DOCSLIB.ORG

Mitochondrial DNA Diversity and Wolbachia Infection in The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mitochondrial DNA Diversity and Wolbachia Infection in The Biological Control 37 (2006) 1–8 www.elsevier.com/locate/ybcon Mitochondrial DNA diversity and Wolbachia infection in the Xea beetle Aphthona nigriscutis (Coleoptera: Chrysomelidae): An introduced biocontrol agent for leafy spurge R. Roehrdanz a,¤, D. Olson b, R. Bourchier c, S. Sears a, A. Cortilet d, G. Fauske b a Biosciences Research Laboratory, Red River Valley Agricultural Research Center, Agricultural Research Service, US Department of Agriculture, Fargo, ND, USA b Department of Entomology, North Dakota State University, Fargo, ND, USA c Agriculture and Agri-Food Canada, Lethbridge, Alta., Canada d Agricultural Resources Management and Development Division, Weed Integrated Pest Management Unit, Minnesota Department of Agriculture, St. Paul, MN, USA Received 12 April 2005; accepted 7 December 2005 Available online 20 January 2006 Abstract Aphthona nigriscutis is one of several species of Aphthona Xea beetles that have been introduced into North America in an eVort to control the weed, leafy spurge (Euphorbia esula). It has been a very eVective biological control agent at some locations but not at others. Overall genetic diversity is one parameter that could have an eVect on Aphthona establishment at speciWc locations. We have examined the genetic diversity of mitochondrial DNA in populations of A. nigriscutis from several North American collection sites. The results indicate that the insects are divided into two mtDNA clades. About 78% of the individuals comprise a clade (A) that has little or no mtDNA diversity. The remaining insects in the other clade (B) display extensive diversity with 15 haplotypes observed. The two subpopulations coexist at most locations. The bacterial endosymbiont Wolbachia has been discovered in some individuals. About 86% of the individuals from mtDNA clade A tested positive for Wolbachia. Portions of the Wolbachia ftsZ and wspA genes were sequenced and the sequences have been shown to fall within the Wolbachia Supergroup A. None of the insects from clade B appear to be infected. The association of Wolbachia with one, but not both, mtDNA clades of A. nigriscutis may play a role in limiting genetic diversity within beetle populations. Published by Elsevier Inc. Keywords: Aphthona nigriscutis; Flea beetles; Wolbachia; Biological control; Euphorbia esula; Leafy spurge; Mitochondrial DNA; Genetic variation; mtDNA 1. Introduction tles have become established (Anderson et al., 1999; Team Leafy Spurge). Four species account for almost all of the Several species of Chrysomelid Xea beetles from the currently established populations, Aphthona Xava Guille- genus Aphthona have been introduced into North America beau, Aphthona cyparissiae Koch, Aphthona lacertosa since the late 1980s in an eVort to control the invasive weed, Rosenheim, and Aphthona nigriscutis Foudras. The latter leafy spurge (Euphorbia esula L.). Both the plants and the two are dominant at most established North American insects are natives of Eurasia. In a broad sense, biological sites. control of leafy spurge has been quite eVective, with an 80– One downside that has become apparent as the beetle 90% reduction of spurge at sites where Aphthona Xea bee- populations have been expanded in both natural dispersal and continued introductions is that they fail to establish at many spurge infested locations. This diYculty is more pro- * Corresponding author. Fax: +1 701 239 1348. nounced in A. nigriscutis. Species diVerences in habitat pref- E-mail address: [email protected] (R. Roehrdanz). erences and dispersal capabilities along with local variation 1049-9644/$ - see front matter. Published by Elsevier Inc. doi:10.1016/j.biocontrol.2005.12.004 2 R. Roehrdanz et al. / Biological Control 37 (2006) 1–8 in the spurge may explain some of the failures (Flaherty, apolis-St. Paul