007G > C 4,23590 P.R1120p cp999.1 FNT Colorocta Co103 2012 :216054239C T 6.85050T p.02188x CCD32390,1 FN1 Colorectat MX2 och :210031807A 70450A p.02349N ccd42403.1 GMARCAL Broast HCC130 g.ch:2171789710 c . 12940 THS HCC 1580 2.Chr2 : 21.506970CPA 532780A p.F 1080L CCO 430 How to 2.ch 2 :21080500CG P.Ro 8LCHA mchZ20323514_2203735230HGACHAGGACA ( horrozygos ) 1291_1300d -KACAACUACA Cco97447,1 EPM Coloroctol d2: 2221138830T p.Q948x U.S. Patent Sep. 29 , 2020 Sheet 16 of 36 US 10,787,712 B2

Figure 12 - Continued

SERPINE2 Q.chr2 :22 082098ANT 6812AT p.X204N cc092485.1 Com ColoraN 1.H222002a8QSA P.EZOK CCD92470.1 FW12595 Broest HOC130 $ p.cha2 : 228.584084C - T 0.3 % BCT P. T1291 8P110 0.22308071237 » C 2T> C AMOT CC 32474.1 8P10 Grant Q2: 230838388G > A C20470 > P.G8838 CCDS248.1 CHRND Order HCC1008 g.chr2: 2337242920 p.DOISE CCD82503.1 UOTIAB HCC1187 O.chr2 : 234462937G - Thornozygoun ) PEM2) CCO $ 2 18.1 CMKORT Colorectat Mox27 p.ch.237771243CA P.YUX LRRFIP Breast BBST 0.738399278A > G OCOS2521,1 LRRFIP Bneert WcO2218 ochr2 : 2211419C > G c_2030 P.SBBC CCOS271.1 LARFIPT Boost a835T -a2-238454328C > T < 30000T p.QO34X CCO92528,1 PER2 HOC 38 C.chr2 :238944197CG 24870G p.LR3Y CC092529.1 HDC Broen OBZIT g.ch:239780784C 4.2180 p.P7Z7R CC092529.1 HDACA HCC1143 g.chr2: 239712398GA 1924 + 10A CCD92334.1 GPCT HCC1599 ochr2 : 241124149C > A fomOXYDOU ) 61010COA P.A337D CCOS2.07.1 RONPEPLI Colorectal Wu 1 Q.CY2 : 74123939G > 47390A p.1247M CCD9209.1 CAPNIO Colorecta g.chr2 : 2412-3451AG c.827A > G p.E276G CCD92347.1 HOLOP BB31T Duchy2241910118_241018107dOCAAMATCCAG 6.548_555de CAAAATCCAO CCOS257.1 HOBP 8818T g.ch2241807035AC c . 1701AC P.X588N CCO82547.1 HOLBP Broad HCC1008 g.com:241888IOBAT < 2810A » T p Doggy cco92558.1 Cobran W g.chr3 :359718 CCOS238.1 C und Mu Cv3 : 377080CA c . 1279A p.L4271 COO82357.1 CNTNO Broan BBAT 0.3221 PT108A CCOS2557.1 CNTNO Bingast HCC1143 o.ch:13896DEA > T Thomozygous ) c . 17527 p.ssac CCOS2558,7 CNTI Colorado COP ochr3 :2047385AC p.X2N CC092558 CNN . Colorecte ! 3 : 3012809CA C $ 780A P.P178T CCC92372.1 ORGAP Broast HCC1590 .ch : 9000473CA 18970 P.Lh3 CROS2583 . T. Cotorociat och 3 : 9845885GMA c.724GA P.G ZS CCO92595.1 Cabaron Co79 Q.ch3-98459530 - T p.M284 Ccos2604.1 HRHI Colorecta 0.cy : 11278876T > A P.00385E ZNF850 Coloroctat g.ch:2 1437742G - A c . 11.56G PAJAST CCD920X1 ZNFase Coloractat N22 O.chr3 : 214377370 C. 1 181CC AH370 CCO32042,1 RARB Cotorocta p.ch3 :25 + 77777GA c.247G - A p.V83 COD3204.1 FL0804 HCC1589 Qeya :25 * 07a31 0316T > A p.F1066 CCOO 0.1 EOMES Braun HCC10 .ch3 :27733877QC 4. 1999GMC p.E8870 CC32042.1 TGFora Colorectat H * 188 0.217AXG p.73V CCO $ 288.1 TOFBR2 Colorecta Mbc34 chr3 : 30707954Q * A ( homozygou ) c . 1S63GA p.W2X TGFER Colorocta C074 .ch3 : 307079740A Monotygous ) 41583 P.R5201 CC032833,1 Fex Coordel Q.ch323010020A 07BGA A.V220 TOAD BD277 0.ch3 : 37752238C > T P.R750C CCO92689,1 MOAÐ Broast HCC1395 9. - 13 : 378354400T (homozypous ) D.E1025x CCO92672.5 OLECT 8881 HCC1592 B.chr3 : 38079284C > p.PASIR CCOS1883.9 CMYAT Brest HCC1398 2.0 : 39204810TA 1301TA ALAM COo82083.1 CMYAT Broan OB TOT 9.3: 3920240 $ cra AR1148 % CCD92743.1 ALS BET g.:487004000 p.Q280E CCD82743.1 ALSZCZ Broast HCC2218 o.ch:400947BCT c . 172BCT P.L57RF CCCX32785.1 PLXND1 erroan Q.CH3 : 48420 * 24AT C.SGT2A - T p.D1891V CCD92771.1 PFKFBA Broast HCC1000 g.ch3 : 40551024CG Champous ) P.NIBIK CCO32773.1 COLTAT Brodu HCC1937 4355AXC p . T119P CCD $ 2773.1 COTAS BB7T o.chr2 : 485989510A 4090A AP1384T CCOS2773.1 COLTA1 Braa . BAZZT 6.4088CT P.R1386W CCO92837.t RNUJIP ? Broast HCC1187 9.c3 :51850802 > G ( Oxyg c.22CG P.R.O CCD92837 .: ANUSIP ? g.chr3 :51944262CA 610250 p.A342E CCOS2844.1 ACY1 Brosst HOC1590 g.ch:51898047GC C1103GC P.EJAID CCD22840 , TLRO Colorocta g.ch3 : 57230870GA 2702G > A p.R9011 CAMA , 1 TLRO p.ch3 : 52230 $ 740T a 2798CT p .T933N CCOS2254.1 PHF ? Brasi p.ch3 : 52437334G > C 11070 > C RKSIN CCD82888.1 MCC52022 Catoroch C074 D.ch3: 5288 17550T MV52-1G > T CCC2837.1 APPL HCC2218 o.ch3 :572774990 C c . 1827G > C D.EB430 cco92295.1 FUN Breau BB137 g.ch:58:065993G>A 1897 P.RS. CCoS2089 . FLNS B823T ochr $ : 50080272CA c . 1989 p.HBOJK CCD92885 , 1 FUB BB23T 0.ch3 :56088998CA D. TOOK CCO92880.1 FUD 2871 p.ch 5a07083450070830dAco 62301_7335dUpACG Wctor CCD9288.5.1 FLNB reau HCC2157 0.ch3 : 5809548900 44601CG P.A15140 CCD8B29 . 1 ONASE 13 Broost HCC1383 0.ch3: 50171019C > ( homozygous ) 659CG D.LIBV OCD92986.1 ONADEL Breast BAZOT g.ch:50 168314G > C C.244CC P.GOR CCDs2000.1 ONADEILS Colorect D.ch3: 50 1650 19A c250 p.Y : 178 CCD97808.1 TAKRP Broant HCC1000 .co.07136673WT thomozygous ) p.81770 CCOS2800.1 TA - KAP Colorecta M38 0.3: 871372950A € .1136GA P.R370K CCD920271 EPW3 Colorocta o.ch:89259070C>A C.110C A 137X Cc092822.1 EPI Colorecta C074 QC3: 89341800MG 0.25A G p.Nas9 CcOS20221 EP3 Colorecta 18 g.chr3 :39545079A > C 1881AC p.ls?tt CCOS20122.1 EPHA3 Colored Q.3:88581134GA p.D9OBN CCO92B28.1 PROS1 Colorectal MX1 p.ch305080707A > O 1014AG p.E $ 150 CCO92039.1 Colarocta Mat30 g.ch3 : 101934071GT PA1409 CC092971.1 BOC Brogu HCC1054 0.ch3: 114481477G > A 0.7137G > A p.7713M CCO - 92987 . THEOA ch : 1200384700T p.524n GOLGO1 HOC 157 O.cho3 : 1220105030 c . 10-14G * C p.Q348H CCOS3004.1 QOLG91 Opst HCC 1385 p.ch3 ; 122899214CG ( homozygous ) c.2831050 DA943 COS3015.1 DTXL Droo HCC1007 g.ch:1237702547-C (homosypous ) 40276 P.X2O8N cc0830 19.1 SEVA_B BB247 g.ch:124182077GA c . 1240A p.2428 CCD63019.1 SEMASA Broast HCC1395 a.ch:1241285080G (hovnozygoua ) 600DCG D.17234 CCO $ 3027.1 HAPP Colorectat Wo 27 0.dys : 1251704880T 4.637CT P.R2131 cc093028,6 TRAD H. SYOT o.ch:125a52372AT 6.39BAT CCOS3033.1 SOPL11 ana * g.ch:120777630C-T 2.551CT p.8184L CcOS1034.5 ALDWILI Cohoroda MEX .chra : 127333016C - T thomozygous ) 15320T PAS11V CCOS2007 , PIKOR Baxt MC2157 g.ch:131907228GSA 2.23070A D.R6060 CcOS 117 . CLOT Colorosa C092 0.03: 1418062470T (homozygou » ) c . $ 78G > T p.81931 CCOS3112.5 CUSTN2 Calarasi o.ch3 : 14178 * 4320A p.7650 CCOS3138.7 CPAD Bratt HCC1837 g.ch:1500859890T c . 1000T p.E34x HP o.ch:1503511100 > 0 11900 P.R3970 U.S. Patent Sep. 29 , 2020 Sheet 17 of 36 US 10,787,712 B2

Figure 12 - Continued

CCD3196.1 P2RY14 Colorocta MA2 o.ch : 152414384T > C 419T > C p.L140P CCDS3150.1 P2RY14 Colorectal C079 Q.ch : 1524130933T 0910GST P.E304 CCOS3167.1 GPRBT Coloroctol C092 g.chr3 : 152495181G > T € 5710T P.D1914 CCD33173.1 SLC11 Ora : 157034028T > C P.V001 ccD93179.1 VEPW BROT g.chr3 : 158.583788.com C 8880 G CCOS3170.1 VEPHI rom BEST p.ch:150581776G>T G.B & BG?T P.92334 Cc09317B .. VEPH1 Broan HCC1593 03 : 358481BB415848 18830AM ¢ .2443_2444d AA CCD33109.5 Areas HCC1599 p . Chr3 : 181612837_101812930WATTATAT 6.9746Boda ATTATAT CcOS -3201.5 WOR40 Coloroda M22 03: 588 804885G A 0.29GA P.R104 CCD93204,1 GOLPH Broox HCM197 ochr : 189243948GT p . 81471 CCD93204.9 GOLPH Eroant HCC1187 9.chr 3 : 189233252GC 034GC P.A312P CCD 204 , COLPIT ONAR HCC1187 0.03: 1892237510T 4035CT p.4312V CO92217 . FNDQe HCC1305 chr3 : 1735535500T 027700T P.P8275 CC083220.0 CCTV Eraad a.ch3 : 17401818ZAC p . T802P MENI Coloco H27 wchr3 : 1805778520 a 12430 C p.D41541 cC093230 . PEX MAY g.chur 3: 1810748870A € 878GA PA28T CCO83234 , FXRI Bne HC157 Qahr : 1821818940 > A 4897GA CCDON3.1 MCF22 Coloradot M20 g.ch:18431225STOC 6761TC p.25.4p CC033243.1 MCF27 Coloroctol MX30 w.chr3 : 1844315050 > A 1865G > A P.R8Z2H WCF2 HOC1395 actua ; 1843801730T 3115CT p.LiQu9F CCO33250.1 HTRIC Colorecta M1 och 185250708G > A 4382GA D.V128M ccp93253 , Brass HOC2210 o.ch3,185365ASOC G7G > C p.R218T CCD9249.1 E4G1 Cotorocta M27 g.ch:135523730CT 20870ST p.P69SL CC093707.1 MC2180a Broas HCC1305 @ .ch : 165-5452316A 47796 P.SZOON CCD33274.1 OGKO Broast HCC138 ochr3 : 187315408GA CZ1180A D.E706K CcO93770.1 10500 colorecta MX2 Q.ch:187757209TA CCD33282.1 EF4A2 HCC157 Ach3 ; 18708e87G > C 541GXC p.MAIL CC093283.1 RFC . Colorpoint M22 D.chr : 187990717_187930708CATCAGCTCGTCAA 4912923derTCAGCTCGTCAA CCOO U23.1 Brest HCC195 + chr : 187090402A > T . 1080 > T p . T3548 cco93207.1 RTP1 Broant HOC1187 och3: 1884001380A (homozygout ) c.28CA P.Ross CCDS3294.1 LEPRELS Broox MCC218 0.03: 1871835840G 61277C p . $ 420X CCO $ 3784.1 LEPRELI Broast o.c3: 101171383G > A . 1837G p.0813N OCD9 * 07.1 HOC2157 o.ch3 : 185599293G > T 41016G > T P.G339V CCDS331.1 WYERS HCC2218 g.ch3: 19777847BC » 170CG P.Soon CCDS382.1 Coloreciat COT Q.ch4: 5745708G > T c . 1848GT P.AS50 $ EVC Colornet Cotos a.ch4: 5704499T > 4.2740T > G p.1914V CCDS3382.1 EVC2 Colarosta g.ch4; 58828885882838dc1AQ (homozygous ) 4.3635_3838_olAG CCD92384.4 FL48481 Bros HCC1008 Q.ch4 :80872226 » thoroxygous ) PA150P MARUINS Cotoradat g.ch:820008BCT PA375V CC083390,1 SHOTC1 Colorecte M38 ocha: B34784B0A P.A719H Ccos3399.1 SHOTC1 Colorosa ! 218 g.ch:83553380mA 433886A PA1130T CCOS3411.1 FAMA Bront HCC1395 g.ch:137025280T 4737G > T 2.82431 acOS3424,1 HCAP - C Colorector M40 g.cher 4 : 17403171TC c . 704T > C p.AREST CCOS434,5 UNAPO4 Colorostat C074 p.chr4 : 250B6A27A > G a . 46AG D.155V TBC1019 Broant HCC2218 c.chru: 284204710T ( homozygous ) P.R434X CCOS $ 455,1 VODH Coloroctal .ch 1 : 3932444339324443dupT V81044_dupT CCC83457.1 NBP2 HC218 a.cht: 3992887BCG P.P2834 GABRA Ho 570T .ch : 467712BAC 4156 p . 3516R cco92497.: KOR Colorecta M27 p.chrt :358205510T 4.8240T p.f275L CCD3497 . Colorectat Mx36 p.ch 4 :55803435G Athomozygous ) 426170 D.GSTUR CCD83510.1 Chorf14 Broast HCC1107 0.037073742A - Q ( homozygoua ) . 1728 p.0579R CCDA3538.1 APIN Cotorcol Mc38 o.ch:71248391G>C c = 28G C p.61430 UNQ839 Coloroch cht: 715713780 > A pockygous ) 62320A P.0703 CCOS.S04.1 EREG Brood HCC2218 g.chr4 :75010257Q > C c 125C P.GAZA CCOS2 $ 70.1 COKL2 Aroun HC218 och :76BB42030 6142100 p.9474X CCOS.571,1 GDP2 Boost g.ch:72839734G>C CCQ9337 1.1 OSAP2 Brpart HC02157 g.ct1: 769279410T c 1301CT P.P4341 CC093590.1 THAP Colorectal C074 acht: 21196508 > C.ZOGA p . 1802 CCO93000.1 HEL300 Broost HC2218 0.47183 106A 1003GSA p.DSON COST H 578T g.ch:85910101AC c.811AC p.K20 - T CCDN00.1 CD91 Collectat Co74 chrt :05913007_05913602dupT 6789 dupT CCD93610.1 MLLT B 0 : 1 HCC1937 och :8841400XA 0.3810CA P.Q1204K CCD93837.1 GAID ? Colorectal o.chrt :943891730A COZONA p . 1209N CCD9 % 850,1 ROOMT2 BroBit HCC1599 chr : 10003407CA a 2450A p.P820 CCDS3857 . NFXD Broax H218 g.ch:103808177GA VV91.1A CC093870.1 FL20184 Brons HCC1008 ochr :108BOBO1JG > c.2016 AKBTN Cstorocta Q.C4: 109240SGA 07GWA p.G113R CCOS388 1.1 Bran HCC1385 Q.cr:1099294420 c . 270G p.F9L CCD1891.1 ENPEP Braa MCC1395 Q.CY:111833424GX c2880GMC P.RANTT CCOS3707.1 ANX2 Braast O.chr : 114501807G > A 4.2054GA P.GBASE CCDS37072.7 ANK Colorectal worzo chat: 1168178BBGA c37996 > p.G1287R CCOS3702 . ANK ? Cataracal C074 Q.c : 1148438880A 10958CA p.T3,3K CCD33708.1 NOST3 Coloradat Wb27 g.ch:1 18313460T > G 702T > p .2840 GA01 BBZT Q.chre : 14468441040 c.248A > P.Y83C CCDS3739,1 GABI Brannt HCC1834 Q.Chr # : 144717323CA 11600A AT397N CC033763.1 HSHIHI Broast W STOT .chr4 : 1484313944 MSZAG CC083789.1 EDNRA gachrt: 1487848 / A > 0.408A > C D.1938L CCDC3777.1 NRIC Cotonucu N30 p.chra : 149715597CA c21CA p.H7Q CCO93773.1 LRBA BB34T p.ch:151869542G>T 4.81140T p.MAH ccp93773.1 LRBA Broag BAZIT ochr : 151715815 C6820G > C P.62274R CCD837731 URBA Braxt Dicht: 151501740C > A (homozygous ) 6.81020A p.72701K CCO777.1 FBXW7 Cotaructor Co74 och 4 : 1519902690T p.29xx CCD937.1 FBXW7 Ha 174 p.ch:153608989GPA 4,13910 P.R4604 CCDS771.1 FBXWY Colorecta Hx190 g.ch:153804883G>T c . 1514CT P.RSOS FBXW Cotorocta 210 o.ch:133803051CT ( homozygous ) a . 1745CT p.8587 CC093800.1 2TFOH Colorectat Co74 a.ch:150978452_150970485dUPTTGTGGTAAGTTAT c.pal_IVS8 + tup TTGTGOTMOTTAT ETFOH Colorecta : chat : 169087 1230C 1893GC P.V565L CCOGOB0.1 FOL . 2.ch : 1631092080 Atomozygous ) 274CA R.1921 ccagua 10.1 Cotroci g.ch:16078327BCA tomozymous ) BDOGMA A. Rzeta CCO91011.1 TUT HCC1037 g.ch:16734440*CO 2082 P.LBBBV CcO90670.1 FAXOG OTAR KCC1509 o.chr : 175533448CA c.800A p.L2891 U.S. Patent Sep. 29 , 2020 Sheet 18 of 36 US 10,787,712 B2

Figure 12 - Continued

CCOSS 3.1 ADMza Cataructed H189 y.chr : 1762714880T ACT DP31L ADV20 Cataractat o.ch:1787720190A 4813G A AV7051 CD31.1 FLD0100 Brdan HC218 g.chat: 188435922GC 0.81CC p.DIH POCCO Braxt HCC1107 0.75: 358875G > T c.387G > T P.G123C Cc09882.1 CRRS Broaut HCC1395 o.ch:1354951GT c.99G - T p . 313N CCoSy883.1 Broau HCC X8 D.ch:14041531GA C391G - A p.G1218 CcOS33831 SLCS Braam BAT D.ch : 1458172A > C c . 1832 CCDS3.73.1 MGC0297 0.ch:78211330G p . CCDS3881.1 CTNNO Coloroda a.chrá : 11034920_11034910UST 4.3382333## T p.P11598 CCD93001 . CTNNDZ Colorecta COTO .chr : 110287880T C34750T CCD 38.5 Broant HCC1837 ochrs : 13997497_1399747 &cTTTAACGOTMAGOTGCTGTTGT 451_72domTMACGGTMAGGTGCTGTTGT CCOS1880.1 COHIG Colorected p.ch : 19874680GT 193G > T PERSX COMO Breast BBT g.churs - 24545571G > T @ 1111G > T p.13711 CcOS 2.1 CO10 Brood HCC218 Q.com:745737SOG>T 21460T p.E716X CCD91894.1 Colorocta M22 p.chr : 13587170 - T 0.1918CT D.ABOX CCO99907.1 ONJAS Broadt HCC 34 w.chr34973389GA 292GA p.Dan CC093911.1 ILTR Broott MCC 1907 c.chrt :35011398C IVS - 30G ap CO3914.1 LOC167 177 Colorecta W3 Ochr3607 1 85CA P.R515H CC093020.1 NPOL Broat CC1008 2.c : 3705S1BBGA 4.4830GA p.E1047K CCD83927.1 LIFR Colorected C074 3 : 38517544T> G 220T G 2.F 108.5L CCD839321 PRKANAI * CC143 g.ch:40834002AG c.2010 P.QIR CCO93937.5 OXCTS Colon col Mx38 wy $ : 41843298G > T (V97-10 > T p.8288R CCOS0948.1 FL2383 HCC1187 05: 438 * 1741Cm 4.7980G PARPW Coord w.chr $ 801655911G ASTITA CCOS397 1.1 LBST Coloracial chr5 : 52878330T 124CT p.T4154 CC093993. PIKIRI Bcas Ho 076T ch : 87625348_67625351dupTM (hornazyno ) C. 1350 1358dupTM indd CCD93099. t = PW Coloractal Not30 och A421221G > A < CA D.EK Coloroctor M 189 g.ch : 5 :71525915GA GOTOA p.R1200 CCO9 :4012.1 MAPIB AVT4H C094012 . MAPIB Colorostat och 5 :71528668GMA p.A1144 RABGRE2 Colorectat co74 g.chr5 :80374504G > A 316 - A p.DOBN CCO9 40521 RASGRFZ Broost HCOZ218 Och 804259310 > A 10120 0940 * 7 . RSGRF2 Colorectal H21 @ 5 :304442940 c . 1948T P.ROSOX RABQRF2 BBZ3T . :805572780 CACC PD1218E HAPUNT Colorecta H200 9.502084190_82904190dup CCD3400 4,1 HARUN Colorectal g.chr5 : 8297313BGA 4.93GSA AR03H OTBOU Colorat NAS g.ch:1002501744G CCOS 107.1 APC Cataracted M g.ch:11214+4910T c.8370T PR213X CCO94107.1 APC Colorocta WZ7 p.ch:112179160CT P.R302X CCOR4107.1 APC Colorocta Nx40 o.ch:1121020780G c . 12400 - G AYtex CCD84107 . ) Cotroctol 10 och 5 : 112102091Atomoxygeus ) c . 1283A p.W421X CCD34107.1 APC Colorectal ..cs: 1121907900 > c . 14950T P.R499X APC Cotroctol Hx29 a.ch:1219079-5T>A 6 150QT > A DYSax CCDS4 107,1 APC Colorectal her to .ch : 11220-1945AT 0_2735AT P.RO1PX CCD34107,1 APC Cotaractat C07 g.ch:112201995CA 28050A p.YBOLSX CC034107 , APC Colocacia H * 188 ado : 112202209_112202270nat ( homozygous ) 3070 3080T AAC Coloracial p.chr5 : 112202323CT Promoxydrous ) 0.313CT p.Q1045X CCD84107,1 APC Colorectal g.ch:112702623G-T AGAT p.E1145X CcOS 107.1 Colorocta WAB . : 112207846_1122029403G ( homozynow ) C.3758_37590 CcOS4 107.1 ARC Corticia ) Mos Q : 112202950A > T (homazyOU ) 3700AT p.11254F CCD84 107.1 APC Colorocta Q.C.1122001340 - G ( oryodus ) C.344CG p.81315x CCO94107.1 Colorocta N26 R.c $ : 112203148da.C ( homozygous ) CCD94107 . Colorecta Nud g.ch:112203146doc c.3850doc 4.4037C p.81348X CCC94107,1 Cotrocta MX2 dos: 112203227C- thommypous ) p.61374X CCD34107,1 APC Cotoracter 0.ch:112203310G>T (homozygou ) C4120G > T CCO94107,1 Ca?orocta 172 f.ch:112200310TA DomyOs ) c4120T > A 0.4101T > A p.c1387X CCDS # 107.1 Correcto Hx109 2.c :112203351TPA p.S1400X CCD94107.3 APC Cotoneta M - 3 Q.chrs : 112703389C > A thomozygous) # 4109CA CCO94107,1 APC Cotroclat H219 g.ch:11220348404G (hronozygous ) 64304401 w.chr $ 112203502do thotoZY OA ) 4312data CCO34107.5 APC Catarata Ca 100 Q.c : 12203538Totomozygou ) P.R1450x CCOSA 107.1 Coloracha C182 g.ch . $ . 1122035300 Tomaryous ) 4.43480T P.R1450X CCD $ 4107.1 APC Color cal M27 Q.chr : 112203051112203852dupTT C.4481_448ZCUTT p.71487 CCD94107.1 APC Cotoractat Mt47 g.chr5 : 11Z203851T > C CCD84107,1 APC Cotaracted Co7 + ch : 11220353delt 47AT CC094107,1 Colorado Cod2 o.ch:112203883dot ThomorydoIA ) 447300T cc034107.5 Colornocte f.ch:11220388WoIT C.4473dor CCD34107 . Cotorocta g.ch:112200846_1122030ains C.4496_4977 TRIMB HCC1385.ch:114494200_1144841844oCAGTTAG (homolypous ) 1820_1828dOKAGTTAG p.DXAN CC094118.1 FEMIC HCC1854 .3: 1 14808455G > A C 13000 CCD110.1 FEMIC HCC195 + p.ch:1 14880374G > 013040A D.DKSZN CC03121.1 CO01 Colorado 0.c : 113170091G > C C.427GC P.E1430 Braon HTC 10 g.ch:12889135CA c . 107 &CA p.1380 CCO9148.1 ADAMT819 4.742TC p.8240P Ccos.100.1 Droost HCC135 chr $ : 13425T231TC Choilmypous ) p.9334 CCD8 + 104.1 TTID Cotrocter NO7 o.ch:1372747G>T CDBGST CCD34234.1 NOWPA2 Srcast HCC0 o.ch:140007085G-A monozygous ) c . 140GMA p . 050N CCD 4257,1 PCOWBIS Brecut HCC1107 g.c : 140607486C > T thomozygous ) 0215 & T PA719Vp.G759V CC0944257 . PCOHDIS Broan PBTT a.ch:1406076030 c.27736T CCD94260.1 CENTRO Comodal M22 .ch 5 : 141032027CT 4. 14110T P.R471W CCD94200.1 CENTE Broa HCC2218 D.ch:1410202400A c.25070A D.Sp.110854 & 3 X CCD94200,5 CENTO Brtant HCC1143 2.CM:1470185420G p.71428P CCO3.208.1 CENTO Arapst HCC1107 w.ch:141014064AC momozygous ) C.4282 CCD9 # 205.1 Coloroso Co92 Q.ch:147004746CT CCT p.R315C KAOS C. 99G > C p.X33N CCD94787.1 SCOBAR Greast HC02157 4 : 1472412496 > C ( homozygous ) p.ROSOK ccOS4300.1 TCOF1 Comcat C074 0.ch:149740885GSA (homozygoun ) c.285BGA CCD94100.1 SYNPO Colorado g.ch:160018498_15001@sado CCGCCC 42382_237CCGCCC p.pro P791dol Coloroc Cog ? g.ch:1588804020A 398CSA P.R1330 CCD84338.1 ADAM 10 P.AZDOT CCOS08.1 ADAM 10 Coordded H200 och : 1588689000A c.882GA p.P1801 CCD84356.1 GABRAS .ch : 101049229A CCOSA30.1 KUBRA Brodat g.ct.1078517356C VSD 10C CC094379,1 GABRP KCC1143 Q.ch:170171784A>G C. 1207ANG p.116R CCD94407,1 HK Colombo Me g.ch:170247220C>T 14300T P.R4BOW U.S. Patent Sep. 29 , 2020 Sheet 19 of 36 US 10,787,712 B2

Figure 12 - Continued

CCD94407,1 HX3 Broaut HCC1000 g.ch:1702471020-T ( ozpous ) C 1490CT DA499V CCDA10.1 DONI Brons HCC1303 g.dv5 : 178020 1630 > T 159 16T DEN1 Prosut HCC108 . : 1702201626A CB32G > A A Ezrak COS20.1 DEN1 Eroast BBIOT ndr ) : 170017072G 1918G C p . E6400 CCO3 + 422.1 POLIM ? HOC2157 o.ch:170843275G p.X450N CCD3430.1 GMCLIL drcent HCC1107 g.ch:177548188dok thomatycous ) c74100A GMOLIL Coral Coto 2.c : 17756083T > C 4.8241 D.V275A CCD94442.5 GRMO xos HCC1008 Q.cd:17.3318230T 6.5720T p.8191F CCOSA445.1 RUPYI Broast HCC1008 0.0 : 176929004GT p.C150F CCOS4450.1 XL0878 Brau MCC1003 Q.ch:179223550SA 4.320BCA p.P10890 CCD94477.1 SERPIN81 Anast BAST och : 2785885_27a5b85dum 6. 137_dupG CCOS4477.1 SERPINB1 Broat HCC1395 D.UB : 2779248G > C CCD94483,1 MoCogo Caloract 0.18 : 31714BSCT p.REW CCD + * 80.1 Broan HCC1305 0.08: 3888941G > 0.807G p.E2030 CCD :34488.1 PRPFUA BDB * HC218 Q.chro : 39942870G c . 19740G p.F250L CCO94480.1 PRPF4B B817T 8 : 3994317G > A c.2004 > A D.WESEX CCD91903,1 BHPS Colarosta 0.ch:7*075$4CA , 10280A PA3430 CCOX4503.1 BUPO Colonocat x2 9.avo :70754600T c.1427CT p . 0478L CCD94531.1 Colorada Q.ch/8:14005457Y>C c.120T > p.443A CCOSA301.1 ANF 182 MOX4 % .ch : 14085502CST 4.173CT P.P5BL CCDAS 1 HISTIHIE Cotonectat W37 c.380C > T DA12V COOKS029.1 HOSTIZBA Coord MX2 p.c8: 278P 11280T P.H1 TOY COR4A3,1 WINTIHIB Q.cht : 77843208AT 470AT p.K27X CCD9B35.1 HIST118 Colarostor x43 g.ch8 : 278430300SA € .2579 p.GBGD HISTIHL Ht899 4ch?a tác c . 1000 p.EB40 CCO91644.7 ZNF39 Colorecta Nx43 g.ch:282025826>A 44100 p.R1370 CCOSAA58.1 QR1203 Braut HCC 1309 g.ch:20450204C 4,750C > G p.F250L CCOS.703 . ) BAT Snart BezoT g.c : 3170788DT 280CT P.Ticart CCOS4708.1 BAT Broaut HCC 1994 p.che; 317078B4GA 0.3456GA P.R1152H CCOS709.1 BAT3 Bloga HCC1395 8 : 3171488403 UTA CCCS724.1 Co70 .ch : 310453026A 10300A DA3471 cco94724.1 Catandu g.ch.8 : 319440120T 12380T AT412M CCD94731.1 SXOVL HOC 1187 g . 18 :320087990 +84700 CCD94731 . 8V2L Com .ch3 ; 32042557CA ALIV Coop1 0.2205CSA p.M7651 CCD84739, HOC 1187 g.chro : 322264010 A 6.280G > A PAST cc094789.1 MSD 1788 HOC 1187 w.chro : 332812880 > T P.V1502 cc0948 18.1 WAPX13 Brook HCC1037 9.c10 : 387147380T p.E 18X CC094838.1 ON Colorretot C002 g.ch:300487500T C.8877CT P.T22281 CCD34944.1 coort102 Skott W2218 f.drs : 30053834CA 611570A PAISSE CCD848 1 . TREMLI Soost HCC 1143 p.c16 : 41220989CG C. 180G p.LOV CCD94854.1 TRENI Boont HCC 157 4ch0: 413582200 288CA P.R978 CCD34958.1 FOXP4 Arcas HCC 1143 v?i 21A 33510 RASIT CC094003 , ZNF310 BDS3T g.c0: 434303 ISAG c . 1095 P.N323 CCD94895.1 ZNF318 HCC1395 ochrt : 43415894GC p.G1094A CCD94002.7 POLY Brust MCC 1305 .ch : 136631726 p.G15ND CCO94008.1 SLAI Colowodat MX2 p.chro : 443077726-6A PA2891 CCOS4008.1 SLUAI Coloroeba .chro : 44308235AQ tas P. Y CCD94022.9 GPR 118 @das ch8: 177030030T 71820T P. $ 731L CCO940271 RHAO Broant HCC1008 od : 408828150T 1303CT CCD94933,1 TFAP2 Broast HCC 218 g.chro : 50804580GT HD CCD84035 , 1 P.V14F PXO Coloroctal g.chuo : 520580080 > A D.RIBH CCD9403.1 PKHD1 Colorectat HX5 w.chre : 520059100T 241CT D.R10 : 16 CC094935 . PKHD1 Colorocta ! g.chro : 92005204T > 43707T > G p.11096R CC094023,1 PWDI Coloroctol g.chro : 510976970T p.R1824W CCD944933.1 PKHDS Coloractat Hu189 o.ch6: 519803510A 05.10G - A p.61806K C # 084057.1 UN00350 Orbant HCC1395 0.dwo : 553242226C P. 0163M CC094970 . COAT p.ch:70800859G-A p.G301D CCD84970.1 COAT Bros HCC1395 g.chra : 7095A7890 3037G > C D.K1019N COO476.1 KCS Colonocta ! MAZ Q.chro : 73808461T > G p.W101G CCOS 4978.1 KCHOS Colorectal M4 g.chro : 738438700T 47307 D.R24C CO109 Colorecta H218 g.chro : 745733460G p.Q10075 CCO04982,1 CD109 Coloroctos M39 .ch : 745745320A G31050A P.N1003K CCO94987.1 PHP Colorecta O.chr0 : 797818370 > A C 1405C " D.V4651 CCD94607 , 1 PHP Colorectas C079 O.chro : 7970720SGT c5000GT p.R17871 @rorat Hi?n na8: B3c9MM C.3483G - C AD11 % SH MEBSOR HCC1187 g.cht :847084966 > T p.XTY CCD35000.1 MCASOR Breast BesaT g.co:6470600A P.LIDOM COo8s01.1 EPHAY Colorectal M27 0 :64171890T 11110T D.R37 W CC33032.1 MANEA HC357 q.ch 0 : 08180805ANO 4.982AG p.YU 1C CCD95048.5 GRIK Broan chro : 1027312080 > C 4.538G > C P.E1870 CC03505..1 AP05 Colordotal p.chra : 108882BOSAT € 17A > T D. SO CC33070.1 MICAL Breast HCC1395 chro : 1098795040A c.923CA D.L30SM < COS1078.1 MICAL Brdost HCC1509 a.chep, hinsac CCES5082.1 DOO Brod HC210 ch : 110828txa C 4060 CCD95091.1 REYOL Colorecta 27 0.chuo : 111603854_111803854dupT 4.2163_cupT CCD9 $ 111.1 Biroest HCC210 9.co.1171199 1600 C14CG P.Fidt CCO3.111.1 KPNAS ATDAN BAST p.curs : 1 171521890T 4.957QT p.R3193 CCOS $ 119.1 Con204 Broas HCC1383 Q.chro : 118919830CT c . 10430T P.6348F CCD5138.1 Brdou HCC1509 0.chure : 129077559 " > G 4,3470CG p.P1180A CCD95185.1 EYA Colores o.chro : 13382518373 P.L15ZR CCD33105.5 EYM Colerocia M29 0.0 * 0 : 1338314930A CB01G P.0301N CcOS5206.1 FAX030 Colorecta . Co7 . od : 14618921200 230 P.Sec GRM : Colorecta g.chro : 1487018 $ 40T AR698W cco95228.1 LTMFDIL Ca?orocta Act: 151350128T > G D.L414R CC093229.1 AKAP 12 Calorecta och8 : 151782358G > A 0.718G > A p.E240K CCD95229,1 AKAP 12 corocta M 9. cud : 1517854204 > Thomozygous ) c.3B & QA > C P.KIT cco , OYNET Colorocter MX3 w.chro : 1527008080 > A c . 11011GA p . 738711 CCD86238.1 BYNET Colorats g.ch:152747421AC p.242100 SY ARE Colorectal W.22 Wars : 1627473830 > A c . 1200 GA P.R42234 CCOS $ 238.1 SYNE Colorectal Cor g.ch:162731382TG 4.16520T G p.LSSO7R CcOS5237.1 SYNE : N441 o.ch:157553254G-A 6.89750A P.R2992H U.S. Patent Sep. 29 , 2020 Sheet 20 of 36 US 10,787,712 B2

