DOCSLIB.ORG

Evidence That Lokern Virus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Evidence That Lokern Virus Tangudu et al. Virology Journal (2018) 15:122 https://doi.org/10.1186/s12985-018-1031-6 RESEARCH Open Access Evidence that Lokern virus (family Peribunyaviridae) is a reassortant that acquired its small and large genome segments from Main Drain virus and its medium genome segment from an undiscovered virus Chandra S. Tangudu1, Jermilia Charles1 and Bradley J. Blitvich1,2* Abstract Background: Lokern virus (LOKV) is a poorly characterized arthropod-borne virus belonging to the genus Orthobunyavirus (family Peribunyaviridae). All viruses in this genus have tripartite, single-stranded, negative-sense RNA genomes, and the three RNA segments are designated as small, (S), medium (M) and large (L). A 559 nt. region of the M RNA segment of LOKV has been sequenced and there are no sequence data available for its S or L RNA segments. The purpose of this study was to sequence the genome of LOKV. Methods: The genome of LOKV was fully sequenced by unbiased high-throughput sequencing, 5′ and 3′ rapid amplification of cDNA ends, reverse transcription-polymerase chain reaction and Sanger sequencing. Results: The S and L RNA segments of LOKV consist of 952 and 6864 nt. respectively and both have 99.0% nucleotide identity with the corresponding regions of Main Drain virus (MDV). In contrast, the 4450-nt. M RNA segment has only 59.0% nucleotide identity with the corresponding region of MDV and no more than 72.7% nucleotide identity with all other M RNA segment sequences in the Genbank database. Phylogenetic data support these findings. Conclusions: This study provides evidence that LOKV is a natural reassortant that acquired its S and L RNA segments from MDV and its M RNA segment from an undiscovered, and possibly extinct, virus. The availability of complete genome sequence data facilitates the accurate detection, identification and diagnosis of viruses and viral infections, and this is especially true for viruses with segmented genomes because it can be difficult or even impossible to differentiate between reassortants and their precursors when incomplete sequence data are available. Keywords: Lokern virus, Main drain virus, Orthobunyavirus, Peribunyaviridae, Reassortant, Genome sequence, High- throughput sequencing * Correspondence: [email protected] 1Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, Ames, IA, USA 22116 Veterinary Medicine, Iowa State University, Ames, Iowa 50011, USA © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Tangudu et al. Virology Journal (2018) 15:122 Page 2 of 8 Background has been sequenced (Genbank Accession no. AY593736.1) Lokern virus (LOKV) is a poorly characterized virus in the and no sequence data are available for the S or L RNA genus Orthobunyavirus (family Peribunyaviridae). The segments. The objective of this study is to fully sequence genus has previously been separated into serogroups, with the genome of LOKV and to determine its genetic and LOKV classified in the Bunyamwera (BUN) serogroup [1]. phylogenetic relationships with other BUN serogroup Other viruses in this serogroup include Batai virus viruses. (BATV), Bunyamwera virus (BUNV), Cache Valley virus (CVV), Maguari virus (MAGV), Ngari virus (NRIV), Methods Northway virus (NORV), and Tensaw virus (TENV). Virus LOKV was originally isolated from Culex tarsalis mosqui- LOKV (isolate FMS 4332) was obtained from the World toes in California in 1962 [2]. Additional isolations have Reference Center for Emerging Viruses and Arboviruses been made from arthropods of various species as well as at the University of Texas Medical Branch in Galveston, rabbits and hares in the western half of the United States, TX. The virus had been passaged 13 times in suckling with most isolates recovered from Culicoides spp. midges mouse brains prior to receipt and underwent an additional [2–5]. Serologic data indicate that the geographic range of passage in African Green Monkey kidney (Vero) cells at LOKV also includes the eastern half of the United States Iowa State University. [6]. LOKV is not a recognized pathogen of humans or ver- tebrate animals but its ability to cause disease has not High-throughput sequencing been widely investigated. Total RNA was extracted from subconfluent monolayers All viruses in the genus Orthobunyavirus possess a tri- of LOKV-infected Vero cells using Trizol Reagent (Ther- partite, single-stranded, negative-sense RNA genome [7]. moFisher, Carlsbad, CA), fragmented using RNase III The three RNA segments are designated as small, (S), (New England BioLabs, Ipswich, MA) and assessed for medium (M) and large (L) and are approximately 1.0, quality using an Agilent 2100 Bioanalyzer (Agilent, Santa 4.5 and 6.9 kb in length, respectively. Complementary