metropolitan area. RIV is near Grass Lake 2001; Jonsen et al., 2001; Müller-Schärer et al., 2004; Mun- (lat: 44.81807, long: ¡93.45514), FCL is by the Flying dal et al., 1999). The presence of a genetic bottleneck and a Cloud Airport (lat: 44.81895, long: ¡93.47341) (both north reduction in genetic diversity could also restrict the eVec- of the river), and BLU is at Blue Lake (lat: 44.79591, long: tiveness of the beetles in certain environments or on certain ¡93.43922) which is south of the river. The ALB4 site is in strains of leafy spurge. Many insects imported as potential southern Alberta, Canada about 20 km southwest of Leth- biological control agents are collected as small populations bridge, AB (lat: 49.584167, long: ¡112.871111). A. nigriscu- from one or few sites and may not reXect the full genetic tis was incidental at two other sites in southern Alberta, diversity of the species. Consideration of the genetic diver- ALB1 (lat: 49.244722, long: ¡113.260278) and ALB3 (lat: sity has the potential for making biological control agents 49.181389, long: ¡113.308333). more broadly eVective (Hopper et al., 1993). Many of the The most frequent Aphthona species found at these sites Aphthona beetles redistributed in the central USA and was A. lacertosa, but A. cyparissiae and A. Xava could Canadian prairies also come from a relatively small number sometimes be present in small numbers. Initial sorting sepa- of beetle recollection sites. A genetic bottleneck may have rated the black beetles, A. lacertosa, from all of the others occurred at initial collection sites for importation and/or at which are brown. Specimens, as numbered sample exem- collection sites for redistribution of A. nigriscutis, resulting plars, were submitted to Dr. Fauske for species identiWca- in a narrowed genetic base that may limit beetle adaptabil- tion. Species determinations were based upon external ity at new release sites. morphology, internal morphology, and genitalic dissection. Little is known about the inherent genetic variability of Previously identiWed mtDNA clades were than assigned to the Aphthona species, either as released populations in species based upon matching sequences in the morphologi- North America or as endemic species in Europe and Asia. cally determined specimens. Our overall goal is to assess the genetic variation of the Aphthona populations that have become established in the 2.2. DNA preparation and PCR USA and Canada, beginning with an examination of mito- chondrial DNA. There have been reports of Wolbachia Total beetle DNA was extracted from either whole infections in North American A. nigriscutis (Kazmer, 2001; insects or the head and thorax portion via the high salt pro- Nowierski et al., 2001). Wolbachia infections can have a cedure of Cheung et al. (1993). Alternatively, DNA was direct inXuence on reducing the diversity of mtDNA (Arm- extracted from one of the hind legs using the DNeasy Tis- bruster et al., 2003; Behura et al., 2001; Shoemaker et al., sue kit (Qiagen, Valencia, CA). When only a partial insect 2003). There are conXicting views regarding the possible was used, the remainder of the insect was returned to the extent to which Wolbachia may also aVect the nuclear freezer at the Biosciences Research Laboratory in Fargo as genetic diversity (Ballard et al., 2002; Telschow et al., 2002). a voucher specimen. The mitochondrial primers 16S2 (LR- Because A. nigriscutis is such an important biocontrol N-12945 5Ј-GCGACCTCGATGTTGGATT) and C2R agent of leafy spurge, any factor that may aVect its estab- (C2-J-3684 5Ј-GGTCAATGTTCAGAAATTTGTGG) lishment and reproductive success is of interest. Therefore, were used to amplify a portion of the mtDNA about 9 kb in we also tested the populations for the presence of Wolba- length. Reaction components were from the Applied Bio- chia and deWned the Wolbachia that we found. This report sciences XL kit and the long PCR conditions and mtDNA details the mtDNA diversity from the species