Figure 12 - Continued

COD35249.1 MAQUI Breda HCC1000 a.chr8 : 154B46733_154848711 do GMGQATAAGTTTTAACTOTGOT c . 520_5514QAGGATANAGTTTTMACTGTGGT CcO9 : 2 $ 1,1 ARIDIB Broot HCC1395 Out : 157548383GC 2287GC p.0756A CCD85289.1 TCPT MAA HCC1000 2.0: 1601808930 p.lt CC086278.1 Braat HC218 p.cy:180842140CT IS2C > T CCOS5285.1 OX vc . Caga Q.chro : 1838502383 > A C. 1007CPA P.R2380 CCD85931.1 SNXO Cotorocta Q.ch7 : 208482000 C. 440CG PA1476 CCOS.357.1 ZO + CA Broen HCC1844 g.ch/7:63BSA20 4.310CST P.P14 CCD95458.1 RPAS Coloradta ! 0.27 : 7451981GT c . 1510T p.651X CCDS 368.1 FEROOL Colorecta Co82 Q.chu7 : 16050120GA 106GBA P.GR CCD85371.1 ABCBS Colorectal p.ch# 7 : 205112034 - T 1.888AT P.E230V CCO3.380.1 GPDUB BBTT g.ch7: 230871330A PA100 Cos5180.1 GPNMB Brest w.ch7 : 23060950GT 6. 1550GT 2.55191 HOX3 HCC18 par7 : 289223780 > A 0.124CA P.DAN CCD954404.1 HOXA3 BroBit 882BT g.ch:20823109G>A 0,391CA PA1317 HOXM HCC1395 g.ch7 : 26943483G > A € , 110G > p.370 CC095416.1 BOR HCC718 och / 7 : 278063JANG 4.137AG p.4 7R CCES24.1 PEDAS HCC2713 Q.ch7: 2 885501G > A CCD35424.1 PLEKB Broaut HCC1000 D.7283747571 - A 1103TA AVSBE GHRHR Cataracter Wbus 0.ch7 : 307817840 > A 6.133GA PAST CCD85435.1 LOC273075 C076 Q.ch17 : 31384 080T > C 3137 p.L105V CcOS52.1 TXNDO - 3 Brest HO02157 p.c ? : 3768072 + T > C 4.866T > C p.1209T cc09883.1 C701111 HC2218 g.ch7 : 390471321GA 488G > A p.GZBE CCO99485.1 GUJ Colorocta Cart D.ch7 : 41881503CT 4.506CT P.P1697 CCD35403.1 Cokanoc Com Q.chy7 : 41778001T > C 4.3910T > D.81304P CCD95487.1 PSM Cotoroctol Q.ch7: 427378600G $ 32800 p.L110v CC085303 , 1 KOFOP3 27 p.ch17 : 45733980CT p.TV IGFBP . H218 .ch : 7 : 45727781CT 7540T p . 2.52c CCOSS531,1 ASL Broast HCC1837 2.497 :84895896C > p.T1815 CCD95531,1 ABL BB12T g.ch7 : 849959552T 0.598GT p.6.2007 CCD98549.1 BAZ18 HCC1385 p.ch:723288170G 0.27470G p.S918x CCO85599.1 BE3 HCC 1854 .ch7 : 2303844983rA G. 391GPA RA131T ccog $ 800,1 ABC3 Colpractat Mit p.chr7 : 888032es > T c_260191 P.K8B7N CC085022 . AKUPO Colorecta Co100 Q.clu7 : 81325299_91335300GTCC 5678_587TMEGTCC NAP Bro8 BBST W7 :01344028_0134402eduna a 6384_dupa CcDosa21 UPO Colorectal g.chw7 :91353325G - T 072270 > T p.W24095 CcOS58221 Bindest HCC 1008 g.ch:1370313G-C 6.908SG p.62970 CCD85029,1 LOC253012 Browst HCC1951 g.ch67-92493404G - A 4. SSG > A P.GIOR CcOS5089.1 GPA HOC2210 g.ch:954178960>A ( homozygous ) 3980A p.02OON CCD85095.1 THO - 1 HCC1837 .ch 7 : 997084WGA C. 885GSA M. VZOM CC095716.1 ZHOT Colorecta chr7 : 100460515C - T 4.400CST p.R134W CC095720.1 an HCC2157 .ch7: 10151 1870A » G 1488ANG p . $ 400G COS $ 720.1 Cakractat och7 : 101518570C > T 18250T CONST37.1 P9EF1 9.677 : 105503630TC c . 527TC p . 1785 CcOS5751.1 NRCAN Broa BA23T p.ch17 : 1073830950A 0.37780A p.P1093H NRCAM Arvest g.ch:10738451 1G > T 3347G - T P.G1118V CC09373.1 N277 Broast HOC1837 07: 11157367BAT 956AT p.20 CCO93789.1 INF777 HCC1395 p.ch:111578717G>C G. 120G P.L433F CCORUT 0,1 PPPIRA Broot Q.ch7: 113113437G > C 4. 1601 p -0554A FOXP1 B76891 HCC1599 0.chr7 : 113883859CT + 45C > T P.Q149X CcOS5782.1 TFEC Colbracht g.ch:11518859-40G 4.438C p.L148V CC35771.1 WW2 Broas HOC 1599 qch7: 114512383_11651733Ada CAACCIGACTTCCCGGGOCATGGA C.362905do CAACCTGACTTCCCGGGGCATGGA dot CCD85780.1 WT18 Colorocta MX38 g.ch:120585712G>A 6.340G - A p.V11BM ccOS.5787.1 FU5834 Colorectat Co 108 g.ch:1229889206>A 0.220-4G D.R7356 CcOS $ 799.1 LRACA HCC 1000 o.ch 7 : 1272840471272840360 # TATCTGRACTTO $ 98_609daITATCTGAUCTTG p.Y200 203dol CCOXSUTB8.1 LRRC Cotoractat Mox42 0.471272829100G # 1735 p . 1579A CC095820.1 SECBL1 Colorectal Hot72 7 : 1324502050 > T 40590T p . 3220 CCOS $ 29.1 8ECWL1 Cororocta Coo g.ch 7 : 1330076876 4 1795GA PA500T CCO93828.1 BECSL 1 Colorectal g.ch:133050808_*33059828dOLAAGAMAACTTGTCATCAG c . 18891907 deAAGMAMACTTOTCATCAG CcOS5837.1 FL11000 Colorectat M42 .ch : 134308783CA 3350A PA112E CCD95830.1 MGC5242 Colorocta MX27 p.chr7 : 134308847CT c . 161CY P.PL CCOSSB5..t TEXA91 Brest KCC1187 och 7 : 1300842240T 0.256C > T P.R & BW CCD95883.1 ORAR Colorectat Co 108 g.ch:139908320TA c . 1799T A p.VODOE MULK Brut HCC1000 p.ch7: 140784320_140784345deICTTTGTACAGQAQAATATTA 6.821_040docTTGTACAGGAGAATATTA Ccos9872 . PR881 Coloroctor Q.chr7 : 141948123CT c . 4100T T137H CCD85973.1 EPHAR Colorecta Ca 108 ochr7 : 1420801980 > A c 1033GA p.D345 CcOS5073.1 EPHBS Colorectal Hx109 p.chr7 :142082259GC c . 1782C > P.A588P cc099973.1 EPHES Coloroso MEX 3 g.ch/7:142093204G > 4.7111G > A P.R7040 CCD85870.1 EPH88 Colorecta MX43 Q.C7: 142084865A » G c.274AG p.D915G GCD85881.1 ALONS Brannt H : 89 ? Bahu : 1475559180 - A c.1642G - A D.E540X CCD84891.1 Ez a Colorocta M + 2 p.ch7: 147951992147831991dupTA c . 1380_13810TA CCO85897,1 FW3141 ) Broast MCC1000 g.ch7 : 146609580_146809580dotAGC 6.1480_1470d ACC p.8490de CC089000 . Breant HCC1990 och 7 : 1488932377 > A 4.497 > A p.V1BBE CCD890 12.1 N083 Colorecta H0 g.ch 7 : 1501301530T 14200 T D.R474C CCDS $ 9121 NOS ) Coboroctal Co109 actu7 : 1501412150 > A 1805 P.RBORO ecd03013.1 ABCBO Pront BA 19T g.ch:150189047T > 6443T » p.1348T CCD950 13.1 ABCD : Braagt RC1187 g.ch:150178345CG 4.2018 PASTYG CCD95827.1 PHER Cororoctal M22 p.ch7 : 1506033520 > A e . 150 p.E138 % CCD85601 . WUL Colorectal o.ch:7:131399910T>G 1039T > p.c347G CC09531.1 MULS Colorectal 0.77 : 1313973503 > A 11080A p.DDON CcOS5001.1 Cotu 079 g.ch:131387313T > 414331 > P.1478W 24 . CCOUS5831,1 WLW ) Colorectat Mbro g.ch7 : 181339999_151339930daTTTTTGGATAGGTATTGGTGGATTT 11,3870doTGGATAGGTATTGGTGGATTTA A ATGGTGCGGCUMAGA YGOTGAGGAGA CCDB % 831.1 HL Cataractat o.ch:1333188770 0.5718CT D.R $608X Coloroctol C74 g.ch:1512972184T 11092AST p.738089 CCD95930 , HTASA Coloroctol Co92 ch7: 154313.5550 4.784CT p.R282C CcOS5947,1 Colorecta g.ch:158948975G>A 421466 > p.718K CCD : 5,1 LOC157097 Colorectat 0.8: 8878186 LOC157697 Cotrocta 0079 g.ch:8087830T 230330T AL385F CCD35981.1 DEFA Cotaracta ! g.chro : 8781025G > A 6.221GA D.R740 U.S. Patent Sep. 29 , 2020 Sheet 21 of 36 US 10,787,712 B2

Figure 12 - Continued

CCDS8072.1 HR Calandia M41 achs : 22037124G > A c . 1898GA p.78330 CCOS8O20.3 HUC218 Octo8 : 220788080 >Chondygous ) p.DA5M COSBO_3.1 NEF ) BRODA Qu8 : 24827214.248272274 tobo ( homozygous ) 180 00_120e11100p CCD88031.1 DPYSL2 Cotroced Mato a.ch8 : 2858584DCT P.RO1C CCES8057.1 ADRAJA Breast HCC1187 q.ch:8:287782880-T 6. 118CT P.6407 ccossos , 8TMN Colorecta ! W27 w.ch8 : 271551300 > T c . 171G > T p.W57C CCOS8081.1 PURG HCC2157 th?89cbon p . 316T CCS08.1 WRN Cotoroda Co92 Q.chr8 : 310404126T 0.275G > T p.G92V CCOSB097,1 GPA124 Cotonector M20 Q.ch:37809825_37809825dup c . 1218_Lupo CCOS8119.1 ANKI HCC1008 O.cha : 41690449G > C 0.894CC p.02H CCD98128.1 XBXB Breast HOC 38 w.ch3: 422935320T 1070BT DA303 3 HOOK HCC 143 0.8: 42008057AG p . 221R CCOS8131,1 GPRT Broust His D.do:540150780A Colorectat Co74 g.ch:50221983GT C. VOGT PA2143 CO ADHFE : Broost HCC1008 g.ch:8:87523750AT c.501A > T P.0194V BOK Broost HCC1395 g.ch:87038883CT 2750T PASIV coso100.5 ARFGEF Calorectal C.92 pro : 803028240 -970A p.G318E CCDS 201.1 DEPOC2 Colector g.chro : 691522250 A Domozygous ) C 16096 DV5371 B Comoda q.che : 09155281_6913525 tdupT 1092CupT CC068201.1 DEPDC Colorectal Mx2 g.ch3 : 892993320A 47120A PA1571E CCOSEZO3.1 VEOT1 Coloractat Co92 Q.1: 89571125AC p.KSON KGNOZ Colorected g.ch:740114926A 13460 p .V4501 CCOSA230 , FABRA Bront HCC1051 D.chr8 : 02597ABOAC 89AC P.EXD cco98258.1 RUNXITI Colorecta o.ch 8.93037651CT 611580T D.R39W CCD66268.1 RUNITI Colorectal g.ch:9487624C-T P.R35W CCOS8298.1 RUNYIT Colkorocta Mx8 p.chro :B30521890T 6.14120T P.MIV Broast HCC 38 p.c8: 89232009GC p.68750 Ernest HCC1937 C.ch:10090145&CO B001CG D.L3001V CC TM76F4 Ca?orocar C07 D.co:1054060>T c12376T p.E412X Ccosa 15.1 COMO Cotorectad chat : 114100330TG 0.90XT > G P ,W320 C CSWDO M27 9.06 : 113386584GX P.R307054 335 CSMDG HCC1598 0.ch:113346883_1133458400CTTOTACAATTAATQGCACATGGA c.0841_0684daCTTGTACAATTAATGGCACATGG ccoSa 15.1 CSMD Colorado H218 2.Chy : 1133258920A + 10007BOSA p.A3350 ENPP2 Man a.chre : 120877278GA c 11180A p.373 ZNF372 Colorocta M27 picha: 120099220GT c.1535GT p.C312F CCES8358.1 FL.632440 Brunt HCC1395 0.c : 12818383SGC c.816 p.L275 30 ADCYO Cotonet 8 : 131817737 c.2843 P.F8814 CcOS X89.1 VHRFA Cotoraca ch8411018TA C.MOTA P.IO7N CCDSBI 8.1 UHAP2 Cotorbetet o.ch:64772 ORANG NS8 + 370 #P CCDS 177,1 PTPRD Catorcat g.ch:88288266A C.83G > P.R20 CCD $ 6472.1 PTPRO colorocta 84 .chro : 8971372T > C p.1278P CCDSB472.1 PTPRO Coordat g.ch:8478142T>C 6.2836TC p . VO 79A CCOS $ 495 . IPN81 p.chro : 27087377G > T $ 49.2G p.WC IFNA2 HCC1954 g.ch:21374700CT 5000T p.61m CCS0514.1 OMRTA1 Color MX27 D.ch.22441419C > T 4.102240T P.A320 TEK HCC2218 o.chu : 27148127G > C 635 10 > C p.X1171 CCCS8574.1 FANCG Colorata w.cheng.350841550A . 1919GA P.ABOTT CCO36975.1 cataract o.ch:35081828TA Q.2058T > p . 148cm CCOS8579,1 UN13B Colorado C.92 g.chr8 : 35285791CT 6.625CT CCOSAS $ 0,1 TESX1 O.choo : 35999473CT ( harnozygous ) C. 1816CT A HS397 CCOS8812.1 FRMPOI HCC1107 g.c : 37730240G > A 17150A P.G5720 CcOS881 . , 1 MCARTI g.chra.378779340 thamowypous ) AT2051 CCoSca : 5.1 VPS 13A Colorectal M277 g.chro : 77053989 > 4.4826 p.R1611 CCD8872.7 Coloro ctal Mga g.ch:85477758G>A Thomazygous) 4. 12876A P.E423K CCDS807 2.1 AGTPBPI Coloractat Wb32 chro : 85477540C > T # 1488CT p.R486X CCCXS8892,1 SPTLCI Bindast HCC2187 .chro :91897307C - T p.R23W COSB701 . ) SUSO Broad HCC 38 g.chr9.02919823TA C. 41 & TA p .31407 COUS8745.7 STX17 Colorectal WA .chne : 99810420dolu (horarygoun ) cotodola CCUS702 . ) ABCAS Colorscat HX177 2.ch : 1070041AC AOC p.E210D CCOS8762.1 ABCAT coloractat Coro ochro : 104684471CT 27400T p.D9177 CCDXS87B2.1 ABOA Colocal gdug . 1048513570A 5.4219GA PA1407T Ccose787.1 ABCA1 Colorseta M129 g.do : 1046787100A 4,8375GA DA21097 CCO $ 8788.1 FCMD HCC1395 o.ch:105440380GA c . 6730 p.DZ25N CCDS0788.1 Brons HCC1395 g.chro , 1054 0887TA a 675T > A p.o255 CCOS8773.1 IKBKAP HCC1907 g.ctwo: 10871402GC c . 268SGC p.M9301 CCCS8813,1 ASTN2 Brest HCC1954 g.ch:1 182878270C 43724G - C P.V12 2L 0801 Colorocta Musa p.chro , 1190080880A 4.21340A P.P712T CCDXS8B2B.1 CSN raad HCC1008 ch ? CCOSA 28.1 GSN Arnad BBZ3T Q.chro : 1211520130T 2802CT p.T2011 CCOS8878.1 CSN B828T 0.c.1711602310A 18320 D.8811N CCES883 .. NOUPAS Broast HQ 157 w.chro : 12198817 %AC 18AC P.N140H CcOS8844.1 ORINI Branst HCC 38 Q.chert : 922358458CA 580A PT190N CCDS 51.1 Brodat 578T p.co: 1230002000 > p.GZOOR SPTANI Braait 8913T o.ch:128427731CG p.390NC CCOS805.3 SPTAN1 Breast BB9T ochro : 1284333520T 3049CT p.P10173 SPTAN1 Brdan HCC1054 ress site P.R17947 CCOS8903.1 SPTANT Brau BB27T ochro : 1284630240A 057520 p.D1918N 8PTAN1 BBT g.ch:120475167doc 47399doc CCO36940.1 NUP214 Broost BBST g.chye , 1310150266 > p.G424 CCES8040.1 NUP 21 . Broast HCC1000 odre : 131102588CT p.P1378L CCOS8940.1 NUP214 Drost BBT p.chro : 131107610CT 641750T P.A1392V Brah g.ch:131213231CT 182-30T UTR CCD98949.1 FUN46082 Colorectat qdo: 132404423CT < $ * T P.R1726 CCOS & 997.1 GFIJD Colorecta x2 ochro : 1328947280A 4.8820 p.R23IH CCDS0959 , RALOD3 Colorecta o.chro : 133011618GT a 14070 p.R 90L CCOSBSB. SURFI Arad HCC1393 och : 133751124C 267CG p.MOOK CCD58983.1 FCN2 Colorata g.ch:135001117C-T 0.230CT P.Psor CCDS985.1 g.chro : 135030351A > O p.Y175C CCOST010,1 AEGP HCC 38 w.chre : 137024559CMA hoitotypovs } 47300A P.P244T Broox OB 13 Y Qahrt.137077846_137027846khupC 62797_cup U.S. Patent Sep. 29 , 2020 Sheet 22 of 36 US 10,787,712 B2

Figure 12 - Continued

p.R1095W CCOS7010.1 AEGP BOB BB2T Q.cug : 1370302640 B p.K17N CCO9704.1 ASMAT Broan HC2218 g.ch:1372590680 56 CCD87050.1 AB13T vol3753853 t . 35CT PAINp.Y1142F CC097050.1 EHTI Brtast HECZ218 g.chue , 137838405A > T 4.3425A > T .chrt0 : 435084_435083 AGCACACCTTGCTTTGGGGTCARACGTG 12 $ _12267AG CACAGCTTGCTTTGGGGTCAA CCO97054.1 KONA0934 Proput B927T QATCAGCAGCCTCTTCGTCAGTM ACGTGGATCAGCACCCTCTTGGTCACTA Press HCC1689 p.chr10 : 420088CA € 17570A P.ASSE CC097091.1 K0934 C1804A p.co 229 ccp07034.1 KUM0034 Catoractal D.chr104199790A ts K24 Bro BB1ZT o.chr10 : 380592daft 2832deT CCD8705 4.1 4063 Breast HCC1187 O.chr10.3630800mA P.V1241 ccd97068.1 ADARE Colorbetet H208 g.chrto : 13858710T 6290 p . 1210M CCD97058.1 ACARB2 Colorado Co100 g.chr10.12530390A 15340A PVS121 CCD97007.1 NE HCC 1143 g.chr10 : 54857220 > A C. ZG > A P.D140N CC097099.1 C100x130 Braest HCC1395 o.ch:135630300C D.R2017 CC09710.1 C1001146 Breast HCC 30 g.ch:10.147408370>C domanypows ) D.ESQ CCO37403.1 HSPA ++ HCC1589 D.Chw10 : 14930046CT 4.2540 > PAASV CCO37104.1 SU9H2 Brdam HCC215 O.chr10.14004431G > C 6.9876 P.DUH CCO97113.1 CUBIN o.h10.17153020C > A c.2368A P. 7560 CCO37113.1 CUBN Bron HC2157 0.co.17147845AC 1-2 CCOS7113.1 Cataractat 0.010 : 770020240 > T C.8756CT P.A2252 CCD97113,1 CUBN Broast BBZOT g.chro : 180723000T c8741CT D.A2914Vp.13189V CCD97112.1 CUEN Braas B13T o.ch:16933338A>G COS & SAXG Coordat M30 o.ch:10:17311080 > 4. 559G - T P.E1A7X CCOS7120.1 VM 0.8333A p.02120 STAN Colorocta o.chro : 177771530 > A p.P 4717 CC087124.1 SLC3A12 Broast HCC1837 g.ch 10.103202270A PA90 CCS7125 , CACNA2 Colorecto p.chr10.187309410G A. Vogt CCD37139.1 6PAGO roast HCC1599 g.chr10 : 22897457G - T 4316G > T , 1424CT p . 3475 CCOS750 . WAC Colorectal C010 g.chro : 200408440 P.K38IN CCOS7188 . ? LOC22062 HOC 1143 p.chr10 : 311781970 p.R289H CCD97191.1 CX 10.1 Colorecta Hx218 o.ch/10:358372530SA C. 8060 p.0271R CCOS7191.1 CX0.1 Colorac CO108 Ochr10.359372580A CCO37183.1 ANCORA @root HOC1954 o.chrto - 374520110G 0511 A.Q171E HCC1395 p.chr10.382884350 > A 4.810A RE21K CCD97183.1 2529 HCC 2157 Ochr10 : 38282BBBAG P.DO1G CCD37200.1 RET Colorecta Woo w.chr10 : 429178927G RV1450 CCO37200.1 RET Colorectal ochro : 429244BDOT 1070CT P.A30W ccc97200.1 Coloroctol MX47 9.61042929028GA 1778GA p.Q583E cc037203,1 RASSF Colorecta och 10 : 447980850T 42200 p.Q77X CCD37211 . ZNF7 Brost HCC1143 och 10 : 44019205 > T 638BAT P.H129L RBP ) Coloractat C002 o.ch:10 ; 48009205G > A € 1589GA D.R530H CC097216,7 2104CT P.R702W CC0972221 FRNPD Colorectal MX22 D.ch 10.4909532BCT p.RICOH CCD97220.1 Croat2 Colorectal Most ter 89888402A 6299 CC097229.1 EROC8 Colorocta Ochr10 : 50371216CG 6. 1771CG D.P591A ERCCS Coordetal 163835 p.R657l CCD97229.1 ERCCB Broot g.cx10.5034889DGC c.31139 P.R10SOT Prag HCM29 o.co.503488570 - C -3355GIC p.E1119p . 11100 CCD37229.1 ERCOO goo.509885AAT c . WAT p.D150 PGOT Proost ch10,5009392 A > c . 12 + AAG p.ESOTK CCO372821 CCART Ca?oroctal ch ? 01282GA a10196 p.K57N PP Q.chr 10 :71048592 CCC97299.1 Brest 235A D.E270 CCO37304.1 NODAL Cotonetta M38 g . 10 :718851046 > A P.R123H CCD37309 . Colorado MX26 0.ch 10 : 72030297G > A 3886 > A p.1208V USPS Brobat HCC1000 p.chrto : 740485860G CCD8715,1 MYSTE Braut HCC1008 g.chr10 : 7840554 A > thomozymous ) 1447A » G P.TABAp.1551V CCO97.07.1 R17 Broast HCC2218 p.chrto :80728328CG c . 1851CG p.X2429 CCO37238 .; C1001 Broad HCC1399 g.ch:10:80916108G>C 725G p.VUBM CCO3T379.7 MMRN Colorect MX32 0.chrto :88893 170GA CIMZGA p.V1071 CC®37300 . ) ATAD1 Cotorca ) Co108 g.chro : 89540170GA 3186 A Eroast KC - 100B Och 10 :04824811G > A 6.5000 D.W167X CCO37442.1 SORBSI HCC 1954 Ochr10 :971643726A CSA2GA PA185Tp.032X CCD37470,1 AVP11 Enam KC1187 Ochr10 : 8842955 $ T (homozygous ) CCD37403 . nara HEC1954 Q.ch 10.101492838CT c.2300 P.PTIL CCD97494.1 WNTHE Cotonda Cara o.cr10 : 102729875GC 1576 PE539 CCD97301.1 BODI p.ch10 : 1027299000 C. 1166CT P.H33Y CCD97507 . ) Z182 Cataractal Momo g.ch 10.102752847GA 0.3820 P.R121H CCOS7507.3 UZT82 Baput HCC1954 Q.chr10.102753716G > C 871GC p.R2830 CCCS75701 LOR1 Colorocta Cao ? chr10.1038588450A c7880 IN Brow # HCC1000 0502 6.3780 P.E1100 c.869AC p.X223N CC097559,1 SORT81 KCC1187 Q.chrid : 108.5793794 > C P.8502X ADOS Coloractat Cos2 o.chr10 : 111082005CG 17750G p.Q120R CC097567.1 POCO4 HCC1008 ochr10 : 1128327620C p.KAR CC097572.1 ACSLS Colorecta M2 1867 C. 133TANG p.G4680 CC097672.3 ACÉLS Color H 18 . Ochr10 : 1141878040 > A ( homozypous ) 013070 CCD97576,1 TCF7 Colorectal Co82 Ochr10 : 11490776BAG IV 10-20 HP CC097576 . TCF7L2 Colorado 172 w.ch10 : 1149077800- thomozygous ) M310-1G > CCD97976 . 1 TCA712 Coloroctal M41 0.010 : 114015323CT 1.139307 P.A49C CCD97389.1 AWACO Cotonectat Mart 62 GOTG P.L137R CCCS7 590,1 ABLIMI Broast HOE 38 g.chro : 1183517130T p.81280 CCO87595.1 PNLPRP Pran HCC1008 182870 4388C p.R2030 cc087820.5 FOFAZ Brast #B 0.0070 p.798V CCO37628,1 Buon BBAT .choto : 12383439700 0.23920G CCD97678 , HCC1599 3030 PA1370 Cro97810 . C10037 Colorado C 74 017 P.153 CCO37046,1 Ciort 137 Colprocta g.cy0 : 127309037CT P.LOSF CC097040.1 C100137 Hat189 w.chrto.127414420 41835C PYS45X CCD97649.1 BCCIP ochro.12750518BGT . 1080T P.EAZX cc037852 , 1 2002 HC130 $ 0.0 10.1276093850 ( hortatysous ) 8280G P.PZOSRp.03011 cC097650 , ADWM12 Burgos HCC1000 ochro: 127779650GC C.DOIG p.G47BE ADAM12 Prox1 BBST 2737 14360 CC087893,1 ADM2 HCC1300 027887 0.237BGT p.L782F U.S. Patent Sep. 29 , 2020 Sheet 23 of 36 US 10,787,712 B2

