SF3B2-Mediated RNA Splicing Drives Human Prostate

Author Manuscript Published OnlineFirst on August 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3965 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

1 SF3B2-mediated RNA splicing drives human prostate cancer progression 2 3 Norihiko Kawamuraa,b,1, Keisuke Nimuraa,1,2, Kotaro Sagaa, Airi Ishibashia, Koji 4 Kitamuraa,c, Hiromichi Naganoa, Yusuke Yoshikawad, Kyoso Ishidaa,e, Norio 5 Nonomurab, Mitsuhiro Arisawad, Jun Luof & Yasufumi Kanedaa,2 6 7 aDivision of Gene Therapy Science, Osaka University Graduate School of Medicine, 8 Suita, Osaka 565-0871, Japan 9 bDepartment of Urology, Osaka University Graduate School of Medicine, Suita, 10 Osaka 565-0871, Japan 11 cDepartment of Otorhinolaryngology-Head and Neck surgery, Osaka University 12 Graduate School of Medicine, Suita, Osaka 565-0871, Japan 13 dGraduate School of Pharmaceutical Sciences, Osaka University 14 Yamada-oka 1-6, Suita, Osaka 565-0871, Japan 15 eDepartment of Gynecology, Osaka University Graduate School of Medicine, Suita, 16 Osaka 565-0871, Japan 17 fJames Buchanan Brady Urological Institute and Department of Urology, Johns 18 Hopkins University School of Medicine, 600 N. Wolfe St., Baltimore, MD 21287, 19 USA 20 1Co-first 21 2Corresponding author 22 23 Running title: SF3B2-mediated RNA splicing in prostate cancer progression 24 25 Keywords: SF3B2, RNA splicing, SF3b, AR-V7, prostate cancer 26 27 Significance: 28 RNA splicing factor SF3B2 is essential for the generation of an androgen receptor 29 (AR) variant that renders prostate cancer cells resistant to AR-targeting therapy. 30 31 Additional information: 32 This work was supported by Platform Project for Supporting Drug Discovery and 33 Life Science Research (Basis for Supporting Innovative Drug Discovery and Life

Downloaded from cancerres.aacrjournals.org on October 7, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3965 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

34 Science Research (BINDS)) from AMED under Grant Number JP19am0101084 and 35 DAICEL, Inc. to K. Nimura. 36 37 Corresponding authors: 38 Keisuke Nimura, Division of Gene Therapy Science, Osaka University Graduate 39 School of Medicine, Suita, Osaka 565-0871, Japan 40 tel:+81-6-6879-3901; fax:+81-6-6879-3909 41 [email protected] 42 Yasufumi Kaneda, Division of Gene Therapy Science, Osaka University Graduate 43 School of Medicine, Suita, Osaka 565-0871, Japan 44 tel:+81-6-6879-3901; fax:+81-6-6879-3909 45 [email protected] 46 47 N.K., K.N., and Y.K. made patents application with DAICEL, Inc.. 48 49 The manuscript includes 4,980 words of text including introduction, methods, results, 50 discussion, and 7 figures. Supplemental Information includes Extended 51 Experimental Procedures, 8 supplementary figures, and 3 supplementary tables. 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66

67 68 Abstract 69 Androgen receptor splice variant-7 (AR-V7) is a constitutively active AR variant 70 implicated in castration-resistant prostate cancers. Here, we show that the RNA 71 splicing factor SF3B2, identified by in silico and CRISPR/Cas9 analyses, is a critical 72 determinant of AR-V7 expression and is correlated with aggressive cancer 73 phenotypes. Transcriptome and PAR-CLIP analyses revealed that SF3B2 controls 74 the splicing of target genes, including AR, to drive aggressive phenotypes. 75 SF3B2-mediated aggressive phenotypes in vivo were reversed by AR-V7 knockout. 76 Pladienolide B, an inhibitor of a splicing modulator of the SF3b complex, 77 suppressed the growth of tumors addicted to high SF3B2 expression. These 78 findings support the idea that alteration of the splicing pattern by high SF3B2 79 expression is one mechanism underlying prostate cancer progression and 80 therapeutic resistance. This study also provides evidence supporting SF3B2 as a 81 candidate therapeutic target for treating cancer patients. 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99

100 101 INTRODUCTION 102 Splicing of precursor mRNA (pre-mRNA) is a critical process involving the 103 alternative use of exons/introns leading to diverse mature mRNAs from a limited 104 numbers of genes (1). Recent genome-wide analyses of cancer transcriptomes 105 have revealed globally aberrant splicing profiles including exon skipping and intron 106 retention in mature mRNAs (2,3). Although the molecular mechanisms underlying 107 aberrant splicing in cancer are largely unknown, one of the causes of aberrant 108 splicing in cancers may be mutations in splicing factors including SF3B1, U2AF1, 109 SRSF2 and ZRSR2, as well as altered expression of splicing factors, such as 110 RBFOX2, MBNL1/2, and QKI (2,4). 111 Prostate cancer is one of most frequently detected cancers in men. 112 Although the majority of localized prostate cancers are curable, progressive and 113 metastatic prostate cancer contributes to ~307,000 cancer deaths each year 114 worldwide (5). Androgen deprivation therapy (ADT) is the front line therapy for men 115 with metastatic prostate cancer, but almost all men develop castration-resistant 116 prostate cancer (CRPC) after first-line ADT. CRPC patients may be treated with 117 additional hormonal therapies, including abiraterone acetate and enzalutamide, 118 which are newly developed inhibitors of androgen-receptor (AR) signaling with 119 proven survival benefit in patients with CRPC (6–9). A significant proportion of men 120 with CRPC are resistant to abiraterone acetate and enzalutamide, and nearly all 121 men develop acquired resistance to these agents over a period of 1-2 years. 122 Because both abiraterone acetate and enzalutamide exhibit anti-cancer effects 123 through inhibiting of the ligand-binding domain at the C-terminus of the AR, they 124 may not suppress AR signaling mediated by truncated AR splice variants (AR-Vs) 125 lacking the ligand-binding domain (10). Among the many AR-Vs that have been 126 characterized (11), AR-V7 is most compatible with detection due to its high 127 frequency and abundance relative to other AR-Vs. Detection of AR-Vs has been 128 associated with aggressive prostate cancers and CRPC progression (10). These 129 findings suggest a critical role of splicing in modulating the activity of AR, a key 130 prostate cancer drug target associated with CRPC progression. However, key 131 splicing factors that are critical for AR-V7 generation have not been definitively 132 identified and characterized.