Clara, CA). Libraries were constructed using the Ion Total and highly conserved nucleotide sequences are located RNA-Seq Kit v2 (ThermoFisher) and assessed for quality at the 5′ and 3′ termini of each RNA segment. Base and analyzed at the Genomic Technologies Facility at pairing of these sequences results in the formation of Iowa State University using an Ion Proton Sequencer panhandle structures assumed to be required for the ini- (ThermoFisher). Ion-Torrent reads were mapped to the tiation of genome transcription and replication [8, 9]. genome of Chlorocebus sabaeus using Bowtie 2 in order The S RNA segment codes the nucleocapsid (N) protein to identify host cell sequences [17]. Unmapped reads were and a nonstructural protein NSS in overlapping reading analyzed using the sortMeRNA program to remove frames [10]. The M RNA segment codes for a polypro- rRNA-related reads [18]. All remaining reads with Phred tein that is post-translationally processed to generate the values ≥ 33 were subjected to de novo SPAdes (ver 3.5.0) N- and C-terminal glycoproteins, Gn and Gc, and a non- assembly [19]. Contigs were mapped to a reference ortho- structural protein NSM [11]. The L RNA segment codes bunyavirus genome (MDV for S and L RNA segment for the L protein which functions as the RNA-dependent sequences; CVV for M RNA segment sequences) using RNA polymerase [12]. LASTZ [20]. Alignment files were manually verified on The exchange of RNA segments (genome reassortment) Tablet [21]. between closely-related orthobunyaviruses can occur when a vector or host is co-infected with two or more vi- Reverse transcription-polymerase chain reaction and sanger ruses [13, 14]. Reassortment is considered to be a major sequencing means of evolution for these viruses because the resulting Reverse transcription-polymerase chain reaction (RT- progeny can possess new and advantageous genetic and PCR) and Sanger sequencing were performed to verify phenotypic traits. Reassortment sometimes generates vi- LOKV sequences generated by high-throughput sequen- ruses that are more pathogenic than their donor viruses. cing and to close gaps between contigs. Complementary One example is NRIV which acquired its S and L RNA DNAs were generated using Superscript III reverse tran- segments from BUNV and its M RNA segment from scriptase (ThermoFisher) and PCRs were performed using BATV [15, 16]. NRIV has been associated with large out- high-fidelity Taq polymerase (ThermoFisher) in accord- breaks of hemorrhagic fever in humans in East Africa ance to the manufacturer’s instructions. Primers were de- while the most serious disease manifestations associated signed from the sequences generated by high-throughput with its precursor viruses are low-grade fever and myalgia. sequencing and are available upon request. RT-PCR prod- The genome of LOKV has not been fully sequenced. A ucts were purified using the purelink gel extraction kit 559 nt. region of the M RNA segment that spans part of (ThermoFisher) and sequenced using a 3730 × 1 DNA se- the 5′ untranslated region (UTR) and Gn coding region quencer (Applied Biosystems, Foster City, CA). Tangudu et al. Virology Journal (2018) 15:122 Page 3 of 8 5′ and 3′ rapid amplification of cDNA ends Table 1 Genetic relatedness of the small, medium and large The 5′ and 3′ ends of each RNA segment were identi- genome segments of Lokern virus and its closest known relatives fied using 5′ and 3′ rapid amplification of cDNA ends, Virus Lokern virus respectively. Briefly, 20 pmol of pre-adenylated DNA % nucleotide identity % amino acid identity ′ a adaptor (5 -rApp/TGGAATTCTCGGGTGCCAAGGT/ Small Medium Large N NSS ML ′ μ ddC-3 ) was ligated to 1 g of viral genomic and Abbey Lake virus 70.9 59.8 71.4 73.4 64.0 55.0 76.5 anti-genomic RNAs using 200 U of T4 RNA ligase 2 (New Batai virus 79.5 68.7 73.1 88.4 90.1 71.5 80.7 England BioLabs) and incubated for 1 h at 25 °C. Ligated b–– –– products were recovered by ethanol precipitation and Birao virus 78.3 87.6 85.0 complementary cDNAs were created using Superscript III Bozo virus 76.3 ––79.0 78.2 –– reverse transcriptase and an adapter-specific primer. PCRs Bunyamwera virus 80.0 63.4 73.5 89.7 86.2 62.4 81.1 were performed using adapter- and gene-specific primers, Cache Valley virus 83.5 72.5 76.1 89.3 94.1 78.4 85.5 and RT-PCR products were purified and subjected to Cholul virus 83.3 58.6 – 89.3 94.1 54.4 – Sanger sequencing. Fort Sherman virus 81.8 72.7 76.3 91.0 93.1 77.9 86.0 – – Nucleotide and amino acid sequence alignments Germiston virus 71.1 59.3 73.8 67.0 54.7 Nucleotide and predicted amino acid sequences of LOKV Ilesha virus 79.6 67.4 73.4 86.7 85.2 67.0 80.2 were aligned with other sequences in the Genbank data- Main Drain virus 99.0 59.0 99.0 99.6 100.0 53.9 99.0 base by application of BLASTn and BLASTp, respectively.