Figure 12 - Continued

CCDS76821 TCEROIL Colorectat o.chr10 : 132205137A > C 1187ANC p.X3987 CCD87884,1 C10029 Brosat MCC1305 w.chno: 133828871C 88SCO p.R2890 COD37800.1 ST102C Cotrocte och 10 : 133083093dal ( homozydows ) 6.700dak 1 CCDS7889.1 BTC C079 Bc410 : 133886259QA (homozygous ) 4 1127GAI p .378 CCD97682.1 PAQUX Corected co74 0.cm0 : 135093889G > A 14060A P.R4999 CCD97721.5 TWSFT HCC1395 p.chr 1 : 857887CG 201CG p.1871 cc097748.1 NUP98 HCC1443 p.ch:11:37587830 e2CG P.584X CCD97748.1 NP98 HCC1187 Q.ch:11:3857478G-T (homozygous ) € 4835GT p.01837V CCD97784,1 Colorectal Mart3 p.chr 1 : 84202020T 6. 15780 T p.RS6X CC08771. OCH31 Coloroctol M43 o.chr 1 : 8807854CT 6.47470 p.R1500W CCD37778.3 NALP14 Brandt HC02218 Ochr 1 : 70355280G p.87790 CCOO7770.1 DYT Colorecte C074 p.chr 1 : 73350310A 13330 P.DSN CO87788.1 RICS co74 w.cht: 808AA9G - T D.0345V CCD97802.1 AMP3 Ca?orocta M28 g.cw11: 10428 108T > (tommorous ) 191 + 27 sp CCD97008 .. OKKO Broert HCC1000 cort 1 : 1197668000 2.8129x CCD376721 MYOD1 HCC1006 pc11 : 176994520A 704GA CCO3767.1 MYOD 8913T g.chy11 : 170895040- > 4.928CT PA3097 CC097654.1 SLOOMS HOC1395 Qy11 : 2031880BTA c . 1895A D. VODE CCD97895.1 NELLI Colorocta M7 1.21512308GT £ . 18540 p.C553F CCD37050.1 SLC17AO HCC1008 07172318891A > T (homotyogu ) 1184 > T P.T499 CC097871,1 FL45154 Mor30 Q.11 : 30881846C > T + 17080T P.ASB9V CC097873.1 CS3 Broast BB13T a.chm : 31348934A > G CAG P.N220 CCD87873.1 ZCSU HCC1187 p.11 : 31404489_31404470dMTCTTO 4304_308. do TCTTG CCO37878.1 RCN1 Coton.ct M43 Ocut 1 : 32075382T > G 035 ? T = 0 P.F : 17 OCD37000.1 Bron 9.do11 : 325887701G 4238A6 P.EBOG CCO87907.5 B913T mr1: 440559760 > A c682GOA P.G221E OCO97907.1 PHAC3 Bros HCC2218 0.chrt 1 : 440813810T 3178CT p.S383L CC037940.5 FOUHO Colorecte MX43 g.chr11 : 481884710 > A C87G > A P -A73T CC097956 . PRG2 D.chri 1 : 58911878CT c . 535CT D.A1796 CCO37971.1 Catorocta 0.art1 : 59125877A > C c.8VAC p.774 CO97987.1 MSS Colorecta Com Bart 1 : 59957842TG 4,38AT p.123R CCOSR03.1 ZBTB3 Bress HCCI143 o.chr : 82274502AT 4.1271A - T p.H424L ZBTB ) 6.chr11 : 62276499C > T s . 13840T p . $ 455F CGD33030.1 ITXA HCC1000 g.ch:62351060CY p.q25H CCOBBO 31 SLAS HCC1037 g.chyt1 :82030BARCT 6 117BCT PA383V CCOS8043,1 SuQ2O Broast HCC 38 g.co:62032785AG c . 1459AG P.M * 87 CCO38043.1 & LMA9 cozorocta 27 o.ch 11 : 0293288DCA 5 , 1963CA P.N52 SK CCD88069.1 PRDXS HCC1305 Ochr 11 :838449443TC ¢ . 1897 p.F157L CCO 800 4.1 800 HCC1187 9.hr11: 848415276 1756 - C P.A59P cc098134.1 C0218 Coloreda MX41 ochott : 85841057G > T c . 180 > T p.LBF CCD8013,1 CO248 Colorecta C079 Ochr11 : 65436848_65838340dup pamokygous ) c.2729 dupc CCD80180.1 8PTBA Cotorocta p.ct1 : 68229003B - A 4.23203A p.e774 cco 8101.1 RCEI Broox HCC1143 ochr 1 : 6837012800 4.9780 D.PCA ccc99104.1 CORO1B Cataratat p.chrit :868628310A D.V411M CCD00184.1 MILS Broa HC218 g.ct: 882745120T C. 5830T P.H.SY CCOS8212 .. FOUR Erdost KOCI837 g.chr11 : 71610382CA 4.700CA p.HZZON CODS & 2 10.1 P097 HC2157 # -chrit : 719800130 > A 03250A AW175X 91C2B KCC 38 g.ch 1 :745527370 > A c.2290 A p.E77K FZO Catate MX39 g.chur11: 0034013AAC 1307A D.K430T CCD80281,1 RA Cotorocta CO74 g.chr 1 : 87522042AC 32ANC P.K11 : T MRE11A Breast 887 g.chr 1 : 93044523T > c.7101> G D.F2370 CC09878 . MRE11A NCC2210 g.chrt: 93043390CT R.K302Y cc 90071.1 MMP 10 BD HCC1008 octur1: 10215 22000 24CC p.E1420 Ccosa328,1 POGFO Colorecta M41 .chr11 : 10331955BGT 0.5886DT p.021884 CCOSO.1 GUCYTAZ 1718 g.chr 1 : 106382016CT p.Q119x CC090933.1 CUCY # A2 Colorectat g.cht: 106083BA2AT c . 2042AT P.E6BTV GUCYIA Caloracol ochr 1 : 10608383CAC 205AAC D.NBEST Çco $ 2.1 Dax10 an KGC1008 Q.ahr 1 : 7080991300 p.L580V CCOS0342.1 DDX10 Bregat BEZ3T g.chr 1 : 10B089215_108099289dalfhomozygous ) c . 1781. 1855ded indd CCD38349.1 FWJ10728 Brosul O.chri1 : 111457912AC IS2 - AC CCD98974 . MGC13125 Colorocio g.11: 1181244084C # 1BB0AXC p_X620V CCOS8379.1 KIA A0999 Ha 578T Q.ch 1 : 1 182518BSAT 0.9020T p.H331L CCS8379.7 KILA0998 BB4OT 9.chr11 : 1162337650T 308CT P.A1103V CCOS8384.1 Colorsdal Mx3 Q.1: 1188044BBCSA 2155GA p.17101 CCOSA384,1 DSCALI Cotonda N2 Q.chr 1 : 116898353 052840A P.V17621 CCD842.1 BIR1 HEC 1395 9.c17 : 118289583G > A 1000 > A AESAK CCOS11,1 DPAOTt HCC 38 g.chr14 : 108.4775496A c270 > A P. M1 CODSBA17.1 PDZ Sredu HCC1937 Q.cr11 : 118564922AXC SP CCO88.28.1 TRIME HCC2218 O.cht1 :1184847270 19410T CC098424.1 TECTA Breost BBIT ochr 1 : 1204942850A 4,851GA P.RAH CCOSSAM.1 TECTA B0001 BB737 @cht: 120504092_120504097cupc 2108 cupc CCO9043.1 TECTA HCC 38 ochr11 : 1205042001> A promozygout ) 2312 > A p . TIN CCOS04.1 TECTA g.ch:120505827AC C24384 D.N813T CCOS8438.1 SORLI Broost B829T o.ch 1 : 120845999 > 03591 PL1209 CcO99419.1 SORL Colorecta Co100 Q.ch 1 : 1209851784 > T sp CCO96438.1 SORLS Bon HCC 38 Q.crit : 120988018_120888020dA CACTCCATCCCC thomaryooun ) 4.4130_4140dXCACTGCATCCCC p.H * 380_P1383401 COS8434.1 SORL1 Breast HCC 157 d.cr11 : 120981121A = T G4741A - T p.M151L CC086438.1 SORLI Colabot MB drti : 120007007C hozygoun( ) p.L 1972 cC094442.1 SCNI8 Colorecta NAS B.ch 11 : 1230185434T C.266AT p.Q891 CCD98442.1 & CNE Co?oroctor Ochr1: 1230141050A 5 : 3GPA PA185T WQW9946 Colorecta .cht1 : 1248717110 > T 5.395QT p.D129Y CC088188.1 COON Brannt HCC 210 ochr 1 : 1252809210A c.17940A p.W598X CCD98460.1 RPUSD Broast HOC1837 p.chr11 : 125580721TC IST> KONJI HCC1009 ochr 1 : 1282150020T tromosypous ) p.9115F CCD8488.1 AOWT813 Colerant C070 o.chr 1 : 1288483azaro C2308AG CCOS8400.1 ADAWT815 chat: 128048703TG AC8780 cco3_500.1 WUX Co74 9. 2 : 202928A > KOBA AE11880 OCD88.300.5 WNK HCC1335 Ochr12 : 08959700 0.539SC p.Q1799 CcDads1.1 AKAPO Colorad B.chr2 : 4399237CT 6.24910T P.RBS1C CCD88338.1 KCHAS Broast RC02167 p.chr12 : 5024472G > A 6.89ao Brosst H3 678T o.chr12 :5998136A 6.470BA » G p.Y1 $ 700 U.S. Patent Sep. 29 , 2020 Sheet 24 of 36 US 10,787,712 B2

Figure 12 - Continued

CCosas . MLF2 Calonuctal Ochr12 :8730171T > 6.239T > p.Foc CCOS8573,1 CLSTN Colorocto C074 Q.cr12 : 72014440T p.H074Y CCDS8505 . VFAPS en ochitz : 80883351 > A 6.18TA P.V10 CCDsas07.1 Broast HCC1395 9.12 : 8977150C > G 618BCG p.S013X CCD88800.1 PZP Cotorocta Oct2 : 9201205GA P.RI123H CCD8-8820.1 FLJ10292 Broot HCC 30 g.ct2 : 10650233GA P.Eit9K CCDS 830.1 CSDA Corcuctat g.ct2 : 10781891AM P CO0883 , Brosat HC1187 .ch12 : 109577IBANG C.446 P.N1495 CCDS8070.1 FW132115 Breast HOC w.ch7121495071014858699d TTCCTAAGTGGA 4.754785dOITTCCTMAGTGG P.F752_G25Scot CcO98584.1 8LCO183 Colorecta COT4 Od 17 : 209105BATO 2.87 & T > p.2824 ccoS 004.1 8LCO103 Cotorocta 0.01912 : 20980278AT t . 1039A ALMX7L CCO90880.1 SLCO1A7 Colorecta C074 pich12 : 21345402G > A C.ASBGA p.V2204 CCRS0091.1 LAB HOC1395 Q.choriz21668743G ) T 181 + 1GT CCD0702 . KRAS Coloradtet Cand 0. 12 : 257aa5520 > A 6.340 > A p.G128 CCDS8702.1 KRAS Colorectat C092 w.chr2 : 25280 $ S10A 4,350 A P.G12 CCC387022.1 KAAS Colore.co .chr2 : 25288551G > A p.G12D CCD38702.7 KRAS Colorectat H00203 2.017257895510 - T hometypous ) 356 > T D.G12V CC098702.1 KRAS H219 Ochr12252895510 > T 6.35G > T p.c12v CCC90702.1 KRAS Colorba H219 J.Cw12252885310 - T 356 > T p.GIZV CCOSB707.1 KRAB Cotorocia M30 Q.c.17 : 282805310C AGIZA CCOS8707.1 KRAB Colorectal p.cher12 : 25289551G > A thomozygous ) P.G120 CCOS8700.1 KRAS Colorocter M : 41 p.ch:12:25288531G>A 4.35GA D.G12D CCD98700.1 KRAB Colorectat Hos g.chr12 : 262095480 > A 6.30 p.G130 ccos8702.1 KRAS p.shar12 : 252805480 > A (horrorygous ) tap p.0130 CCDs8702.1 KRAS Colorectal Mox3 o.ch12 : 252885480A p.Q130 CCD88702.1 KAAS Colorociol M27 a.chart2 : 252713434 > C182A p.QSIR CCO58702 . KRAS g.ct2 : 25268814AT 4.351A5T p.K117N CCD88702 Colorecta 9.44 : 12 : 25299829G > A pomozygous ) P.A140T cc088702.1 KRAS g.cr12 : 292880280 > A PA1407 cc 3700.1 Colorect 12 : 289088407C 079T > G A.BZ2TP CCOS8719.1 PTHK Anaat HC2218 g.ch 17 : 28007587T > A 503T > A D.8169T CCDsaTz0.1 Bico1 Colorechy dir12 : 7281780CT 2341CT P.R781X cco38737.1 CNTNO Colorado CoB2 Ochr12 : 0908097CA c.23810A PP79H POZRNA Coloredad g.12 : 4025318AGYA P.GSZER CC099741,5 PPHUNI Brdos HOC 1187 0 , chr12 : 41005014GSA DomozyCouS ) 517G > A p.7172314 cco90758.1 HOACTA HCC1937 9.chr12 : 40.700.45G A c . 1276 P.VN CcOS8787.1 MCR31 Colondetot M_22 o.chr12 : 48238781GA 413210A p.V4411 ccc98203.1 BLCI1A Cotrocta MX32 chr12 : 40088587G > A 4.142A p.448T CCD986125 PLA1 KCC 30 g.chr12 : 50 :022725G > C 2276C p.G78A CCO98.34,1 KONR83 Cotonectat Cag2 Q2: 5129824G > A P.R2124 CCDS8034.1 KOR93 H210 Ochr12 : 51284700C > T p.724811 Ccosa30.1 HUCYTZA g.chutz : 51458841CG 4.502C p.t188V CCCB.0.1 RARO Broast p.chrt2 : 518018040A # 12B8CA A.G4309 CCD88889,7 M7 g.chrtz : 528804980A 6.25G A D.GB78 CCOS8915.5 USP :57 M43 chr12 : 54997687CT PA1107 CCOSB910.1 TUELESS @rast BB28T chr12 : 55108952CA 1288C P.44290 CCOS8918,1 TIMELESS HCC18 gar12 : 3510103200 P.Q100DE CCOS8932.1 URPI H020 g.chr12 : 558450206 > A p.EASOK CCOSBB32.1 LRP1 Cotarpctul C002 9.2538852430 > A 4 11279GA P -R3780H CCDsap0.1 INHBE HC1187 9.chr12 : 58135771G C 185G C PRAT CCOS8930.5 INHOE Brest BBIT ochr12 : 50130480GT pQ215H CcO99940,1 GUT erdost BB23T .cu 12 : 50145841CG 4,628C D.P2104 CCOS8040.1 Braput BO9T 0.0r12 :581497130T 15410T P.TS141 CCD98940.1 Gut HCC1008 chr12 : 58151239G > C c.24496 > p.E8170 CCOS0343.1 DOT Colorado Co 100 port ? : 501970250T P - A115V GLC28A10 Colorecta MX30 Ochr12 : 50305740T > D.L1859 ccoga9 $ 1.1 CENTG1 400st BB4OT 0.0 12 : 504110230A c.1013GA p . 4339T CCD88951.9 CENTB $ HCC 1599 p.chr12 : 5 409800GT 6. 1438GT p .4Boy CCDSB005.1 KCN2 HCC1599 chr12 : 73730683G > A 13090A P.1463 CD39010.1 FW90370 Breast HCC1837 17 :79274124G - T 9ZOGST p . 307F CcOS # 081.1 ORIN BB137 #chst 00240350AT $ 4934AT p.K 18454 CCO90091,1 DAIM Breast HCC1000 g.ch:12:100271900AT 47354AT P.12452F CCO3D115.1 PRD Droon HCC1305 0.0012 : 10001251016A ( hormygous ) IVSS + 1GSA CC099141.1 FW40142 0.0 12 : 10895087aQA € 780A PLAZAT CCCS8159 . FW13099 MCC13D3 chr12 : 1106430191 » (notxzygous ) 0.2307 p . $ 789R CCDS 107.1 RPUS Coloroclat Co100 .ch12 : 111309aozAC 6.29AAC p.X1000 CCDS9 180 . MSI1 HCC1143 Ochr12 : 1192503950c C.478GC p.E180g CCO99209.1 TCF1 HSTOT Q.chr121180847B0AG ( trorTxozypous ) 6.817A p.X27JE CCOS9209.1 TCP1 Broom 8812T .chr12 : 1199001036A 4.17210A p.8574N CCO39213,1 Coloreto HC 18 Ochr12 : 20033587A > G p.NZ5S CC099213.1 PZAXT Colaracat g.chr2 : 1200052586 > T C. 1721GOT P.R574L CCOS9220 , ANAPCS Broost HCC1143 D.ch12 : 120218842GT 4 1851G > T p.9617H CcO89232.1 RON Braba HCCI d.cz:171297924G>A 0.3808GA p.M12121 CCD89238.1 GPR81 KCC 187 g.ct2 : 121738002_121735801nka homozygous ) c . 183_188INA CCO38238.1 GPR81 Brest H $ 578T achrz : 121738783_121738782deTA (homozygous ) 4,084_085CITA co99237 . TAPHY Cotors Mox27 g.ch:12:1217889720 c . 910G p.Q31E Cc99240.1 88NO : BA23T g.ct2 : 122335002AT 1007A > T p.T8338 CCOS 248.1 SBNOI Bed KCA2218 cc17 : 122329881G > A 268 % A p.E88BK CCD $ 8246.1 OBNO1 Broan KOC 30 D.ch:12:1223250330G 29970G p.8996C CCO $ 0275,1 DU91 HCC 3 .chr12 : 1310930430A ( hooxygoun ) p.D105N CCD90283.1 ZNF10 Braait MC218 Q.chr12 : 103424380 MS33CC CCD99300.1 BACS Colorado g.chr3: 228108300A p.M16484 CC90312.1 FLJ28477 Colorectal Cor2 g.cm3: 240423B0CA a . 1042A PA338T CCOGDA. BRCV Broost HCC1398 g.chr13: 31811200GT p . 1562X CCO $ 9517.1 ME Coloroco co 108 g.art3 : 32538145C > T 0.28810T D.P954L ccoSp343,1 CIENKIAIL Colarocin C & .chr13 : 36 $ 773320A 502G > p.R210 CC089309.1 Babos HCC1395 g.chr13 : 27218559G " A c . 412GA P.Etax Cco $ 375,1 W8P4 Breast HCC1143 Ochr13 : 40540772A > homozygous p.X113R COD SO390,1 COO Boas HC02219 Och 13 : 44988327CT (homozygoua ) $ $ 85BCT p.A0200 CCD3940.1 PCDM8 HC0218 Och 13 :531704 16C them youa) 2658C POSCH CCO $ 9442.1 PCO : 120 Erebut HCC1807 g.chr13 ; 60284566GA 614063 p.74301 U.S. Patent Sep. 29 , 2020 Sheet 25 of 36 US 10,787,712 B2

Figure 12 - Continued

KUFS chr13 : 72534890CT 4.901CT P.P2018 CC099454,1 LM07 Colorectal a.chr13 :75278880A > G. 100DAG D.T354 CCC90451.1 UMOT Colorecta 13 :752910020 € 1351CA D.LSIM CCDS572.1 ITR HOC 167 9.hr3 :0402277CA P.T37N CCDS487.1 FAAP1 8rast HCC1395 0.013 :978815330 > T (homozygous ) 021410 > T P.R714L CCOS8497.1 FW14824 Brasst HCC1954 a.chr13 : 100082897A > G 4.1177A > P.MY CCDS8498.1 YGCNL.1 .chr13 : 1005182880 > A +44286 p.M14781 CCESO9001 Colonocat Cord Ochr13 : 101851 898G > T 12GT P.W4C CCDS ! $ 10.4 IR82 Cotoryctat Mot38 cr13 : 109233290109233 andupcco 43105_310BdupCCG P.P1036WD < CO3974.1 LOC122258 Coloroctel Mx30 q.chr13 : 1120787730T p.R25W CC030384,1 NDRO2 Broant HCC1008 ochr4 : 20556451CT IVS11 + 30T GLC7A7 MCC 1954 c.chr14 : 223134110T « 1237CT p.P4 38 CCO30-97.1 ACINT Colorectal chr14 : 228004680 A c3470GSA P.Rt1B0 CCDS9.505 . 1 EFB Colorbcat W32 .chn14 : 22898 GT $ 10830T p.M3811 CCOSO802.1 DHR82 g.ch14 : 23184274CT G.8150T p.A272V CCDS9.24.1 HCC 210 och14 :238431880A p.84977 CCD39624.4 C14 : 21 Brdost HC185 0.014 : 23844107G > A 107TOA p.Rozso OCOS8397.1 PRKD1 Colorectat o.14 : 29205115T p.11524 CCD96037,1 PRKOS Colorocta Ochr14: 291 183850A c 25690 > p.E057 % CCOSO.1 AWAPO Broast HCC130 ochr14 :3213974T p.K9107 CCOS 1.1 AKAPO Oro # 1 HCC1393 D.c14 : 32312630 > T 3576C > T P.M11921 ccoS0844.1 AXAPO Colorecta M32 9.07 14 : 32361182CA 2.81471X CCOS084.1 AWAPO Broout HCC 39 chr1 + 323618740C p.E17020 CCDS1844.1 AKAPO Colord.ctat .chr14 : 3238285CA 55 15CA p.P 1839T CCDS8849.1 CFL2 Granit HCC1934 Ochr14 : 342523811G 411G P.MTM CCOS8857.: BAZIA Broent HCC - 1005 w.chr 14 :3420777xto (homozygous ) 0.4288de CCO90050 . NFKBUR HCC1187 g.chr14 : 34942727.34047728npc thomozygous ) 427 428insc M HCC1395 00 14 : 38788838Q » C (homozygova 13090 p.1437H CCOS9879.1 C14041155 Brdost B?ZUT p.ch:1404515600 4.7850 p.7262R ccp90879 . C14art155 Breast 28MAT p.chr14 : 44043851CA 0.22800A p.Q754K CCDS $ 379.1 C14041155 HCC137 Ochr14.440438170 T c.2324CT p.8776L Ccost887.1 PAPF39 HCC2216 o.cr14 : + 4847384CG * CCDS9702 . C14020 HCC1937 a.ch14: 50438380A » G homozygous ) 46.6134 p.cosy CODS0708.1 NO HCC 3a g.chr14 :51566592_51608589SALAGTA c.767_V3+ SAGTA3d CC30708 , 1 N Broox HCC1937 o.cr14 : 51547354CT 37 20T P.P12388 COC89725.1 KTNI Eroast BB22T g.chr 14 : 551544 SOCG 6.677CG D.PZOR CCC0723.1 KINI Brgou HCC 1008 g.cho14 : 55214913C 6.3946AC p.T1316P CCOS9727.1 C1400101 Brous HO0216 g.ch 14 : 581185WT 1510T D.Q51X CCDS9730.1 DACT ) Colorecte W38 9.c14 :50 177231G > T C.370G > T RG 1240 CCD38730.1 DACTI Colorecta 0.01814 : 50103139C > T c.2045CT P.S882L CCDS9740.5 SIX Broast HCC1383 0.01714: 60280479G > C (homozygous ) 6,4G > p.Ezo CCOS9749.1 SIX HCC18 $ 0714: 002504436A 6.3274GA CCOS9749.1 SIX Broast BB20T Q.chr14: 002498840A 2.0759 € CCD98781,5 SYNE2 BOBA BOOT da 14 : 8372 $ 128GA c.8973GSA p.vp CCOS9701.1 SYNE2 CC 1589 ochr14.8374647 / A > fornozygous ) 775A > G p.Y2585 CCDS0701.3 SYNE2 Broad p.chr14 : 237S5709_63755798cm 1.8883 . dupa CCDS0788.1 ZFYVE28 Broen BRZT Och 14: 67221501CA 4.34810A PA1184E CCOS8780.1 ZFY28 Bruda HCC1954 g.chart :87202874GA 6.5034GA A.R19450 CCD99BOO.1 SLCRA HCC1395 o.co & BB597360GC thromozygous ) t . 18340 - C D.EB 120 CCD8BBD7 , 1 SIPAIL1 MCC2218 pa 14: 71708978G > C C208BGC p.E8960 CCOS8828.1 AFC Cotorocter C092 D.chr14 :730343856A CCO39830.1 C140115 Calonacted p.chrid : 738938360A C. 397G > A B.V1301 CROSB830.1 Ciort 115 Colorado Me g.c14 :73894222_73894222dupg 983 dup CcOS9870,1 NRXN g.ch 4 :78003451doc 2278dac cD $ 9873.1 KCC2218 gar14 : B07525 $ 4CG 2.BCG p.L30V CCDS0911.1 Coloratul g.chrt483013738C > T UTR CCD99911,1 ktM Colorecta H4210 Q.ch 14 :93149164T > C VS24 + 2T > C CDS9951.t KI1409 Colorectal Mx62 p.chr148315e3 80A 648-450A p.Vt 5494 CCD39917.1 PRIMAT Cotordca g.c14 : 03323753CT 4.850T p 4224 CCO90049,1 BCL 110 Cotorocta Cag2 o.ch 16: 987117220T 699 107 D.P 319 CC099955 .. CV Colorocta Co70 g.dx1498684690CT ( homozypous ) 4588CT p.PSOL Colorectat Q.chr14 :09885801CT 07400T p.1249L CCOS $ 280.0 WARS Aroan HCC 187 g.chy 14: 098710180 > C 6. 138 $ > C PE4550 CCD38972 , CINP Colorecta ! g.ch 14 : 101084757G - A 6520GA p.DTTN CCO90080.1 EIF : Breast HCC 1143 9.16.102877099.AT c . 1253T p.K410N CCO910001.5 BRFI Cotorocta C074 w.ch4: 10475 $ 0740A p.V542M CCOO 10013,1 MKRNO Colorocta C074 0.001321382456C >Tomozygous ) € 434CT AT1451 ccog10013.1 MKRNO Colorada H159 w.chr15 :213627380 > C 7180 p.82397 CCD910015.1 Ci sort2 nh? Times ) 6 110G > A P.R370 CO910015.1 Cart Colorado 190 D.ch5: 22472447G Athomozygous ) « 34OGA P.V110 CCO910020.1 OCA2 Broad HCC1854 o.chr15 : 257701 440 > A 6217G > A D.ATBT CCO100428.1 ARMCVPIIA HC02218 p.chr15 : 307160784A C. 1813A p.E605 * CCC910051.1 PANG Ca?oroctat Nx42 g.chr15 :383442080 > A PRIH CC0910055 .. ochr15 : 384150BOAG C. 5684XG P.E1890 CCRT0089 . ? VP378 Calorectat Cotos p.chr15 :398528189 > T 0.27370 P.A9133 CC0910070,1 RPAPI Coloroctal o.chr15 : 3260805GA 015740A p.R5250 CCOS 10098.1 TPSOBP Colorectal 0.chrt5 : 414958280T 4.47470T P.R1583x CCOS10134.5 Colorecta Mat o.chri 5 : 48142782AT 14BAT P.E49V CCD91014 , Colorecta May27 O.chr15 : 483321980A c.8GA p.E285K Cos 10135.7 GABPB2 Coloractat Mex 18 0.chr15 : 48389197CG homozygous ) 4.91CG P.PSIA CcOS 10150.1 NEDOX Bromul KCC 1008 g.chr15 : 539051000T 922CT p.H3094 CCD910178.1 RORA Coloreta ! Mex43 p.chrt 5 : 587058140T 4.520T p.P18S CCD310222.1 SMADO Colorocta HX5 w.ch:65284257CA (homozygous ) 17.GA CCD310222.1 SMD Colorecta g.chris :0520pazia T ( homozygous ) 4 11780 T P.PIB3L CCDB10220.1 COA020 Colorectat M28 p.chr 15 :0679 48900T 0.00T p.py13 CCD310242.1 BRUNOUS 28 p.chr5 : 703893450T P.R134X CCO - 910260.1 ISUR Colorectat p.ch 15 :722547000 > GSA70A p . DI & UN CC0910202,1 SEWAZA ochrt5 : 724941420 T 1759-30T P CcO910260,1 CYP1A : 029T p.chri $ :728020100A 6. 474CA P.Y158X CCD310208.1 CYPAT HCC 1008 g.chr15 : 727999930 - T 14290T p.Rer CC910308.1 CTS Coloretat g.com:77014040A p.01281 U.S. Patent Sep. 29 , 2020 Sheet 26 of 36 US 10,787,712 B2

Figure 12 - Continued

CCDS10020.1 ADANTEL Colorectal Ochr15 :27344684G > A 4.9880A p.VIC cco91028.1 ANTAL Comorial M27 Q.chr15 : 223770076A 6 17600SA P.R507H CCOS103201 ADAKTSLS Coloro stel g.cy15 : 824303 12C > T Thornozygous ) 0.25830T P.R.SSC CC0910370.1 ADAMTSL Colangcial Co92 p.ch15 : 62450811CA ( homonySou ) 6.3940A DA1315E CCD310361.1 NEVORIN Colorectal MOB g.chr15 : 00013735_86315738_dupCAQA 4371_374dup CAGA is CCDS10433.5 Arnart HCC1395 g.chr10 : 1310438G > C CCDS10486.5 ABCA3 Orgau Ochr10 : 2308308CA C.200CA p.L29CM CC0810460.1 ABCAS Broan HCC1395 10 : 2205803GC 4.2403GC p.E801D c0910166.1 ABCA3 Proust BOTOT Q.chr10 : 2276787C > 6.32070G p.H30690 CCO010471.1 HCC 210 .ch10 : 2517980G > A 5 + 3G > up CCO910471.1 CO + 14 Colorectal w.chr18 : 25104716A 4.880G > A CCDS10480.1 MGC.7202 o.com 18 : 26798390A C.ZBOGPA PRB7Q CC0310501,1 ZNFT Eraan MCC1143 ochr 18 :33076010 p.aZZE CCOS10513,1 DAWA HCC1395 g.chr1a4444867G > T 13840 > T p.5482X CCOS10530, PRO0149 Colorectat Mat2 qar18 :91043990 A thorzypous ) P.R1220 CCOS10 4,1 POLT Coloro chat Co7 och 10 : 2030381GC 43180 p.E1060 CC0910550.1 MGC18943 Cotroci Cotoo D.ch10 : 2071850BTC R.KORT CC0910584.1 Cobracat tx189 0.0y18 :21040901AT 14 SOAT ALB Consig394.1 DNA NOT D.ch6: 208-567110T 6.48230T D.S1608F CCP910601,1 Cataractat o.ch:8:21a782970G c17?CHO p.859X CCES10801.1 WOCR H176 o.chri071887480DA 4.023T > A F208Y CCOS10008.1 SCN1G Coloractat 4.172G > A p.GS & R CCO910203.1 SCANIB Vetoroste ) Q.cm18 : 23780172CT 0832C > T PA311V CCOS10508,1 SCHOT 2.68: 737701810T c . 941CT p.A314V CCD310309 . 1 BCNNID BO # HC2218 ochr18 : 2379456BOG c . 115900 p.1387V CCOS10828 . 1 Breast MCC 1008 ochr 18 : 2514597400G 4.6870 > D.12294 CCOS10701.1 FL13179 BEST p.chr18 : 309830850A C. 1966 P -4567 CCDS $ 0701 . ) FW13479 Broast HCC1509 0.ch 18 : 30980394G > A 8566 p.C2885 CCDS10701.1 FU13.079 BBS AB12T g.chr18 : 3098075800 6.9920xG P.TIR CCDS10701.1 FU13479 Braon BROT g.chr16 : 30980003G A 16876A P.R5580 CCD910702.1 ZNF845 BA24T g.ct18 : 309091SAAT c . 4010A > T AN13371 DXF848 HC218 och 18 :31001789CA N $ 10A " P CCO910707.1 Broast HC1589 o.ch:18:31108046AC A13120 CCOS10715.1 FU3B88 Bros HCC2157 g.chr18 :314270880A + 128G > A p.C43E CCD310720.1 WCBPT Broan HCC1385 R.C16 : 451949496 > A M8.3GA CCD310723.1 Colorecta Co100 Och 16 : 45023915G > A € 1098GSA p.C368R CCD910729.1 PHA Broast Q.chr 18 : 48260708T » p.1897 Ccb310720.1 PHX9 Colore.co M2 g.c18 : 40760828G > A 0.26203A p.G877R CCD910752 . MMP colorant M < 3 g.ch18 :54077040GA S882GA DA228T CCDS 10752.1 MMP2 Colonde g.ch 8 : 4408859CT P.T4981 cco9107-2 . $ MOMP7 Coord Co74 g.ch 16 : 5-1098803 > T 4. 1931G - T Ce0010788 . AFR Broot HCC1395 g . 10 : 540SB253A V812*** COD31075a . ? ALER Broast BA1OT g . 18 :540544404 > T 1814AT P.OBOSV CC0910770 .. LC12A Broast HCC1000 p.cw10.6 $ 475525 56476594ddlTCCTCCTGCT 61793_1802 do TCCTCCTCCT h CcOS10773.1 NOD27 Bromst HCC1143 g.chr18 :658174390A 1083G > A p.10811 CCD910702,3 WOVP13 HCC1395 o.ch/18;58838828A>G 6. 1787AO P.D3986 CCD310802.1 COWB HCC1698 D.chro: 80303301CA € 15990A p . Y533X ccog10827.1 CBF8 HCC 1008 g.to:8.58.58101CQ + 298CC p.P100A CCOS10837.1 LOC283849 Brook HCC1395 g.chr16 : 85780329T > A 6223TA AY75N Ccp910032.1 LOC283848 Broast p.chr16 :857788500A € 15410A p.A3140 CCO810A3,5 FHOD1 Breda H 573T g.chr18 :85825351dolc 0 1758detc CCD310077.1 CG37 Bront HCC2218 o.chrte :87933024G - C (homozygous 6. 5 1G PE1710 CC09109 + $ . 1 CARI Brooo HCC1395 g.chr18 : 7082707BGC RS4077 CC0910929.1 Colorectat H100 o.chr16 : 75253574G > A 144SGA PA32X CCC310926.1 ADAMT818 Ca?orocta g.chr10 : 75847434AC 6,1384A p.K455T CcOS 10028.1 ADWT998 Colorodu MX32 2.chrte :75913817_769138 12 dupT c . 2045_dupT COS10948 , 1 WFDC1 Broust HCC1395 g.chrt8 : 82809453GA 412G > A P.V130M CCD810090.1 ZOHHC7 Colorocta M * $ .chrte :835815980A 6 1300 - A P.DUN CCD9 10952 . KIVA0102 Colorectal M22 g.ch/18:8423979_842397980upc 6.368_dup CCDS10052.1 KLAAD117 Colorecta H200 p.chr16 : 84252481CT 18700T P.R327W CCD910950 . IRF8 HCC1599 .chr10 : 845001B4GA 02420 P.RO1K IRFO 8vost H578T p.chn18 : 84SOS6150A PA1977 CCD910901.1 BOR # g.chr18 : 8800B67100 c.888 p.1290V CCC810970 . CALAS 9.rte :2743887BCT C 181CT D.A81W CCO910970 . Cotonouco g.chrie :a7400389CA c . 15280A PS10T CCO310972 .. CBFAT3 Colorocta g.chrie : 97479155GA 4.917GSA P.R306H CCD810372.1 CBFAT3 Caloracta 1643 o.chr18 : 87473289C > c . 1552GA P.E $ 18K cc0310972.1 CeFAT3 Colorecta M1 p.chr 18 : 074732 40CT c . 1801CT PA54V CCO910BB2,1 DPEPI Cotaractat C - 100 * .c18 : 48731258G > A 0.737G A P.R246H CCDS10098.1 NUN Breast HCC1009 Q.ch 17 : 873851CT $ 83CT P.H105Y CCD811004.1 BKIP OTOA # o.ch7: 1347896C > T 944C - T p .9315F CC091 1028.1 OR152 Cotorocial M40 ochr 17 : 3283384C » G c . $ 0200 AH1890 COS11043.1 ATP2A3 Broant HCC1395 p.chr17 : 3791093G > A 420716A P.R874H Colorosa g.ch17 : 389381703 6.100 P.R70 CCO311044.1 MGM2124 Colorectal g.chr17 : 39928180 - C c . 203 > C P.R7P CCOS 11045.1 MGC20871 Colorad W chr17 : 4337918G > A 6.15180 PASOTT CC0911057,1 PL Ord # HCC130 $ O.chw17 : 4508825400003 do ACAGMATCCTG4400 1982.2002 do ACAGATCCTGAAVO Indet CcOS 11057.1 PLC4 Bregat BAST p.chyt7 : 46888000 6.24190 p.Q807E CC091 1088.1 ZNF232 Coloreda 22 .chr17 : 4053482C > T CHSCT PA15oy CC0311038.1 ASOR ) Broox p.c17 : 70183350 > homozygous ) NV35 CC0911101.1 CENTB1 Orvaut BBST p.chr 17 :7185890GC CCDS 11101.1 CENTB1 Broast HCC185 g.chur17: 71885141 G341A D.K1140 CC0911101.1 CENTD1 Q.chr17 :71874630 > A C.3380A P.R1290 cog11118.1 TP53 Cotorocta o.chr17 : 75202480 > T ¢ . 1880 - T DESAX CCOS11118,1 BA 18T o.chr17 : 7570091CG p.Y1077 CCD311118.1 Oros HCC1187 g.chr17 : 7520090_752D00Bde CoT thonosypous ) 6.372_32GOT 0.0108da . Cotoroctol 219 o.chr17 :7520047_7520040deo thonotypous ) 4385_58B6ATG Cotarecta C074 9.6117 :75192631 Monrypous ) 0.402T > G p.F134L CCD811116.1 TPA3 Colorocta o.chr 17 :7819226CT Thomatypus ) 94300T p.Q14X CCO311110.1 TPS Ho 578T 2.4Y17 :7618168G ™ T (homozygous ) p.V157F CCO911118.1 TP53 Oroast HCCIO p.chr17 7610187A - Q ( homozygoua ) 6488 p.Y 1630 U.S. Patent Sep. 29 , 2020 Sheet 27 of 36 US 10,787,712 B2