A. nigriscutis, primers were as described previously (Roehrdanz, 1995; the distribution of that diversity, and the impact of Wolba- Roehrdanz and Degrugillier, 1998). The PCR products chia on that diversity. were digested with the restriction endonucleases XbaI, AseI, AluI, SspI, DraI, DpnII or HinfI. VeriWcation of the proper 2. Materials and methods sized amplicons and the restriction fragment length poly- morphism (RFLP) patterns were made using agarose gel 2.1. Insects electrophoresis and ethidium bromide staining in the com- pany of molecular size standards. Individual RFLP pat- Adult A. nigriscutis were collected from established sites terns were given an alphabetical designation while the in North Dakota (ND), Minnesota (MN), and Alberta composite haplotypes were numbered in the order they (AB), Canada. Insects from the USA were brought to were discovered. Some initial haplotype numbers in Fargo live and frozen at ¡80 °C for future use. Insects from sequence were discarded when those individuals were deter- Canada were frozen in Canada and sent to Fargo packed in mined to belong to one of the other existing haplotypes. dry ice. The three ND collection sites were near Medora (MED) (lat: 46.9444, long: ¡103.5333) in southwestern ND, 2.3. Wolbachia near Lisbon (LIS) (lat: 46.4166, long: ¡97.5000) in the southeastern part of the state, and in Ward County (WAR) The presence of Wolbachia was determined by conduct- (lat: 48.3083, long: ¡101.3333) near Minot in north central ing PCR with primers speciWc for Wolbachia genes. The ND. The Minnesota collections were from the Minnesota primers ftsZ-1 (5Ј-GTTGTCGCAAATACCGATGC) and River Valley in Eden Prairie and Shakopee near the Minne- ftsZ-2 (5Ј-CTTAAGTAAGCTGGTATATC) amplify R. Roehrdanz et al. / Biological Control 37 (2006) 1–8 3 about 1050 bp of the ftsZ cell cycle protein. FtsZ-F (5Ј-T established sites except the two Canadian sites, ALB1 and ACTGACTGTTGGAGTTGTAACTAAGCCGT) and ABL3. At those two locations only 1/62 and 1/73, respec- ftsZ-R (5Ј-TGCCAGTTGCAAGAACAGAAACTCTAA tively, were A. nigriscutis, however 60–80% of the beetles CTC) amplify about 570 bp in the middle of the larger ftsZ were black (A. lacertosa) and the minority brown beetles segment (Werren et al., 1995b).
Load more

Recommended publications
  • Overcoming the Challenges of Tamarix Management with Diorhabda Carinulata Through the Identification and Application of Semioche
    OVERCOMING THE CHALLENGES OF TAMARIX MANAGEMENT WITH DIORHABDA CARINULATA THROUGH THE IDENTIFICATION AND APPLICATION OF SEMIOCHEMICALS by Alexander Michael Gaffke A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Ecology and Environmental Sciences MONTANA STATE UNIVERSITY Bozeman, Montana May 2018 ©COPYRIGHT by Alexander Michael Gaffke 2018 All Rights Reserved ii ACKNOWLEDGEMENTS This project would not have been possible without the unconditional support of my family, Mike, Shelly, and Tony Gaffke. I must thank Dr. Roxie Sporleder for opening my world to the joy of reading. Thanks must also be shared with Dr. Allard Cossé, Dr. Robert Bartelt, Dr. Bruce Zilkowshi, Dr. Richard Petroski, Dr. C. Jack Deloach, Dr. Tom Dudley, and Dr. Dan Bean whose previous work with Tamarix and Diorhabda carinulata set the foundations for this research. I must express my sincerest gratitude to my Advisor Dr. David Weaver, and my committee: Dr. Sharlene Sing, Dr. Bob Peterson and Dr. Dan Bean for their guidance throughout this project. To Megan Hofland and Norma Irish, thanks for keeping me sane. iii TABLE OF CONTENTS 1. INTRODUCTION ...........................................................................................................1 Tamarix ............................................................................................................................1 Taxonomy ................................................................................................................1 Introduction
    [Show full text]
  • Are All Flea Beetles the Same?