Load more

Recommended publications
  • California Encephalitis Orthobunyaviruses in Northern Europe
    California encephalitis orthobunyaviruses in northern Europe NIINA PUTKURI Department of Virology Faculty of Medicine, University of Helsinki Doctoral Program in Biomedicine Doctoral School in Health Sciences Academic Dissertation To be presented for public examination with the permission of the Faculty of Medicine, University of Helsinki, in lecture hall 13 at the Main Building, Fabianinkatu 33, Helsinki, 23rd September 2016 at 12 noon. Helsinki 2016 Supervisors Professor Olli Vapalahti Department of Virology and Veterinary Biosciences, Faculty of Medicine and Veterinary Medicine, University of Helsinki and Department of Virology and Immunology, Hospital District of Helsinki and Uusimaa, Helsinki, Finland Professor Antti Vaheri Department of Virology, Faculty of Medicine, University of Helsinki, Helsinki, Finland Reviewers Docent Heli Harvala Simmonds Unit for Laboratory surveillance of vaccine preventable diseases, Public Health Agency of Sweden, Solna, Sweden and European Programme for Public Health Microbiology Training (EUPHEM), European Centre for Disease Prevention and Control (ECDC), Stockholm, Sweden Docent Pamela Österlund Viral Infections Unit, National Institute for Health and Welfare, Helsinki, Finland Offical Opponent Professor Jonas Schmidt-Chanasit Bernhard Nocht Institute for Tropical Medicine WHO Collaborating Centre for Arbovirus and Haemorrhagic Fever Reference and Research National Reference Centre for Tropical Infectious Disease Hamburg, Germany ISBN 978-951-51-2399-2 (PRINT) ISBN 978-951-51-2400-5 (PDF, available
    [Show full text]
  • A Look Into Bunyavirales Genomes: Functions of Non-Structural (NS) Proteins
    viruses Review A Look into Bunyavirales Genomes: Functions of Non-Structural (NS) Proteins Shanna S. Leventhal, Drew Wilson, Heinz Feldmann and David W. Hawman * Laboratory of Virology, Rocky Mountain Laboratories, Division of Intramural Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Hamilton, MT 59840, USA; [email protected] (S.S.L.); [email protected] (D.W.); [email protected] (H.F.) * Correspondence: [email protected]; Tel.: +1-406-802-6120 Abstract: In 2016, the Bunyavirales order was established by the International Committee on Taxon- omy of Viruses (ICTV) to incorporate the increasing number of related viruses across 13 viral families. While diverse, four of the families (Peribunyaviridae, Nairoviridae, Hantaviridae, and Phenuiviridae) contain known human pathogens and share a similar tri-segmented, negative-sense RNA genomic organization. In addition to the nucleoprotein and envelope glycoproteins encoded by the small and medium segments, respectively, many of the viruses in these families also encode for non-structural (NS) NSs and NSm proteins. The NSs of Phenuiviridae is the most extensively studied as a host interferon antagonist, functioning through a variety of mechanisms seen throughout the other three families. In addition, functions impacting cellular apoptosis, chromatin organization, and transcrip- tional activities, to name a few, are possessed by NSs across the families. Peribunyaviridae, Nairoviridae, and Phenuiviridae also encode an NSm, although less extensively studied than NSs, that has roles in antagonizing immune responses, promoting viral assembly and infectivity, and even maintenance of infection in host mosquito vectors. Overall, the similar and divergent roles of NS proteins of these Citation: Leventhal, S.S.; Wilson, D.; human pathogenic Bunyavirales are of particular interest in understanding disease progression, viral Feldmann, H.; Hawman, D.W.