Figure 12 - Continued

CCD311118.1 TPO Broa HCC1395 Q.chr7: 7519131G > Athomozygous ) P.R1754 < COS11110.1 TP3 Colorectal x172 g.chr17 :751012500 $ 53000 D.P1777 TPSO Brest Be28T och 17 :75190950C 3P CCD911112,1 TP53 Colorado Cosm g.chr 17 : 7312995 > momonyooua ) 57000 p.11936 CCO311110.1 TP :) Broast BOBOT g.chr17 :7518937CT 00370T p.R212X CCD911118.1 TP3 Colorecta ochr17 : 751a937C - T thamanya ) 4.6370 > P.R213X CC0811118.1 TP Colorectat Q.co 17 : 7510937CT ( homozygous ) p.A213x C311110.1 TPS Colorectat 216 a.ch 17 :75t8838G (homozygous ) 00386 p.R210 CCDS1111A : TPS Broart HCC 1598 w.chr17: 7518335AxTthomonypous ) SP CCD8111111 TP : 3 Breast B81ST ochr17 : 7518284CT 4.7220T p.52415 cc 311118.1 TPS3 Praxt g.ch:17:7518243do Chorzypour ) 0723.doc ccn911118.1 TP53 Catactal 2 ochr17 :7518283 dec ( homozyou ) 4723dok CCOSIT118,1 TP : 3 Cotroctol M8 p.c17 : 75102810T (horatygow ) T25GT p.242F Broast C2157 0.017 : 7918284CT ( homozygous ) 07420T P.R248W cca9111101 IPS Breast ochr17 : 7512263GA ( homozyou ) C.74367 P.R2480 CCD11110.1 TP 3 Coloroti p.chr17 : 75182596 cfhomotyros) 7470C P.R2495 TPS3 Broegt g.chr17 : 75182377518230d CTGQMAA( homozyou ) c.761_78BdOICTGGAAGA COS11118,1 TPSO Colorect Mx180 achr17 : 7517884CT (hornotypaus ) P.R207W CCOS11118,1 TP 3 o.ch:17:7517852 811CA p.E271K CCO911118.1 TP : 3 Colore Cos2 g.chr17 :75178460T (hormotygous ) 6817CT P.R2730 C00811110 . TP.3 0.417 :7617845G > T (homozygou ) c . 10GT P.Rar CCW811118,1 TPS Colectat g.chr 17: 731784SQUA ( homozygous ) .8180 P.R273H CC0911118 . Broast 8812T och 17 : 7517801C P.P2763 CCES11110,1 TPA Broast BE22T g.ch/17:73170310T 6.832CT CCCS11110.5 Coloroda 9.117 : 7517824 @ > Thamnozygous ) D.2001 CCD311118.1 Braut HOC1008 g.cot7 :75178220 > C Memorydows) C1G > C D.2014 CCD911118.1 TP53 Bront HCC1937 p.d17 : 7317747C Thootygous ) 6.916C > T p.A30BX CCD917118 . TPV Colorectal g.17 :7517653 thororygous ) IS7-2A > G Co911126.1 LIPO Brast HEYAT 17 :7792107T > G IS15-3T > G SP Boost HCC1000 g.ht7 ; 79901336C 4.20BGCC p . Esto CCOS11131.1 PERT ra g.cv17 : 7987427A > G Mozypous ) 2954 P.N9853 CcO911131,1 PER1 Colectat M32 0.017 : 7980772C > T 43179CT P.SSOBOW CcOS111-7.1 PIKAS M g . 17 :875349SCT P.R28C CCOS11139.1 Mis Brant HOC1395 0.0r17 : 10343003CT Domozygoua ) 0.39170T p.813061 Co911155.1 MYHY BRZIT 17 : 10341208GPA PA 1445T CC0811154.1 MYHO Braut BB12T dh7: # 0340456G > A 0.4792G D.V15SBM cco911180.1 DNAHO BESOT Ochr17 : 114953250 > T 4.2312G > T p.1771 CCOX11180.1 Breast HCC1385 g.com:116764770 47957G > C p.D283H co311180.1 Braart 283BT o.chr17 : 11730888CSA < 10991CA p.T3884N CCO311180.1 ZNF620 w.chr17 : 16487631AT 12044 > T p . 432c CCOS1122 ) . NOSA HCC1187 g.chr17231169900 > T promozygous ) c.203.5G > T P.A6785 CCC911235.1 PGS Breast MC02218 Q.ch 17 : 239127BBGA C.477GSA P.M1591 ccc911284.1 Colorecta g.chr17 : 285842080 > A ¢ 35590A A.L1187 CC0911204,1 NF1 Colorected H 100 Q.chr17 : 26877105_26877108do CTCT ( homoxypous ) 6.4944_4917de CTCT CC0911284.1 NFI Colordat Care g.ct17 : 2888807107 457800T P.PUOL CC0911284.1 NF1 Breast H : 578T g.chr17 : 28711703G > A CB170GA D.G2724R ACCN1 Colorectal MX42 p.chrt7 : 28463201CA SP CC0911284.1 UGO Cataractal .chr17 : 30350-4740 > A 5. 1888G > A p.1030N CCD911291.1 FW10458 HCC1599 g.ct17 : 30497830G ™ C V67-1GC CCDSt129 1.1 FL10458 Breast 8857 Q.ch17 : 304875030A p.Q319K CC0811292.1 COM Breast HCC7218 g.chr17 : 305210020 > C 6.1488cc P.D498H ccp9 1207.1 RABL108 Broox Hot197 p.cr17 : 31098470G > A (homozygoun ) 6.154GA p.V52M CCOO 1299.1 FLS2830 Broast C02218 g.chr17 :31209592C > forczypous ) c.9900G ccO811702,1 FLA2B30 Broca C2218 plchyt7 : 31208439CG hormozygous ) ap CC0311317.1 Colorectal MX43 p.c17 : 3259298BQ > A P.R 18870 CCO91137 , 1 CACNBT Cataractal p.chr17 :3459352BCT 61191CT p.P3841 CC0311354.1 Q8OME Brodu KCC1837 g.c 17 : 35318028A0 fomozygous ) p.02280 CC0311388.5 CTEN Colorectal g.ch 17 :358884130T C. 1924CT D.R642C CCD811379.1 KRT20 Colorectal C092 g.cu17 : 362649544 > Chomozygous ) 10A > P.SAR g.chr17 : 37181514_37181473.dotAGGGCATCATGGAGGAGGATGAGG C110_ HOIAGGGCATCATGGAGGAGGATGAG ondor CCD311407.1 JUP Brodat HCC1395 CCTGCGGGCGCCAGTACA ( homozyODAS ) GCCTGCGGGCGCCAGTACA OC0311418.1 RAASC CO92 Qa717 : 375359280 remarymous ) PRCH CCD911420.1 KCN Coloractat cm 7 : 3758923BGC t.23886 D.G797R CCD311425.1 PTRF Breast HCC1837 p.cy17 : 3782680 ZOA CCO31 1440 , 1 g.chn17 :26313072CT 6.3470T P.P 116L. CCCXS11453 . BRCAT Ervaat HCC2157 g.chr17 : 385213130 - T ( homozygoun ) 90GT p.LIOF CCD911453 . BRCAT Broast BEZUT g.ch:18488800GC p.1758F CCOS114.3.3 BRCAD Broast BBIT .chr17 :39488742G > T 4.23320T P.G7C CCOS11503.1 HCCZ218 w.ch/17 : 425893110C from my oux ) c.8096 p.G270A CcOS 11511. Calandat g.ch37 : 42724834GA CCOS11512.1 FW40342 HCC 7216 O.ch7: 428028540ST c.es8QT AQ288H CCOS 11544.1 QALOT Color del N_22 O.ch7: 44801142CA 0.1378CSA P.P459H CCO911590.1 DOKE Brogu HCC165 p.ch17 :52267451T > O homozygoua ) +2981 > P.LOOR CCOS11591.1 TRUS Brdan HCC 1937 0.chyt7.52338841AST c . 801AY p.XX01 % CCO911600,7 SER91 gdyt7.534368170T c . 28SOT p.P893 CCD311804 . ) MPO Cotrocta chr17 : 53707977CA 40C > p.R4470 CCD911013 . PPMIE Broot Acht7 :5439705107 c.6980T 2.52236 cco311813 . PPWIE 889T Q.chr17 : 544018200G 310G p.A3110 CCOS 11021.3 RPSBXBT Colorocta Wx62 p.chr17 : 5.53668630A 8500 - A p.6280E CCOB 11845.1 PSMC . Colorectal M32 chrt7 : 592809560 > A a . 1796 A P.FBOQ CC0811893,1 ABCA8 Colorectal N33 Qahrt7 :848-43889_84643869cupt c.418.dupT CC0811702.1 IREM2 Colomnocte M427 Q.cm17 : 70125181A_G 4,704G p.127A CGD311709.1 Colores M2 ocht 7 : 70438500CT a . 1175CT PA32V Brgast 18220T CCO911710.1 CA och17 : 707-47110CT (homozygous ) P.PLp.897C CCC911005 . CONX10 @rost MC2210 p.chr17 : 77600040CG 2000MG co311010.1 VTE2R 0.77: 7792592700 ( homozygous ) p.81481 SC0311868.1 Ciborlig Broou HCC 1954 ochr18 :13071832GA 2450A p.REQH Brosu HC1509 pcrto : 138716587> A RM40E CCC311880.1 C1oort1 P , VBSN ccc911879.1 ANNADQ9 HCC2218 p.chr18 : 194728590A 42830A p.R5070 CCC311801. KIM1012 HC2218 m.chr18 :277240140 - A a 18103 > CCO91 1908 . OTH Broast HCC1837 g.chr18 :30652190_30852199000TOT ( homozygous ) c70_70dcdardy U.S. Patent Sep. 29 , 2020 Sheet 28 of 36 US 10,787,712 B2

Figure 12 - Continued

CDS 11917 .: P15RB Broust KCC1395 g.ch:18:319013030 4.63GMC p.0211 CC0911918 , STATIP1 Braxt HCC1187 g.ct18 :31994843_31694944da CT 1738_1740 ICT CCO311023 . SETSP1 Colorectal WAZ g.chr8: 407887070 AA11087 CC0911070.5 KIM1432 Broar BBAT g.chr18 : 41725074G > A c . 1027GA p.AT CCD911920 . 1 XA1832 Oroost HCC1854 g.ct18 : 41714111G > A p.C8977 CC0911028.1 XQM1822 BOAR BB13T o.18 : 41704 % 880T p.R888W CcOS 11932.1 ICEB3B Colorecta 0.chr18 : 42814141G > A PR4980 CCO $ 11934.1 SWADA MO g.ch 1843828642AT( hoxxyou ) C.8994 > T p . 300V CCD911034.1 SMADZ Colorectat g.cx18 : 438223200A Dromarygous ) ISO - 16 CCD911094.1 SUADA Collona.cat p.chma: 4387215_438777209d GTTGCTC Drone you ) € 1385_1391dOGTTGCTC CCD811935.1 KW0427 HCC 1187 p.dm8.44541852GC 1185 p . 388 CCD911035 , KM0427 @rpost B21T g.chr18 ; 44642001QC 13140 p.44381 CCD811050.1 SMAD Cotoract Mate O. 18 : 468291920T (homorygous ) p.P1305 ccO811850 . g.chu 18 :46845888G > Athanatyg ) 61051G p.0351N OC09 11950,1 SWD 92 Q.chr16 : 469459170 thomasypows ) P.RSIH CCD311990.1 Cotonotar H208 Q.ch 18 : 48845989_46845970doAG ( homocyoous ) c.13_1135data CC311957,1 Colaracal Co97 p.ch10 : 40191000TC hemorygowa ) PF10383 CCD8 + 1989.1 ATPEB1 Hec1589 p.chr18 : 53513397CA 199 + CA CCD311999 , ATP8a1 Broas BB9T o.chr18 : 534887774CA IV817 - CA CC0911085 .. ATPOI BB 14T o.chr 16 : 53478454C - T P.ABBOV CCD911885.1 ATP01 Broox BBIT p.cx18 : 5346894000 4.35340G p.11178M CCO91100D . ZNF532 Bropat MCC 1954 o . 18 : 51752703CT c.240SCT p.8872 CCD911077,1 CD Broast BOVOT 9. - 10 : 573211003 > A 004G A p.M2203 CCO911977.1 CORO BBOUT O.chr10 : $ 734010A 41246CA p.P410T CCDG 11977.1 Broast HOC2137 v.dur 10 : 573727400T 2238G > T p.0740H CCO911979.1 KM1406 Colorecta O.ch 18: 580922180 > A p.6573E CCOS11693.1 C100114 Colorecta C092 p.chr18.63328558NG 6.328A G D.X1100E CCOS 11980.1 Socso Colorociat MX2 g.chr18.60143130_06143138doXAG 4.254_233dotAG CCD312013.1 o.chr874053407 > A homozygous ) C. 128GA P.R1401 SC091201..1 NFATC1 0.cnr 8 : 7577 % 2060 > A C043G > A P.A315T CCO312020 . POLCI Coloro cal p.chr10 : 75780256G > C c . 5240 > C P.G175A Ciorto Brost HC62137 g.chr19.984282001 CS85 : CCO312005.1 OAZA 1 Bront HCC1008 wang : 1385828T » A 1141T > A CCO9120018 . 1 BOBO D.chr19 : 14130070 ¢ 18 -BAGT RASGZS Ccb912088.9 AP Prant H2157 chr19 1470307GA CB007GWA AG2000S CC0912073 . Breast HCC1395 o.19 : 1558358A (homozyVOU ) $ 1 + 30A P COS12074.5 Coordat Waa2 - chro: 180122SCT c.22CT D. ASV CCD912078 . LOC113179 Bram HC218 . : 188408BCT CCO $ 12090.t UMN8 Colorectat Co 108 g.chr19 : 2380146C > T CB16C > T p.218W CcO912133.1 TRE Breast Hs 578T g.chir19.47892520A 138GSA p . 1481 CC0912140 , 1 PIPRS Coloro cat W32 O.chr19 : 5173816C > T 4.28210T AT974 CC0912167.1 RFX Broaut HCC1395 g.chr18 : 5995274C - G ( homozygous ) p.A37G CCOS12157.1 Breest @ B28T g.chr19 :599118SCA 328GYA p . E110K CCO917157.5 RFX u.chn5991045_59910 - SCUDO C.sup 13 CC0912171.1 SH21A Orves HCC139 $ p.chn9 :37060204 * homocysous ) A E2656 CCO912180.1 MCOLN1 Breast KOM137 g.chr19,74997130 > C 001GC AV2311 CCD912207.1 MGM3407 Colorecta Coro 0.cr10 : 8889827C > A (homozygou ) 1750A p.A2D CCDS17207.1 MOC3407 Ochr 10 : 8689058CA p.A337T CC0912214.1 ZNF580 Cotonschot .chr10 : 8440838G > * 1976 - A P.G188E OLM Colorectat M - 42 g.chr18 : 0879494C - T 257CT p. TB6M ccos17230.1 CAMS Broost BAST g.chr16 : 30283230C (homory out ) c . 418COG p.L140V CCO312233.1 KCA Bregu BB23T .chr19.102833740 p.R188W CAMB Brost HC2157 g.chr10 : 10284919G > 14020 » C P.E4880 CCD317238.5 KEAP Etre est CC100B g.chr19 : 104716420A C.BAGA p.C23Y KEAP : BBROT q.rº 1040 1011CT . 1 $ A5CT PA522V CCD912240,1 TMEDT HC2157 9.chr19 : 10808771G - A 4.30.CA p . 10QN CC0912258.1 LPPR Colorectal MX42 2.Chr10 : 11332885CT P.1155M ZNF12 Cokorectat g.chr10 : 123229450T 4 454CT P.P1525 CCD912271.1 ZNF42 Colonucta : Coo2 o.chr112322671CC c.728CC p.2435 CCD913329,1 AWP8 Bront HCC 1009 p.chr10.153268130T 1992AT P.Q684H TPUT HCC1305 g.ch:16085509G-C 4810G - C p.E2040 COS12421 APIMI Aron KC1008 9.c9.18200800G > A C.OBGA AR3030 3W FW20422 BAR HCC1187 cthot9.1910–1980 - T 0.2530 T P.E & sx CC091230.1 HCC1107 o.chr19 : 19104400WT P.EB5V 03 PBX Colores Woul Q.chro. 195389190T + 84BCT p . 72314 CC0912413,1 ZNF43 Colorectal .chro : 217838-80 - T P.R238C CCD917479.1 LOC128240 HCC2210 9.chr10 : 38330410GC 4 408G - C P.D168H CHSTO Caforcat M g.chr9: 38955270A 4.74QGA p.12171 21 Colorocta p.chur19 :400901BOCA P.A130 CcO912503.1 ZNF589 HCC 38 p.chr19 : 42803051CG c.8C - G 1 2NF588 BOST 0.chr18 : 42597140A > G 42801G P.E876 ZNF340 Colors Co74 Ochrt0 : 42784845AT p.X2751 HCC 218 ochr19 : 451981tec c . 10 p.L15V CCO912590.1 NRAGEFT Coloroc Co18 O.Cr19 : 47080 $ MGA P.V18SM Drond HCC 218 p.chr19 : 474030000mA c . 3100 D.E104K CCD312801.1 CIC BBTT g.chr19 : 47486714GrA c . 1051G > P.ABSZT CCD812801.1 CAC Q.19 : 47448433_4748841pc C3150_dupc C2127 UPE HCC1509 acht : 47872705ca 6. 437CA p.P1480 CCOS12024.7 XR Catonadat G.ch19 : 487480430T c . 10480ST P.R350w CCD - 312004 .: ZN 155 Colorata MA ? o.19-181832704 P.H174R < C0312049.1 APOCA ACC1107 09: 50140242CA P.P750 BFR816 Broo11 H 570T g.chr18 : 50254380TC c . 589TC P.L1883 CCO312001.1 AGE 1 Coloroclat M2 g.chr19 : 50003719508037190 ( homoxycowa ) 0053_dup 0267 EMU M11 g.chr10 : 508118180 > T D.V4S4L CCOS17703.1 ZNF1 Brods HCC1000 g.chro :527384830T p.3158L CCD312700.1 Breast HCC1508 g.chr10 : 5303-4556CT p.3441F 12 Colonial C079 Q.ch18 :53348953A > G 6454A p.K152E CCD - 912711.1 Cataractat g.ch18 :53323070C > T 18350T p.88124 32 GRIND MCC 1000 o.c9: 535936790T p.P $ 408 ccc912719 , HOC 38 g.co9: 53800181 KA00 p.G280R 32 GRIND Breast BRZAY g.chr19 : 53010100AG 1580G p.E5276 U.S. Patent Sep. 29 , 2020 Sheet 29 of 36 US 10,787,712 B2

Figure 12 - Continued

CCD312780.1 T8X8 Coloreda p.ch 19.54058282GA p.019R CCO12750.1 S73 Bromo HCC1395 g.ch 18,55070015CT 4.14210T p.9474F 0912799.1 BHANK1 Colorectal 9.chr19 : 558975770A c . 1706A P.A5080 CcOS 12799.1 BHANK1 Cobarocta H174 a.ch 18.558374440A 0.00780A P.G2BR CcOS 12803.1 KLK15 Brouat HOC1907 9.c19 500720180SA 4096A PA137T cC0312870.1 SIGLECT Cotrocta w.chr19.56339605 " > D.USP CC0912348.1 ZNP437 Eraat HC2157 C18 :3T2284984CG c.12450 P.L4 16V CCDS 1284.1 ZNF422 aast chm18.51229275G > A c . 1469 p.C490Y CCO3128.50 , ZNF180 Cotored g.chr 19 : 57517398 > A C. 102STA D.13420 CC0912877 . NOVIFA HOC 157 ochm18 : 59301950AXO c.134AG P.N52Dp.V1377 CC0912884.1 HCC2157 g.chr18 :59403079G - T 6.4090T CC0912903 . $ KURZ094 Broast HOC2218 Qc0: 80029310 A fazynoua ) G.B07C p.Q203K cc0912911,1 NCAT Cotxoco Co74 Q.chr18.80109881G > T c.250GT p.087Y CCD912017.1 NALP7 Cotorocta ochro.B0141220A - C IP cco912834,1 NALPO HCC1395 0.ch10.60935735G > A 12746 p.G425D CC0817037.1 NAPO Broost 8B13T g.ch6,811597250 63770 p.P128R CCD812937.1 NALPO Progat HCC2218 g.chr10.81159380A > T € , 1124A > T p . 275V CCD917937.1 NALPS Colorectal C074 Ochr19.81191078A > T p.Q1D45t CCDX81204 1.1 ZSCANS colorocta od 18 :01428984G?C p . 1480 CCD312015 , ZNF47 Colectat Co74 D - chr10 : 8 1726330T c . 1092T » p.FXIC PE03 Collegetat Na7 0.01819.820188410A c . 17810A D.R5941 CC0813013.1 SOCBP2 Colorosa g.ch.20.12411410rA honetygoun ) c.317G > A p.R1000 CC09180 % . ATRN HCC 1599 w.chr20 : 3399953_33999550oTTo thomozygous ) c198_tta - TTg p.107da OCD913058,1 Cotoroch MO 0.02073800300_3500805GGCT 6.1410_1413UpGCT CC08 13080.1 BN Broost HCC 1999 QC20 : 5917800_3817355dKGTGTTTGTMGC homozygous ) 500050170 - GTGTTTGTAAGC Indo CCO813075.t & MOX Brest HCC1383 Q.chr 20.47111440A 0.10180A p.Q340K CCOS 13ca3.1 RASSF ? Cotrocta W30 o.ch:20:4719703G>A fonozyonu ) P.R1441 CC0813107.1 PLC31 HCC 3B 20 : 8893784G > C 62719GDC P.A907P CCOS13109.1 C27100 Broast HCC 1937 oc20-9448810_9148828doDXATGATCCTGTCTGCGGT 0.599 61700CCATCATCCTGTCTGCGGT 13 CCOS13103 . ANKRDS HCC185 p.ct20 998197G > P.KASAN CCCS13122.1 Broast HCC 15.09 0.chr20.18308332A > C t.23151 » D.X772T C20or23 Colonocat MX42 0.cz0 : 18307478C homozypous ) p . 105TX CCD913172.1 ENRP82 Coloradtad Q.chr20 : 1888042A > C c.554 P.K100 CCD913125.1 ACSK Colorectal Col4 o.chr20 : 1738403BGA c.1270GA p.0424N CCD913127.1 OSTN Colonta Q.chr20 : 17535709GA c . 410CA p.030 CCD913130,7 SNXS Colorectal MX27 p.ch 20,178775660T 6.888CST P.R296X cco913149 . CIOR1 Calooctal CoR2 .chr 20.23014832GT ISO - 3G > T CC0913140.1 CIQR1 Colorocta Coro g.chr20 : 230141710T 6.859CT p.A220V CCD813169.1 COT HCC 1509 9.did: 236150370A 62300 A ATTIIN CCD913182,1 HM13 Broast HCC1143 g.chr20-20300075GA C.545G ? p.W182X CCDs13180.1 TPX2 Comoroda Mox1 g.chezo :76035303CA 61391CA P.1484N ccm913210.1 OPILI Codorodat CO2 g.chr20 : 310801000T 4.590 T PAROV CCCXS1331.6 EIF282 Colorado w.ch20 : 32158987_3215e9asdowa 4.81 630MMAG p.Kidot CCD913241,1 NCOAS Brest HCC1854 g.ch20.327945430T c.3178CT P.P10809 CC0912241,1 NCONS Proost B815T g.ct20.32794180A 0.357Y0A P - 81181A CODS13252.1 Broast O.C20 : 334353ABC A.W449 CCO313257.1 809CAGOK Colorocta C079 p.co 20 : 33593874AC VSZ -ZAC < p CCD913257,1 SOBCAGRA Co74 p.chr20 : 33003108CA C.890CA D.T287K CCO913302.1 TG Coorociat Mx43 g.co20.30102120GT 1979G > T P.G960V CCC913313.1 TOP HCC 38 g.ct20 : 39182111A 2077A > G P.K326R CCD913313.1 PLCOI Breast HC218 O.ch20 : 392345520 > C P.ABSSP CCOS13318.1 SFRSS Coloro C074 D.W20,41570087C > T UR CC0313318.1 FR88 p.ch20 : 415221380 > A t.13GSA P.R1450 CCOS1303281 CDAPIL Cokorectal p.chs20r623205350T c.62 10T p.R141W CCO913332.1 CD121 HCC218 g.chr20 :425424920T c250CT P.R & AC CCO913377.1 C2004181 Breast HCC1637 0.chr20-439034043803381delTGCTGGACTAACOCT 41112_11280 & ITGCTGGACTAACCCT dat CCD913381,1 BLCIAS Colorocte C092 g.chr20 : 441150880A 2471G > A p.CB24D CC0913400.1 SULF ? Broast BBIT g.chra0.45728625TC c.15911C p.Y5JIH CCD313408.t SULF2 Brent HO02157 g.chr20 : 457284990A + 17170A p.D573N CCO913411.1 ARFGEF2 Broast HCC2713 g.chr20 : 4703815JAG 62380ANO P.KTE ARFGEF2 Breast HCC1937 w.chr20 : 470880730A 6.48050 > A P.W1535X CSEIL Colorectal Wx43 uchr20 : 471441616 > T P.CB49F CCD31339.1 ZFP8 * Ergost BB28T g.ch20 : 50134662CA 1779CA p . 0503E CCD81339.1 ZFPOA HCC1009 g.chr20 : 50134814GC 6. 1827G > p.X609N CO813443.1 ZNF217 Colorectal Moc 3 g.chr20 :51631806GSA 007G p.0273N Cc03150 , 8P011 Broast HCC130 $ p.chr20 : 55348568_65348389de AT 4.888 887doUAT CC0913459 . CTCFL Colanctal .chrad . $ 55242720T 1084CT AR362X CCD31372.1 GNAS Colorectal y.chrzo.389170150T CBDUCT P.R2010 CC031472,1 ONAS Colorectal p.chrzo.58917815CT 0.6010T D.R2010 CCO91472.1 GNAS Coloxocial MX2 g.chrzd : 539170160 > A 66020A p.R201H CC0913484.1 20ort177 MOC 1393 g.c.20.57032076A » G 42034G P.SHO CC091393 ) . ARFRP1 ?????? HC1187 ochr20.01803956CG p . 1100V CC0813030.1 Cotoro cias 0.020.019925300T P.EOX CCOX313957.1 GPRS Cotrocal 27 g.du20.02200355G - A 2740 > A p.GOZR CC0312580,1 HCC 30 ochr21 : 9973152GA 17GA D.RBO CCDS 13971.1 PR887 Breast HCC1009 g.ch21 : 1059684110588831dTTTTMATAGCT IS209_2313TTTTAATAGCT CCES13000.1 KRTAP20-1 Ordest HCC2157 9.21 : 30910799C > T C. $ 550T p.852 CC0913908 , KRTAP21-1 Brda KCC1395 p.ch/21:31049525G>A p.6159 CC08133091 Colocal Mu27 g.ch.21 :31011050C > T P.R878c CC091380D , 1 TAMI 189 Q.721 : 31424431C > T 6.4016CT p.A13397 09138-40 . 21010 colorecte Mbu32 Ochr21 : 38330348A > 4.1259ANG p.E4200 CCD913847. : HLC9 Bras1 HCC1008 g.chr21 : 37231408G > T c1280 T p.EsaxPE420 CCD913648.1 DSCRO HCC1143 g.chr21 :37302370GST CC091385 1.1 Breast WCC1937 p.ch21 : 374602SZAT 4.3888A > T p.K1280M cco913850 . KCN15 Broast g.chr21 : 385932846 » A 0.211C PAT CC0313880,1 TMPAS93 9.M21 : 42688585d . c . 11do ccc913802 , PKNOX1 Ca?oroctol g.ch21 : 43J101900A MSCA CC0911992 , PKNOX1 Cotorctat H189 ochr21 : 43314994G > * 7936A p . Vesi co313895 , CRYM HCC1305 Och 21: 424852500 > p.0105 # CC09137 12 . C2 tomto Coorddal g.chr21 : 44778042G > A PA168T CcO913713.1 KATAP10-0 Colorectal ochr21 : 448508380A e , 1910A P.SEAN U.S. Patent Sep. 29 , 2020 Sheet 30 of 36 US 10,787,712 B2