133 In the present study, we identified SF3B2 (also known as SF3b145 or 134 SAP145) as a positive splicing regulatory factor for AR-V7 by in silico analyses of 135 RNA binding factors associated with AR-V7 expression using transcriptome data 136 from prostate cancer patients followed by examination of AR-V7 expression after 137 the candidate splicing factors were knocked out by the CRISPR/Cas9 system. By 138 genome-wide RNA splicing analysis and photoactivatable ribonucleoside-enhanced 139 cross-linking immunoprecipitation (PAR-CLIP), we show that SF3B2 controls the 140 inclusion of SF3B2-bound exons and an exclusion of SF3B2-bound introns. 141 Moreover, Pladienolide B, an inhibitor of a splicing modulator SF3B complex, 142 repressed SF3B2-addicted tumor growth under castration conditions in vivo. 143 Collectively, these results indicate that SF3B2 is a critical determinant of RNA 144 splicing and gene expression patterns and controls the expression of key genes 145 associated with CRPC progression, such as AR-V7. 146 147 148 Materials and Methods 149 1. Cell culture and transfection 150 The 22Rv1 prostate cancer cell line was purchased from the American Type Culture 151 Collection. LNCaP95 was a gift from Dr. Luo. Cell line authentication was not 152 performed. All cells were confirmed to be mycoplasma-negative before inoculation 153 of cells into mice (TaKaRa). The length of time between thawing and use is less than 154 3 months. The detailed method is described in extended experimental procedures. 155 156 2. Xenograft prostate cancer model 157 All experiments using mice was approved by Osaka University Animal Experiments 158 committee and was performed following the guidelines. The in vivo tumor growth of 159 human prostate cancer cells was determined using a subcutaneous transplant 160 xenograft model. Male NOD/SCID (non-obese diabetic/severe combined 161 immunodeficient) mice (Charles River) were castrated surgically at 7 weeks of age. 162 Cancer cells (2 x 106 cells) in a PBS / Matrigel mixture were injected subcutaneously 163 into these castrated NOD/SCID mice at 8 week of age under deep anesthesia, and 164 the mice were maintained in a temperature-controlled and pathogen-free room. All 165 animals were handled according to approved protocols and the guidelines of the

166 Animal Committee of Osaka University. The tumor size was measured weekly, and 167 the tumor volume was calculated according to the following formula: tumor volume 168 (mm3) = length × (width)2 / 2. When the tumor volume reached ~100 - 300 mm3 for 169 22Rv1 or ~200 -400 mm3 for LNCaP95, the pladienolide B derivative (5 mg / kg) or 170 vehicle was administered intraperitoneally to each mouse on days 0, 2, 4 and 6, as 171 previously described (12) with minor modification. The relative tumor volume was 172 calculated as the ratio between the tumor volume at time t and the tumor volume at 173 the start of treatment. 174 175 3. Flow cytometry analysis and cell sorting 176 AR-V7-GFP cells were cultured in medium containing 0.5 μg/ml puromycin for 177 selection after transfection with gRNA targeting to genes of interest or control gRNA 178 for 5 days. FACSAria II (BD Biosciences) was used for flow cytometry. At least 179 50,000 events were collected per sample. After negative selection for doublet cells, 180 the remaining gated cells were analyzed and sorted based on GFP expression 181 levels. Dead cells were stained by PI (Dojindo) and Annexin V (Biolegend). The data 182 were analyzed using FlowJo software (Version 10). 183 184 4. Quantitative RT-PCR 185 RNA was isolated using the Isogen RNA extraction kit (Wako Pure Chemicals). 186 cDNA was synthesized from total RNA using the High-Capacity cDNA Reverse 187 Transcription kit (Applied Biosystems). qPCR was performed using the SYBR Green 188 PCR Master Mix (Applied Biosystems) and the CFX384 Real-Time System 189 (BIO-RAD). The primers used in this study are listed in Supplementary Table 1. 190 Genomic DNA contamination was examined by evaluating reverse transcription 191 reaction samples lacking reverse transcriptase. 192 193 5. RNA-seq 194 Sequencing libraries from at least two biological replicate RNA samples were 195 prepared using NEBNext Ultra RNA Library Prep Kits for Illumina (NEB) following 196 the manufacturer’s instructions. 197 198 6. RNA precipitation using Halo-tag

199 The Halo-tag was knocked-in immediately before the stop codon of the SF3B2 gene 200 in 22Rv1 cells. The total cell extracts of 5 X 10E6 SF3B2-Halo knocked-in cells were 201 incubated with 50 µl of Halo-Link Resin (Promega) overnight at 4°C to precipitate 202 SF3B2-RNA complexes. Contaminated genomic DNA was removed from the 203 extracted RNA using 1 µl of TURBO DNase (Thermo Fisher Scientific). Enrichment 204 of RNAs was determined by quantitative RT-PCR. 205 206 7. PAR-CLIP 207 PAR-CLIP was performed according to the original protocol (13) and another 208 protocol with some modifications (14). The antibodies used in this study are listed in 209 Supplementary Table 2. The detailed method is described in extended experimental 210 procedures. 211 212 8. Tandem affinity purification and mass spectrometry 213 The SF3B2-TAP-exprerssing prostate cancer cell line was generated from 22Rv1 214 cells. The SF3B2-TAP complex was purified from nuclear extracts by TAP 215 technology as previously described (15). The purified proteins were precipitated 216 with trichloroacetic acid and separated on SDS-PAGE gels. Protein bands stained 217 with silver were excised from the gel, in-gel digested with trypsin and analyzed by 218 tandem liquid chromatography/mass spectrometry (LC-MS/MS). 219 220 9. Bioinformatics 221 Deep-sequencing data are available under DRA accession DRA006189, which 222 includes the following: 3 PAR-CLIP libraries and 8 RNA-seq libraries. The detailed 223 methods are described in extended experimental procedures. 224 225 226 RESULTS 227 SF3B2 is identified as a splicing factor associated with AR-V7 expression by 228 in silico analysis of transcriptome data and by disruption of candidate genes 229 by CRISPR/Cas9 in prostate cancer 230 Because increased AR-V7 expression has been detected in CRPCs (16), we first 231 sought to identify splicing factor-encoding genes with increased expression in