    [Show full text]
  • Genetic and Phylogenetic Characterization Of
    Article Genetic and Phylogenetic Characterization of Tataguine and Witwatersrand Viruses and Other Orthobunyaviruses of the Anopheles A, Capim, Guamá, Koongol, Mapputta, Tete, and Turlock Serogroups Alexey M. Shchetinin 1, Dmitry K. Lvov 1, Petr G. Deriabin 1, Andrey G. Botikov 1, Asya K. Gitelman 1, Jens H. Kuhn 2 and Sergey V. Alkhovsky 1,* Received: 2 September 2015; Accepted: 7 November 2015; Published: 23 November 2015 Academic Editors: Jane Tao and Pierre-Yves Lozach 1 D.I. Ivanovsky Institute of Virology, Gamaleya Federal Research Center for Epidemiology and Microbiology, Ministry of Health of the Russian Federation, 123098, Moscow, Russia; [email protected] (A.M.S.); [email protected] (D.K.L.); [email protected] (P.G.D.); [email protected] (A.G.B.); [email protected] (A.K.G.) 2 Integrated Research Facility at Fort Detrick, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Fort Detrick, Frederick, MD 21702, USA; [email protected] * Correspondence: [email protected]; Tel.: +7-499-190-3043; Fax: +7-499-190-2867 Abstract: The family Bunyaviridae has more than 530 members that are distributed among five genera or remain to be classified. The genus Orthobunyavirus is the most diverse bunyaviral genus with more than 220 viruses that have been assigned to more than 18 serogroups based on serological cross-reactions and limited molecular-biological characterization. Sequence information for all three orthobunyaviral genome segments is only available for viruses belonging to the Bunyamwera, Bwamba/Pongola, California encephalitis, Gamboa, Group C, Mapputta, Nyando, and Simbu serogroups. Here we present coding-complete sequences for all three genome segments of 15 orthobunyaviruses belonging to the Anopheles A, Capim, Guamá, Kongool, Tete, and Turlock serogroups, and of two unclassified bunyaviruses previously not known to be orthobunyaviruses (Tataguine and Witwatersrand viruses).
    [Show full text]
  • Orthobunyaviruses: from Virus Binding to Penetration Into Mammalian Host Cells
    viruses Review Orthobunyaviruses: From Virus Binding to Penetration into Mammalian Host Cells Stefan Windhaber 1 , Qilin Xin 2 and Pierre-Yves Lozach 1,2,* 1 CellNetworks—Cluster of Excellence and Center for Integrative Infectious Diseases Research (CIID), Department of Infectious Diseases, Virology, University Hospital Heidelberg, 69120 Heidelberg, Germany; [email protected] 2 Institut National de Recherche Pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Ecole Pratique des Hautes Etudes (EPHE), Viral Infections and Comparative Pathology (IVPC), UMR754-University Lyon, 69007 Lyon, France; [email protected] * Correspondence: [email protected] Abstract: With over 80 members worldwide, Orthobunyavirus is the largest genus in the Peribunyaviri- dae family. Orthobunyaviruses (OBVs) are arthropod-borne viruses that are structurally simple, with a trisegmented, negative-sense RNA genome and only four structural proteins. OBVs are potential agents of emerging and re-emerging diseases and overall represent a global threat to both public and veterinary health. The focus of this review is on the very first steps of OBV infection in mammalian hosts, from virus binding to penetration and release of the viral genome into the cytosol. Here, we address the most current knowledge and advances regarding OBV receptors, endocytosis, and fusion. Keywords: arbovirus; Bunyamwera; cell entry; emerging virus; endocytosis; fusion; La Crosse; Oropouche; receptor; Schmallenberg Citation: Windhaber, S.; Xin, Q.; Lozach, P.-Y. Orthobunyaviruses: 1. Introduction From Virus Binding to Penetration into Mammalian Host Cells. Viruses Orthobunyavirus consists of over 80 members that are globally distributed, which is a 2021, 13, 872. https://doi.org/ genus of the family Peribunyaviridae (Bunyavirales order) along with Herbevirus, Pacuvirus, 10.3390/v13050872 and Shangavirus (Table1)[ 1].