Figure 12 - Continued

C. 476CT p.3159F CCO9137131 KRTAP10-6 Broan HCC1907 .ca21 : 44850921CT 6.539_583TGAACACOCACCCTGATAAGCTGC cC0313710.1 TGO Brosu HCC1187 ado21 : 45148007_451480130_ITGAACACGCACCCTCATAAGCTGCG G CCD91373.1 MCHUP 210 p.ch/21:40528175CG E 12250G AL4084 CC0913734.1 MCMAP Catarac p . 21 : 484894810 A 4.728GMA P.V15781 CCD913745.1 ATASVIET Colorado M2 p.chr . 18470592 14BAG P.RSOG CCD913754.1 BEBAS HOC 30 g . 22 : 17279020A 1483A > G P.NBSS CCC313785.1 TAXI Arbox HCC1000 g.ch:10127178C Nomozygous ) c.8280 D.7270X < CO913789.1 g.ch72 : 18144980GA 1010GA CCD913708.1 GHBIL Breda C0195 g.ch:18150B 4G A homozygous ) RAZSOT CCC313774.1 Bros HCC1.599 9.22 : 164747050T 618300T P.PHOLS CC0913775.5 RANBP Bndast * CC1937 g.ch:18481172GC 6.483 P.EIBD CCO313779,1 SCARF Broon HCC1937 q.char27 : 191081280T - 14050T CCD913783.1 PPWIF Colortctat .chrz : 208100780 > A 3876 p.0417KP.R2880 cco313793 , PPMIF H 570T c.ch22 : 206021350A 1240A p.DIBEN CC0913818.1 Coloroctel M23 oc : 2247338G > A Thomarypows ) p.012 CCD913847.1 CA2018 g.chr22 : 27521032AT 4.35AST CC09138.39.1 ort10 BRN PB101 ochr27 : 28248417CA R.T380K CCD913859.1 Bronet HCC1008 w.chr22 : 282279040A e . 14056 D.G49DS CCO913891.1 NF2 g.chr22 : 24395425GA C. 13876 D.5493 % CCO913870.1 MIR Braut HCC1037 d.ch22 : 287235250C GC816 AVIL CCD8 13870.1 MTMRO BEZIT g.ct22 : 28740982_28740882cup a2880 pc # CCO913875.1 SF341 Colorecta WA2 ch22 : 29059540T C. 1531CT P.R511W cco8 13888.1 SMTN Colorecta Muto chr22 : 29917321G > A < 1010GA p.R6070 CC0913888.1 EMTN Cotoroc schr22 : 298183350T 4.22880T D783V CCC913025.1 APOLI Brodat HCC1037 q.ch34985945TC 48117C SCO813927 . ) MYHO 887T g.ch : 22: 350731830C P.KAION CC0313827.5 MY Boozt HCC1107 ochr2 : 35012070_35012874d LCA (homozypous ) 6.4200 4202deGC ander TUPASSA 0.02: 35823941_358238410UpC c4_up TMPA858 Brest HCC1609 w.chr22 : 35610313GA 0.688G > A CC0913041.1 TMPASSO Drom BB33T o.ch22 :35810308C A homozygous ) 675CA p.PLp .82256 CCD913049.1 RAM Bronst HCC1143 g.chr22 : 35082146C > T CCD913050.1 LGL82 Drapat HCC1395 g.chr22 : 39290775QC 0.3946C p . E1320 CCO913091 . ! Broot BB22T ochr22 : 38343938G > A A.G2398 CC0913951 . ) GGA1 Bressi HCC1395 ChY22: 38051528C 14SG PABA CCD913931.1 MICALI Broast HCC18 .chr22 : 386982786 DE817K C00313083.1 POLAZF HC2157 g.ch22 : 38870940T > A C. 178T > A AVON CCD913078.7 UNCEAS Colorosa M + 2 och : 22 : 374588400A 1913 + 1GA EP CCD913903.1 RPL3 eros . HCC2157 ch22 : 38040102A > G JANG CCC914000 . LOC113228 H 570T och 22: 397472070 PA250V CCO814017.1 ACOZ Broad HC02157 Och22 : 40248408CA 2090CA . T897N SREBF2 HCC2157 Q.chr22 : 40591489G > T 0.0176 - T p . 2736 BREAF2 Broast HCC1937 tch 2 :40584 75T > A 1041T > P.MA7K CCCS 14023.1 4.8880 p.EXBOG CCD914042.5 ARFGAP ) HCC1954 Ochr22 : 41538305A > G PA5803 CC0914073.1 PKOREJ Breast BBT 0.022 ;4977733C (homozygous ) 6.2008C G p.716751 CC0814073.1 PKDREJ Breast HCC1395 w.chr22 : 44974115CT 4.58240 - T CO3 + 4025.1 PAND HCC1395 f.ct22 : 46018038CT (homozygous ) p.81377 CCO9 14093.3 AC0029442 Broost HCC1008 o.ch : 49735500CT ( homozygous ) c . 1200T P.P431p.G2143 rox Coloroctat Co108 w.ctX : 5887002 > A 0.0400A p.D12454 CCO914123.1 APXL HCC1395 q.cheX : 07160550C (hororypous ) cco314152.1 TRO Colorado MX41 OvX : 1269687305T ( homozygous ) c . 157CY PR33x CC03141551 EOFLO Broast BB13T .ch : 13405025G > T P.L508F CC091415 $ . $ EQFLO Areast HCC1008 ochX : 134050250T 15240T p.1508F CCO914104.1 AS811 Brook HC02218 ChX: 13031320_1500131501GCCAGA c . 93 3410GCCAGA CCD814101 , NHS Arapu HCC1395 p . #X : 175044780 > A ( homozygous ) 0.253.00 DABUT CC0314162 . SCML Bromu HCC2157 ochrX : 17527859% A 1290A p.YUX CCOS 14189,7 COKL Colorocta Co10 g.ch:13A 1803 c 1102AC p.N *888 CCDS110 $ .t FW14503 HCC1999 g.chrX 1629445010 » PAIP kasut HCC1000 g.ch:199500200 D.H16V CCOS14107 , RPSOXAS D.R46 CcOS 14188. CNKSR2 Colorocter MX32 O.chyx : 21204JAGA 61376A p.D103N CCO314202 . 1 HCC1000 Q.chX216343350A CV07G > A p.LIMF CCOS14233.1 OMD Coloredot M1 g.chX : 32422005GT (homozygour ) c . 100267 CCOS14233,3 DMD Broast BOZT p.chrX : 32220310C 4.24550C D.E12190 CcOS 14233,1 CMD Breast HCC1395 ochrX :321073840 A ( homozygous ) C.4409C - A PR1470H CC0S14233.1 DMD Coprocta C079 w.chrx : 3 1740236C > T 0.04910T PA2104 CCOS14230 , FAMTB Orvos HCC2710 p.chX34721209C - T p.Q2oex CcOS 14239.5 PRRO1 Breast HCC1000 O.chX : 3706359T > A , 176T > A P.Foas c.2094 > G PQXTOR CCO314207,1 OTC Eroast 8.38024437AG p.F125L CcOS 14254,1 CROP2 Broast HCC1393 octoX : 40270564CA thomonydou ) C.39750A p.R2941 CO314255 , 1 DOXX chx409597020 thomoyDOUS ) c.8010 C CC0314200 , MAQA Brandt HCC1393 B.ch:132710060 A Corydows ) 6.45CA P.DISE CCC914204.1 DUSP21 Colorada O.chaX : 44460131CT C.4990T P.R167C CCO914205 .. Colorecto Nuz Q.CHX14080991T > Chorozpows ) 3317T > p.L 1106R ccc914274,1 RAM1Q Colorecta Mit3 cX: 10786098 > A ( homozygous ) 11870A P.R390H CCO914202.1 PFC Broast BBAST o.ch 47245490C > T p . Brot HCC2210 Q.chX + 7245324CO c.BoOG p .6274 CcO9147021 g.chiX483184810T 4.8700T p . 224W CCO31409,1 PQBP1 Cotoractat M02 AW2520 CCD314311.. SLW2 Broant HC2157 n.cX:40$160780>T 6.750GT p.E55BD CCC914370 .. UMOS ochX 87885070 410740C p.K587T CCNBS Colorado C074 p.chrX488.5999AC 61730AC p.K4580 MAGEDI Braut Ho 578T D.ch:54724215C 6.1372 CCDS 14302.5 c.379T > A D.W127R CCDS14570.1 MTMRO BOBX HCC1000 Q.cheXt3357707TA p .45 + K CCD314379,1 MTMRO HCC1937 p.cheX : 63331794GA 13600A LASIL Coroan Muo Q.CHX64934294C T P.R170C CCDS 14381.1 c . 582G > A p.G100s CO314390.1 STARDO HCG1385 octoxo7720578GA ( honorous ) 724A p.6242X CCD314390.1 BTARDO Broax BB32T a.cheX87720741G A p.P 1181 Cotrocio Mox22 c.cX000195200 t CCO914SBO . ARR Colorecta 0.chrX : 89280859_802808.5.SpA 4.8.2_dup Colorado o.ctX :894461900A Q.11B0A p.GOR OLG c.398GA p.W13x CCO914408.1 Broast HCC139 $ Q.chrX : 7022897BCA indd CCO914412,1 TAFS HCC1385 g.ch:70381158_70381163-LAGATAT ( hoaxypous ) 0.1046 1051dGUGATAT U.S. Patent Sep. 29 , 2020 Sheet 31 of 36 US 10,787,712 B2

Figure 12 - Contined

CC0314412.4 TAF1 Broa # BRIST p.chex : 704970701 € 4940defT fa CCO31478.1 8LC182 HCC30 CHX7350100723534407dBIMATCT 1033_1BKAMATCT CCO314433.1 HACEED HCC2713 och : 75432842A > T C 1019T p.Y840F MAGEE : Boat ch : 75433014Chamorro 1991 P. TEBAN TEX2 Catractat C079 ChrX78083.9607 D.VOA Colorecta Mo D.ch:79004034GSA € 1510A PLASTY Colorected MX3 chX78082690G > A promozygous ) 09180 p.0307N CCD914448.1 TBX e 125/1 p . 0420 CCC914430,1 PCD411X Colorectat C074 G.cheX 0898773A> P.R1010x CC0914491.1 PCD11X calore p.chex : 9926253707 4.3052CT p.F8081 CcOS 1417.1 HIRAPUA HC2710 x 1048175-000 18180 CCC314920,1 PRPS1 Erront g - chrX 1068940280 c8070 » C p.W2190A203H CCD814528.1 PRPS1 g.ch:108894677TX PRPS ) Colorstad M 0.chX : 1004947120G a 69100 p . 310 COUWB Colorecta -chX 1072200916A 33BOGA P.G11305 SC0314341.1 EROA Cetorpet Co too .chrX 107785681CT p.0215E CO31451.1 RO .chrX 1677850786 COCA p.G557R CC0914544.1 TRBUH N228 ochX: 107704051GC 18896 CCC3H54-1 Broox HCC2157 o.chrX : 108525282GC ( homozygous ) 4.29GC D.RIOP CCC91454,1 Colorasta ) M27 X 108732225CT 3070 T D.R1330 Corpora Co ? ochrX 100222750TC 7091 > p.Y237H _C0314350.1 FUZ270 10720 P.Q3SER CAPI Co74 ochX 1103002780 - C B04854 CC0914500.1 18 Brvos HCC1 107 p.X 114703778_ > C P -A1226 CCO914575.1 127 Bond HCC1000 p.chrX : 117090990 p.Rc CCOS1 380.1 NIWAU Colorecta MX32 X1107087050T € 1570T 10Z » p.LX2P CC0914009 , Broast NCC 38 . : 123531210GC R.V12161 CC0314009 , 1 OnZt Dra * g.wX120350450GA 3946G p.F1462Y CCC314608.1 0021 X 1232816831 C4444T > G CCD814608.1 ODY Bron HCC1837 a.cheX 123243590GC ç.07030C p . 02235N CC0814008.t OCZ1 Colorectal Ca78 p.chX 123243107GY P.L2396F ccp914618.1 BCORL1 HCO218 arX : 1288747780A 42456 A D.G620 18 Q.X: 13375802A 1876A D. V CCD314642.1 Broot McC1008 D.ch:13637501CG P.P217 CC081483..t FGF13 Cotarptat g.ch:1374400BBGA ATPIC Cotorected M p.ch:13381224.40T 4700T p.7157 CCRS14688.1 ATPI1C Colorectal Co 108 g.chX : 1365577494 > C 2792AC p.0831P CO91487e . 1 MAGE Broset HCC1054 g.ch:1410172780T ct @ CST co 108 p.chrx : 1424430263A 4.616GSA CCDS 14697.3 CD9912 Colorectal o.chuX : 1400 152140A IVS8 + 1G > A C40914701, CNDA2 Breast HCC1854 o.ch:1505786886A Motypows ) 4.290G - A P.ROTH CC0314701,1 Broat HCC1008 ActX 1505877390A 1196G A PR3990 cco914702.1 HACEM Dreast HCC1008 g.chX 1507831876 > A 459G > A P.Q1530 CCO914770.1 WWGEAJ BYGGET CC1000 g.chrX151968374C c.833AC P.K278T CC09147221.1 BGN BBAT p.chex 1522933786C 0.7976 - C p.R286T CC0914721.1 BON HCC1000 g.ch:152293415-T a.884CAT P.IVAN PNCK Broaw o.chX41524500820T 073CT P.PZSS 0914742.1 POZK Broot HCC1599 g.ch:162594843CT D.A3oCp.2471 CC0314733.1 HCC100 % g.ch:162092547GA cc0814787.1 Cokydd wuctX : 1510709750A 0685GA Donorc poslalna w woordinator in Oro Mey 2004,17 33.1 VCc @enta Cruz releas of the human ganoo, onome coordinates and oncos of mutations are on the coding strand changes heterozyogous union marked as honorygous. ... gonorric name : , EDNA Requince ; p . proton sanca : 04 , deletion dep . dupleetan fou , Insertion " che , cromosome : Mustions in non - coding sequences Ano annotod by Intron maumber proceded by V, with positiva number morting them to the GT spte donor site and getive nunta marting to the of the AG spokoptar milw . frumuhin mutation : p , plco alto mutations UTR . Macon in Sountranslatodrogion Ends , ha trama intortion , dalotion or duplcntion chango affocting more than a brygle codon Tho mio acht change routing from mutation in the tranatatlan bulating motonino ore Adilcetod known " . U.S. Patent Sep. 29 , 2020 Sheet 32 of 36 US 10,787,712 B2

O 0 0 0 0 O O 0 O 0 o O 0 0 UTR O 0 0 0 0 O 0 0 0 0 0 0 0 0 0 0 O o

0 O O O O O 1 O 0 O 0 1 O 0 2 0 0 0 0 1 0 0 O O OOOOOOOOOOOOOO Oupll.Splica cationsito 1 1 0 O O 0 0 O 0 O ooooooo 0 0 0 1 0 0 0 0 0 0 0 O

0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 3 Deleton O 0 Q 0 0 0 0 0 0 1 0 O 0 0 0

0 O 0 0 O 0 0 0 Insertion 0 0 0 0 0 O 0 0 0 O 0

1 1 0 0 0 0 D 0 0 0 Non. 0 0 0 0 D 0 0 O 0 D 0 1 0 0 0 0 0 0 sando 0

1 I 4 2 3 1 1 1 1 2 3 3 1 2 2 2 sonso 3 2 Z 2 2 1 2 2 2 2 2 3 3 3 2 3 2

3 5 2 $ 3 3 2 2 Z N NUNG W 3 1 2 2 2 7 3 2 3 3 2 Hetaro. Kygous 2

1 1 0 0 0 1 0 O 0 f 0 0 0 0 0 0 0 0 O OOOOOOO 0 0 1 0 0 Q 0 1 0 0 0 0

4 $ 2 ?? ?? ?? . ??? ?? ? 3 3 2 2 3 2 2 3 2 2 3 2 2 2 2 2 2 2 2 HomocontainingTotalnumbermutation ofmutations zygous 2

7* 15% 6% 16% 8% 7% 9% 6% 6% 7% 6% 14% 13% 10% 8% 6% 13% 8% 7% 9% 12% 9% 9% 6% 7% 8% 7% 15% 8% 9X 10X Estimated fractionof tumors 9% 10% 104 CAMP econd 1.65 1.39 1.87 1.95 225 1.76 1.33 1.74 1.25 1.43 1.59 3.07 208 2.02 3.29 1.46 2.24 1.29 1.75 1.34 1.75 1.06 1.46 2.45 1.69 2.53 1.29 1.67 1.94 1.79 1.25 1.57 3.38 2.12 3.36 1.45 1.43 1.38 2.30 1.66 223 1.56 221 2p24.2 3p14,3 18913.1-qer Chromosoma band 16013,3 1042 7936 1p31 10028.3 9934.3 3p21.31 16221 19p13.3 2022 7ceng11.2 18021.31 2018.1 ?q28 1792114021,3 224122 Sp14.013 18022-423 17013.1 12914.1 1p36.3119273.2 30222 2012-011.2 3p26.025 1p21 6912913 3p21.1 10p12.31 15222-224 5,35,3 119220223 17p12 3p21,1-3p14.3 9234.3 17912 16p11.2 4431.21 2024.1 22913.31 12913.7-913.3 7015 94332037.2 2437

Dodg)associated,caminaadapthoacontainingARFdindingprotein1CCDS13955,1 CCD810466.1ATP-bindingcaasatta,autofamilyA(ABC1)mambar3 (MDRTAP),mambar10ATP-bindingcessatio&ublamilyCCDS1500,1 CCDS5913,1ATP-bindingcassetta,autfamilyB(MONTAP)mamber& danydrogenase,C410C-12straightchainAcyCoenzymeACCOS689. Rhoguaninonucleoudeexchangefactor(GEF)4CCDS2165,1 CCOS10268,1cytochromeP450,family1subfamilyApolypaplita CCD312719,1prutamatorecoplo,lanotropicN-methylDaspartale2D chromadomanCCDS57.1holkasaDNAbindingprotein5 DEAD(AspGtAlapolypoplidaABP)box10CCOSA342.1 auchromatichistoneCCDS7050,1-lysinoNmathylbansferase1 UDP-Nacetylabshsgalactoseminepolypeptidodeacetylgalactosemiyttrandterose5 CCOS11985.1ATPase,Classtype88.member1 CCDS3892.1cacherin10.ypa2(T2-adherin) aublin(inttisictectorcobalamin-raceptor)CCO$7113.1 CCOS11160,1dynanaxonamal,nosvypolypeptide9 GRB2-associatedCCDS3758.1bindngprolain1 CCDS8940.1glioma-associatedoncogenohamobog1 CCDS5380.1transmembranoolycoprotein)amb( CCOS2547.1highdensitylipoproteinbindingprotein metallopeptidasadomain12ADAMCCOS7653.1 CCDS10758.1autocrinamouiltyfactorreceptor CCOS12068.1adenomatosispolyposlacali2 CCD$9679.1chromosomo14openreadingframe155 associated1FerdiomyopathyCCDS2683.1 CCOS778.1collagen,typeXIalpha1 CCOS4970.1collagan,typeXIXalpha1 CCDS2773.1sdagenVII,alpha1po CCOS2800.1doornbonucleaselika3 MAMdomainCCOS7010.1containing4 argininosuccinatelyasoCCOS5531.1 8-c81Clinymphoma11ACCDS1861.1 CCO$11453.1broastcancer1,eartyonset CCDS11977.1cocherin20,type2 CCDS11101.1cordaurin,bata1 cyclinM4 EGF_kedomamCCOS14155.1multipla*,6 CCOS11291.1notchlesshomolog1 CCDS10701,1incfingerprotah668 CCOS1891.1F440859hypotheticalprotein CCOS2885.1flamin0,bala Genonamoaccassion CCDS2743.1ALS2Culornallixo CCDS13859.1THOcomplex5 CentaurinCCDS8951,1,gammet CCOS12601,1piquahomolog contactin6CCDS2557,1 histonedeacatytaseCCD$2579,14 Fig.13.TableS5BreastCAN-genes CC0514721.1blglycan CCDS4420.drobrint goloolinCCDS6828.1 CCOS CCOS2024.1 CCDS2203.1 COL19A1 Geno ABCAJ ABC810 A8C88 ACAOM ADAM12 AEGP ALSZCL AMFR APC2 ARHGEF4 ASL ATP881 BCL11A BRCA1 C1401155 C22ort19 CDH10 COH20 CENTB1 CENTG1 CHOS CMYA1 CNNM4 CNING COL11A1 COL7A1 CUBN CYP1A1 OBN1 ODX10 ONAH9 ONASE1L3 EGKLG EHMTI F10458 F13479 FL0869 FINO GABI GALNT5 GGAI GU1 GAWM8 GRIND GSW HOACA HOLB U.S. Patent Sep. 29 , 2020 Sheet 33 of 36 US 10,787,712 B2

0 0 0 0 0 0 0 0 0 0 0 0 Q 0 0 0 0 0 0 0 0 0 0 0 0 0 0 O o 0 0 0 0 O 0 0 0 0 0 0 0 O 0 0 0 0

OOO 1 OOO O O O 0 1 0 1 0 0 0 0 0 O 0 0 0 0 0 1 0 0 0 0 0 O 0 0 1 o 0 O O 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 O 0 0 O 0 o

0 0 O 0 0 0 $ 0 O 0 0 O 0 0 0 0 0 o 0 0 O O 0 O O 0 Oooooooooooooo QQ 0 f

0 1 0 0 0 0 0 1 0 o 0 0 0 O 0 0 0 0 0 0 0 O 0 O 0 e 0 O

0 O 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 O O 0 0 0 0 1 0 0 0 0 1 0 0 1 0 0 0 O 0 0 O

1 1 1 2 2 1 2 2 3 2 2 2 2 ON N 1 N N N N 3 N N N 1 2 1 2 2 1 2 2 2 3 3 3 2 2 2 2 2 2 2 2 3 2

d 4 1 1 2 1 2 2 2 2 1 2 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 2 2 2 2 2 2 2 5 2 2 NNN 2 2 2 3 2 2NNN

I 0 O 0 0 0 0 D 1 0 0 Q 1 O 0 1 0 0 1 . 1 0 1

3 2 2 2 2 2 2 3 2 2 3 2 2 2 2 2 2 3 2 2 2 2 2 2 2 3 2 3 2 2 5 NNN NNNNNNN ?

12% 9% 10% 10% 10% 12% 6% 7% 11% 6% 6% 10% 12% 11% 8% 6% 9% 16% 6% 6% 8% 8% 9% 6% 8% 7% 94 6% 8% 11% 6% 6%

1.57 2.08 1.65 1.09 1.05 1.61 1.46 2.46 1.33 2.44 1.66 1,46 1.74 2.13 2.42 1.29 1.48 1.29 2.13 1.57 1.03 2.66 1.53 1.65 1.45 1.09 1.14 1.75 1.67 2.23 1.37 1.45 1.43 1.38 1.75 1.42 1.29 1.10 1.83 1.36 1,34 2.08 1.74 2.08 1.29 1.06 2.46 1.46 1.57 1.66 1,75

19p13.3-p13.2 Eplar72.33 Xp11.3-p11.2 7p21.011.2 1p36.1.035 7015-014 19913.2 12913.3 3p21.3 19p13,2 18021,1 10p15.3 11923.3 184123 697.2 140721 1602214931.3 2437.31932-231 Xq13,3 1930.11 1p36.13 1102122q122 17p131 11015.419913.42 20911 7931.1-931.2 104213 9234.1 194213 2823.1 5431 11011 22913.31 6p25.2 Xq21.427 14322 2933 1925.3 3821.1 12424.31 160122-012.1 3421,1 6p25 14923 5015,3 2911.211423.2-224.2 2937,1

releasingfactor2 palycystickidneydisease(polycystin)andREJspermreceplorforoggJolly CCDS3663.1soltecarrierfamily&(neurotransmitertensporter,dopamha)member3 CCDS3773.1LPS-responsivavosidatrafficking,beachandanchorcontaining associationRasRAIGDS(/AF-6)andpleckstrinCCOS2359.1homologydomains1 CCDS4477.1garkinpeptidaseinhibitor,cadeB(ovalbumin)member1 xostecarrerfemalyCCDS262.19(sodhentydrogenexchangermember2), CCOS8436.1 soruwelatedreceptor ,LOLA class)Arapeats-containing intercellularadhesionmolecule5telencephalin, CCDS299.1mitogermactivatedproteinkinasekinasa6 CCDS11155.1myorin,heavypolypoplido1skeletalmusdeadult CCOS12937.1NACHT,leucinerichrapeatandPYDcontaining8 CCOS1570.1obscut,cytoskeletalcalmodulinandinteractingtitirRhoGEF CCOS5424.1plackstubhomologydomaincontaning,familyA CCOS4488.1PRP4pre-mRNAprocessingfader4homologB CCDS1514.1protaintyrosinephosphatasonowhocaplar,type14 CCDS1359.1ralguaninenudeotidadissociationstimulator-lika1 CCOS7054.1OIP?discounteractingprotein2honologC leucinerichrepeatCCD$2521,1thFlil)interactingprotein1 MRE11monolicrecomblmatlanCCOS8298,111homologA aminocyclopropane1-carboxylatesynthaseCCOS7607.1 CCDS10609.1sodiumchannel,nontottage-galedbeta CCDS12239.1KelcheECH-Essociatedprotein1 microtubuloCCDS435,1-actincrosslinkingfactor1 CCDS14433.1 melanoma anticonfamlyE.1 chromosomaCCDS166.1iopenroadingframe64 homolog,1.auchin-like CCDS2837.1RNA,U3smallnucleatarInteractingprotein2 CCDS5000.1cytochromoSroductase4 CCDS13241.Inuclearracoplarcoactivelor6 CcOS5751.1 merconalcelladhesionmolecule CCD$14529,1phosphorbosytpyrophosphatasynthelasa1 CCDS1221.1RASproteinactivatorlika2 CCOS40521Resisprotein-specificguantrenucleotida CCDS12157.1regulatory faclar x2 370,strawberynotchhomolog1CCDS8246.1 CCDS9749.1sinooculishomeoboxhomolog4 SP110CCOS2474.1rudaarbodyprotein CCOS1165.1Fcreceptor-ike5 integrirCCOS2689.1alpha,8 CcOS5111.1Karyopherinalpha5 CCOS10832.1hypotheticalproteinLOC283849 CCD$13870.1myotubulartirelatedprokain3 CCDS7828.1myogenicdifferentiation1 CCO$4257.1protocacherinbala15 CCOS14282.1 complementfactorpropardin CCOS11613.1proteinphosphatase1E CCDRAP1$218.5GTPaseactivatingprotein GCDS5404.1homeoboxAS CCO$8939,1inhibin,balsE KIAA0989CCDS8379.1protein 133kDanucleopornCCO$1579,1 CCO$6940.1nucleoport2140a CCDS3019,1semaphorn5B ContinuedFigure13- CCD$11835.1KIAA0427 CCDS11926.1KIAA1632 kineciaCCOS9725.1 CCOS1724.1ototertin CCO CCDS14073.1 RASGRF? HOXA3 ICAMS INHEE IRTA2 ITGAS KEAPI KIAA0427 KAA0934 KAA0989 KAA1632 KPNAS KTNI LOC283849 LRRA LRRFIPI MACFI MAGEET MAP3K6 MGC24047 MRE11A MTMR3 MYOD1 NALP8 NCASOR NCOAG NRCAM NUP133 NUP214 OBSON OTOF PCOH815 PFC PHACS MKOREJ PLEKHAN PPMIE PRPF4B PRPST PTPN14 RAPIGAT RASAL RfXZ RGLI RNUSIP2 SENOT SCNNID SEMA58 SERPINBI SC6A3 SLC9A2 SORLI SP110 U.S. Patent Sep. 29 , 2020 Sheet 34 of 36 US 10,787,712 B2

ooooo 0 O 0 0 0 0 0 D

0 0 0 D 2 0 0 0 D D

OOOO 1 0 0 Oood

0 0 oo Oo

0 0 0 o O Oo oo

ooo Oo 0 0 0 0 103 20 successfullysequencedinthatgono(io.,baseswithPhredqualityscore220) 2 2 1 2 1 2 1 2 2 2

2 1 1 8 3 1 INN

O 1 12 0 1

2NN W 2 4 2 3 18 3 2 2 NNN 2

10% 13%2.41 11%1,42 9%1.98 2.099% 7%1.29 6%1.82 1.376% 1.158% 2.6116% 1.586% >1055% 1.24 20912-913.21.456% 1.29 1.42 1.05Spler-912.1.7% thenumberofbasescontainingmutationsgenedividedby 9433-434 X413.1 14923.2 12924.2 11922-224 1921 229123 17p13,1 3924-425 2p23.1 11013 20913.2 14924.1 13.12189

envelope2CCD$9781.1containing,nuclearSYNEZspectrinrepeat CCOS13941.1transmembranoproteaseTMPRSS8,sorno8 domainhomolog1VEPHICC083179.1ventricularzoneexpressedPH SPTAN1CCDS6905.1spectrin,alphanonerythrocytic1 CCDS9209.1transaplontacio1.hepaticTCFI CCOS7873.1zincfinger,CSL-typecontaining3ZCSL3 CCOS13439.1zincfingerprotein64homologZFP64 ZFYVE26CCDS9786,1zinc(ingar,FYVEdomaincontaining26 Thefractionofthe35breasttumorsovalneodinDiscoveryandValidationscreens Continued13-Figure CCO$14390,1STARTdamaincontainingSTARDS8 CCDS11118.1tumorproteinp53TPS CCDS4895.1protein318ZNF318zincfinger ZNF589CCOS12503.1zincfingerprotein569 CCDS13408.1sulfatase2SULFI tectorinTECTACCDS8434.1akona THBS3CCOS1099.1thrombospondi3 xanthinadehydrogenaseXOHCCD$1775.1 U.S. Patent Sep. 29 , 2020 Sheet 35 of 36 US 10,787,712 B2

0 O 0 0 . 1 0 0 0 0 O 0 0 UTA 0 0 0 0 0 @ 0 0 0 0 0 0 O

0 0 0 O 0 1 0 0 0 0 0 O O O O O O 0 0 0 0 0 0 0 0 0 0 0 0 Dupll.Splice O 0 0 0 0 0 0 1 0 0 O O O 0 O 0 Delationcatan<o 0 0 1 0 0 0

0 OO 0 0 O 0 0 0 OOO O O O

V 0 0 O 0 0 0 Inserton 0 0 0 0 Q O O O O O

1 2 0 O 1 0 O Non sansa O 0 0 0 0 18 0 0 0 0 0 0 0 0 1 0

2 4 3 2 6 2 2 3 5 MWNNNA 1 2 2 1 16 2 Nu old - NN Mls. sonso 4 NNNN NNNA

1 7 2 2 2 2 3 1 3 5 1 2 2 12 ??? ?? ? ? ?