232 CRPCs and AR-V7-positive prostate cancers (Figure 1A and 1B). Using previously 233 published microarray-based gene expression data in patients with benign, localized 234 prostate cancers and CRPCs (17), we compared the expression level of 309 genes 235 encoding splicing factors and RNA-binding proteins, selected by gene ontology 236 (GO) terms in AmiGO (18) (Figure 1A). This set of genes differentiated the three 237 sample groups by cluster analysis, with a general trend toward an upregulation in 238 CRPCs compared with localized prostate cancers and benign prostate samples 239 (Figure 1A). We further examined this subset of genes according to AR-V7 240 expression levels in the TCGA prostate cancer dataset (19). Using this in silico 241 approach, we identified 21 genes encoding splicing factors that were upregulated in 242 both CRPC and TCGA prostate tumors with high AR-V7 expression. (Figure 1B). 243 To determine the functional effect of the candidate splicing factors on 244 AR-V7 expression, we generated CWR22Rv1 (hereafter called 22Rv1) prostate 245 cancer cells with stable knock-in of green fluorescent protein (GFP) immediately 246 before the AR-V7 stop codon in AR cryptic exon 3 (AR-V7-GFP cells) using 247 CRISPR/Cas9 (Figure 1C and S1). The GFP cassette does not include polyA 248 sequence to avoid affecting the use of the cryptic exon 3 polyA site (20). 22Rv1 cells 249 have a tandem duplication of exon 3 and cryptic exon 3 in AR gene (21) (Figure 1C). 250 To avoid unexpected effect on further analysis, we selected a clone that lost the 251 tandem duplication (Figure 1C, S1A-S1C). Fusion of GFP with AR-V7 was 252 confirmed by Western blotting (Figure S1A and S1B) and FACS analysis of AR-V7 253 gRNA-transfected AR-V7-GFP cells (Figure S1D). Full-length AR (AR-FL) was 254 consistently expressed in AR-V7-GFP cells, compared to wild type 22Rv1 cells, 255 while AR-V7 expression was increased in AR-V7-GFP cells (Figure S1B and S1E). 256 It may be due to increasing stability of AR-V7 RNA, because AR-FL expression was 257 consistent (Figure S1B and S1E). We could not detect AR-V7-GFP protein by 258 AR-V7-specific antibody (Figure S1B), though we could detect the protein by GFP 259 antibody, FACS analysis or qPCR (Figure S1A, S1D, S1E). An addition of GFP at 260 the end of AR-V7 may prevent the AR-V7-specific antibody from recognizing the 261 C-terminus region of AR-V7. This cell line allowed for the examination of 262 endogenous AR-V7 expression through the evaluation of GFP. Transfection of 263 gRNAs against the 21 candidate genes revealed that a distinct AR-V7-GFP negative 264 population that was the most striking in SF3B2 gRNA-transfected cells without cell

265 death (Figure 1D, 1E, S2A, S2B, S2C and S2D). U2AF2 (also known as U2AF65) is 266 known to be correlated with AR-V7 expression (22). Although an increase in U2AF2 267 expression was detected in CRPCs and AR-V7-positive prostate cancers (Figure 268 S2E and S2F) and AR-V7-GFP negative cells were increased by U2AF2 gRNA 269 transfection (Figure S2B), the correlation between U2AF2 expression and AR-V7 270 expression in the RNAseq data of CRPCs was not consistent compared with SF3B2 271 (Figure S2F). These results support the conclusion that SF3B2 is a strong candidate 272 splicing factor involved in the regulation of AR-V7 expression. 273 Increased SF3B2 expression was detected in CRPCs and prostate 274 cancers with high AR-V7 expression (Figure 1F). SF3B2 expression was also 275 increased in prostate cancers with high Gleason scores (8-10), a pathological 276 indicator of prostate cancer malignancy, consistent with a similar pattern of AR-V7 277 expression (Figure 1G). In contrast, SF3B2 expression did not correlate with 278 full-length AR expression (Figure S2G). Notably, mutations in SF3B2 did not affect 279 AR-V7 expression or the Gleason score (Figure S2H). Higher SF3B2 expression 280 was associated with poor progression-free survival in prostate cancer (p = 0.0042 281 by log-rank test) (Figure 1H). Interestingly, high SF3B2 expression was also 282 associated with poor overall survival in bladder cancer (p = 0.0237), acute myeloid 283 leukemia (AML) (p = 0.0316), lung adenocarcinoma (p = 0.0109), head and neck 284 squamous cell carcinoma (p = 0.0491), and breast cancer (p = 0.0441) (Figure S3). 285 Thus, high SF3B2 expression was associated with aggressive phenotypes of 286 various human cancers, including prostate cancer, and SF3B2 may regulate the 287 expression of AR-V7 as well as other genes involved in cancer progression. 288 289 Depletion of SF3B2 decreases the expression of AR-V7 and 290 androgen-responsive genes in human prostate cancer cells 291 To examine whether SF3B2 regulates AR-V7 in cells with intact AR-V7 sequences, 292 AR-V7 protein expression in SF3B2 gRNA-transfected prostate cancer cells was 293 analyzed in 22Rv1 and LNCaP95 cells, another prostate cancer cell line expressing 294 endogenous AR-V7 (23). Transfection of SF3B2 gRNA decreased AR-V7 protein 295 expression in both cells, concomitantly correlating with reduced levels of SF3B2 296 (Figure 2A and 2B). 297 To further confirm the role of SF3B2 in the regulation of AR-V7, we used

