Biological Control 37 (2006) 1–8 www.elsevier.com/locate/ybcon Mitochondrial DNA diversity and Wolbachia infection in the Xea beetle Aphthona nigriscutis (Coleoptera: Chrysomelidae): An introduced biocontrol agent for leafy spurge R. Roehrdanz a,¤, D. Olson b, R. Bourchier c, S. Sears a, A. Cortilet d, G. Fauske b a Biosciences Research Laboratory, Red River Valley Agricultural Research Center, Agricultural Research Service, US Department of Agriculture, Fargo, ND, USA b Department of Entomology, North Dakota State University, Fargo, ND, USA c Agriculture and Agri-Food Canada, Lethbridge, Alta., Canada d Agricultural Resources Management and Development Division, Weed Integrated Pest Management Unit, Minnesota Department of Agriculture, St. Paul, MN, USA Received 12 April 2005; accepted 7 December 2005 Available online 20 January 2006 Abstract Aphthona nigriscutis is one of several species of Aphthona Xea beetles that have been introduced into North America in an eVort to control the weed, leafy spurge (Euphorbia esula). It has been a very eVective biological control agent at some locations but not at others. Overall genetic diversity is one parameter that could have an eVect on Aphthona establishment at speciWc locations. We have examined the genetic diversity of mitochondrial DNA in populations of A. nigriscutis from several North American collection sites. The results indicate that the insects are divided into two mtDNA clades. About 78% of the individuals comprise a clade (A) that has little or no mtDNA diversity. The remaining insects in the other clade (B) display extensive diversity with 15 haplotypes observed. The two subpopulations coexist at most locations. The bacterial endosymbiont Wolbachia has been discovered in some individuals. About 86% of the individuals from mtDNA clade A tested positive for Wolbachia. Portions of the Wolbachia ftsZ and wspA genes were sequenced and the sequences have been shown to fall within the Wolbachia Supergroup A. None of the insects from clade B appear to be infected. The association of Wolbachia with one, but not both, mtDNA clades of A. nigriscutis may play a role in limiting genetic diversity within beetle populations. Published by Elsevier Inc. Keywords: Aphthona nigriscutis; Flea beetles; Wolbachia; Biological control; Euphorbia esula; Leafy spurge; Mitochondrial DNA; Genetic variation; mtDNA 1. Introduction tles have become established (Anderson et al., 1999; Team Leafy Spurge). Four species account for almost all of the Several species of Chrysomelid Xea beetles from the currently established populations, Aphthona Xava Guille- genus Aphthona have been introduced into North America beau, Aphthona cyparissiae Koch, Aphthona lacertosa since the late 1980s in an eVort to control the invasive weed, Rosenheim, and Aphthona nigriscutis Foudras. The latter leafy spurge (Euphorbia esula L.). Both the plants and the two are dominant at most established North American insects are natives of Eurasia. In a broad sense, biological sites. control of leafy spurge has been quite eVective, with an 80– One downside that has become apparent as the beetle 90% reduction of spurge at sites where Aphthona Xea bee- populations have been expanded in both natural dispersal and continued introductions is that they fail to establish at many spurge infested locations. This diYculty is more pro- * Corresponding author. Fax: +1 701 239 1348. nounced in A. nigriscutis. Species diVerences in habitat pref- E-mail address: [email protected] (R. Roehrdanz). erences and dispersal capabilities along with local variation 1049-9644/$ - see front matter. Published by Elsevier Inc. doi:10.1016/j.biocontrol.2005.12.004 2 R. Roehrdanz et al. / Biological Control 37 (2006) 1–8 in the spurge may explain some of the failures (Flaherty, apolis-St. Paul metropolitan area. RIV is near Grass Lake 2001; Jonsen et al., 2001; Müller-Schärer et al., 2004; Mun- (lat: 44.81807, long: ¡93.45514), FCL is by the Flying dal et al., 1999). The presence of a genetic bottleneck and a Cloud Airport (lat: 44.81895, long: ¡93.47341) (both north reduction in genetic diversity could also restrict the eVec- of the river), and BLU is at Blue Lake (lat: 44.79591, long: tiveness of the beetles in certain environments or on certain ¡93.43922) which is south of the river. The ALB4 site is in strains of leafy spurge. Many insects imported as potential southern Alberta, Canada about 20 km southwest of Leth- biological control agents are collected as small populations bridge, AB (lat: 49.584167, long: ¡112.871111). A. nigriscu- from one or few sites and may not reXect the full genetic tis was incidental at two other sites in southern Alberta, diversity of the species. Consideration of the genetic diver- ALB1 (lat: 49.244722, long: ¡113.260278) and ALB3 (lat: sity has the potential for making biological control agents 49.181389, long: ¡113.308333). more broadly eVective (Hopper et al., 1993). Many of the The most frequent Aphthona species found at these sites Aphthona beetles