    E-1274 Are All Phyllotreata cruciferae Flea Beetles Crucifer Flea Beetle Versus the Same? Leafy Spurge Flea Beetles Denise L. Olson Assistant Professor, Entomology Dept. Janet J. Knodel Extension Crop Protection Specialist, NCREC, NDSU Aphthona lacertosa “FLEA BEETLE” is a common name describing many species of beetles that use their enlarged hind legs to jump quickly when disturbed. The adults feed on the leaves of their host plants. Heavily fed-on leaves have a shot-hole appearance. The larvae (wormlike immature stage) usually feed on the roots of the same host plants as adults. Common flea beetles that occur in North Dakota include the Flea beetles crucifer flea beetle (Phyllotreata cruciferae) and the leafy spurge have enlarged flea beetles (Aphthona species). The crucifer flea beetle is a hind legs that non-native insect pest that accidentally was introduced into they use to jump North America during the 1920s. Phyllotreata cruciferae now quickly when can be found across southern Canada and the northern Great disturbed. Plains states of the United States. The leafy spurge flea beetles are non-native biological control agents and were introduced for spurge control beginning in the mid-1980s. These biological control agents have been released in the south-central prov- inces of Canada and in the Upper Great Plains and Midwest Crucifer flea beetle is states of the United States. Although P. cruciferae and Aphthona an exotic insect pest. species are both known as flea beetles and do look similar, they differ in their description, life cycle and preference of host plants. Leafy spurge flea beetle species are introduced biological control North Dakota State University, Fargo, North Dakota 58105 agents.
    [Show full text]
  • CDA Leafy Spurge Brochure
    Frequently Asked Questions About the Palisade Insectary Mission Statement How do I get Aphthona beetles? You can call the Colorado Department of We are striving to develop new, effective Agriculture Insectary in Palisade at (970) ways to control non-native species of plants 464-7916 or toll free at (866) 324-2963 and and insects that have invaded Colorado. get on the request list. We are doing this through the use of biological controls which are natural, non- When are the insects available? toxic, and environmentally friendly. We collect and distribute adult beetles in June and July. The Leafy Spurge Program In Palisade How long will it take for them to control my leafy spurge? The Insectary has been working on leafy Biological Control You can usually see some damage at the spurge bio-control since 1988. Root feeding point of release the following year, but it flea beetles are readily available for release of typically takes three to ten years to get in early summer. Three other insect species widespread control. have been released and populations are growing with the potential for future Leafy Spurge What else do the beetles feed on? distribution. All of the leafy spurge feeding The beetles will feed on leafy spurge and insects are maintained in field colonies. cypress spurge. They were held in Additional research is underway to explore quarantine and tested to ensure they would the potential use of soilborne plant not feed on other plants before they were pathogens as biocontrol agents. imported and released in North America What makes the best release site? A warm dry location with moderate leafy spurge growth is best.
    [Show full text]
  • The Effect of Aphthona Whitfieldi (Coleoptera: Chrysomelidae) Populations’ Density on the Growth of Jatropha Curcas in Burkina Faso
    Advances in Entomology, 2017, 5, 127-137 http://www.scirp.org/journal/ae ISSN Online: 2331-2017 ISSN Print: 2331-1991 The Effect of Aphthona whitfieldi (Coleoptera: Chrysomelidae) Populations’ Density on the Growth of Jatropha curcas in Burkina Faso Alizèta Sawadogo1,2, Souleymane Nacro1,3 1Fasobiocarburant, Léo, Burkina Faso 2Crops department, IDR, Nazi Boni University of Bobo-Dioulasso, Bobo-Dioulasso, Burkina Faso 3INERA, CREAF of Kamboinsé, Ouagadougou, Burkina Faso How to cite this paper: Sawadogo, A. and Abstract Nacro, S. (2017) The Effect of Aphthona whitfieldi (Coleoptera: Chrysomelidae) Aphthona whitfieldi Bryant (Coleoptera: Chrysomelidae) is a major insect Populations’ Density on the Growth of pest of Jatropha curcas L. in Burkina Faso. This study aimed at evaluating the Jatropha curcas in Burkina Faso. Advances effect of the insect pest populations’ density on the growth of the plant. To in Entomology, 5, 127-137. achieve this purpose, 90-day aged single plants were caged in a randomized https://doi.org/10.4236/ae.2017.54013 complete block design experiment with 5 treatments and 5 replicates. The Received: August 8, 2017 treatments consisted of increasing numbers of adults of A. whitfieldi used to Accepted: October 16, 2017 infest the caged plants: T0 (0 adult = check), T1 (100 adults), T2 (200 adults), Published: October 19, 2017 T3 (300 adults), T4 (400 adults). All caged plants were infested 21 days after transplantation and the evaluation started 14 days later one on every 2-week Copyright © 2017 by authors and Scientific Research Publishing Inc. basis from September 18, 2014 to February 19, 2015. The growth parameters This work is licensed under the Creative of the plant were assessed.