298 the AR-V7-GFP signal as a marker for isolating SF3B2-depleted cells in SF3B2 299 gRNA-transfected AR-V7-GFP cells, since SF3B2 knockout cells could not be 300 established and siRNAs against SF3B2 could not efficiently decrease SF3B2 to 301 examine its function. SF3B2 protein was significantly depleted in 302 AR-V7-GFP-negative cells in SF3B2 gRNA-transfected AR-V7-GFP cells (lower), 303 while AR-V7-GFP-positive cells (upper) had comparable amounts of SF3B2 relative 304 to control cells (Figure 2C and 2D). Thus, we defined the isolated 305 AR-V7-GFP-negative cells from SF3B2 gRNA-transfected AR-V7-GFP cells as 306 SF3B2-depleted cells. Indeed, SF3B2-depleted cells lost not only SF3B2 but also 307 AR-V7 protein expression, while a weak decrease in AR-FL protein was detected 308 (Figure 2E). In contrast, AR-V7 depletion did not diminish the amounts of SF3B2 309 protein, suggesting that AR-V7 was not involved in the upregulation of SF3B2 310 expression (Figure 2F). Collectively, these results support a key role for SF3B2 in 311 the regulation of AR-V7 expression. 312 We next performed genome-wide mRNA expression analysis to determine 313 whether SF3B2 depletion led to altered expression of androgen-responsive genes 314 (Figure 2G, 2H, and S4A). SF3B2 depletion resulted in the decreased expression of 315 67 out of 100 androgen-responsive genes belonging to the gene set of 316 NELSON_RESPONSE_TO_ANDROGEN_UP (24), including KLK3 (also known as 317 prostate-specific antigen (PSA)) and transmembrane protease serine 2 (TMPRSS2), 318 but not ACTB (Figure 2G, 2H, and S4C). Thus, SF3B2 depletion in prostate cancer 319 cells led to significant decreases in the expression of AR-V7 and the majority of 320 androgen-responsive genes. 321 322 PAR-CLIP analysis identifies global SF3B2-binding sites 323 To investigate the genome-wide molecular functions of SF3B2, we determined the 324 binding sites of SF3B2 by PAR-CLIP analysis (13). A single band at the expected 325 size was detected in PAR-CLIP of tandem affinity purification-tagged SF3B2 326 (SF3B2-TAP) from whole cell extracts of 22Rv1 cells with stable SF3B2-TAP 327 expression (Figure 3A). SF3B2-bound RNAs from three independent experiments 328 were analyzed by deep sequencing, yielding ~460 M of reads in total. 329 SF3B2-binding sites were found not only in coding regions, including exons and 330 introns, but also intergenic regions including promoters (Figure 3B, S4D, and S4E).

331 To discover the SF3B2-recognizing RNA motif, the reads with a T-to-C 332 conversion by the PAR-CLIP reaction were analyzed by PARalyzer (25) and 333 cERMIT (26). cERMIT identified the CNNGU RNA sequence as the 334 SF3B2-recognizing RNA motif (p < 1E-08, compared with 1000 random scores), 335 following analysis of 3,154 clusters identified by PARalyzer and the exclusion of 336 clusters assigned to repeats and rRNA (Figure 3C and 3D). 337 Notably, SF3B2 bound to AR exon 1 and cryptic exon 3, the inclusion of 338 which would lead to the AR-V7 transcript (Figure 3E). SF3B2 depletion significantly 339 decreased transcription from these exons (Figure 3E), although SF3B2 depletion 340 did not significantly affect the expression of AR-FL protein (Figure 2E). This 341 difference might be caused by the stability of AR-FL protein. To examine whether 342 endogenous SF3B2 binds to the SF3B2-binding sites in AR, we established 22Rv1 343 cells carrying a Halo-tag knock-in immediately before the stop codon of SF3B2 344 (Figure 3F). RNA precipitation analysis of SF3B2-Halo revealed an enrichment of 345 RNAs in AR exon1 and cryptic exon 3 (Figure 3F). Thus, PAR-CLIP analysis of 346 SF3B2 revealed the genome wide SF3B2-binding sites, and confirmed SF3B2 347 binding to AR pre-mRNA including cryptic exon3, a critical exon for AR-V7. 348 349 SF3B2 regulates the splicing and expression of target genes 350 SF3B2 is a component of the SF3B1 (also known as SF3b155 or SAP155) complex, 351 known as SF3b, which functions as a component of U2-small nuclear 352 ribonucleoprotein (snRNP) in pre-mRNA splicing (27–29). We next explored the 353 genome-wide functions of SF3B2 in the regulation of splicing and gene expression. 354 SF3B2 depletion affected approximately one-fourth of the detected splicing events 355 (Figure S5A and S5B) and increased intron retention (IR) and exon skipping (ES) 356 (Figure S5C and S5D). The expression of SF3B2-target genes was decreased 357 according to the location and number of SF3B2-binding sites (Figure 4A and 4B), 358 implicating that SF3B2 binding to an intron is critical to controlling gene expression, 359 whereas the peak height of the SF3B2 binding site (xRPM) was not associated with 360 a decrease in expression of SF3B2 target genes (Figure 4C). 361 To examine whether SF3B2 modulates both an inclusion of exons and an 362 exclusion of introns in the SF3B2-binding sites, we performed meta-exon or -intron 363 analysis of transcripts or PAR-CLIP signals of SF3B2 at SF3B2-bound sites (Figure