    [Show full text]
  • Characterization of Maguari Orthobunyavirus Mutants Suggests
    Virology 348 (2006) 224–232 www.elsevier.com/locate/yviro Characterization of Maguari orthobunyavirus mutants suggests the nonstructural protein NSm is not essential for growth in tissue culture ⁎ Elizabeth Pollitt, Jiangqin Zhao, Paul Muscat, Richard M. Elliott ,1 Division of Virology, Institute of Biomedical and Life Sciences, University of Glasgow, Church Street, Glasgow G11 5JR, Scotland, UK Received 9 November 2005; returned to author for revision 23 November 2005; accepted 15 December 2005 Available online 30 January 2006 Abstract Maguari virus (MAGV; genus Orthobunyavirus, family Bunyaviridae) contains a tripartite negative-sense RNA genome. Like all orthobunyaviruses, the medium (M) genome segment encodes a precursor polyprotein (NH2-Gn-NSm-Gc-COOH) for the two virion glycoproteins Gn and Gc and a nonstructural protein NSm. The nucleotide sequences of the M segment of wild-type (wt) MAGV, of a temperature-sensitive (ts) mutant, and of two non-ts revertants, R1 and R2, that show electrophoretic mobility differences in their Gc proteins were determined. Twelve amino acid differences (2 in Gn, 10 in Gc) were observed between wt and ts MAGV, of which 9 were maintained in R1 and R2. The M RNA segments of R1 and R2 contained internal deletions, resulting in the removal of the N-terminal 239 residues of Gc (R1) or the C- terminal two thirds of NSm and the N-terminal 431 amino acids of Gc (R2). The sequence data were consistent with analyses of the virion RNAs and virion glycoproteins. These results suggest that neither the N-terminal domain of Gc nor an intact NSm protein is required for the replication of MAGV in tissue culture.
    [Show full text]
  • Role of Bunyamwera Orthobunyavirus Nss Protein in Infection of Mosquito Cells
    Role of Bunyamwera Orthobunyavirus NSs Protein in Infection of Mosquito Cells Agnieszka M. Szemiel1, Anna-Bella Failloux2, Richard M. Elliott1* 1 Biomedical Sciences Research Complex, School of Biology, University of St. Andrews, North Haugh, St. Andrews, Scotland, United Kingdom, 2 Department of Virology, Institut Pasteur, Paris, France Abstract Background: Bunyamwera orthobunyavirus is both the prototype and study model of the Bunyaviridae family. The viral NSs protein seems to contribute to the different outcomes of infection in mammalian and mosquito cell lines. However, only limited information is available on the growth of Bunyamwera virus in cultured mosquito cells other than the Aedes albopictus C6/36 line. Methodology and Principal Findings: To determine potential functions of the NSs protein in mosquito cells, replication of wild-type virus and a recombinant NSs deletion mutant was compared in Ae. albopictus C6/36, C7-10 and U4.4 cells, and in Ae. aegypti Ae cells by monitoring N protein production and virus yields at various times post infection. Both viruses established persistent infections, with the exception of NSs deletion mutant in U4.4 cells. The NSs protein was nonessential for growth in C6/36 and C7-10 cells, but was important for productive replication in U4.4 and Ae cells. Fluorescence microscopy studies using recombinant viruses expressing green fluorescent protein allowed observation of three stages of infection, early, acute and late, during which infected cells underwent morphological changes. In the absence of NSs, these changes were less pronounced. An RNAi response efficiently reduced virus replication in U4.4 cells transfected with virus specific dsRNA, but not in C6/36 or C7/10 cells.