    [Show full text]
  • Petition for the Release of Aphthona Cyparissiae Against Leafy Spurge in the United States1
    Reprinted with permission from: USDA-ARS, March 19, 1986, unpublished. Petition for the release of Aphthona cyparissiae against leafy spurge in the 1 United States ROBERT W. PEMBERTON Part I TO: Dr. R. Bovey, Dept. of Range Science USDA/ARS/SR Texas A&M University College Station, TX 77843 U.S.A. Enclosed are the results of the research on the flea beetle Aphthona cyparissiae (Chrysomelidae). This petition is composed of two parts. The first is the report “Aph- thona cyparissiae (Kock) and A. flava Guill. (Coleopera: Chrysomelidae): Two candi- dates for the biological control of cypress and leafy spurge in North America” by G. Sommer and E. Maw which the Working Group reviewed on Canada’s behalf. Copies of this report should be in the Working Group’s files. This research, which was done at the Commonwealth Institute of Biological Control’s Delémont, Switzerland lab, showed A. cyparissiae to be specific to the genus Euphorbia of the Euphorbiaceae. This result agrees with the literature and field records for A. cyparissiae, which recorded it from: Euphorbia cyparissias, E. esula, E. peplus, E. seguieriana, and E. virgata. The Sommer and Maw report also included information on A. cyparissiae’s taxonomic position, life history, laboratory biology, mortality factors, feeding effects on the host plants, the Harris scoring system, as well as a brief description of the target plant – leafy spurge (Euphorbia esula complex), a serious pest of the rangelands of the Great Plains of North America. Based on this research, the Working Group gave permission to release A. cyparissiae in Canada and to import it into the USDA’s Biological Control of Weeds Quarantine in Al- bany, California, for additional testing.
    [Show full text]
  • Barcoding Chrysomelidae: a Resource for Taxonomy and Biodiversity Conservation in the Mediterranean Region
    A peer-reviewed open-access journal ZooKeys 597:Barcoding 27–38 (2016) Chrysomelidae: a resource for taxonomy and biodiversity conservation... 27 doi: 10.3897/zookeys.597.7241 RESEARCH ARTICLE http://zookeys.pensoft.net Launched to accelerate biodiversity research Barcoding Chrysomelidae: a resource for taxonomy and biodiversity conservation in the Mediterranean Region Giulia Magoga1,*, Davide Sassi2, Mauro Daccordi3, Carlo Leonardi4, Mostafa Mirzaei5, Renato Regalin6, Giuseppe Lozzia7, Matteo Montagna7,* 1 Via Ronche di Sopra 21, 31046 Oderzo, Italy 2 Centro di Entomologia Alpina–Università degli Studi di Milano, Via Celoria 2, 20133 Milano, Italy 3 Museo Civico di Storia Naturale di Verona, lungadige Porta Vittoria 9, 37129 Verona, Italy 4 Museo di Storia Naturale di Milano, Corso Venezia 55, 20121 Milano, Italy 5 Department of Plant Protection, College of Agriculture and Natural Resources–University of Tehran, Karaj, Iran 6 Dipartimento di Scienze per gli Alimenti, la Nutrizione e l’Ambiente–Università degli Studi di Milano, Via Celoria 2, 20133 Milano, Italy 7 Dipartimento di Scienze Agrarie e Ambientali–Università degli Studi di Milano, Via Celoria 2, 20133 Milano, Italy Corresponding authors: Matteo Montagna ([email protected]) Academic editor: J. Santiago-Blay | Received 20 November 2015 | Accepted 30 January 2016 | Published 9 June 2016 http://zoobank.org/4D7CCA18-26C4-47B0-9239-42C5F75E5F42 Citation: Magoga G, Sassi D, Daccordi M, Leonardi C, Mirzaei M, Regalin R, Lozzia G, Montagna M (2016) Barcoding Chrysomelidae: a resource for taxonomy and biodiversity conservation in the Mediterranean Region. In: Jolivet P, Santiago-Blay J, Schmitt M (Eds) Research on Chrysomelidae 6. ZooKeys 597: 27–38. doi: 10.3897/ zookeys.597.7241 Abstract The Mediterranean Region is one of the world’s biodiversity hot-spots, which is also characterized by high level of endemism.