364 4D-4G). PAR-CLIP signals of SF3B2 were detected across the meta-exon or –intron 365 regions (Figure 4D and 4E). The SF3B2 signals were stronger in exons than in 366 introns, possibly reflecting that the removed introns were degraded. Notably, 367 transcripts with SF3B2-bound exons were significantly decreased by SF3B2 368 depletion (p = 1E-11, Figure 4F), while transcripts with SF3B2-bound introns 369 demonstrated increased intron retention (p = 2E-15, Figure 4G). Collectively, these 370 results support a critical role for SF3B2 in the inclusion/exclusion of exons and 371 introns. 372 373 The SF3B2-recognizing motif in cryptic exon 3 is critical for the generation of 374 the AR-V7 transcript 375 To further demonstrate the critical role of SF3B2 binding to cryptic exon 3 (as shown 376 in Figure 3) in the splicing of AR-V7, we designed two gRNAs for the 377 SF3B2-recognizing motif to disrupt the SF3B2 binding sequence (Figure 5A). While 378 control gRNA recognizing the sequence between the cryptic exon 3 and the 379 SF3B2-binding site did not increase the GFP-negative population in AR-V7-GFP 380 cells compared with the control gRNA that does not contain the matched sequence 381 in the human genome (Figure 1E, 5B, and 5C), both gRNA #1 and #2 targeting the 382 SF3B2-recognizing motif significantly increased in the AR-V7-GFP-negative 383 population (p = 0.0001 or p < 0.0001, Figure 5C). The data indicate that the 384 SF3B2-binding site is necessary for inclusion of cryptic exon 3 into AR mRNA, i.e., 385 the generation of the mature AR-V7 transcript. 386 We next examined splicing between exon 3 and cryptic exon 3 or between 387 exon3 and exon4 in AR by quantitative PCR (qPCR) in the AR-V7-GFP-negative 388 population isolated from the SF3B2 core motif in cryptic exon 3-targeting 389 gRNA-transfected AR-V7-GFP cells (Figure 5D-5F). Splicing between exon 3 and 390 cryptic exon 3 was significantly decreased in the isolated AR-V7-GFP-negative 391 population, while splicing between exon 3 and exon 4 was not affected by disruption 392 of the SF3B2-binding site in cryptic exon 3 (Figure 5E). Conversely, SF3B2 393 overexpression increased splicing between exon 3 and cryptic exon 3 without 394 having a significant effect on splicing between exon 3 and exon 4 (Figure 5F). Thus, 395 SF3B2 binding to AR cryptic exon 3 of the AR plays a key role in the inclusion of this 396 target exon into AR-V7 mRNA.

397 398 SF3B2 overexpression enhances tumor growth in vivo and increases the 399 expression of AR-V7 and its target genes 400 Because high SF3B2 expression is associated with aggressive cancer phenotypes 401 in patients (Figure 1 and S3), we next examined whether SF3B2 overexpression 402 could alter phenotypes in prostate cancer cells. Consistent with the results showing 403 that SF3B2 increased AR-V7 splicing (Figure 5), SF3B2 overexpression increased 404 AR-V7 protein expression in two prostate cancer cell lines, while the full-length AR 405 protein was not significantly affected (Figure 6A, 6B, and 6C). Because AR-V7 406 promotes tumor growth in vivo, along with an increase in its target gene expression 407 (23,30), we examined the effect of SF3B2 overexpression on tumor growth in vivo 408 under an androgen-depleted conditions (Figure 6D and 6E). We demonstrated that 409 SF3B2 overexpression significantly promoted tumor growth in 22Rv1 and LNCaP95 410 cells under castration conditions (p < 0.05, Figure 6D and 6E). Notably, 411 SF3B2-mediated aggressive cancer phenotype was reversed by AR-V7 knockout 412 (Figure 6D, 6E, and S6), indicating that regulation of AR-V7 splicing is one of the 413 critical roles of SF3B2 in CRPC. 414 Because SF3B2 overexpression increased AR-V7 splicing, we next 415 examined whether SF3B2 overexpression promoted genome-wide changes in 416 splicing. Consistent with AR-V7 splicing, SF3B2 overexpression increased the 417 inclusion of SF3B2-bound exons (p < 2E-16, Figure 6F and S7A) and promoted the 418 splicing efficiency of SF3B2-bound introns (p < 2E-16, Figure 6G). SF3B2 depletion 419 led to a decrease in SF3B2-bound gene expression, while SF3B2 overexpression 420 led to both a decrease and an increase in SF3B2-bound gene expression (Figure 421 S7B). Consistent with the increase in AR-V7 expression, AR target genes, such as 422 KLK3 and KLK4, were significantly upregulated in response to SF3B2 423 overexpression (Figure 6H and S7C). Notably, AKT1 and UBE2C, which are the 424 AR-V7-specific target genes and regulate cell proliferation, were increased in 425 response to SF3B2 overexpression (23,30) (Figure 6H and S7C). SF3B2 426 overexpression also increased the expression of NOTCH1, which is implicated in 427 castration resistance and prostate cancer invasion (31,32). Depletion of SF3B2 led 428 to decreased NOTCH1 expression by altering the splicing of the NOTCH1 mRNA 429 (Figure S7D). Consistent with these altered gene expression patterns, GO terms