    [Show full text]
  • Bunyaviridae Family and the Orthobunyavirus for BUNV Replication (8)
    Bunyamwera orthobunyavirus glycoprotein precursor is processed by cellular signal peptidase and signal peptide peptidase Xiaohong Shia,1, Catherine H. Bottingb, Ping Lia, Mark Niglasb, Benjamin Brennana, Sally L. Shirranb, Agnieszka M. Szemiela, and Richard M. Elliotta,2 aMedical Research Council–University of Glasgow Centre for Virus Research, University of Glasgow, Glasgow G61 1QH, United Kingdom; and bBiomedical Sciences Research Complex, University of St. Andrews, St. Andrews KY16 9ST, United Kingdom Edited by Peter Palese, Icahn School of Medicine at Mount Sinai, New York, NY, and approved June 17, 2016 (received for review February 29, 2016) The M genome segment of Bunyamwera virus (BUNV)—the pro- (II and IV) (Fig. S1A), and its N-terminal domain (I) is required totype of both the Bunyaviridae family and the Orthobunyavirus for BUNV replication (8). genus—encodes the glycoprotein precursor (GPC) that is proteo- Cleavage of BUNV GPC is mediated by host proteases, but the lytically cleaved to yield two viral structural glycoproteins, Gn and Gc, details of which proteases are involved and the precise cleavage sites and a nonstructural protein, NSm. The cleavage mechanism of ortho- have not been clarified. Experimental data on GPC processing have bunyavirus GPCs and the host proteases involved have not been only been reported for snowshoe hare orthobunyavirus (SSHV); the clarified. In this study, we investigated the processing of BUNV GPC C terminus of SSHV Gn was determined by C-terminal amino acid and found that both NSm and Gc proteins were cleaved at their own sequencing to be an arginine (R) residue at position 299 (9) (Fig.
    [Show full text]
  • And Evidence That Estero Real Virus Is a Member of the Genus Orthonairovirus
    Am. J. Trop. Med. Hyg., 99(2), 2018, pp. 451–457 doi:10.4269/ajtmh.18-0201 Copyright © 2018 by The American Society of Tropical Medicine and Hygiene Genetic Characterization of the Patois Serogroup (Genus Orthobunyavirus; Family Peribunyaviridae) and Evidence That Estero Real Virus is a Member of the Genus Orthonairovirus Patricia V. Aguilar,1,2,3* William Marciel de Souza,4 Jesus A. Silvas,1,2,3 Thomas Wood,5 Steven Widen,5 Marc´ılio Jorge Fumagalli,4 and Marcio ´ Roberto Teixeira Nunes6* 1Department of Pathology, University of Texas Medical Branch, Galveston, Texas; 2Institute for Human Infection and Immunity, Galveston, Texas; 3Center for Tropical Diseases, Galveston, Texas; 4Virology Research Center, School of Medicine of Ribeirão Preto, University of São Paulo, Ribeirão Preto, Sao Paulo, Brazil; 5Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, Texas; 6Center for Technological Innovation, Instituto Evandro Chagas, Ananindeua, Para, ´ Brazil Abstract. Estero Real virus (ERV) was isolated in 1980 from Ornithodoros tadaridae ticks collected in El Estero Real, Sancti Spiritus, Cuba. Antigenic characterization of the isolate based on serological methods found a relationship with Abras and Zegla viruses and, consequently, the virus was classified taxonomically within the Patois serogroup. Given the fact that genetic characterization of Patois serogroup viruses has not yet been reported and that ERV is the only virus within the Patois serogroup isolated from ticks, we recently conducted nearly complete genome sequencing in an attempt to gain further insight into the genetic relationship of ERV with other Patois serogroup viruses and members of Peri- bunyaviridae family (Bunyavirales order).