    [Show full text]
  • Integrated Noxious Weed Management Plan: US Air Force Academy and Farish Recreation Area, El Paso County, CO
    Integrated Noxious Weed Management Plan US Air Force Academy and Farish Recreation Area August 2015 CNHP’s mission is to preserve the natural diversity of life by contributing the essential scientific foundation that leads to lasting conservation of Colorado's biological wealth. Colorado Natural Heritage Program Warner College of Natural Resources Colorado State University 1475 Campus Delivery Fort Collins, CO 80523 (970) 491-7331 Report Prepared for: United States Air Force Academy Department of Natural Resources Recommended Citation: Smith, P., S. S. Panjabi, and J. Handwerk. 2015. Integrated Noxious Weed Management Plan: US Air Force Academy and Farish Recreation Area, El Paso County, CO. Colorado Natural Heritage Program, Colorado State University, Fort Collins, Colorado. Front Cover: Documenting weeds at the US Air Force Academy. Photos courtesy of the Colorado Natural Heritage Program © Integrated Noxious Weed Management Plan US Air Force Academy and Farish Recreation Area El Paso County, CO Pam Smith, Susan Spackman Panjabi, and Jill Handwerk Colorado Natural Heritage Program Warner College of Natural Resources Colorado State University Fort Collins, Colorado 80523 August 2015 EXECUTIVE SUMMARY Various federal, state, and local laws, ordinances, orders, and policies require land managers to control noxious weeds. The purpose of this plan is to provide a guide to manage, in the most efficient and effective manner, the noxious weeds on the US Air Force Academy (Academy) and Farish Recreation Area (Farish) over the next 10 years (through 2025), in accordance with their respective integrated natural resources management plans. This plan pertains to the “natural” portions of the Academy and excludes highly developed areas, such as around buildings, recreation fields, and lawns.
    [Show full text]
  • New DNA Markers Reveal Presence of Aphthona Species (Coleoptera: Chrysomelidae) Believed to Have Failed to Establish After Release Into Leafy Spurge
    Biological Control 49 (2009) 1–5 Contents lists available at ScienceDirect Biological Control journal homepage: www.elsevier.com/locate/ybcon New DNA markers reveal presence of Aphthona species (Coleoptera: Chrysomelidae) believed to have failed to establish after release into leafy spurge R. Roehrdanz a,*, D. Olson b,1, G. Fauske b, R. Bourchier c, A. Cortilet d, S. Sears a a Biosciences Research Laboratory, Red River Valley Agricultural Research Center, Agricultural Research Service, US Department of Agriculture, 1605 Albrecht Blvd, Fargo, ND 58105, United States b Department of Entomology, North Dakota State University, Fargo, ND, United States c Agriculture and Agri-Food Canada, Lethbridge, AB, Canada d Agricultural Resources Management and Development Division - Weed Integrated Pest Management Unit, Minnesota Department of Agriculture, St. Paul, MN, United States article info abstract Article history: Six species of Aphthona flea beetles from Europe have been introduced in North America for the purpose Received 28 September 2007 of controlling a noxious weed, leafy spurge (Euphorbia esula). In the years following the releases, five of Accepted 10 December 2008 the species have been recorded as being established at various locations. There is no evidence that the Available online 31 December 2008 sixth species ever became established. A molecular marker key that can identify the DNA of the five established species is described. The key relies on restriction site differences found in PCR amplicons Keywords: of a portion of the mitochondrial cytochrome oxidase I gene. Three restriction enzymes are required to Flea beetles separate the immature specimens which are not visually separable. Adults which can be quickly sepa- Leafy spurge rated into the two black species and three brown species require only two restriction enzymes to resolve Euphorbia esula Aphthona the species.