430 related to cell activation, including mitochondrion organization and ribosome 431 biogenesis, were significantly enriched in genes upregulated by SF3B2 432 overexpression (p < 0.001, Figure 6I). Thus, high SF3B2 expression leads to 433 aggressive phenotypes in prostate cancer with increased expression of genes 434 associated with cancer progression. 435 436 Pladienolide B represses growth of SF3B2-addicted tumors in vivo 437 Because SF3B2 has been shown to be involved in the SF3b complex (27–29), we 438 examined whether SF3B2 is associated with SF3b components in prostate cancer 439 cells. SF3B2-associated proteins were purified from the nuclear extracts of 22Rv1 440 cells with stable SF3B2-TAP expression by tandem affinity purification (Figure 7A). 441 SF3B2-TAP was localized to both the nucleus and the cytoplasm, consistent with 442 the localization of endogenous SF3B2 (Figure S8A). Mass spectrometry identified 443 an association of SF3B2 with SF3B1, SF3B3 (also known as SF3b130 or SAP130), 444 SF3B4 (also known as SF3b49 or SAP49), SF3A1 (also known as SF3a120 or 445 SAP114) and SF3A3 (also known as SF3a60 or SAP61) (Figure 7B). These results 446 indicate that SF3B2 is a key component of the SF3b complex. 447 Several compounds have been shown to inhibit splicing and exhibit 448 potential as anti-tumor drugs (33). Among them, pladienolide B, a commercially 449 available macrolide, has an anti-tumor activity and disrupts splicing through an 450 interaction with SF3B3 (12,34). As SF3B2 was associated with SF3B3 in prostate 451 cancer cells, we sought to determine whether pladienolide B is a candidate 452 therapeutic drug for aggressive cancers with high SF3B2 expression. Notably, 453 pladienolide B treatment reduced the interaction of SF3B2-TAP with its associated 454 proteins (Figure 7A and 7B). Given the effect of pladienolide B on SF3B2-associated 455 proteins, we examined its effect on AR-V7 splicing (Figure 7C and S8B). 456 Pladienolide B decreased AR-V7-GFP expression in AR-V7-GFP cells in a 457 dose-dependent manner. In addition, AR-V7 expression was significantly decreased 458 by pladienolide B treatment in both 22Rv1 and LNCap95 cells (Figure 7D and S8C). 459 AR-V7-GFP expression was also decreased in AR-V7-GFP cells after treatment 460 with spliceostatin A, another SF3b inhibitor (Figure S8D). Pladienolide B strongly 461 inhibited cell proliferation of 22Rv1 cells at a concentration of 4 nM, compared to a 462 lesser effect of normal human prostate cells PNT2 (Figure S8E and S8F). To

463 demonstrate its anti-tumor effect in vivo, pladienolide B was injected 464 intraperitoneally into hosts bearing 22Rv1 or LNCaP95 tumors with stable SF3B2 465 expression when the tumors reached sizes of ~100 - 300 mm3 or ~200 - 400 mm3, 466 respectively, under castrate conditions (Figure 7E, 7F, S8G, and S8H). Notably, 467 pladienolide B treatment resulted in significant regression of both tumors under 468 castration conditions (p < 0.01, Figure 7E and S8G). Moreover, tumors with stable 469 SF3B2 overexpression were more sensitive to a pladienolide B treatment than 470 tumors with GFP expression alone (p < 0.05, Figure 7F and p < 0.01, Figure S8H). 471 Therefore, the aggressive phenotype conferred by high SF3B2 overexpression may 472 be reversed by therapeutic targeting, and pladienolide B is a candidate therapeutic 473 drug for cancers that are addicted to high SF3B2 expression. 474 475 DISCUSSION 476 SF3B2 high expression confers aggressive prostate cancer phenotypes 477 Cancer cells exhibit not only altered gene expression levels but also splicing of 478 various genes related to cell proliferation or cell death (4,35). Mutations in genes 479 encoding splicing factors result in aberrant splicing and cell death in hematopoietic 480 cells (36,37). Mutations at splice sites also become a cause of aberrant splicing and 481 functional perturbation. However, aberrant splicing has been detected in cancer 482 without somatic mutations in either splicing factors or splice sites (35). Thus, the 483 mechanisms that alter splicing in cancer remain unclear. 484 Some splicing variants are known to mediate cancer progression (35). 485 Among them, a splicing variant of the AR, AR-V7, has a critical role in castration 486 resistance and anti-cancer drug sensitivity (10). Although an association of U2AF2, 487 Sam68 or CPSF1 with AR-V7 expression has been reported (38,22,20), it remains 488 unclear whether these splicing factors upregulate AR-V7 expression in patients with 489 prostate cancer and how AR-V7 expression is upregulated in CRPC. In the present 490 study, we now demonstrate that high SF3B2 expression, without a mutation in 491 SF3B2, increased AR-V7 through direct binding to AR cryptic exon 3 and conferred 492 an aggressive phenotype in prostate cancer by altering gene expression profiles. 493 Furthermore, high SF3B2 expression was associated with poor progression-free 494 survival and overall survival not only in patients with prostate cancer but also in 495 those with bladder cancer, AML, lung adenocarcinoma, head and neck squamous

496 cell carcinoma, and breast cancer (Figure S3), implying that high SF3B2 expression 497 may be related to other key splice variants that drive cancer progression similar to 498 AR in prostate cancer. Indeed, in breast cancer, MENAINV, a splicing variant of 499 MENA, a member of the ENA/VASP family of actin filament elongation factors, 500 promotes haptotaxis on fibronectin gradients, which is associated with metastasis, 501 and high MENAINV expression leads to poor overall survival (39). As another splicing 502 factor that leads to aggressive cancer phenotypes at high expression levels, SRSF1 503 (also known as SF2 or ASF) overexpression results in an increase in tumor growth 504 along with increases in a splicing variant of S6K1 (40). Thus, high expression of 505 splicing factors, including SF3B2, is a cause of the production of splicing variants 506 leading to an aggressive phenotype in cancer. 507 508 The molecular mechanisms of SF3B2 for regulating splicing 509 The spliceosome, a dynamic megadalton complex consisting of 5 small nuclear 510 ribonucleoproteins (snRNPs) (U1, U2, U4/U6, U5), is assembled on introns and 511 removes the vast majority of introns from pre-mRNAs (41). U2 snRNP recognizes 512 the branch point sequence in introns and promotes transesterification to produce a 513 lariat structure (42,43). SF3b, a multi-protein complex with SF3B1, SF3B2, SF3B3, 514 SF3B4, SF3B5, SF3B6, SF3B7, is a component of U2 snRNP (29). SF3B1 515 (SF3b155) and SF3B6 (p14) form the helix of U2 RNA and pre-mRNA, resulting in 516 the bulged adenosine in the branch point sequence that acts as the nucleophile (41). 517 SF3B1 (SF3b155) interacts with U2AF2 (U2AF65), which binds to the 518 polypyrimidine tract downstream of the branch point sequence (44,45). Consistently, 519 cross-linking and immunoprecipitation (CLIP)-seq of U2AF2 revealed that U2AF2 520 bound to the vast majority of 3’ splice sites (3’ SSs) (46). However, a key role for 521 SF3B2 has not been investigated in detail in previous studies. 522 SF3B2-associated proteins were not identical to the components of the 523 SF3B1 complex (Figure 7). Particularly, SF3B6 was not involved in 524 SF3B2-associated proteins, suggesting a distinct function from conventional SF3b 525 because SF3B6 binds to the bulged adenosine at the branch site (28). Moreover, 526 the global SF3B2 binding profile was different from U2AF2 (Figure 4). Although 527 there is a possibility that a difference between PAR-CLIP and CLIP causes a 528 different binding pattern, disruption of the SF3B2 motif, identified based on SF3B2