1 0 1 1 1 0 0 4 0 O 0 0 2 0 O O 0 0 0 O 0 0

3116

2 2 3 2 3 2 5 2 7 3 3 2 2 2 3 3 4 2 4 3 2 3 2 16 CAMPcontainingnumberofHomoHetero mutationmutationstygousTygous6core 2 tumorsTotal 9% 10% 21% 0% 10% 19% tractionof 5% 14% 10% 6% 8% 9% 74 6% 6% Estimated 2.8212% 1,577% 1.757% 2.7017% 3.2712% 2.6710% 1.586% 1.8511% 4.2213% 3.5013* 1.96 >10 1.04 1.14 1.33 1.17 1.26 1.02 1.97 1.51 5.07 1.19 2.64 3.51 1.22 2.47 1.22 1.17 1.60 >10 2.21 1.29 1.97 1.00 2.14 1.22 1.29 3.69 2.31 1.90 2.96 1.27

3p26p25- 19p13.2 Chromosome band 9q31.1 10925.1-425.2 4934 11925 16923 15925,2 5q21-922 10026.13-728.2 15911-913 6p21.3 6913 11913 3p28.1 8923.3 3p11.2 7933435 10q11.23 149322 6923 4931.3 16924.3 20q13.3 11921-2225914,3 6p22-21.3 12913.3 6914 14932.13 12p12.1 1932.1 13922.2 8p23.3 2424-431 2934-235 1932 15911-913 7936.1 16913-921 17911.2 1942.13 12924

ADAMTS15CCDS8488.1ADAMmetallopeptidasawiththrombospondntype1moll,15 ADAMTS18CCOS10926.1ADAMmetallapeptidasewiththrombospondhtype1moti,18 excisionrepatcross-complementingrodentrepairdeficiency, KCNQSCCOS4976.1potassiumvonage-galedchannel,KQTlikesubfamilymember5 bucnesch24,1repeat-containingLGREGproteincoupledreceptor6CC PERXTCCDS9213.1purinergicreceptorP2x.Agand-getedionchannel,7 CCO$6762.1ATP-bindingcassette,sublamilyA(ABC1)member1ABCA1 CCDS1570.1obscurin,cyloskeletatcalmodulinanditin-InteractingRHOGEROBSCN ACSLSCCOS7572.1acycoasynthetaselong-chainfamilymember5 CCDS2556.1calladhesionmoleculewithhomologytoCALIL1CAM complementationgroup6 GUCY1A2CCDSB335,1guanylatocyclasa1,solublealpha2 CCDS4061.1HyaluronanproteoglycanendHARLN1linkprotein1 CCOS8702.1VnKuras2KirstenratsarcomaoncogenevalhomologKRAS CD46malecidocomplement,regulaloryproteinCCOS1479.1 MLLCCDS5931.1myeloid/lympholdormked-incagoleukemia3 Clon29CCOS4724.1solutecamiarfamily44,member4 F-boxandWC40domainFAXWIprotein7CCOS3772,1 CCDS10970.1galadosamine(N-acetynfwBuilatesulfataseGALNS CCDS2232.1lowdensityUpoprotein-volatedprotein2LRP2 CCDS10013,1makorn,angfingerproteinMKAN33 ADAM28CCOS3823.1ADAMmetallopeptidasedomain29 adenomatoslapolypostaCCDS4107,1coll C100/137CCDS7646.1chromosomo10openreadingtrame C150rtaCCD$10015.1chromosoma15openreadingframe2 CSMD3CCDS6315.1CUBandSushimultipledomains3 MAP2CCOS2384.1mladtubule-associatedproteln2 Fig.14.TableS6ColorectalCAN-genes ADAMTSL3CCDS10326.1ADAMTS-like3 CCDS8134,1CD248molecula,endostalihCD248 CCOS2922.1EPHrecaptorA3EPH43 CCOS5873.1EPHB6EPHreceplor86 CCDS9955.1Enah/Vasp-likeEVL EYA4CCDS516Seyesabsenthomolog4.1 CCDS13472.1GNAScomplexlocusGNAS HIST1H10CCOS4635,1hlstand1,H10 LOC157697CCOS5955.1glutamatenich1 MGC23407CCDS12207.1hypotheticalproteinMGC33407 CCOS10752,1MMP2mattametabopepudess2 GenenameaccessionGone CD109CCDS4982.1CD103moleculo CNTN4CCDS2558,1contactin4 KGIRS3CCDS8834,1keratin6int3 CCOS9454.1LMO7domainLIM7 CCOS11264,1neurofibrominNFI1 CCOS ERCCGCCDS7229.1 CCDS9911,1KIAA1409KAA1409 APC MCP U.S. Patent Sep. 29 , 2020 Sheet 36 of 36 US 10,787,712 B2

1 0 0 0 0 ? ? ? O 0 0 0 0 0 0 0 0

0 O 0 1 0 1 O 1 0 0O

O O 0 0 0 0

0

2 0 0 0 1

0 O 0 0 0 0 0 0 0 0

1 O 0 0 0 0

11*

1 1 3 3 1 2

23 21 2

2 2 5 2 20 3 2

20 20

O O O 0 0 2 1 2 15 Oooo

5 3 2 2 2 2 2 5 2 2 2 3 2 2 3 2 18

%12 7% 1.907% 2.8310% 2.859% 1.486% 1.876% 2.229% 3.4616% 1.447% 1.909% 2.2910% 2.429% 1.896% 2249% 3.0510% 4.5613% 2.329% 10>51% 2.196% 1.18 3.27 1.91 'TheTradionofthe35coloredaltumorsevaluatedinDiscoveryandValidationscreenscontainingmulationsgenedividedbynumberbasessuccessfullysequencedthat(Le.,withPhiredqualityscore220) 9p23-p24.310%2.20 2.216%20pler-912 8p21.6-p21.21.906% 1935.3-p35.11.35 q13.120912-1.28 3421-425 8914 6p12.2 21922.3 14q11 10911.2 8922 11923.3 7931 18921.1 15922.33 18921.1 8925 Xq21.1 10425,3 3p22 17p13.1 3p25.3 9p24.1 16012 19013.2

TGFBR2CCOS2648.1transforminggrowthfactor,betareceptor11(70/80%Da) CCOS4908.1Solutocamerfamily29(nucleosidatransporters),member1SLC29A1 CCDS3158,1purinergloreceptorP2Y,G-proleincoupled14P2RY14 CCDS84721proteintyrosinephosphatase,receptortype.DPTPRD PTPRUreceptortype,UCCOS334.1tyrosinephosphataseprotein translocatedto,1transcriptiontador;CCDS6256.1runtrelatedRUNX1T1 CCOS11934.1SMAD,mothersagalnstOPPhomolog2(Drosophila)SMAD2 CCDS11950.1SMAD,mothersagainstDPPhomolog4(Drosophila)SMAD4 CCOS6469.1ubiquitin-like,containingPHDandRING(Ingerdomains2UHRF2 CCO$8442.1sodiumchannel,votage-gatedtypeklbetaSCN3B SFRSEargininalserine-rich6CCOS13318.1splicingfactor, CCD$10222,1SMAD,mothersagainstDPPhomolog3(Drosophila)SMAD3 SYNETCCOS5236.1Spactrinrepeatcontaining,nuclearanvelope1 CCOS2585.tubulintyrosineIlgase-likefamily,member3ML3 CCDS10801.1ubiquinotcytochromecreductaseVQCRC2careproteinil CCD$4987.1plockstrinhomologydomaininteractingproteinPHIP 1CCD$4935,1polycystickidneyandhepaticdiseasePKHD1 CCDS13692.1PBXknotted1homeoboxPKNOX1 CCDS5829,1exocystcomplexSEC8L1component4 CCOS7200.1ratprotooncogene-RET SDBCAG84CCO$13257.1ERGICandgolgi3 CCD$7576.1transcriptionfactorHike2TCF7L2 CCOS11118.1tumorproteinp53P5 CCDS12271.1zincfingergroteinZNF442442 Continued14-Figure CCD$9637,1proteinkinasePRKD1D1 -box22CCD$14445.1TTEX22 US 10,787,712 B2 1 2 CONSENSUS CODING SEQUENCES OF somatic mutation in a gene or its encoded cDNA or protein HUMAN BREAST AND COLORECTAL is determined in a test sample relative to a normal sample of CANCERS the human . The gene is selected from the group consisting of those listed in FIG . 13 ( Table S5 ) . The sample is identified CLAIM OF PRIORITY 5 as breast cancer when the somatic mutation is determined . This application is a continuation of U.S. patent applica A method is provided for diagnosing colorectal cancer in tion Ser . No. 16 / 664,505 filed Oct. 25 , 2019 , which is a a human . A somatic mutation in a gene or its encoded cDNA continuation of U.S. patent application Ser. No. 15 / 413,903 or protein is determined in a test sample relative to a normal filed Jan. 24 , 2017 ; which is a divisional of U.S. patent sample of the human . The gene is selected from the group application Ser. No. 14 / 224,102 filed Mar. 25 , 2014 , which 10 consisting of those listed in FIG . 14. ( Table S6 ) . The sample is a divisional application of U.S. patent application Ser. No. is identified as colorectal cancer if the somatic mutation is 12 / 377,073 filed Jul. 12 , 2010 , which is a 371 U.S. National determined . Application of PCT /US2007 /017866 filed Aug. 13 , 2007 , A method is provided for stratifying breast cancers for which claims priority to U.S. Provisional Application No. testing candidate or known anti - cancer therapeutics. A CAN 60 / 842,363 filed Sep. 6 , 2006 and U.S. Provisional Appli 15 gene mutational signature for a breast cancer is determined cation No. 60 / 836,944 filed Aug. 11 , 2006 , the entire con by determining at least one somatic mutation in a test sample tents of which are hereby incorporated by reference . relative to a normal sample of a human . The at least one STATEMENT OF FEDERALLY SPONSORED somatic mutation is in one or more genes selected from the RESEARCH 20 group consisting of FIG . 13 ( Table S5 ) . A first group of breast cancers that have the CAN - gene mutational signature This invention was made with government support under is formed . Efficacy of a candidate or known anti - cancer Grant Nos . CA121113 , CA043460 , CA057345 , CA062924 , therapeutic the first group is compared to efficacy or GM007309 , RR017698 , CA043703 , and CA109274 second group of breast cancers that has a different CAN awarded by National Institute of Health . The government 25 gene mutational signature . A CAN gene mutational signa has certain rights in the invention . ture which correlates with increased or decreased efficacy of the candidate or known anti - cancer therapeutic relative to TECHNICAL FIELD OF THE INVENTION other groups is identified . This invention is related to the area of cancer character A method is provided for stratifying colorectal cancers for ization . In particular, it relates to breast and colorectal 30 testing candidate or known anti - cancer therapeutics. A CAN cancers . gene mutational signature for a colorectal cancer is deter mined by determining at least one somatic mutation in a test BACKGROUND OF THE INVENTION sample relative to a normal sample of the human . The at least one somatic mutation is in one or more genes selected It is widely accepted that human cancer is a genetic 35 from the group consisting of FIG . 14. ( Table S6 ) . A first disease caused by sequential accumulation of mutations in group of colorectal cancers that have the CAN - gene muta oncogenes and tumor suppressor genes ( 1 ) . These tumor tional signature is formed . Efficacy of a candidate or known specific ( that is , somatic ) mutations provide clues to the anti- cancer therapeutic on the first group is compared to cellular processes underlying tumorigenesis and have proven useful for diagnostic and therapeutic purposes. To 40 efficacydifferent onCAN a second - gene groupmutational of colorectal signature cancers. A CAN that hasgene a date, however, only a small fraction of the genes has been analyzed and the number and type of alterations responsible mutational signature is identified which correlates with for the development of common tumor types are unknown increased or decreased efficacy of the candidate or known ( 2 ) . In the past , the selection of genes chosen for mutational anti - cancer therapeutic relative to other groups. analyses in cancer has been guided by information from A method is provided for characterizing a breast cancer in linkage studies in cancer - prone families, identification of 45 a human . A somatic mutation in a gene or its encoded cDNA chromosomal abnormalities in tumors , or known functional or protein is determined in a test sample relative to a normal attributes of individual genes or gene families ( 2-4 ) . The sample of the human . The gene is selected from the group determination of the human genome sequence coupled with consisting of those listed in FIG . 13 ( Table S5 ) . improvements in sequencing and bioinformatic approaches Another method provided is for characterizing a colorec have now made it possible , in principle, to examine the 50 tal cancer in a human . A somatic mutation in a gene or its cancer cell genome in a comprehensive and unbiased man encoded cDNA or protein is determined in a test sample ner. Such an approach not only provides the means to relative to a normal sample of the human . The gene is discover other genes that contribute to tumorigenesis but can selected from the group consisting of those listed in FIG . 14 also lead to mechanistic insights that are only evident ( Table S6 ) . through a systems biological perspective . Comprehensive 55 These and other embodiments which will be apparent to genetic analyses of human cancers could lead to discovery those of skill in the art upon reading the specification of a set of genes , linked together through a shared pheno provide the art with type, that point to the importance of specific cellular pro cesses or pathways . BRIEF DESCRIPTION OF THE DRAWINGS There is a continuing need in the art to identify genes and 60 patterns of gene mutations useful for identifying and strati FIGS . 1A and 1B . Schematic of Mutation Discovery and fying individual patients ' cancers . Validation Screens. FIG . 2. Mutation frequency of CAN - gene groups . CAN SUMMARY OF THE INVENTION genes were grouped by function using Gene Ontology 65 groups, INTERPRO domains , and available literature. Bars According to one embodiment of the invention a method indicate the fraction of tumors ( 35 breast or 35 colorectal) is provided for diagnosing breast cancer in a human . A with at least one mutated gene in the functional group . US 10,787,712 B2 3 4 FIG . 3. ( FIG . S1 ) Codon mutation frequencies . Open bars , 13 ( Table S5 ) . Particular genes which may be tested and CCDS codons ( n = 7,479,318 in 13,023 genes ) ; red bars , useful are gelsolin GSN , cadherin genes CDH10 and codons affected by base substitution mutations in breast CDH20 , actin and SMAD binding protein filamin B FLNB , cancers ( n = 789 ); blue bars , codons affected by base substi and autocrine motility factor receptor AMFR . Additional tution mutations in colorectal cancers ( n = 669 ). 5 useful genes include ATP - dependent transporter ATP8B1, FIG . 4. ( FIG . S2 ) CCDS genes excluded from analysis . intrinsic factor - cobalamin receptor CUBN , actin binding One hundred thirty - four transcripts from 119 genes that protein DBN1 , and tectorin alpha TECTA . For colorectal closely matched more than one genomic locus ( large circle ) , cancer , the gene ( or cDNA or protein ) to be tested is any of and / or were located won the Y chromosome ( small circle ) , those shown in FIG . 14. ( Table S6 ) . Particular genes which were excluded from analysis. 10 may be tested and useful are ephrin receptor EPHB6 , mixed FIG . 5. ( Table 1. ) Summary of somatic mutations lineage leukemia 3 gene ( MLL3 ) , and protein tyrosine FIG . 6. ( Table 2 ) Spectrum of single base substitutions phosphatase receptor PTPRD . Other genes which may be FIG . 7. ( Table 3. ) Functional classification of CAN tested and useful are polycystic kidney and hepatic disease genes * 1 gene PKHD1 , guanylate cyclase 1 GUCY1A2, transcrip FIG . 8. ( Table S1 . ) Primers used for PCR amplification 15 tion factor TBX22 , exocyst complex component SEC8L1 , and sequencing ( page 1 of 1333 only ; all primer sequences and tubulin tyrosine ligase TTLL3 . Any somatic mutation are publicly available in a downloadable file may be informative . Particular mutations which may be used ( 1133427_som_tables.zip ) at the website of the journal are shown in FIG . 12 ( Table S4 ) . Science (www.sciencemag.org ) under Supporting Online The number of genes or mutations that may be useful in Material located at the webpage / cgi / content/ full / sci; 20 forming a signature of a breast or colorectal cancer may vary 1133427 / DC1 ) from one to twenty - five. At least two , three , four, five , six , FIG . 9. ( Table S2A . ) Characteristics of the colorectal seven or more genes may be used . The mutations are cancer samples . typically somatic mutations and non - synonymous muta FIG . 10. ( Table S2B . ) Characteristics of the breast cancer tions . Those mutations described here are within coding samples. 25 regions. Other non - coding region mutations may also be FIG . 11. ( Table S3 . ) Distribution of mutations in indi found and may be informative . vidual cancers . In order to test candidate or already - identified therapeutic FIG . 12. ( Table S4 . ) Somatic mutations identified in agents to determine which patients and tumors will be breast or colorectal cancers sensitive to the agents, stratification on the basis of signa FIG . 13. ( Table S5 . ) Breast CAN - genes . 30 tures can be used . One or more groups with a similar FIG . 14. ( Table S6 . ) Colorectal CAN - genes. mutation signature will be formed and the effect of the therapeutic agent on the group will be compared to the effect DETAILED DESCRIPTION OF THE of patients whose mors do not share the signature of the INVENTION group formed . The group of patients who do not share the 35 signature may share a different signature or they may be a The inventors have developed methods for characterizing mixed population of tumor - bearing patients whose tumors breast and colorectal cancers on the basis of gene signatures. bear a variety of signatures. These signatures comprise one or more genes which are Efficacy can be determined by any of the standard means mutated in a particular cancer . The signatures can be used as known in the art. Any index of efficacy can be used . The a means of diagnosis, prognosis, identification of metastasis , 40 index may be life span , disease free remission period , tumor stratification for drug studies , and for assigning an appro shrinkage , tumor growth arrest, improvement of quality of priate treatment. life, decreased side effects , decreased pain , etc. Any useful According to the present invention a mutation , typically a measure of patient health and well -being can be used . In somatic mutation, can be determined by testing either a addition, in vitro testing may be done on tumor cells that gene, its mRNA ( or derived cDNA ), or its encoded protein . 45 have particular signatures. Tumor cells with particular sig Any method known in the art for determining a somatic natures can also be tested in animal models . mutation can be used . The method may involve sequence Once a signature has been correlated with sensitivity or determination of all or part of a gene, cDNA , or protein . The resistance to a particular therapeutic regimen , that signature method may involve mutation - specific reagents such as can be used for prescribing a treatment to a patient. Thus probes, primers, or antibodies. The method may be based on 50 determining a signature is useful for making therapeutic amplification , hybridization , antibody - antigen reactions, decisions . The signature can also be combined with other primer extension , etc. Any technique or method known in physical or biochemical findings regarding the patient to the art for determining a sequence -based feature may be arrive at a therapeutic decision . A signature need not be the used . sole basis for making a therapeutic decision . Samples for testing may be tissue samples from breast or 55 An anti -cancer agent associated with a signature may be , colorectal tissue or body fluids or products that contain for example, docetaxel, paclitaxel , topotecan , adriamycin , sloughed off cells or genes or mRNA or proteins. Such fluids etoposide , fluorouracil ( 5 - FU ) , or cyclophosphamide . The or products include breast milk , stool , breast discharge, agent may be an alkylating agent ( e.g. , nitrogen mustards) , intestinal fluid . Preferably the same type of tissue or fluid is antimetabolites ( e.g. , pyrimidine analogs ) , radioactive iso used for the test sample and the normal sample . The test 60 topes ( e.g. , phosphorous and iodine ) , miscellaneous agents sample is , however, suspected of possible neoplastic abnor ( e.g. , substituted ureas) and natural products ( e.g. , vinca mality, while the normal sample is not suspect . alkyloids and antibiotics ). The therapeutic agent may be Somatic mutations are determined by finding a difference allopurinol sodium , dolasetron mesylate , pamidronate diso between a test sample and a normal sample of a human . This dium , etidronate , fluconazole, epoetin alfa , levamisole HCL , criterion eliminates the possibility of germ - line differences 65 amifostine, granisetron HCL , leucovorin calcium , sargra confounding the analysis . For breast cancer, the gene ( or mostim , dronabinol, mesna , filgrastim , pilocarpine HCL , cDNA or protein ) to be tested is any of those shown in FIG . octreotide acetate , dexrazoxane, ondansetron HCL , US 10,787,712 B2 5 6 ondansetron , busulfan , carboplatin , cisplatin , thiotepa, mel drugs or dosages of particular drugs ( e.g. , small molecules , phalan HCL , melphalan , cyclophosphamide, ifosfamide, bioengineered proteins , and gene - based drugs such as anti chlorambucil, mechlorethamine HCL , carmustine , lomus sense oligonucleotides, ribozymes, gene replacements, and tine, polifeprosan 20 with carmustine implant, streptozocin , DNA- or RNA - based vaccines ) , including FDA - approved doxorubicin HCL , bleomycin sulfate, daunirubicin HCL , 5 drugs, FDA - approved drugs used for off - label purposes , and dactinomycin , daunorucbicin citrate , idarubicin HCL , experimental agents . Other medical interventions include plimycin , mitomycin , pentostatin , mitoxantrone , valrubicin , nutritional therapy, holistic regimens , acupuncture, medita cytarabine, fludarabine phosphate, floxuridine, cladribine , tion , electrical or magnetic stimulation, osteopathic rem methotrexate, mercaptipurine, thioguanine , capecitabine , edies, chiropractic treatments, naturopathic treatments, and methyltestosterone , nilutamide , testolactone , bicalutamide , 10 exercise . flutamide, anastrozole , toremifene citrate, estramustine Four important points have emerged from our compre phosphate sodium , ethinyl estradiol, estradiol, esterified hensive mutational analysis of human cancer . First , a rela estrogens, conjugated estrogens, leuprolide acetate , goser tively large number of previously uncharacterized CAN elin acetate , medroxyprogesterone acetate , megestrol genes exist in breast and colorectal cancers and these genes acetate , levamisole HCL , aldes leukin , irinotecan HCL , dac- 15 can be discovered by unbiased approaches such as that used arbazine , asparaginase , etoposide phosphate, gemcitabine in our study. These results support the notion that large - scale HCL , altretamine, topotecan HCL , hydroxyurea, interferon mutational analyses of other tumor types will prove useful alpha - 2b , mitotane , procarbazine HCL , vinorelbine tartrate , for identifying genes not previously known to be linked to E. coli L - asparaginase , Erwinia L - asparaginase, vincristine human cancer . sulfate , denileukin diftitox , aldesleukin , rituximab , inter- 20 Second , our results suggest that the number of mutational feron alpha - 2a , paclitaxel , docetaxel , BCG live ( intravesi events occurring during the evolution of human tumors from cal ) , vinblastine sulfate , etoposide, tretinoin , teniposide, a benign to a metastatic state is much larger than previously porfimer sodium , fluorouracil, betamethasone sodium phos thought. We found that breast and colorectal cancers harbor phate and betamethasone acetate , letrozole , etoposide citro an average of 52 and 67 non - synonymous somatic mutations rorum factor, folinic acid , calcium leucouorin , 5 - fluorouricil, 25 in CCDS genes , of which an average of 9 and 12 , respec adriamycin , cytoxan , or diamino - dichloro - platinum . tively , were in CAN - genes. FIG . 11 ( Table S3 ) . These data The signatures of CAN genes according to the present can be used to estimate the total number ofnonsynonymous invention can be used to determine an appropriate therapy mutations in coding genes that arise in a " typical ” cancer for an individual. For example, a sample of a tumor ( e.g. , a through sequential rounds of mutation and selection . Assum tissue obtained by a biopsy procedure , such as a needle 30 ing that the mutation prevalence in genes that have not yet biopsy ) can be provided from the individual, such as before been sequenced is similar to that of the genes so far a primary therapy is administered . The gene expression analyzed , we estimate that there are 81 and 105 mutant profile of the tumor can be determined , such as by a nucleic genes ( average , 93 ) in the typical colorectal or breast cancer, acid array ( or protein array ) technology , and the expression respectively. Of these , an average of 14 and 20 , respectively, profile can be compared to a database correlating signatures 35 would be expected to be CAN - genes. In addition to the with treatment outcomes . Other information relating to the CAN - genes, there were other mutated CCDS genes that human ( e.g. , age , gender, family history, etc. ) can factor into were likely to have been selected for during tumorigenesis a treatment recommendation . A healthcare provider can but were not altered at a frequency high enough to warrant make a decision to administer or prescribe a particular drug confidence in their interpretation . based on the comparison of the CAN gene signature of the 40 A third point emerging from our study is that breast and tumor and information in the database . Exemplary health colorectal cancers show substantial differences in their care providers include doctors , nurses , and nurse practitio mutation spectra . In colorectal cancers , a bias toward C : G to ners . Diagnostic laboratories can also provide a recom T : A transitions at 5 ' - CpG - 3 ' sites has been previously noted mended therapy based on signatures and other information in TP53 ( 42 ) . Our results suggest that this bias is genome about the patient. 45 wide rather than representing a selection for certain nucleo Following treatment with a primary cancer therapy, the tides within TP53 . This bias may reflect a more extensive patient can be monitored for an improvement or worsening methylation of 5 ' - CpG - 3 ' dinucleotides in colorectal cancers of the cancer. A tumor tissue sample ( such as a biopsy ) can than in breast cancers or the effect of dietary carcinogens be taken at any stage of treatment . In particular, a tumor ( 43 , 44 ) . In breast cancers , the fraction of mutations at tissue sample can be taken upon tumor progression , which 50 5 ' - TpC - 3 ' sites was far higher in the CCDS genes examined can be determined by tumor growth or metastasis . A CAN in this study than previously reported for TP53 ( 37 ) . It has gene signature can be determined , and one or more second been noted that a small fraction of breast tumors may have ary therapeutic agents can be administered to increase , or a defective repair system , resulting in 5 ' - TpC - 3 ' mutations restore , the sensitivity of the tumor to the primary therapy . ( 15 ) . Our studies confirm that some breast cancers have Treatment predictions may be based on pre - treatment 55 higher fractions of 5 '- TpC -3 ' mutations than others, but also gene signatures. Secondary or subsequent therapeutics can show that mutations at this dinucleotide are generally more be selected based on the subsequent assessments of the frequent than in colorectal cancers ( FIGS . 6 and 11 ; Tables patient and the later signatures of the tumor. The patient will 2 and S3 ) . typically be monitored for the effect on tumor progression . Finally, our results reveal that there are substantial dif A medical intervention can be selected based on the 60 ferences in the panel of CAN - genes mutated in the two identity of the CAN gene signature . For example, individu tumor types ( FIG . 7 ; Table 3 ) . For example , metalloprotei als can be sorted into subpopulations according to their nase genes were mutated in a large fraction of colorectal but genotype. Genotype - specific drug therapies can then be only in a small fraction of breast cancers ( FIGS . 13 and 14 ; prescribed . Medical interventions include interventions that Tables S5 and 56 ) . Transcriptional regulator genes were are widely practiced , as well as less conventional interven- 65 mutated in a high fraction of both breast and colorectal tions . Thus, medical interventions include, but are not lim tumors, but the specific genes affected varied according to ited to , surgical procedures, administration of particular tumor type ( FIG . 7 ; Table 3 ) . There was also considerable US 10,787,712 B2 7 8 heterogeneity among the CAN -genes mutated in different it will be important to apply rigorous approaches to identify tumor specimens derived from the same tissue type ( FIGS . those mutations that have been selected for during tumori 12-14 ; Tables S4 , S5 , and S6 ) . It has been documented that genesis. Statistical techniques, such as those used in this virtually all biochemical , biological , and clinical attributes study or described by Greenman et al . ( 11 ) , can provide are heterogeneous within human cancers of the same histo- 5 strong evidence for selection of mutated genes. These logic subtype ( 45 ) . Our data suggest that differences in the approaches are likely to improve as more cancer genomic CAN - genes mutated in various tumors could account for a sequencing data is accumulated through The Cancer major part of this heterogeneity. This might explain why it Genome Atlas Project ( 47 ) and other projects now under has been so difficult to correlate the behavior, prognosis , or way . response to therapy of common solid tumors with the 10 ( iv ) There has been much discussion about which genes presence or absence of a single gene alteration ; such altera should be the focus of future sequencing efforts . Our results tions reflect only a small component of each tumor's muta suggest that many genes not previously implicated in cancer tional composition . On the other hand , disparate genes are mutated at significant levels and may provide novel clues contributing to cancer are often functionally equivalent, to pathogenesis . From these data , it would seem that large affecting net cell growth through the same molecular path- 15 scale unbiased screens of coding genes may be more infor way ( 1 ) . Thus, TP53 and MDM2 mutations exert compa mative than screens based on previously defined criteria . rable effects on cells , as do mutations in RB 1 , CDKN2A ( v ) The results also raise questions about the optimum ( p16 ) , CCND1 and CDK4 . It will be of interest to determine number of tumors of any given type that should be assessed whether a limited number of pathways include most CAN in a cancer genome study. Our study was designed to genes, a possibility consistent with the groupings in FIG . 2 20 determine the nature and types of alterations present in an and FIG . 7 ( Table 3 ) . “ average ” breast or colorectal cancer and to discover genes Like a draft version of any genome project, our study has mutated at reasonably high frequencies. Our power to detect limitations . First , only genes present in the current version of genes mutated in more than 20 % of tumors of a given type CCDS were analyzed . There are ~ 5000 genes for which was 90 % , but only 50 % of genes mutated in 6 % of tumors excellent supporting evidence exists but are not yet included 25 would have been discovered . To detect genes mutated in 6 % in the CCDS database ( 46 ) . Second , we were not able to or 1 % of tumors with > 99 % probability in a Discovery successfully sequence ~ 10 % of the bases within the coding Screen would require sequence determination of at least 75 sequences of the 13,023 CCDS genes ( equivalent to 1,302 or 459 tumors , respectively . Though it will be impossible to unsequenced genes ) . Third , although our screen would be detect all mutations that may occur in tumors , strategies that expected to identify the most common types of mutations 30 would identify the most important ones at an affordable cost found in cancers , some genetic alterations, including muta can be envisioned on the basis of the data and analysis tions in non - coding genes , mutations in non - coding regions reported herein . of coding genes , relatively large deletions or sertions , ( vi ) Ultimately, the sequences of entire cancer genomes , amplifications, and translocations, would not be detectable including intergenic regions , will be obtainable . Our studies by the methods we used . Future studies employing a com- 35 demonstrate the inherent difficulties in determining the bination of different technologies, such as those envisioned significance of somatic mutations, even those that alter the by The Cancer Genome Atlas Project ( TCGA) ( 47 ) , will be amino acid sequence of highly - annotated and well - studied able to address these issues . genes. Establishing the significance of mutations in non The results of this study inform future cancer genome coding regions of the genome will likely be much more sequencing efforts in several important ways. 40 difficult. Until new tools for solving this problem become ( i ) A major technical challenge of such studies will be available, it is likely that gene -centric analyses of cancer will discerning somatic mutations from the large number of be more useful. sequence alterations identified . In our study, 557,029 non Our results provide a large number of future research synonymous sequence alterations were detected in the Dis opportunities in human cancer . For genetics, it will be of covery Screen but after subsequent analyses only 0.23 % of 45 interest to elucidate the timing and extent of CAN - gene these were identified as legitimate somatic mutations ( FIG . mutations in breast and colorectal cancers , whether these 1 ) . Less than 10 % of nonsynonymous alterations were genes are mutated in other tumor types, and whether germ known polymorphisms; many of the rest were uncommon line variants in CAN - genes are associated with cancer germ - line variants or sequence artifacts that were not repro predisposition . For immunology, the finding that tumors ducible . Inclusion of matched normal samples and sequenc- 50 contain an average of ~ 90 different amino acid substitutions ing both strands of each PCR product would reduce false not present in any normal cell can provide novel approaches positives in the Discovery Screen but would increase the to engender anti - tumor immunity . For epidemiology, the cost of sequencing by four - fold . Although recently devel remarkable difference in mutation spectra of breast and oped sequencing methods could reduce the cost of such colorectal cancers suggests the existence of organ -specific studies in the future ( 48 ) , the higher error rates of these 55 carcinogens. For cancer biology, it is clear that no current approaches may result in an even lower ratio of bona fide animal or in vitro model of cancer recapitulates the genetic somatic mutations to putative alterations. landscape of an actual human tumor. Understanding and ( ii ) Another technical issue is that careful design of capturing this landscape and its heterogeneity may provide primers is important to eliminate sequence artifacts due to models that more successfully mimic the human disease . For the inadvertent amplification and sequencing of related 60 epigenetics, it is possible that a subset of CAN - genes can genes . The primer pairs that resulted in successful amplifi also be dysregulated in tumors through changes in chromatin cation and sequencing represent a valuable resource in this or DNA methylation rather than through mutation . For regard . Even with well - designed primers, it is essential to diagnostics, the CAN -genes define a relatively small subset examine any observed mutation to ensure that it is not found of genes that could prove useful as markers for neoplasia . as a normal variant in a related gene . 65 Finally , some of these genes , particularly those on the cell ( iii ) Although it is likely that studies of other solid tumor surface or those with enzymatic activity , may prove to be types will also identify a large number of somatic mutations, good targets for therapeutic development. US 10,787,712 B2 9 10 The above disclosure generally describes the present of each exon included all coding bases as well as the four invention . All references disclosed herein are expressly intronic bases at both the 5 ' and 3 ' ends that serve as the incorporated by reference . A more complete understanding major splice recognition sites . In order for an amplicon to be can be obtained by reference to the following specific considered successfully analyzed , we required that > 90 % of examples which are provided herein for purposes of illus- 5 bases in the target region have a Phred quality score ( defined tration only, and are not intended to limit the scope of the as –10 [ log1o ( raw per -base error ) ]) of at least 20 in at least invention . three quarters of the tumor samples analyzed ( 8 ) . This quality cutoff was chosen to provide high sensitivity for EXAMPLES mutation detection while minimizing false positives. Using 10 these criteria, 93 % of the 135,483 amplicons and 91 % of the To begin the systematic study of the cancer genome , we total targeted bases in CCDS were successfully analyzed for have examined a major fraction of human genes in two potential alterations. common tumor types , breast and colorectal cancers . These Examination of sequence traces from these amplicons cancers were chosen for study because of their substantial revealed a total of 816,986 putative nucleotide changes . As clinical significance world -wide : together, they account for 15 the vast majority of changes that did not affect the amino ~ 2.2 million cancer diagnoses ( 20 % of the total ) and 940 , acid sequence ( i.e. , synonymous or silent substitutions) were 000 cancer deaths each year ( 14 % of the total ) ( 5 ) . For likely to be non - functional, these changes were not analyzed genetic evaluation of these tumors , we focused on a set of further . The remaining 557,029 changes could represent protein coding genes, termed the consensus coding germline variants, artifacts of PCR or sequencing, or bona sequences ( CCDS) that represent the most highly curated 20 fide somatic mutations . Several bioinformatic and experi gene set currently available ( 6 ) . The CCDS database con mental steps were employed to distinguish among these tains full - length protein coding genes that have been defined possibilities . First , any alterations that were also present in by extensive manual curation and computational processing either of the two normal samples included in the Discovery and have gene annotations that are identical among refer Screen were removed , as these were likely to represent ence databases . 25 common germline polymorphisms or sequence artifacts . The goals of this study were three - fold : ( i ) to develop a Second , as these two normal control samples would be methodological strategy for conducting genome -wide analy expected to contain only a subset of known variants, any ses of cancer genes in human tumors ; ( ii ) to determine the change corresponding to a validated germline polymor spectrum and extent of somatic mutations in human tumors phism found in single nucleotide polymorphism ( SNP ) of similar and different histologic types; and ( iii ) to identify 30 databases was also removed ( 7 ) . Finally , the sequence trace new cancer genes and molecular pathways that could lead to of each potential alteration was visually inspected in order to improvements in diagnosis or therapy. remove false positive calls in the automated analysis. The combination of these data analysis efforts was efficient, Example 1- Cancer Mutation Discovery Screen removing -96 % of the potential alterations and leaving 35 29,281 for further scrutiny ( FIG . 1 ) . The initial step toward achieving these goals was the To ensure that the observed mutations did not arise development of methods for high -throughput identification artifactually during the PCR or sequencing steps , the regions of somatic mutations in cancers . These methods included containing them were independently re -amplified and re those for primer design , polymerase chain reaction ( PCR ) , sequenced in the corresponding tumors. This step removed sequencing, and mutational analysis ( FIG . 1 ). The first 40 9,295 alterations . The regions containing the putative muta component involved extraction of all protein coding tions were then sequenced in matched normal DNA samples sequences from the CCDS genes . A total of 120,839 non to determine whether the mutations were truly somatic : redundant exons and adjacent intronic sequences were 18,414 changes were observed to be present in the germline obtained from 14,661 different transcripts in CCDS . These of these patients, representing variants not currently anno sequences were used to design primers for PCR amplifica- 45 tated in SNP databases, and were excluded . As a final step , tion and sequencing of exons and adjacent splice sites . the remaining 1,572 putative somatic mutations were care Primers were designed using a number of criteria to ensure fully examined in silico to ensure that the alterations did not robust amplification and sequencing of template regions ( 7 ) . arise from mistargeted sequencing of highly related regions While most exons could be amplified in a single PCR occurring elsewhere in the genome ( 7 ) . Alterations in such reaction, we found that exons larger than 350 bp were more 50 duplicated regions may appear to be somatic when there is effectively amplified as multiple overlapping amplicons . loss of one or both alleles of the target region in the tumor One member of every pair of PCR primers was tailed with and when the selected primers closely match and therefore a universal primer sequence for subsequent sequencing amplify similar areas of the genome . A total of 265 changes reactions . A total of 135,483 primer pairs encompassing ~ 21 in closely related regions were excluded in this fashion , Mb of genomic sequence were designed in this manner 55 resulting in a total of 1,307 confirmed somatic mutations in ( FIG . 8 ; Table Sl ) . 1,149 genes ( FIG . 5 ; Table 1 ) . Eleven cell lines or xenografts of each tumor type ( breast and colorectal carcinomas) were used in the Discovery Example 2 — Validation Screen Screen ( FIGS . 9-10 ; Tables S2A and S2B ) . Two matching normal samples were used as controls to help identify 60 To evaluate the prevalence and spectrum of somatic normal sequence variations and amplicon - specific sequenc mutations in these 1,149 genes , we determined their ing artifacts such as those associated with GC - rich regions. sequence in additional tumors of the same histologic type A total of ~ 3 million PCR products were generated and ( FIGS . 1 , 9 , 10 ; Tables S2A and S2B ) . Genes mutated in at directly sequenced , resulting in 465 Mb of tumor sequence. least one breast or colorectal tumor in the Discovery Screen Sequence data were assembled for each amplicon and 65 were analyzed in 24 additional breast or colorectal tumors , evaluated for quality within the target region using software respectively. This effort involved 453,024 additional PCR specifically designed for this purpose ( 7 ) . The target region and sequencing reactions, encompassing 77 Mb of tumor US 10,787,712 B2 11 12 DNA . A total of 133,693 putative changes were identified in 1,672 mutations ( FIG . 5 ; Table 1 ) , many more than what the Validation Screen . Methods similar to those employed in would have been predicted to occur by chance ( P < 1x10-10 ) the Discovery Screen were used to exclude silent changes , ( 7 ) . Moreover, the frequency of mutations in the Validation known and novel germline variants, false positives arising Screen was significantly higher than in the Discovery Screen from PCR or sequencing artifacts, and apparent changes that 5 ( 5.8 versus 3.1 mutations per Mb, P < 1x10-10 , FIG . 5 ; Table were likely due to co - amplification of highly related genes . 1 ) . The mutations in the Validation Screen were also Additionally , any changes corresponding to germline vari enriched for nonsense , insertion , deletion, duplication , and ants not found in SNP databases but identified in the splice site changes compared to the Discovery Screen ; each Discovery Screen were excluded . The regions containing the of these would be expected to have a functional effect on the remaining 4,948 changes were re - amplified and re - se- 10 encoded proteins. quenced in the corresponding tumors ( to ensure reproduc To distinguish genes likely to contribute to tumorigenesis ibility ) and in matched normal tissue to determine if they from those in which passenger mutations occurred by were somatic . An additional 365 somatic mutations in 236 chance , we first excluded genes that were not mutated in the genes were identified in this manner. In total , 921 and 751 Validation Screen . We next developed statistical methods to somatic mutations were identified in breast and colorectal 15 estimate the probability that the number of mutations in a cancers , respectively ( FIGS . 1 , 5 , and 12 ; Tables 1 and S4 ) . given gene was greater than expected from the background mutation rate . For each gene , this analysis incorporated the Example 3 — Mutation Spectrum number of somatic alterations observed in either the Dis covery or Validation Screen , the number of tumors studied , The great majority of the 1,672 mutations observed in the 20 and the number of nucleotides that were successfully ana Discovery or Validation Screens were single base substitu lyzed ( as indicated by the number of bases with Phred tions : 81 % of the mutations were missense , 7 % were non quality scores 20 ). Because the mutation frequencies var sense , and 4 % altered splice sites ( FIG . 5 ; Table 1 ) . The ied with nucleotide type and ext and were different in remaining 8 % were insertions, deletions, and duplications breast versus colorectal cancers ( FIG . 6 ; Table 2 ) , these ranging from one to 110 nucleotides in length . Though the 25 factors were included in the calculations . The output of this fraction of mutations that were single base substitutions was analysis was a cancer mutation prevalence ( CAMP ) score for similar in breast and colorectal cancers, the spectrum and each gene analyzed . The CaMP score reflects the probability nucleotide contexts of the substitution mutations were very that the number of mutations actually observed in a gene is different between the two tumor types. The most striking of higher than that expected to be observed by chance given the these differences occurred at C : G base pairs : 59 % of the 696 30 background mutation rate ; its derivation is based on prin colorectal cancer mutations were C : G to T : A transitions ciples described in the Supporting Online Material. The use while only 7 % were C : G to G : C transversions ( FIGS . 6 and of the CaMP score for analysis of somatic mutations is 11 ; Tables 2 and S3 ) . In contrast, only 35 % of the mutations analogous to the use of the LOD score for linkage analysis in breast cancers were C : G to T : A transitions, while 29 % in familial genetic settings . For example, 90 % of the genes were C : G to G : C transversions. In addition , a large fraction 35 with CaMP scores > 1.0 are predicted to have mutation fre ( 44 % ) of the mutations in colorectal cancers were at 5 '- CpG quencies higher than the background mutation frequency. 3 ' dinucleotide sites but only 17 % of the mutations in breast cancers occurred at such sites . This 5 ' - CpG - 3 ' preference led Example 5 Candidate Cancer Genes to an excess of nonsynonymous mutations resulting in changes of arginine residues in colorectal cancers though not 40 A complete list of the somatic mutations identified in this in breast cancers ( FIG . S1 ) . In contrast, 31 % of mutations in study is provided in FIG . 12 ; Table S4 . Validated genes with breast cancers occurred at 5 ' - TpC - 3 ' sites ( or complementary CaMP scores greater than 1.0 were considered to be candi 5 - GpA - 3 ' sites ) , while only 11 % of mutations in colorectal date cancer genes ( CAN - genes ). The combination of experi cancers occurred at these dinucleotide sites . The differences mental validation and statistical calculation thereby yielded noted above were all highly significant ( P < 0.0001 ) ( 7 ) and 45 four nested sets of genes : of 13,023 genes evaluated , 1,149 have substantial implications for the mechanisms underlying were mutated , 242 were validated , and 191 were CAN mutagenesis in the two tumor types . genes. Among these , the CAN - genes were most likely to have been subjected to mutational selection during tumori Example 4 Distinction Between Passenger and genesis. There were 122 and 69 CAN - genes identified in Non - Passenger Mutations 50 breast and colorectal cancers , respectively ( FIGS . 13 and 14 ; Tables S5 and S6 ) . Individual breast cancers examined in the Somatic mutations in human tumors can arise either Discovery Screen harbored an average of 12 ( range 4 to 23 ) through selection of functionally important alterations via mutant CAN - genes while the average number of CAN their effect on net cell growth or through accumulation of genes in colorectal cancers was 9 ( range 3 to 18 ) ( FIG . 11 ; non - functional “ passenger ” alterations that arise during 55 Table S3 ) . Interestingly, each cancer specimen of a given repeated rounds of cell division in the tumor or in its tumor type carried its own distinct CAN - gene mutational progenitor stem cell . In light of the relatively low rates of signature, as no cancer had more than six mutant CAN mutation in human cancer cells ( 9 , 10 ) , distinction between genes in common with any other cancer ( FIGS . 12-14 ; selected and passenger mutations is generally not required Tables S4 , S5 , and S6 ) . when the number of genes and tumors analyzed is small . In 60 CAN - genes could be divided into three classes : ( a ) genes large - scale studies , however, such distinctions are of para previously observed to be mutationally altered in human mount importance ( 11 , 12 ) . For example, it has been esti cancers ; ( b ) genes in which no previous mutations in human mated that nonsynonymous passenger mutations are present cancers had been discovered but had been linked to cancer at a frequency no higher than ~ 1.2 per Mb of DNA in through functional studies ; and ( c ) genes with no previous cancers of the breast or colon ( 13-15 ) . As we assessed 542 65 strong connections to neoplasia . Mb of tumor DNA , we would therefore have expected to ( a ) The re - identification of genes that had been previously observe -650 passenger mutations. We actually observed shown to be somatically mutated in cancers represented a US 10,787,712 B2 13 14 critical validation of the approach used in this study. All of and an additional 12 genes had clustering of multiple the CCDS genes previously shown to be mutated in > 10 % mutations within a specific protein domain ( 13 to 78 amino of either breast or colorectal cancers were found to be acids apart ). Thirty - one of 40 of these changes affected CAN - genes in the current study. These included TP53 ( 2 ) , residues that were evolutionarily conserved . Although the APC ( 2 ) , KRAS ( 2 ) , SMAD4 ( 2 ) , and FBXW7 ( CDC4 ) ( 16 ) 5 effects of these alterations are unknown, their clustering ( FIGS . 12-14 ; Tables S4 , S5 and 56 ) . In addition, we suggests specific roles for the mutated regions in the neo identified mutations in genes whose mutation prevalence in plastic process. sporadic cancers was rather low . These genes included EPHA3 ( 17 ) , MRE11A ( 18 ) , NF1 ( 2 ) , SMAD2 ( 19 , 20 ) , Example 6 - CAN -Gene Groups SMAD3 ( 21 ) , TCF7L2 ( TCF4 ) ( 22 ) , BRCA1 ( 2 ) and TGF- 10 BRII ( 23 ) . We also detected mutations in genes that had been An unbiased screen of a large set of genes can provide previously found to be altered in human tumors but not in insights into pathogenesis that would not be apparent the same tumor type identified in this study. These included through single gene mutational analysis. This has been guanine nucleotide binding protein , alpha stimulating exemplified by large scale mutagenesis screens in experi GNAS ( 24 ) , kelch - like ECH - associated protein KEAP1 15 mental organisms ( 39-41 ) . We therefore attempted to assign ( 25 ) , RET proto - oncogene ( 2 ) , and transcription factor each CAN - gene to a functional group based on Gene Ontol TCF1 ( 26 ) . Finally , we found mutations in a number of ogy ( GO ) Molecular Function or Biochemical process genes that have been previously identified as targets of groups , the presence of specific INTERPRO sequence translocation or amplification in human cancers . These domains , or previously published literature ( FIG . 7 ; Table 3 ) included nucleoporin NUP214 ( 2 ) , kinesin receptor KTN1 20 and ( FIG . 2 ) . Several of the groups identified in this way ( 27 ) , DEAD box polypeptide 10 DDX10 ( 28 ) , glioma were of special interest. For example , 22 of the 122 ( 18 % ) associated oncogene homolog 1 GLII ( 29 ) , and the trans breast CAN -genes and 13 of the 69 ( 19 % ) colorectal CAN location target gene of the runt related transcription factor 1 genes were transcriptional regulators . At least one of these RUNX1T1 ( MTG8 ) ( 2 ) . We conclude that if these genes had genes was mutated in more than 80 % of the tumors of each not already been demonstrated to play a causative role in 25 type. Zinc - finger transcription factors were particularly human tumors , they would have been discovered through highly represented ( 8 genes mutated collectively in 43 % of the approach taken in this study. By analogy, the 176 other breast cancer samples ). Similarly, genes involved in cell CAN - genes in FIGS . 13 and 14 ( Tables S5 and S6 ) are likely adhesion represented ~ 22 % of CAN - genes and affected to play important roles in breast, colorectal, and perhaps more than two thirds of tumors of either type. Genes other types of cancers . 30 involved in signal transduction represented ~ 23 % of CAN ( b ) Although genetic alterations currently provide the genes and at least one such gene was mutated in 77 % and most reliable indicator of a gene's importance in human 94 % of the breast and colorectal cancer samples, respec neoplasia ( 1 , 30 ) , there are many other genes which are tively . Subsets of these groups were also of interest and thought to play key roles on the basis of functional or included metalloproteinases (part of the cell adhesion and expression studies. Our study provides genetic evidence 35 motility group and mutated in 37 % of colorectal cancers ), supporting the importance of several of these genes in and G proteins and their regulators (part of the signal neoplasia . For example, we discovered intragenic mutations transduction group and altered in 43 % of breast cancers ). in the ephrin receptor EPHB6 ( 31 ) , mixed - lineage leukemia These data suggest that dysregulation of specific cellular 3 gene ( MLL3 ) ( 32 ) , gelsolin GSN ( 33 ) , cadherin genes processes are genetically selected during neoplasia and that CDH10 and CDH20 , actin and SMAD binding protein 40 distinct members of each group may serve similar roles in filamin B FLNB ( 34 ) , protein tyrosine phosphatase receptor different tumors . PTPRD ( 35 ) , and autocrine motility factor receptor AMER ( 36 ) . Example 7 - Materials and Methods ( c ) In addition to the genes noted above , our study revealed a large number of genes that had not been strongly 45 Gene Selection . suspected to be involved in cancer . These included polycys The Consensus Coding DNA Sequence database ( CCOS ) tic kidney and hepatic disease 1 gene PKHD1 , guanylate represents a highly curated collection of 14,795 transcripts cyclase 1 GUCY1A2, transcription factor TBX22 , exocyst from 13,142 genes (www.ncbi.nlm.nih.gov/CCOSI ) . For complex component SEC8L1 , tubulin tyrosine ligase inclusion in CCOS , genomic coordinates defining the tran TTLL3 , ATP -dependent transporter ATP8B1, intrinsic fac- 50 script coding sequence must be identical in Ensembl and tor - cob alamin receptor CUBN , actin binding protein DBN1 , RefSeq databases . The transcripts must have canonical start and tectorin alpha TECTA . In addition, seven CAN - genes and stop codons and consensus splice sites , not have in corresponded to genes for which no biologic role has yet frame stop codons , and be translatable from the reference been established . genome sequence without frameshifts . Finally , CCOS tran We examined the distribution of mutations within CAN- 55 scripts must be supported by transcript and protein homol gene products to see if clustering occurred in specific ogy and inter - species conservation . We examined all CCOS regions or functional domains . In addition to the well transcripts and excluded those that were located at multiple documented hotspots in TP53 ( 37 ) and KRAS ( 38 ) , we locations in the genome through gene duplication ( 113 identified three mutations in GNAS in colorectal cancers transcripts ) or were present on the Y chromosome ( 21 that affected a single amino acid residue ( R201 ) . Alterations 60 additional transcripts ) ( FIG . 51 ) . The remaining 14,661 of this residue have previously been shown to lead to CCOS transcripts from 13,023 genes were selected for constitutive activation of the encoded G protein as through mutational analysis . inhibition of GTPase activity ( 24 ) . Two mutations in the Bioinformatic Resources . EGF - like gene EGFL6 in breast tumors affected the same CCOS gene and transcript coordinates ( release 1 , 3 / 02 / nucleotide position and resulted in a L508F change in the 65 05 ) , human genome sequences , and single nucleotide poly MAM adhesion domain . A total of seven genes had altera morphisms were obtained from the UCSC Santa Cruz tions located within five amino acid residues of each other, Genome Bioinformatics Site ( http://genome.ucsc.edu ). US 10,787,712 B2 15 16 Homology searches in the human and mouse genomes were Whole Genome Amplification . performed using the BLAST - like alignment tool BLAT ( S1 ) Whole genome amplification was used to provide suffi and In Silico PCR ( http://qenome.ucsc.edu/cqi-bin/hqPcr ). cient quantities of DNA for the Validation Screen . Briefly , All genomic positions correspond to UCSC Santa Cruz hg17 5-20 ng template DNA was denatured with 5 M KOH , build 35.1 human genome sequence . The -3.4 M SNPs of 5 neutralized and incubated at 30 ° C. for 16-24 hours with 4x dbSNP ( release 125 ) that have been validated through the REPLI - g buffer and REPLI - g DNA polymerase according to HapMap project ( S2 ) were used for automated removal of the manufacturer's instructions ( Qiagen , Valencia , Calif. ). known polymorphisms . Samples were incubated at 65 ° C. for 3 min to inactivate the Primer Design enzyme before storage at 20 ° C. For each sample , a mini For each transcript, genomic sequences comprising the 10 mum of 5 independent WGA reactions were pooled to entire coding region of each exon as well as flanking intronic reduce the effects of any allelic or locus bias that may have sequences and 5 ' UTR and 3 ' UTR sequences were occurred during amplification . extracted . Primer pairs for PCR amplification and sequenc Confirmation of Sample Identity. ing of each coding exon were generated using Primer3 DNA sample identities were monitored throughout the ( http://frodo.wi.mit.edu/cqi-bin/primer3/primer3 www.cqi ) 15 Discovery and Validation Screens by PCR amplification and ( S3 ) . Forward and reverse PCR primers were required to be sequencing of exon 3 of the major histocompatibility com located no closer than 50 bp to the target exon boundaries, plex gene HLA - A ( forward primer 5 ' -CGCCTTTACCCG and genomic positions with known polymorphisms were GTTTCATT - 3 ', SEQ ID NO : 2 ; reverse primer 5 ' - CCAAT avoided in the five 3 ' - most bases of the primers . Exons larger TGTCTCCCCTCCTTG - 3 ' , SEQ ID NO : 3 ) . In addition , than 350 bp were analyzed as multiple overlapping ampli- 20 matching of all tumor - normal pairs was confirmed by typing cons . PCR products were designed to range in size from 300 nine STR loci ( TPDX , chr 2p23 - ter , D3S1358 , chr3p; FGA, to 600 bp , which was considered optimal for amplification , chr4q28 ; D8S1179 , chr8 ; TH01 , chr11 p15.5 ; VWA , purification , and sequencing. To minimize amplification of chr12p12 - ter ; Penta E , chr15q ; D18551 , chr18q21.3 ; 021 homologous genomic sequences , primer pairs were filtered S11 , chr21 q11-21 ) using the PowerPlex 2.1 System (Pro using UCSC In Silico PCR and only pairs yielding a single 25 mega , Madison , Wis . ). product were used . 0.33 Mb ( -1.5 % ) of target genomic PCR Amplification and Sequencing. sequence was excluded from further analysis due to a lack All primers were synthesized by Invitrogen ( San Diego , of suitable amplification and sequencing primers . A total of Calif. ). PCR was performed in 5 III reactions containing 135,483 primer pairs encompassing -21 Mb of target 1xPCR Buffer ( 67 mM TrisHCI, pH 8.8 , 6.7 mM MgCb , sequence were successfully designed . A universal sequenc- 30 16.6 mM NH4S04 , 10 mM 2 -mercaptoethanol ) , 1 mM ing primer ( M13 forward, 5'GTAAAACGACGGCCAGT dNTPs ( Invitrogen , San Diego , Calif .) , 1 11M forward and 3 ' ; SEQ ID NO : 1 ) was appended to the 5 ' end of the primer 1 11M reverse primers, 6 % DMSO , 2 mM ATP , 0.25 U in the pair with the smallest number of mono- and dinucle Platinum Taq ( Invitrogen , San Diego , Calif. ) and 3 ng DNA . otide repeats between itself and the target exon . Primer Reactions were carried out in 384 - well AB19700 thermocy sequences are listed in FIG . 8 ; Table Si . 35 clers ( Applied Biosystems, Foster City, Calif. ) using a Tumor Samples. touchdown PCR protocol ( 1 cycle of 96 ° C. for 2 min ; 3 DNA samples from ductal breast carcinoma cell lines and cycles of 96 ° C. for 10 see , 64 ° C. for 10 see , 70 ° C. for 30 matched normal mammary tissue or peripheral blood lines see ; 3 cycles of 96 ° C. for 10 see , 61 ° C. for 10 see , 70 ° C. were obtained from American Type Culture Collection (Ma for 30 see ; 3 cycles of 96 ° C. for 10 see , 58 ° C. for 10 see , nassas , Va .) or from A. Gazdar ( S4 , S5 ) . Primary breast 40 70 ° C. for 30 see ; 41 cycles of 96 ° C. for 10 see , 57 ° C. for tumor and surrounding normal surgical tissue specimens 10 see , 70 ° C. for 30 see ; 1 cycle of 70 ° C. for 5 min ). isolated from node positive patients at Palmetto Health Templates were purified using AMPure (Agencourt Biosci Richland or Baptist Hospitals were obtained through the ences , Beverly, Mass . ) and sequencing carried out with M13 South Carolina Cancer Center Tissue Bank . Each tissue forward primer ( 5 '- GTAAAACGACGGCCAGT - 3 '; SEQ ID sample was flash frozen within 30 minutes of excision , and 45 NO : 1 ) and Big Dye Terminator Kit v.3.1 ( Applied Biosys stored at -80 ° C. Surgically removed colorectal tumors were tems , Foster City, Calif .) . 1 % DMSO was included in disaggregated and implanted into nude mice or into in vitro sequencing reactions when the GC content of the template culture conditions as described previously ( S6 , 57 ) . DNA exceeded 65 % . Dye terminators were removed using the was prepared within 3 passages after xenograft establish CleanSEQ kit ( Agencourt Biosciences, Beverly , Mass .) and ment. Characteristics of the tumor samples used in this study 50 sequence reactions were delineated on ABI PRISM 3730xl are listed in FIGS . 9-10 ; Tables S2A and S2B . No tumor sequencing apparatuses (Applied Biosystems , Foster City, used in this study was mismatch repair deficient as assessed Calif. ). with standard microsatellite markers ( S8 ) ; such tumors were Sequence Assembly and Analysis of Mutations. excluded because of their much higher background mutation Sequence traces from tumor and normal DNA samples rates . All samples were obtained in accordance with the 55 were aligned to the genomic reference sequences . To con Health Insurance Portability and Accountability Act sider an amplicon successfully sequenced , at least three (HIPAA ) . quarters of the tumors were required to have 2 ' : 90 % of the Laser Capture Microdissection . bases in the target region with a Phred quality score of 20 or 20 um sections of snap frozen primary breast tumor better . Amplicons not meeting these criteria were not ana tissues embedded in OCT were deposited on Sigma Silane- 60 lyzed further. Mutational analysis was performed for all PrepTM slides and stained with hematoxylin and eosin . coding exonic sequences and the flanking 4 bp of intronic or Tumor cells were separated from surrounding tissue and UTR sequences using Mutation Surveyor ( Softgenetics , recovered on transfer film by laser - capture microdissection State College , Pa . ) coupled to a relational database (Micro ( PixCell® lie , Arcturus ). Genomic DNA was purified from soft SQL Server ). For both Mutation Discovery and Valida approximately 20 slides for each sample using the QiagenTM 65 tion Screens, the following basic steps were employed to QIAamp® DNA Micro kit according to the manufacturer's identify mutations of interest. First , synonymous changes protocol. were identified and excluded from further analysis. Second , US 10,787,712 B2 17 18 nonsynonymous changes in tumor samples were discarded if can be useful predictors of genes that had undergone selec an identical change was present in a normal DNA sample . tion , as it can be assumed that synonymous mutations are Third , known single nucleotide polymorphisms were generally nonfunctional ( 511-515 ) . However, relatively few removed by comparison to a database of dbSNP entries mutations were detected in most genes in many of the previously validated by the Hap Map project. Finally, false 5 tumors we studied , leading to wide confidence limits in this positive artifacts were eliminated by visual inspection of parameter. We therefore used a combination of experimental chromatograms for each sample with a putative mutation . validation and an estimate of the background mutation rate Additional steps are described below . to identify those genes most likely to have undergone selection . Mutation Discovery Screen . 10 Primers designed above were used to amplify all known To correct for the influence of nucleotide composition on CCDS exons from 11 colorectal cancer samples, 11 breast the likelihood of mutation , we assumed that the mutation cancer samples, and two matched normal DNA samples. spectrum observed in the current study was no different from This resulted in a total of -3.25 million PCR reactions, that of unselected background mutations and that both were acomprising total of 42 465Mb ofMb normal of tumor sequences - derived fromsequences the two as matched well as 15 a result of the sameunderlying processes and exposures to normal DNA samples. Following sequence assembly and exogenous agents. The table below shows the background mutational analysis, each observed putative nonsynonymous mutation frequency per Mb at each of the six nucleotide change was confirmed in an independent PCR reaction using contexts and positions analyzed . For example, in our Dis the same primer pair. Upon confirmation, DNA from a covery and Validation screens in colorectal cancers , we normal tissue of the same patient was used to determine 20 found that mutations at 5 ' - CpG - 3 ' mutations were 6.44 more whether the observed mutation was a true somatic event frequent than the mutation frequency at all positions com rather than a germ line variant . When the same putative bined . The expected background mutation frequency at mutation was observed in multiple tumor samples , only a 5 ' - CpG - 3 ' sites was therefore calculated to be 6.44x1.2 = 7.73 single tumor and matched normal sample were initially used mutations per million bp . to confirm the mutation and its somatic mutation . If con Estimated Background Mutation Frequencies Per Million bp