    [Show full text]
  • (Leafy Spurge), on a Native Plant Euphorbia Robusta
    Non-target impacts of Aphthona nigriscutis, a biological control agent for Euphorbia esula (leafy spurge), on a native plant Euphorbia robusta John L. Baker, Nancy A.P. Webber and Kim K. Johnson1 Summary Aphthona nigriscutis Foudras, a biological control agent for Euphorbia esula L. (leafy spurge), has been established in Fremont County, Wyoming since 1992. Near one A. nigriscutis release site, a mixed stand of E. esula and a native plant, Euphorbia robusta Engelm., was discovered in 1998. During July of 1999, A. nigriscutis was observed feeding on both E. esula and E. robusta. A total of 31 E. robusta plants were located and marked on about 1.5 ha of land that had an E. esula ground-cover of over 50%. Eighty-seven percent of the E. robusta plants showed adult feeding damage. There was 36% mortality for plants with heavy feeding, 12% mortality for plants with light feeding, and no mortality for plants with no feeding. By August of 2002, the E. esula ground-cover had declined to less than 6% and the E. robusta had increased to 542 plants of which only 14 plants (2.6%) showed any feeding damage. For the four-year period, the E. esula ground-cover was inversely correlated to E. robusta density and posi- tively correlated to A. nigriscutis feeding damage, showing that as E. esula density declines so does Aphthona nigriscutis feeding on E. robusta. Keywords: Aphthona, density, Euphorbia, mortality, non-target impacts. Introduction established populations. These sites were monitored annually to assess the establishment of the bioagents. A parcel of land 4.8 km (3 miles) south-west of Lander, There was a strong contrast between the Majdic land Fremont County, Wyoming has been infested with and the Christiansen properties where the insects were Euphorbia esula (leafy spurge) for over 30 years.
    [Show full text]
  • Inundative Release of Aphthona Spp. Flea Beetles (Coleoptera: Chrysomelidae) As a Biological "Herbicide" on Leafy Spurge in Riparian Areas
    Inundative Release of Aphthona spp. Flea Beetles (Coleoptera: Chrysomelidae) as a Biological "Herbicide" on Leafy Spurge in Riparian Areas 5 R. A. PROCAR,l G. MARKIN,2 J. MILAN T. BARBOULETOS,3 AND M. J. RINELLA ABSTRACT Inundative releases of beneficial insects are frequently used to suppress pest insects but not commonly attempted as a method of weed biological control because of the difficulty in obtaining the required large numbers of insects. The successful establishment of a flea beetle complex, mixed Aphthona lacertoea (Rosenhauer) and Aphthona nigriscutus Foundras (87 and 13%, respectively), for the control of leafy spurge, Euphorbia esula L, provided an easily collectable source of these natural enemies that enabled us to attempt inundative release as a possible leafy spurge control method in a sensitive riparian ecological zone where chemical control is restricted. Our target weed populations were small isolated patches of leafy spurge along three streams in southwestern, central, and north- eastern Idaho. This study assessed leafy spurge and associated vegetation responses to Inundative releases of 10 and 50 beetles per spurge flowering stem over two consecutive years. Releasing 10 beetles per flowering stem had inconclusive effects on spurge biomass, crown, stem, and seedling density. Alternatively, releasing 50 beetles per flowering stem resulted in a reduction of biomass, crown and stem density in the range of 60-80% at all three study sites, and about an =60% reduction of seedling density at one site, compared with untreated plots. In contrast to leafy spurge, associated vegetation did not conclusively respond to beetle release, indicating that it may take more than two years for desired riparian vegetation to respond to reductions in leafy spurge competition.