redistributed in the central USA and was A. lacertosa, but A. cyparissiae and A. Xava could Canadian prairies also come from a relatively small number sometimes be present in small numbers. Initial sorting sepa- of beetle recollection sites. A genetic bottleneck may have rated the black beetles, A. lacertosa, from all of the others occurred at initial collection sites for importation and/or at which are brown. Specimens, as numbered sample exem- collection sites for redistribution of A. nigriscutis, resulting plars, were submitted to Dr. Fauske for species identiWca- in a narrowed genetic base that may limit beetle adaptabil- tion. Species determinations were based upon external ity at new release sites. morphology, internal morphology, and genitalic dissection. Little is known about the inherent genetic variability of Previously identiWed mtDNA clades were than assigned to the Aphthona species, either as released populations in species based upon matching sequences in the morphologi- North America or as endemic species in Europe and Asia. cally determined specimens. Our overall goal is to assess the genetic variation of the Aphthona populations that have become established in the 2.2. DNA preparation and PCR USA and Canada, beginning with an examination of mito- chondrial DNA. There have been reports of Wolbachia Total beetle DNA was extracted from either whole infections in North American A. nigriscutis (Kazmer, 2001; insects or the head and thorax portion via the high salt pro- Nowierski et al., 2001). Wolbachia infections can have a cedure of Cheung et al. (1993). Alternatively, DNA was direct inXuence on reducing the diversity of mtDNA (Arm- extracted from one of the hind legs using the DNeasy Tis- bruster et al., 2003; Behura et al., 2001; Shoemaker et al., sue kit (Qiagen, Valencia, CA). When only a partial insect 2003). There are conXicting views regarding the possible was used, the remainder of the insect was returned to the extent to which Wolbachia may also aVect the nuclear freezer at the Biosciences Research Laboratory in Fargo as genetic diversity (Ballard et al., 2002; Telschow et al., 2002). a voucher specimen. The mitochondrial primers 16S2 (LR- Because A. nigriscutis is such an important biocontrol N-12945 5Ј-GCGACCTCGATGTTGGATT) and C2R agent of leafy spurge, any factor that may aVect its estab- (C2-J-3684 5Ј-GGTCAATGTTCAGAAATTTGTGG) lishment and reproductive success is of interest. Therefore, were used to amplify a portion of the mtDNA about 9 kb in we also tested the populations for the presence of Wolba- length. Reaction components were from the Applied Bio- chia and deWned the Wolbachia that we found. This report sciences XL kit and the long PCR conditions and mtDNA details the mtDNA diversity from the species A. nigriscutis, primers were as described previously (Roehrdanz, 1995; the distribution of that diversity, and the impact of Wolba- Roehrdanz and Degrugillier, 1998). The PCR products chia on that diversity. were digested with the restriction endonucleases XbaI, AseI, AluI, SspI, DraI, DpnII or HinfI. VeriWcation of the proper 2. Materials and methods sized amplicons and the restriction fragment length poly- morphism (RFLP) patterns were made using agarose gel 2.1. Insects electrophoresis and ethidium bromide staining in the com- pany of molecular size standards. Individual RFLP pat- Adult A. nigriscutis were collected from established sites terns were given an alphabetical designation while the in North Dakota (ND), Minnesota (MN), and Alberta composite haplotypes were numbered in the order they (AB), Canada. Insects from the USA were brought to were discovered. Some initial haplotype numbers in Fargo live and frozen at ¡80 °C for future use. Insects from sequence were discarded when those individuals were deter- Canada were frozen in Canada and sent to Fargo packed in mined to belong to one of the other existing haplotypes. dry ice. The three ND collection sites were near Medora (MED) (lat: 46.9444, long: ¡103.5333) in southwestern ND, 2.3. Wolbachia near Lisbon (LIS) (lat: 46.4166, long: ¡97.5000) in the southeastern part of the state, and in Ward County (WAR) The presence of Wolbachia was determined by conduct- (lat: 48.3083, long: ¡101.3333) near Minot in north central ing PCR with primers speciWc for Wolbachia genes. The ND. The Minnesota collections were from the Minnesota primers ftsZ-1 (5Ј-GTTGTCGCAAATACCGATGC) and River Valley in Eden Prairie and Shakopee near the Minne- ftsZ-2 (5Ј-CTTAAGTAAGCTGGTATATC) amplify R. Roehrdanz et al. / Biological Control 37 (2006) 1–8 3 about 1050 bp of the ftsZ cell cycle protein. FtsZ-F (5Ј-T established sites except the two Canadian sites, ALB1 and ACTGACTGTTGGAGTTGTAACTAAGCCGT) and ABL3. At those two locations only 1/62 and 1/73, respec- ftsZ-R (5Ј-TGCCAGTTGCAAGAACAGAAACTCTAA tively, were A. nigriscutis, however 60–80% of the beetles CTC) amplify about 570 bp in the middle of the larger ftsZ were black (A. lacertosa) and the minority brown beetles segment (Werren et al., 1995b).