    [Show full text]
  • Taxonomy of the Order Bunyavirales: Update 2019
    Archives of Virology https://doi.org/10.1007/s00705-019-04253-6 VIROLOGY DIVISION NEWS Taxonomy of the order Bunyavirales: update 2019 Abulikemu Abudurexiti1 · Scott Adkins2 · Daniela Alioto3 · Sergey V. Alkhovsky4 · Tatjana Avšič‑Županc5 · Matthew J. Ballinger6 · Dennis A. Bente7 · Martin Beer8 · Éric Bergeron9 · Carol D. Blair10 · Thomas Briese11 · Michael J. Buchmeier12 · Felicity J. Burt13 · Charles H. Calisher10 · Chénchén Cháng14 · Rémi N. Charrel15 · Il Ryong Choi16 · J. Christopher S. Clegg17 · Juan Carlos de la Torre18 · Xavier de Lamballerie15 · Fēi Dèng19 · Francesco Di Serio20 · Michele Digiaro21 · Michael A. Drebot22 · Xiaˇoméi Duàn14 · Hideki Ebihara23 · Toufc Elbeaino21 · Koray Ergünay24 · Charles F. Fulhorst7 · Aura R. Garrison25 · George Fú Gāo26 · Jean‑Paul J. Gonzalez27 · Martin H. Groschup28 · Stephan Günther29 · Anne‑Lise Haenni30 · Roy A. Hall31 · Jussi Hepojoki32,33 · Roger Hewson34 · Zhìhóng Hú19 · Holly R. Hughes35 · Miranda Gilda Jonson36 · Sandra Junglen37,38 · Boris Klempa39 · Jonas Klingström40 · Chūn Kòu14 · Lies Laenen41,42 · Amy J. Lambert35 · Stanley A. Langevin43 · Dan Liu44 · Igor S. Lukashevich45 · Tāo Luò1 · Chuánwèi Lüˇ 19 · Piet Maes41 · William Marciel de Souza46 · Marco Marklewitz37,38 · Giovanni P. Martelli47 · Keita Matsuno48,49 · Nicole Mielke‑Ehret50 · Maria Minutolo3 · Ali Mirazimi51 · Abulimiti Moming14 · Hans‑Peter Mühlbach50 · Rayapati Naidu52 · Beatriz Navarro20 · Márcio Roberto Teixeira Nunes53 · Gustavo Palacios25 · Anna Papa54 · Alex Pauvolid‑Corrêa55 · Janusz T. Pawęska56,57 · Jié Qiáo19 · Sheli R. Radoshitzky25 · Renato O. Resende58 · Víctor Romanowski59 · Amadou Alpha Sall60 · Maria S. Salvato61 · Takahide Sasaya62 · Shū Shěn19 · Xiǎohóng Shí63 · Yukio Shirako64 · Peter Simmonds65 · Manuela Sironi66 · Jin‑Won Song67 · Jessica R. Spengler9 · Mark D. Stenglein68 · Zhèngyuán Sū19 · Sùróng Sūn14 · Shuāng Táng19 · Massimo Turina69 · Bó Wáng19 · Chéng Wáng1 · Huálín Wáng19 · Jūn Wáng19 · Tàiyún Wèi70 · Anna E.
    [Show full text]
  • Jamestown Canyon Virus Revisited: Are We Neglecting and Under Recognized Mosquito-Borne Disease ______
    ______________________________________ Jamestown Canyon Virus Revisited: Are We Neglecting and Under Recognized Mosquito-Borne Disease ________________________________________________ Theodore G. Andreadis, PhD Center for Vector Biology & Zoonotic Diseases and Northeast Regional Center for Excellence in Vector-Borne Diseases The Connecticut Agricultural Experiment Station New Haven, CT JAMESTOWN CANYON VIRUS • Mosquito-borne Orthobunyavirus (ss-RNA) found 1 2 1 38 throughout much of temperate North America 1 7 94 6 8 1 1 2 1 1 1 1 • First isolated in 1961 from Culiseta inornata in CO 2 1 1 • Human cases are comparatively rare but appear to be 2 1 on the rise (166 cases from 2004 – 2018) 3 • Mostly in Midwestern and Northeastern states Distribution Human Cases 2000-18 CDC ArboNet • Sero-prevalence = 6.7% - 48.2% - “Under Recognized” 80 • Causes acute febrile illness, fever, meningitis, or 70 Human cases = 166 meningoencephalitis Range = 10 – 84 yrs 60 Median = 48 yrs • Infects a variety of free ranging ungulates - deer, moose, 50 bison, elk (sero-prevalence: 21% in CT, 77% in WI) 40 • White-tailed deer recognized as principal amplification 30 hosts (experimental infections and prevalence of Ab) 20 • Isolated from 26 mosquito species, mostly boreal Aedes 10 • Vertically transmitted in mosquitoes 0 04 06 08 10 12 14 16 18 Matkovic et al (2019), Am. J. Trop. Med. Hyg., 100: 445–451 Enhanced Arboviral Surveillance to Increase Detection of Jamestown Canyon Virus Infections, Wisconsin, 2011–2016 Clinical manifestations of patients with Probable cases JCV disease Confirmed cases Fever 83% N = 30 General weakness 70% Headache 66% Nausea 37% Neck rigidity 30% Altered mental status 23% Dizziness 16% Photophobia 13% Tremors 13% Arthralgia 13% Seizures 6% Matkovic et al (2019), Am.