    [Show full text]
  • Coleoptera, Chrysomelidae) in Azerbaijan
    Turk J Zool 25 (2001) 41-52 © T†BÜTAK A Study of the Ecofaunal Complexes of the Leaf-Eating Beetles (Coleoptera, Chrysomelidae) in Azerbaijan Nailya MIRZOEVA Institute of Zoology, Azerbaijan Academy of Sciences, pr. 1128, kv. 504, Baku 370073-AZERBAIJAN Received: 01.10.1999 Abstract: A total of 377 leaf-eating beetle species from 69 genera and 11 subfamilies (Coleoptera, Chrysomelidae) were revealed in Azerbaijan, some of which are important pests of agriculture and forestry. The leaf-eating beetle distribution among different areas of Azerbaijan is presented. In the Great Caucasus 263 species are noted, in the Small Caucasus 206, in Kura - Araks lowland 174, and in Lenkoran zone 262. The distribution of the leaf-eating beetles among different sites is also described and the results of zoogeographic analysis of the leaf-eating beetle fauna are presented as well. Eleven zoogeographic groups of the leaf-eating beetles were revealed in Azerbaijan, which are not very specific. The fauna consists mainly of the common species; the number of endemic species is small. Key Words: leaf-eating beetle, larva, pest, biotope, zoogeography. AzerbaycanÕda Yaprak Bšcekleri (Coleoptera, Chrysomelidae) FaunasÝ †zerinde AraßtÝrmalar …zet: AzerbeycanÕda 11 altfamilyadan 69 cinse ait 377 YaprakbšceÛi (Col.: Chrysomelidae) tŸrŸ belirlenmißtir. Bu bšceklerden bazÝlarÝ tarÝm ve orman alanlarÝnda zararlÝ durumundadÝr. Bu •alÝßmada YaprakbšcekleriÕnin AzerbeycanÕÝn deÛißik bšlgelerindeki daÛÝlÝßlarÝ a•ÝklanmÝßtÝr. BŸyŸk KafkasyaÕda 263, KŸ•Ÿk KafkasyaÕda 206, KŸr-Aras ovasÝnda 174, Lenkaran BšlgesiÕnde ise 262 tŸr bulunmußtur. Bu tŸrlerin farklÝ biotoplardaki durumu ve daÛÝlÝßlarÝ ile ilgili zoocografik analizleride bu •alÝßmada yer almaktadÝr. AzerbeycanÕda belirlenen Yaprakbšcekleri 11 zoocografik grupda incelenmißtir. YapÝlan bu fauna •alÝßmasÝnda belirlenen tŸrlerin bir•oÛu yaygÝn olarak bulunan tŸrlerdir, endemik tŸr sayÝsÝ olduk•a azdÝr.
    [Show full text]
  • Biology of Aphthona Nigriscutis (Coleoptera: 1 Chrysomelidae) in the Laboratory
    Reprinted with permission from: Annals of the Entomological Society of America. July 1997. 90(4):433-437. Published and copyrighted by: ©1998 Entomological Society of America. www.entsoc.org Biology of Aphthona nigriscutis (Coleoptera: 1 Chrysomelidae) in the laboratory JAN J. JACKSON Northern Grain Insects Research Laboratory, USDA-ARS, 2923 Medary Avenue, Brookings, SD 57006 Abstract: The flea beetle Aphthona nigriscutis Foudras was introduced to Canada in 1983 and the United States in 1989 for the biological control of leafy spurge, Euphorbia esula L. Life history data for A. nigriscutis are de- scribed based on laboratory studies using insect populations from Barnes County, North Dakota, and Fallon County, Montana. Initial emergence of males and females from spring soil samples was synchronized, but com- plete emergence for males preceded that of females. For the Barnes County population, ≈80% of the adults were female. When adults were held as mated pairs at 25° C and a photoperiod of 14:10 (L:D) h, male lon- gevity was longer than that of the female with a median longevity of 221 and 124 days, respectively. Oviposition started ≈10 days after female emergence and proceeded at a rate of 4 eggs per day over an average ovi- position period of 109 days. Oviposition averaged 537 eggs per female with a range of 103-1,157. Eggs from the Fallon County population started to hatch within 10 days after oviposition when eggs were held at 25° C. Egg hatch averaged near 60% and occurred over a period of ≈8 days. Life history data for A. nigriscutis were similar to other univoltine Aphthona spp., except A.
    [Show full text]