5 ' - CpG - 3 ' 5 ' - TpC - 3 ' A ? G T INS / DEL / DUP Colorectal 7.73 0.96 0.56 0.95 0.85 0.51 0.55 Breast 2.99 2.48 0.76 1.38 1.07 0.30 0.55 firmed , DNA from the other tumors containing the same For each gene and tumor type , the number of successfully somatic mutation were similarly evaluated . To exclude the sequenced 5 ' -CpG - 3 ' and 5 ' - TpC3' ( or complementary possibility that putative somatic mutations might be caused 35 5 - GPA - 3 ' ) dinucleotide sites and A , C , T, and G mononucle by amplification of homologous but non - identical otide sites were designated NcpG , NTPC , NA , NC , NG , and sequences , BLAT ( 58 ) was used to search these sequences NT, respectively. N did not include those C's within 5 ' - CpG against the human genome . This examination ensured that or 5 ' - TPC dinucleotides and NG did not include those G's the nucleotide change was not present in a highly related 40 withintions at 5 5' -' CpG- TPC - -33 ' or sites 5'GPA were - 3 nearlydinucleotides always . atNote the thatC residue muta region in the human genome. For putative somatic mutations and mutations at the complementary 5 ' -GPA - 3 ' sites were found in xenografted tumors , BLAT was used to similarly nearly always at the G residue, explaining why the A's and search the mouse genome to exclude the contribution of T's did not need to be corrected for their presence within homologous mouse sequences. dinucleotides. The probability of a gene having the observed Mutation Validation Screen . 45 number of mutations at a particular site was then calculated Every gene found mutated in the Discovery Screen was with an exact binomial distribution . For example , the param further analyzed by amplification and sequencing of 24 eters for this calculation for the 5 ' - CpG - 3 ' category used the additional tumor samples of the same tissue type. Because of observed number of mutations at 5 ' - CpG - 3 ' sites as the limiting amounts of sample DNA , the set of 24 tumors number of positive events, NcpG as the number of indepen evaluated changed over time . All CCDS transcript variants 50 dent trials, and the background mutation frequencies for of the gene of interest were investigated using primer pairs Ncp listed in the table above ( 7.73x10-6 for colorectal that yielded informative sequences in the Discovery Screen . cancers ) as the probability of a positive result in each trial. Mutation detection , confirmation of alterations, and deter The probabilities of a gene having the observed number of mination of somatic status was performed as above , with the mutations at each of the other five dinucleotide or mono exception that all germ line variants previously observed in 55 nucleotides were similarly calculated . The probability of a the normal DNA samples of the Discovery Screen were gene containing the observed number of insertions, dele considered to be known variants ( FIG . 1 ) . tions , or duplications (INS / DEL / DUP ) was calculated by Statistical Analyses. using a binomial distribution with the following parameters: CAMP Scores . observed number of INS / DEL / DUP events as the number of To help identify genes that were mutated more frequently 60 positive events, total nucleotides successfully sequenced than would be expected in the absence of selection , we first within the gene as the number of independent trials, and computed the probability that a given gene was mutated the 0.55x10- as the probability of a positive result in each trial . observed number of times given the background mutation Note that each of these seven probabilities was considered to frequency. The background mutation frequency in breast and be independent. The probability of a gene having the co lorecta I cancers has been previously determined to be 65 observed number of mutations at the observed positions was less than 1.2 mutations per Mb ( 59-511 ) . Comparison of the then calculated to be the product of the seven nucleotide prevalence of synonymous vs. non - synonmyous mutations context - specific probabilities. US 10,787,712 B2 19 20 As 13,023 genes were evaluated for mutations, it was 9. C. Lengauer, K. W. Kinzler, B. Vogelstein , Nature 396 , necessary to correct these probabilities for multiple com 643 ( 1998) . parisons . For this purpose , we used the algorithm described by Benjamini and Hochberg ( S16 ) . The genes were ranked 10. L. A. Loeb , Cancer Res 61 , 3230 ( 2001 ) . in ascending order, assigning a 1 to the gene with the lowest 5 11. C. Greenman , R. Wooster, P. A. Futreal, M. R. Stratton , probability of having the observed number of mutations in D. F. Easton , Genetics 173 , 2187 ( 2006 ) . it , a 2 to the gene with the next lowest probability, etc. The 12. S. E. Kern , J. M. Winter, Cancer Biol Ther 5 , 349 ( 2006 ) . CaMP score for each gene was then defined as -log10 ( 13 , 13. T. L. Wang et al . , Proc Natl Acad Sci USA 99 , 3076 023 * PROB /RANK ), where PROB is the probability of its ( 2002 ) . having the observed number of mutations and RANK rep 10 resents its numerical position in the list . A Microsoft 14. D. Shen et al . , Submitted ( 2006 ) . ExcelTM spreadsheet that automatically calculates CaMP 15. P. Stephens et al . , Nat Genet 37 , 590 ( 2005 ) . scores for individual or multiple genes is available from the 16. H. Strohmaier et al . , Nature 413 , 316 ( 2001 ) . authors upon request. 15 17. A. Bardelli et al . , Science 300 , 949 ( 2003 ) . Statistical Significance of Data in FIGS . 5-6 ( Tables 1 and 18. Z. Wang et al . , Cancer Res 64 , 2998 ( 2004 ) . 2 ) and FIG . 15 ( FIG . S1 ) . To determine whether the observed number of mutations 19. G. J. Riggins , et al . Nat Genet 13 , 347 ( 1996 ) . in the entire set of breast and colorectal cancers differed 20. K. Eppert et al . , Cell 86 , 543 ( 1996 ) . significantly from the expected number of mutations 20 21. J. L. Ku et al . , Cancer Lett ( Jul. 5 , 2006 ) . ( FIG . 5 ; Table 1 ) , a simple binomial distribution test was used , employing a probability of 1.2x10- as the background 22. A. Duval et al . , Cancer Res 59 , 4213 ( 1999 ) . rate . The spectrum of mutations was compared in breast and 23. S. Markowitz et al . , Science 268 , 1336 ( 1995 ) . colorectal cancers ( FIG . 6 ; Table 2 ) using a Chi - Square test . 24. C. A. Landis et al . , Nature 340 , 692 ( 1989 ) . FIGThe . Sl spectrum ) was also of analyzed codons affectedwith a Chiby -mutation Square test (FIG . . 15 ; 25 25. B. Padmanabhan et al. , Mol Cell 21 , 689 (2006 ) . Estimate of Non - Synonymous Mutations in the Cancer 26. O. Bluteau et al . , Nat Genet 32 , 312 ( 2002 ) . Genome . 27. K. Salassidis et al . , Cancer Res 60 , 2786 ( 2000 ) . The total number of genes containing non - synonymous 28. Y. Arai et al . , Blood 89 , 3936 ( 1997 ) . mutations in a typical colorectal or breast cancer was 30 29. K. W. Kinzler et al . , Science 236 , 70 ( 1987 ) . estimated in the following way . Although the actual number of protein coding genes in the human genome is still a matter 30. H. Varmus, Science 312 , 1162 ( 2006 ) . of debate, there are 5180 genes for which excellent support 31. X. X. Tang , G. M. Brodeur, B. G. Campling, N. Ikegaki, ing evidence exists and which are part of RefSeq ( S17 ) but Clin Cancer Res 5 , 455 ( 1999 ) . are not yet included in the CCOS database . We assumed that 35 32. M. Ruault, M. E. Brun , M. Ventura , G. Roizes , A. De the mutation prevalence in genes that have not yet been Sario , Gene 284 , 73 ( 2002 ) . sequenced is similar to that of the genes already sequenced . 33. M. Tanaka et al . , Cancer Res 55 , 3228 ( 1995 ) . Additionally, we were not able to successfully sequence 34. A. Sasaki, Y. Masuda , Y. Ohta , K. Ikeda, K. Watanabe , -10 % of the bases within the coding sequences of the 13,023 40 J Biol Chem 276 , 17871 ( 2001 ) . CCOS genes ( equivalent to 1,302 unsequenced genes ) . We 35. M. Sato et al . , Genes Chromosomes Cancer 44 , 405 thereby estimate that we have successfully sequenced 64 % ( 2005 ) . of the 18,203 protein - encoding genes in the human genome 36. Y. Onishi , K. Tsukada , J. Yokota , A. Raz , Clin Exp ( 13023–1302 ) / ( 13023 + 5180 ) . As we identified an average Metastasis 20 , 51 ( 2003 ) . of 60 mutated genes per tumor in the genes already 45 37. M. Hollstein , D. Sidransky, B. Vogelstein , C. C. Harris, sequenced , 93 genes ( 6010.64 ) would be predicted to be Science 253 , 49 ( 1991 ) . mutated in the entire compendium of protein encoding genes 38. J. L. Bos et al . , Nature 327 , 293 ( 1987 ) . in a typical cancer . 39. R. Brent, Cell 100 , 169 ( 2000 ) . 50 REFERENCES 40. T. Ideker et al . , Science 292 , 929 ( 2001 ) . 41. S. L. Ooi et al . , Trends Genet 22 , 56 ( 2006 ) . The disclosure of each reference cited is expressly incorpo 42. T. Soussi , G. Lozano , Biochem Biophys Res Commun rated herein . 331 , 834 ( 2005 ) . 2.1. B.P. A.Vogelstein Futreal ,et K. al W. . , NatureKinzler Rev, Nature Cancer Med 4 , 10177 , 789 ( 2004 (2004 ) . ). 55 43. M. Olivier, S. P. Hussain, C. Caron de Fromentel, P. 3. A. Bardelli, V. E. Velculescu , Curr Opin Genet Dev 15,5 Hainaut, C. C. Harris, IARC Sci Publ, 247 ( 2004 ) . (2005 ). 44. J. F. Costello et al . , Nat Genet 24 , 132 ( 2000 ) . 4. B. Vogelstein , K. W. Kinzler, The Genetic Basis of Human 45. A. H. Owens, Coffey, D. S. , and Baylin , S. B. , eds . , Cancer (McGraw -Hill , Toronto , 2002 ) 60 Tumor Cell Heterogeneity . ( Academic Press, New York , 5. D. M. Parkin , F. Bray, J. Ferlay, P. Pisani , CA Cancer J 1982 ) , pp . pp . 441-460 . Clin 55 , 74 ( 2005 ) . 6. world wide web domain : ncbi.nlm.nih.gov, database : 46. K. D. Pruitt, T. Tatusova , D. R. Maglott, Nucleic Acids CCDS . Res 33 , D501 ( 2005 ) . 7. Materials and methods are available as supporting mate- 65 47. world wide web domain : cancergenome.nih.gov; docu rial at Science Online . ment: index.asp 8. B. Ewing, P. Green , Genome Res 8 , 186 ( 1998 ) . 49. Y. H. Rogers , J. C. Venter . Nature 437 , 326 ( 2005 ) . US 10,787,712 B2 21 22 SEQUENCE LISTING