529 PAR-CLIP signals, in cryptic exon 3 in AR resulted in decreased AR-V7 expression 530 (Figure 5). The affinity of SF3B2 for RNA may depend on the context of the RNA 531 sequence or its associated proteins, potentially explaining the poor ability of SF3B2 532 PAR-CLIP to detect upstream branch point sites, as PAR-CLIP efficiently recovers 533 SF3B2-bound RNA and determines the binding sites at high resolution (13). Some 534 splicing factors, such as RBFOX2, promote both the inclusion and exclusion of their 535 target exons depending on their binding position by controlling the assembly of 536 splicing factors on pre-mRNAs (47). Similarly, SF3B2 depletion or overexpression 537 affected gene expression and splicing in a SF3B2 binding-dependent manner 538 (Figure 4 and 6). However, SF3B2 depletion did not affect expression and splicing in 539 all genes; as an example, ACTB, a housekeeping gene, was not affected by SF3B2 540 depletion (Figure S4C), suggesting that SF3B2 is associated more with the 541 regulation of splicing of SF3B2-bound RNA. Therefore, while SF3B1 is thought to 542 have a central role in SF3b function for general RNA splicing, our data indicates that 543 SF3B2 directly binds not only to introns but also to exons through recognizing a specific 544 RNA motif to promote an inclusion of the target exon. 545 546 A compound targeting the SF3B2-containing complex is a candidate 547 therapeutic drug for aggressive cancers with high SF3B2 expression 548 Although some drugs, such as abiraterone or enzalutamide, are effective for 549 controlling CRPC by suppressing the androgen-AR axis, CRPC eventually acquires 550 resistance to these treatments and such resistance may be mediated by modifying 551 the androgen-AR axis (10). Thus, there is a need to develop novel therapies 552 targeting resistance mechanisms, including AR-V7-mediated resistance to 553 AR-targeting therapies. The findings from the present study have therapeutic 554 implications for CRPC patients with high SF3B2 expression. Pladienolide B, a 555 splicing inhibitor, binds to SF3B3 and inhibits SF3B1 activity (34,48). Two clinical 556 trials of E7107, a derivative of pladienolides, showed that E7107 controlled tumor 557 growth in ~30% patients, but vision loss occurred in some patients in clinical trials (3 558 / 66) (49,50). The results indicate a potential of splicing inhibitors for cancer 559 treatment, although other pladienolide derivatives or a compound with a different 560 chemical structure are needed to avoid adverse events. 561 Pladienolide B showed strong anti-proliferative activity toward aggressive

562 prostate cancer cell tumors with high SF3B2 expression (Figure 7). The effect of 563 E7107 on the repression of tumor growth has been observed in a limited number of 564 patients (49,50), and in xenografts, the antitumor effect of E7107 is very diverse 565 depending on the cancer cell type (12). These findings suggest that splicing 566 inhibitors show strong anti-proliferative effects on aggressive tumors with a modified 567 splicing pattern by high expression levels of splicing factors. It was recently reported 568 that E7107 extends survival in a mouse model of leukemia with a splicing factor 569 SRSF2 mutation compared with those without a mutation, although it remains 570 unclear how the effect of E7107 is stronger in leukemia with the SRSF2 mutation 571 (36). Thus, biomarker-based patient selection, by expression level or mutation of a 572 splicing factor, may be required to demonstrate efficacy and strong antitumor activity 573 by a splicing inhibitor. Because Pladienolide B shows a strong anti-proliferative 574 effect on prostate cancer with SF3B2 overexpression under castrate conditions in 575 vivo, targeting SF3B2 by pharmacological inhibitors is a viable therapeutic strategy 576 for tumors driven by aberrant splicing. 577 578 ACKNOWLEDGMENTS 579 We thank Mayuko Okado and Mieko Watanabe for technical assistance and Dr. 580 Yukio Kawahara for technical advice. This work was supported by Platform Project 581 for Supporting Drug Discovery and Life Science Research (Basis for Supporting 582 Innovative Drug Discovery and Life Science Research (BINDS)) from AMED under 583 Grant Number JP19am0101084 and DAICEL, Inc. to K. Nimura. 584 585 586 587 REFERENCES 588 1. Lee Y, Rio DC. Mechanisms and Regulation of Alternative Pre-mRNA 589 Splicing. Annu Rev Biochem. 2015;84:291–323. 590 2. Danan-Gotthold M, Golan-Gerstl R, Eisenberg E, Meir K, Karni R, 591 Levanon EY. Identification of recurrent regulated alternative splicing events across 592 human solid tumors. Nucleic Acids Res. 2015;43:5130–44. 593 3. Dvinge H, Bradley RK. Widespread intron retention diversifies most cancer 594 transcriptomes. Genome Med. 2015;7:45.