    [Show full text]
  • Phylogenetic Analysis of Bunyamwera and Ngari Viruses (Family Bunyaviridae, Genus Orthobunyavirus) Isolated in Kenya
    Epidemiol. Infect. (2016), 144, 389–395. © Cambridge University Press 2015 doi:10.1017/S0950268815001338 Phylogenetic analysis of Bunyamwera and Ngari viruses (family Bunyaviridae, genus Orthobunyavirus) isolated in Kenya 1,2,3 2 1 2 C. ODHIAMBO *, M. VENTER ,O.LWANDE,R.SWANEPOEL AND R. SANG1,3,4 1 Human Health Division, International Centre of Insect Physiology and Ecology, Nairobi, Kenya 2 Zoonoses Research Unit, Department of Medical Virology, University of Pretoria, Pretoria, South Africa 3 Centre for Virus Research, Kenya Medical Research Institute, Nairobi, Kenya 4 Division of Emerging Infectious Disease, United States Army Medical Research Unit, Kenya Received 17 December 2014; Final revision 30 April 2015; Accepted 30 May 2015; first published online 29 June 2015 SUMMARY Orthobunyaviruses, tri-segmented, negative-sense RNA viruses, have long been associated with mild to severe human disease in Africa, but not haemorrhagic fever. However, during a Rift Valley fever outbreak in East Africa in 1997–1998, Ngari virus was isolated from two patients and antibody detected in several others with haemorrhagic fever. The isolates were used to identify Ngari virus as a natural Orthobunyavirus reassortant. Despite their potential to reassort and cause severe human disease, characterization of orthobunyaviruses is hampered by paucity of genetic sequences. Our objective was to obtain complete gene sequences of two Bunyamwera virus and three Ngari virus isolates from recent surveys in Kenya and to determine their phylogenetic positioning within the Bunyamwera serogroup. Newly sequenced Kenyan Bunyamwera virus isolates clustered closest to a Bunyamwera virus isolate from the same locality and a Central African Republic isolate indicating that similar strains may be circulating regionally.
    [Show full text]
  • Sequence Analysis of the Small (S) Rna Segment Of
    SEQUENCE ANALYSIS OF THE SMALL (S) RNA SEGMENT OF VIRUSES IN THE GENUS ORTHOBUNYAVIRUS Maizan Mohamed A Thesis Submitted for the Degree of PhD at the University of St. Andrews 2007 Full metadata for this item is available in the St Andrews Digital Research Repository at: https://research-repository.st-andrews.ac.uk/ Please use this identifier to cite or link to this item: http://hdl.handle.net/10023/434 This item is protected by original copyright This item is licensed under a Creative Commons License SEQUENCE ANALYSIS OF THE SMALL (S) RNA SEGMENT OF VIRUSES IN THE GENUS ORTHOBUNYAVIRUS MAIZAN MOHAMED University of St. Andrews, UK A thesis submitted for the degree of Doctor of Philosophy at the University of St. Andrews July, 2007 2 Abstract Viruses in the genus Orthobunyavirus (family Bunyaviridae ) are classified serologically into 18 serogroups. The viruses have a tripartite genome of negative sense RNA composed of large (L), medium (M) and small (S) segments. The L segment encodes the polymerase protein, the M segment encodes two glycoproteins, Gc and Gn, and a non-structural protein (NSm), and the S segment encodes nucleocapsid (N) and NSs proteins, in overlapping reading frames (ORF). The NSs proteins of Bunyamwera and California serogroup viruses have been shown to play a role in inhibiting host cell protein synthesis and preventing induction of interferon in infected cells. To-date, viruses in only 4 serogroups: Bunyamwera, California, Group C and Simbu, have been studied intensively. Therefore, this study was conducted with the aim to sequence the S RNA segments of representative viruses in the other 14 orthobunyavirus serogroups, to analyse virus-encoded proteins synthesised in infected cells, and to investigate their ability to cause shutoff of host protein synthesis.
    [Show full text]