< 160 > NUMBER OF SEQ ID NOS : 215 < 210 > SEQ ID NO 1 < 211 > LENGTH : 17 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 1 gtaaaacgac ggccagt 17

< 210 > SEQ ID NO 2 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 2 cgcctttacc cggtttcatt 20

< 210 > SEQ ID NO 3 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 3 ccaattgtct cccctccttg 20

< 210 > SEQ ID NO 4 < 211 > LENGTH : 15 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 4 ggaagggtgt gagga 15

< 210 > SEQ ID NO 5 < 211 > LENGTH : 15 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 5 ggaagggtgt gagga 15

< 210 > SEQ ID NO 6 < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 6 gaggaagaag ag 12

< 210 > SEQ ID NO 7 < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 7 gaggaagaag ag 12

< 210 > SEQ ID NO 8 11 LENGTH : 36 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 8 US 10,787,712 B2 23 24 - continued ggcggccgcg gcggcagtgg cggcggcggc ggcggo 36

< 210 > SEQ ID NO 9 < 211 > LENGTH : 36 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 9 ggcggccgcg goggcagtgg cggcggcggc ggcggc 36

< 210 > SEQ ID NO 10 < 211 > LENGTH : 16 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 10 agtgttccca acatat 16

< 210 > SEQ ID NO 11 < 211 > LENGTH : 16 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 11 agtgttccca acatat 16

< 210 > SEQ ID NO 12 < 211 > LENGTH : 10 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 12 gacaaggaca 10

< 210 > SEQ ID NO 13 < 211 > LENGTH : 10 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 13 gacaaggaca 10

< 210 > SEQ ID NO 14 < 211 > LENGTH : 10 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 14 caaaatccag 10

< 210 > SEQ ID NO 15 < 211 > LENGTH : 10 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 15 caaaatccag 10

< 210 > SEQ ID NO 16 < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens US 10,787,712 B2 25 26 - continued < 400 > SEQUENCE : 16 tcagctcgtc aa 12

< 210 > SEQ ID NO 17 < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 17 tcagctcgtc aa 12

< 210 > SEQ ID NO 18 < 211 > LENGTH : 14 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 18 ttgtggtaag ttat 14

< 210 > SEQ ID NO 19 < 211 > LENGTH : 14 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 19 ttgtggtaag ttat 14

< 210 > SEQ ID NO 20 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 20 ttaacggtaa ggtgctgttg t 21

< 210 > SEQ ID NO 21 < 211 > LENGTH : 22 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 21 tttaacggta aggtgctgtt gt 22

< 210 > SEQ ID NO 22 < 211 > LENGTH : 23 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 22 gaggataaag ttttaactgt ggt 23

< 210 > SEQ ID NO 23 < 211 > LENGTH : 23 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 23 gaggataaag ttttaactgt ggt 23

< 210 > SEQ ID NO 24 < 211 > LENGTH : 24 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens US 10,787,712 B2 27 28 - continued

< 400 > SEQUENCE : 24 caacctgact tcccggggca tgga 24

< 210 > SEQ ID NO 25 < 211 > LENGTH : 24 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 25 caacctgact tcccggggca tgga 24

< 210 > SEQ ID NO 26 < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 26 tatctgaact tg 12

< 210 > SEQ ID NO 27 < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 27 tatctgaact tg 12

< 210 > SEQ ID NO 28 < 211 > LENGTH : 19 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 28 aagaaaaact tgtcatcag 19

< 210 > SEQ ID NO 29 < 211 > LENGTH : 19 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 29 aagaaaaact tgtcatcag 19

< 210 > SEQ ID NO 30 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 30 ctttgtacag gagaatatta 20

< 210 > SEQ ID NO 31 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 31 ctttgtacag gagaatatta 20

< 210 > SEQ ID NO 32 < 211 > LENGTH : 40 < 212 > TYPE : DNA US 10,787,712 B2 29 30 - continued < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 32 tttttggata ggtattggtg gatttatggt gcggcaaaga 40

< 210 > SEQ ID NO 33 < 211 > LENGTH : 40 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 33 tttttggata ggtattggtg gatttatggt gcggcaaaga 40

< 210 > SEQ ID NO 34 < 211 > LENGTH : 24 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 34 cttgtacaat taatggcaca tgga 24

< 210 > SEQ ID NO 35 < 211 > LENGTH : 24 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 35 cttgtacaat taatggcaca tgga 24

< 210 > SEQ ID NO 36 < 211 > LENGTH : 53 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 36 agcacagctt gotttggggt caaacgtgga tcagcagcct cttggtcagt aaa 53

< 210 > SEQ ID NO 37 < 211 > LENGTH : 53 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 37 agcacagett gotttggggt caaacgtgga tcagcagcct cttggtcagt aaa 53

< 210 > SEQ ID NO 38 < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 38 cactgcatcccc 12

< 210 > SEQ ID NO 39 < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 39 cactgcatcc CC 12

< 210 > SEQ ID NO 40 < 211 > LENGTH : 12 US 10,787,712 B2 31 32 - continued < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 40 ttcctaagtg ga 12

< 210 > SEQ ID NO 41 < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 41 ttcctaagtg ga 12

< 210 > SEQ ID NO 42 < 211 > LENGTH : 10 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 42 tcctcctgct 10

< 210 > SEQ ID NO 43 < 211 > LENGTH : 10 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 43 tcctcctgct 10

< 210 > SEQ ID NO 44 < 211 > LENGTH : 15 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 44 acagaatcct gaagg 15

< 210 > SEQ ID NO 45 < 211 > LENGTH : 15 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 45 acagaatcct gaagg 15

< 210 > SEQ ID NO 46 < 211 > LENGTH : 42 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 46 agggcatcat ggaggaggat gaggcctgcg ggcgccagta ca 42

< 210 > SEQ ID NO 47 < 211 > LENGTH : 42 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 47 agggcatcat ggaggaggat gaggcctgcg ggcgccagta ca 42

< 210 > SEQ ID NO 48 US 10,787,712 B2 33 34 - continued < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 48 gtgtttgtaa gc 12

< 210 > SEQ ID NO 49 < 211 > LENGTH : 12 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 49 gtgtttgtaa gc 12

< 210 > SEQ ID NO 50 < 211 > LENGTH : 19 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 50 ccatgatcct gtctgcggt 19

< 210 > SEQ ID NO 51 < 211 > LENGTH : 19 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 51 ccatgatcct gtctgcggt 19

< 210 > SEQ ID NO 52 < 211 > LENGTH : 15 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 52 tgctggacta accct 15

< 210 > SEQ ID NO 53 < 211 > LENGTH : 15 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 53 tgctggacta accct 15

< 210 > SEQ ID NO 54 < 211 > LENGTH : 11 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 54 ttttaatagc t 11

< 210 > SEQ ID NO 55 < 211 > LENGTH : 11 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 55 ttttaatagc t 11 US 10,787,712 B2 35 36 - continued < 210 > SEQ ID NO 56 < 211 > LENGTH : 25 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 56 tgaacacgca ccctgataag ctgcg 25

< 210 > SEQ ID NO 57 < 211 > LENGTH : 25 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 400 > SEQUENCE : 57 tgaacacgca ccctgataag ctgcg 25

< 210 > SEQ ID NO 58 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 58 gtaaaacgac ggccagtgcc cttccaccct agttcttc 38

< 210 > SEQ ID NO 59 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 59 gtaaaacgac ggccagtctg ttgggtgtct accttccc 38

< 210 > SEQ ID NO 60 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 60 gtaaaacgac ggccagtgtg cctggagaaa cctctcac 38

< 210 > SEQ ID NO 61 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 61 cacctcagtg ttctacgcca g 21

< 210 > SEQ ID NO 62 < 211 > LENGTH : 18 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 62 cgccgccgag attaattg 18 US 10,787,712 B2 37 38 - continued

< 210 > SEQ ID NO 63 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 63 gtaaaacgac ggccagtgag acggaccggg taggg 35

< 210 > SEQ ID NO 64 < 211 > LENGTH : 18 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 64 ctgcggaagc agaacctg 18

< 210 > SEQ ID NO 65 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 65 cacaagatgg ctcggaagac 20

< 210 > SEQ ID NO 66 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 66 gtaaaacgac ggccagtcta gatccttcca gagggcac 38

< 210 > SEQ ID NO 67 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 67 gtaaaacgac ggccagtcct gacactcaaa cccaacag 38

< 210 > SEQ ID NO 68 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 68 gagtgaggtc agggtctcca g 21

< 210 > SEQ ID NO 69 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr US 10,787,712 B2 39 40 - continued

< 400 > SEQUENCE : 69 gagaaccata gagccactcg g 21

< 210 > SEQ ID NO 70 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 70 gtaaaacgac ggccagtgtg ggtgtctgta tccaaggg 38

< 210 > SEQ ID NO 71 < 211 > LENGTH : 39 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 71 gtaaaacgac ggccagttga agggagtaga ctgaccctg 39

< 210 > SEQ ID NO 72 < 211 > LENGTH : 22 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 72 ggacagctct gaggaggaag ag 22

< 210 > SEQ ID NO 73 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 73 gtaaaacgac ggccagtcca acctctgccc tatgtctg 38

< 210 > SEQ ID NO 74 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 74 gtaaaacgac ggccagtagt gctgaggcca acaaatto 38

< 210 > SEQ ID NO 75 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 75 agtcgtagag gctatgctgg c 21

< 210 > SEQ ID NO 76 US 10,787,712 B2 41 42 - continued < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 76 gtaaaacgac ggccagttcg gccatacagg tgctattc 38

< 210 > SEQ ID NO 77 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 77 aggtgctttg ggaagagctg 20

< 210 > SEQ ID NO 78 < 211 > LENGTH : 36 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 78 gtaaaacgac ggccagtaag gcccaggtgt tcacag 36

< 210 > SEQ ID NO 79 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 79 aggaaatgat tcctgtgccg 20

< 210 > SEQ ID NO 80 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 80 gtaaaacgac ggccagtacg tgccttgtcc tgctttag 38

< 210 > SEQ ID NO 81 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 81 tatctcttgt ttcgggttggg 21

< 210 > SEQ ID NO 82 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 82 US 10,787,712 B2 43 44 - continued gtaaaacgac ggccagtatg gaccttcatg gtctccc 37

< 210 > SEQ ID NO 83 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 83 gtaaaacgac ggccagtcaa cagctatgca cttgagcc 38

< 210 > SEQ ID NO 84 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 84 gagcagcagg cagtggttag 20

< 210 > SEQ ID NO 85 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 85 aacttggagg atggctttgt g 21

< 210 > SEQ ID NO 86 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 86 gtaaaacgac ggccagtagt gaaggcctac tgggattg 38

< 210 > SEQ ID NO 87 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 87 gtaaaacgac ggccagtgcc aaatgctctg ttctctgg 38

< 210 > SEQ ID NO 88 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 88 gtaaaacgac ggccagtctc ttccagaaag gctccacc 38

< 210 > SEQ ID NO 89 < 211 > LENGTH : 38 < 212 > TYPE : DNA US 10,787,712 B2 45 46 - continued < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 89 gtaaaacgac ggccagtaga cttgccgacc tgtacgac 38

< 210 > SEQ ID NO 90 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 90 gtcctgtagc tgtgtggatg c 21

< 210 > SEQ ID NO 91 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 91 gtaaaacgac ggccagtaaa gttgtgcatt acgccaag 38

< 210 > SEQ ID NO 92 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 92 gtaaaacgac ggccagtctg ctacctggag ctattccc 38

< 210 > SEQ ID NO 93 < 211 > LENGTH : 19 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 93 cctgacccag gacttggag 19

< 210 > SEQ ID NO 94 < 211 > LENGTH : 22 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 94 tttaccacct ggagaagcag ac 22

< 210 > SEQ ID NO 95 < 211 > LENGTH : 36 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 95 gtaaaacgac ggccagtgca gtgctgtctg tgcctc 36 US 10,787,712 B2 47 48 - continued

< 210 > SEQ ID NO 96 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 96 gtaaaacgac ggccagtcca gctctccaag tacccag 37

< 210 > SEQ ID NO 97 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 97 gacgcccgac tctttagtgg 20

< 210 > SEQ ID NO 98 < 211 > LENGTH : 39 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 98 gtaaaacgac ggccagtgcg acagaataag acttcgtcc 39

< 210 > SEQ ID NO 99 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 99 gtaaaacgac ggccagtaac tcagactgga gggagcc 37

< 210 > SEQ ID NO 100 < 211 > LENGTH : 36 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 100 gtaaaacgac ggccagtcag ttgtcctgga gccacc 36

< 210 > SEQ ID NO 101 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 101 gtaaaacgac ggccagtcaa gcctgaggtc tgttcagg 38

< 210 > SEQ ID NO 102 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 » ORGANISM : Artificial Sequence < 220 > FEATURE : US 10,787,712 B2 49 50 - continued < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 102 ctcagcttgt gagtagcagc c 21

< 210 > SEQ ID NO 103 < 211 > LENGTH : 39 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 103 gtaaaacgac ggccagttgc ctctgacagg tgagtaagg 39

< 210 > SEQ ID NO 104 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 104 aggccttaaa tagggaaacg g 21

< 210 > SEQ ID NO 105 < 211 > LENGTH : 36 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 105 gtaaaacgac ggccagtccg agcgcgtatt aacgag 36

< 210 > SEQ ID NO 106 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 106 gagatgaccg tgagacacct g 21

< 210 > SEQ ID NO 107 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 107 gtaaaacgac ggccagtctt ataatagggc cggtgctg 38

< 210 > SEQ ID NO 108 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 108 accctagcag gtaaagggag g 21 US 10,787,712 B2 51 52 - continued < 210 > SEQ ID NO 109 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 109 atgtcggtgt cagagctgaa g 21

< 210 > SEQ ID NO 110 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 110 gtaaaacgac ggccagtctc gctttcatat ttccgtcc 38

< 210 > SEQ ID NO 111 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 111 tcaggcatgt tcagagagca g 21

< 210 > SEQ ID NO 112 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 112 gtaaaacgac ggccagtgaa tgtggcagga ccgag 35

< 210 > SEQ ID NO 113 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 113 cgagtcctca ctctgccttt c 21

< 210 > SEQ ID NO 114 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 114 tctggatctc agctggattt g 21

< 210 > SEQ ID NO 115 < 211 > LENGTH : 39 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr US 10,787,712 B2 53 54 - continued < 400 > SEQUENCE : 115 gtaaaacgac ggccagtccc acctggtcag agtaaacag 39

< 210 > SEQ ID NO 116 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 116 gtaaaacgac ggccagtagt gggcagctcc cgtag 35

< 210 > SEQ ID NO 117 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 117 gtaaaacgac ggccagttgg tcccactgaa tacccac 37

< 210 > SEQ ID NO 118 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 118 gtaaaacgac ggccagtcac agggcaggtt ggagg 35

< 210 > SEQ ID NO 119 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 119 gtaaaacgac ggccagttcc ttccaccaca actcacag 38

< 210 > SEQ ID NO 120 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 120 gtaaaacgac ggccagtaca ggctgggcct caaac 35

< 210 > SEQ ID NO 121 < 211 > LENGTH : 18 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 121 gggccaagg ttgga 18

< 210 > SEQ ID NO 122 < 211 > LENGTH : 38 US 10,787,712 B2 55 56 - continued < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 122 gtaaaacgac ggccagtgag gtcacacctg ggacagag 38

< 210 > SEQ ID NO 123 < 211 > LENGTH : 18 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 123 agccagtctc caggcacc 18

< 210 > SEQ ID NO 124 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 124 gtaaaacgac ggccagtctc ctcacacgca cttcacc 37

< 210 > SEQ ID NO 125 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 125 gtaaaacgac ggccagtgag aacggacaac ctcactcc 38

< 210 > SEQ ID NO 126 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 126 ttctactcag cacccagaccc 21

< 210 > SEQ ID NO 127 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 127 agottggact gcacatctgg 20

< 210 > SEQ ID NO 128 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 128 US 10,787,712 B2 57 58 - continued gtaaaacgac ggccagtgag gaagggtcct ctcctgtc 38

< 210 > SEQ ID NO 129 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 129 acatctggca gctgaggagt c 21

< 210 > SEQ ID NO 130 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 130 gtaaaacgac ggccagtctc ctctgccctc ctccc 35

< 210 > SEQ ID NO 131 < 211 > LENGTH : 18 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 131 ccaagcctgg cagaggag 18

< 210 > SEQ ID NO 132 < 211 > LENGTH : 19 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 132 caacctgtcc tccagtgcc 19

< 210 > SEQ ID NO 133 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 133 gtaaaacgac ggccagtaga ggccaaaccc accac 35

< 210 > SEQ ID NO 134 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 134 tgtggtagat gctgcctgtg 20

< 210 > SEQ ID NO 135 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence US 10,787,712 B2 59 60 - continued < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 135 gtaaaacgac ggccagtcaa cccgaatagg agaaggg 37

< 210 > SEQ ID NO 136 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 136 caacccgaat aggagaaggg 20

< 210 > SEQ ID NO 137 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 137 cccactactg cttgctcagg 20

< 210 > SEQ ID NO 138 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 138 ttgggaatta ggcttctgct g 21

< 210 > SEQ ID NO 139 < 211 > LENGTH : 19 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 139 gcctcagcaa caggaatgg 19

< 210 > SEQ ID NO 140 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 140 gtaaaacgac ggccagtaga gotgaacaca gtgcttgg 38

< 210 > SEQ ID NO 141 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 141 gtaaaacgac ggccagtccc tacccggtcc gtctc 35 US 10,787,712 B2 61 62 - continued

< 210 > SEQ ID NO 142 < 211 > LENGTH : 18 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 142 ggttcagcac cagcaggg 18

< 210 > SEQ ID NO 143 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 143 gtaaaacgac ggccagtgcc cacctgtgtg gaagtag 37

< 210 > SEQ ID NO 144 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 144 gtaaaacgac ggccagtctc ctgaccgtcg tgtgc 35

< 210 > SEQ ID NO 145 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 145 ccatcctttc cagggaggta g 21

< 210 > SEQ ID NO 146 < 211 > LENGTH : 19 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 146 gacaagggct gctctcctg 19

< 210 > SEQ ID NO 147 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 147 gtaaaacgac ggccagtacc gaaagaaata aagcggtg 38

< 210 > SEQ ID NO 148 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr US 10,787,712 B2 63 64 - continued

< 400 > SEQUENCE : 148 gtaaaacgac ggccagtaaa gcccgaagct aggaactc 38

< 210 > SEQ ID NO 149 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 149 cctgcctagg acagagtttg g 21

< 210 > SEQ ID NO 150 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 150 cttcctgcac agaaaggctg 20

< 210 > SEQ ID NO 151 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 151 gtaaaacgac ggccagtttg tcacttgcgc tgaagaag 38

< 210 > SEQ ID NO 152 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 152 aaaggcctgg atgtactcac g 21

< 210 > SEQ ID NO 153 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 153 ttgccatgtc tctgtcctag c 21

< 210 > SEQ ID NO 154 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 154 gtaaaacgac ggccagtgtc tccgacagac aggacacc 38

< 210 > SEQ ID NO 155 US 10,787,712 B2 65 66 - continued < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 155 gactgcctga gacagaaaccc 21

< 210 > SEQ ID NO 156 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 156 gtaaaacgac ggccagtagg tgctctgtga gacattcg 38

< 210 > SEQ ID NO 157 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 157 gtctcaaccc atccaccctt c 21

< 210 > SEQ ID NO 158 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 158 gtaaaacgac ggccagttcc agaatccaga gcatctcc 38

< 210 > SEQ ID NO 159 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 159 gtgacacccg tgacaaggag 20

< 210 > SEQ ID NO 160 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 160 gtaaaacgac ggccagtgtc catgottgaa cttggagg 38

< 210 > SEQ ID NO 161 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 161 US 10,787,712 B2 67 68 - continued acaagggcac ctcctaccag 20

< 210 > SEQ ID NO 162 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 162 gtcagcttct cccaggetto 20

< 210 > SEQ ID NO 163 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 163 gtaaaacgac ggccagtcgc cctggtctca agtcatag 38

< 210 > SEQ ID NO 164 < 211 > LENGTH : 36 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 164 gtaaaacgac ggccagtctc gtggctctgg gaagtc 36

< 210 > SEQ ID NO 165 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 165 toccagagaa cagagcattt g 21

< 210 > SEQ ID NO 166 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 166 aagcctgtcc cgtgtctact g 21

< 210 > SEQ ID NO 167 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 167 tagtggaaga gottgttggc g 21

< 210 > SEQ ID NO 168 < 211 > LENGTH : 19 < 212 > TYPE : DNA US 10,787,712 B2 69 70 - continued < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 168 ggaagaccct gagctgcac 19

< 210 > SEQ ID NO 169 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 169 gtaaaacgac ggccagtgta gcagtcgctg acatcctg 38

< 210 > SEQ ID NO 170 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 170 aacacctgtg atctggaagg c 21

< 210 > SEQ ID NO 171 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 171 acacatacac acacgtgctc c 21

< 210 > SEQ ID NO 172 < 211 > LENGTH : 36 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 172 gtaaaacgac ggccagtctc gaggcacaga cagcac 36

< 210 > SEQ ID NO 173 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 173 gtaaaacgac ggccagtcag gcgatgaggg aactg 35

< 210 > SEQ ID NO 174 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 174 cgaaatacag gttcctcctg c 21 US 10,787,712 B2 71 72 - continued

< 210 > SEQ ID NO 175 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 175 tgaccgtagt cctcgtagct g 21

< 210 > SEQ ID NO 176 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 176 gtaaaacgac ggccagtacg tcggtcaggc tgatctc 37

< 210 > SEQ ID NO 177 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 177 aactctctga ggctgcaagg 20

< 210 > SEQ ID NO 178 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 178 gctagaaaca gcctaggcca c 21

< 210 > SEQ ID NO 179 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 179 ctgaacagac ctcaggcttg g 21

< 210 > SEQ ID NO 180 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 180 tccctcagag toccaagagg 20

< 210 > SEQ ID NO 181 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 » ORGANISM : Artificial Sequence < 220 > FEATURE : US 10,787,712 B2 73 74 - continued < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 181 gtaaaacgac ggccagtggt agggaaggca gagatgtg 38

< 210 > SEQ ID NO 182 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 182 tgggttcaga ccctgacttg 20

< 210 > SEQ ID NO 183 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 183 gtaaaacgac ggccagtatg accggcttgg aggac 35

< 210 > SEQ ID NO 184 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 184 gacacaggag gagaggtcgg 20

< 210 > SEQ ID NO 185 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 185 gtaaaacgac ggccagttct getacagtct cggcaaag 38

< 210 > SEQ ID NO 186 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 186 ctccctttac ctgctagggt g 21

< 210 > SEQ ID NO 187 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 187 gtaaaacgac ggccagtgtc agccagaaca ggtcgtc 37 US 10,787,712 B2 75 76 - continued < 210 > SEQ ID NO 188 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 188 gtaaaacgac ggccagtgag gcggccattt ctctttac 38

< 210 > SEQ ID NO 189 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 189 tacggccctt tagagatgtg g 21

< 210 > SEQ ID NO 190 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 190 gtaaaacgac ggccagtact ccagtctcag gcccato 37

< 210 > SEQ ID NO 191 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 191 cagagtgagg actcgggatg 20

< 210 > SEQ ID NO 192 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 192 gtaaaacgac ggccagtcac tcagcctgtg totgtgg 37

< 210 > SEQ ID NO 193 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 193 gtaaaacgac ggccagtctt gatggagaac ggtctgtc 38

< 210 > SEQ ID NO 194 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr US 10,787,712 B2 77 78 - continued < 400 > SEQUENCE : 194 caacactttg tgctggttccc 21

< 210 > SEQ ID NO 195 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : 223THERNFORMATNprimer < 400 > SEQUENCE : 195 agtaggagct gatgctgega g 21

< 210 > SEQ ID NO 196 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence 22FEATURE : 23THERNFORMAN: primerp < 400 > SEQUENCE : 196 gaggagcttg ttgttgggaa g 21

< 210 > SEQ ID NO 197 < 211 > LENGTH : 21 212TYPEWNA 213RGANSM Artifiequence 220FEATURE < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 197 taaaggacag gtggaaggtg g 21

< 210 > SEQ ID NO 198 211BENGTH : 22 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223TERNFORMATNprimer < 400 > SEQUENCE : 198 tggctgaacc tctgactcta gc 22

< 210 > SEQ ID NO 199 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 199 cttcctgacc acctcgtctc 20

< 210 > SEQ ID NO 200 211 > LENGTH : 35 212TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 200

caaaacgac gtgct gac gtggg 35

< 210 > SEQ ID NO 201 < 211 > LENGTH : 21 US 10,787,712 B2 79 80 - continued < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 201 tacttccagg cctgagacac c 21

< 210 > SEQ ID NO 202 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 202 gtaaaacgac ggccagtcac acggtcaggt cacacttc 38

< 210 > SEQ ID NO 203 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 203 cctccttaga cctcagcaac g 21

< 210 > SEQ ID NO 204 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 204 gagaaagcag ggacaggaca C 21

< 210 > SEQ ID NO 205 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 205 gtaaaacgac ggccagtaac tgggtgcagc tggaatac 38

< 210 > SEQ ID NO 206 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 206 gtaaaacgac ggccagtagc atgcatccac tcaggtc 37

< 210 > SEQ ID NO 207 < 211 > LENGTH : 19 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 207 US 10,787,712 B2 81 82 - continued agcagcagct gggtctctg 19

< 210 > SEQ ID NO 208 < 211 > LENGTH : 35 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 208 gtaaaacgac ggccagttcc tgcacccact tctgc 35

< 210 > SEQ ID NO 209 < 211 > LENGTH : 18 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 209 cgtcgttgta gaagcccg 18

< 210 > SEQ ID NO 210 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 210 gtaaaacgac ggccagtgtt tgaggttogt ttctgcg 37

< 210 > SEQ ID NO 211 < 211 > LENGTH : 38 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 211 gtaaaacgac ggccagtaca aagatagggt ggtcaggg 38

< 210 > SEQ ID NO 212 < 211 > LENGTH : 21 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 212 caaccaggtc cagccacata g 21

< 210 > SEQ ID NO 213 < 211 > LENGTH : 36 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 213 gtaaaacgac ggccagtgta cagggccagc aggatg 36

< 210 > SEQ ID NO 214 < 211 > LENGTH : 18 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence US 10,787,712 B2 83 84 - continued < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 214 atcttggcca gggtggag 18

< 210 > SEQ ID NO 215 < 211 > LENGTH : 37 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : primer for pcr < 400 > SEQUENCE : 215 gtaaaacgac ggccagtgca cctagaacgg tgcagag 37

We claim : 20 11. A method of characterizing a colorectal sample in a 1. A method of testing a human sample , comprising the human , comprising the steps of : step of: testing a test colorectal sample of the human by subjecting the sample to a reaction , and detecting an aspara testing a suspected colorectal cancer metastasis sample of gine codon or residue in a gene or its encoded cDNA or the human by subjecting the sample to a reaction , and protein at KRAS codon or residue 117 . detecting in a gene or its encoded cDNA or protein an 2. The method of claim 1 wherein an asparagine codon is 25 asparagine codon or residue at codon or residue 117 of detected at KRAS codon 117 in the gene . KRAS of the sample. 3. The method of claim 1 wherein an asparagine is 12. The method of claim 11 wherein an asparagine codon detected at KRAS codon 117 in the encoded cDNA . at codon 117 of KRAS is detected in the gene . 4. The method of claim 1 wherein an asparagine residue 13. The method of claim 11 wherein an asparagine codon is detected at KRAS residue 117 in the protein . 30 at codon 117 of KRAS is detected in the encoded cDNA . 5. The method of claim 1 wherein a sequencing reaction 14. The method of claim 11 wherein an asparagine residue is run on all or a part of KRAS gene including codon 117 . at residue 117 of KRAS is detected in the protein . 6. The method of claim 1 wherein the step of testing 15. The method of claim 11 wherein all or a part of KRAS comprises a step of contacting ( a ) a probe specific for KRAS gene comprising codon 117 is subjected to a sequencing with an asparagine codon at codon 117 with ( b ) the test 35 reaction . colorectal sample . 16. The method of claim 11 wherein the step of testing 7. The method of claim 1 wherein the step of testing employs a probe specific for KRAS with an asparagine comprises a step of contacting ( a ) a primer specific for codon at codon 117 . KRAS with an asparagine codon at codon 117 with ( b ) the 17. The method of claim 11 wherein the step of testing test colorectal sample . 40 employs a primer specific for KRAS with an asparagine 8. The method of claim 1 wherein the step of testing codon at codon 117 . comprises a step of contacting ( a ) an antibody specific for 18. The method of claim 11 wherein the step of testing KRAS with an asparagine residue at residue 117 with ( b ) the employs an antibody specific for KRAS with an asparagine test colorectal sample . residue at residue 117 . 9. The method of claim 1 wherein the step of testing 45 19. The method of claim 11 wherein the step of testing comprises a hybridization reaction between the test colorec employs a hybridization reaction with a probe or primer. tal sample and a primer or probe . 20. The method of claim 11 wherein the step of testing 10. The method of claim 1 wherein the step of testing employs a primer extension reaction in which a primer is comprises a primer extension reaction in which a primer is hybridized to the test colorectal sample and the primer is hybridized to the test colorectal sample and the primer is 50 extended , wherein the extended primer comprises an aspara extended , wherein the extended primer comprises an aspara gine codon at codon 117 . gine codon at codon 117 . *