595 4. Dvinge H, Kim E, Abdel-Wahab O, Bradley RK. RNA splicing factors as 596 oncoproteins and tumour suppressors. Nat Rev Cancer. 2016;16:413–30. 597 5. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. 598 Cancer incidence and mortality worldwide: Sources, methods and major patterns in 599 GLOBOCAN 2012. Int J Cancer. 2015;136:E359–86. 600 6. Beer TM, Armstrong AJ, Rathkopf DE, Loriot Y, Sternberg CN, Higano CS, 601 et al. Enzalutamide in Metastatic Prostate Cancer before Chemotherapy. N Engl J 602 Med. 2014;371:424–33. 603 7. de Bono JS, Logothetis CJ, Molina A, Fizazi K, North S, Chu L, et al. 604 Abiraterone and Increased Survival in Metastatic Prostate Cancer. N Engl J Med. 605 2011;364:1995–2005. 606 8. Ryan CJ, Smith MR, de Bono JS, Molina A, Logothetis CJ, de Souza P, et 607 al. Abiraterone in Metastatic Prostate Cancer without Previous Chemotherapy. N 608 Engl J Med. 2013;368:138–48. 609 9. Scher HI, Fizazi K, Saad F, Taplin M-E, Sternberg CN, Miller K, et al. 610 Increased Survival with Enzalutamide in Prostate Cancer after Chemotherapy. N 611 Engl J Med. 2012;367:1187–97. 612 10. Antonarakis ES, Armstrong AJ, Dehm SM, Luo J. Androgen receptor 613 variant-driven prostate cancer: clinical implications and therapeutic targeting. 614 Prostate Cancer Prostatic Dis. 2016;19:231–41. 615 11. Lu C, Luo J. Decoding the androgen receptor splice variants. Transl 616 Androl Urol. 2013;2:178–86. 617 12. Mizui Y, Sakai T, Iwata M, Uenaka T, Okamoto K, Shimizu H, et al. 618 Pladienolides, New Substances from Culture of Streptomyces platensis Mer-11107. 619 J Antibiot (Tokyo). 2004;57:188–196. 620 13. Hafner M, Landthaler M, Burger L, Khorshid M, Hausser J, Berninger P, et 621 al. Transcriptome-wide Identification of RNA-Binding Protein and MicroRNA Target 622 Sites by PAR-CLIP. Cell. 2010;141:129–41. 623 14. Yokoshi M, Li Q, Yamamoto M, Okada H, Suzuki Y, Kawahara Y. Direct 624 Binding of Ataxin-2 to Distinct Elements in 3′ UTRs Promotes mRNA Stability and 625 Protein Expression. Mol Cell. 2014;55:186–98. 626 15. Nimura K, Ura K, Shiratori H, Ikawa M, Okabe M, Schwartz RJ, et al. A 627 histone H3 lysine 36 trimethyltransferase links Nkx2-5 to Wolf-Hirschhorn syndrome.

628 Nature. 2009;460:287–91. 629 16. Hu R, Dunn TA, Wei S, Isharwal S, Veltri RW, Humphreys E, et al. 630 Ligand-Independent Androgen Receptor Variants Derived from Splicing of Cryptic 631 Exons Signify Hormone-Refractory Prostate Cancer. Cancer Res. 2009;69:16–22. 632 17. Grasso CS, Wu Y-M, Robinson DR, Cao X, Dhanasekaran SM, Khan AP, 633 et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 634 2012;487:239–43. 635 18. Carbon S, Ireland A, Mungall CJ, Shu S, Marshall B, Lewis S. AmiGO: 636 online access to ontology and annotation data. Bioinformatics. 2009;25:288–9. 637 19. The Cancer Genome Atlas Research Network. The Molecular Taxonomy 638 of Primary Prostate Cancer. Cell. 2015;163:1011–25. 639 20. Etten JLV, Nyquist M, Li Y, Yang R, Ho Y, Johnson R, et al. Targeting a 640 Single Alternative Polyadenylation Site Coordinately Blocks Expression of 641 Androgen Receptor mRNA Splice Variants in Prostate Cancer. Cancer Res. 642 2017;77:5228–35. 643 21. Li Y, Alsagabi M, Fan D, Bova GS, Tewfik AH, Dehm SM. Intragenic 644 Rearrangement and Altered RNA Splicing of the Androgen Receptor in a 645 Cell-Based Model of Prostate Cancer Progression. Cancer Res. 2011;71:2108–17. 646 22. Liu LL, Xie N, Sun S, Plymate S, Mostaghel E, Dong X. Mechanisms of the 647 androgen receptor splicing in prostate cancer cells. Oncogene. 2014;33:3140–50. 648 23. Hu R, Lu C, Mostaghel EA, Yegnasubramanian S, Gurel M, Tannahill C, et 649 al. Distinct Transcriptional Programs Mediated by the Ligand-Dependent 650 Full-Length Androgen Receptor and Its Splice Variants in Castration-Resistant 651 Prostate Cancer. Cancer Res. 2012;72:3457–62. 652 24. Nelson PS, Clegg N, Arnold H, Ferguson C, Bonham M, White J, et al. The 653 program of androgen-responsive genes in neoplastic prostate epithelium. Proc Natl 654 Acad Sci. 2002;99:11890–5. 655 25. Corcoran DL, Georgiev S, Mukherjee N, Gottwein E, Skalsky RL, Keene 656 JD, et al. PARalyzer: definition of RNA binding sites from PAR-CLIP short-read 657 sequence data. Genome Biol. 2011;12:R79. 658 26. Georgiev S, Boyle AP, Jayasurya K, Ding X, Mukherjee S, Ohler U. 659 Evidence-ranked motif identification. Genome Biol. 2010;11:R19. 660 27. Cretu C, Schmitzová J, Ponce-Salvatierra A, Dybkov O, De Laurentiis EI,

661 Sharma K, et al. Molecular Architecture of SF3b and Structural Consequences of Its 662 Cancer-Related Mutations. Mol Cell. 2016;64:307–19. 663 28. Will CL, Schneider C, MacMillan AM, Katopodis NF, Neubauer G, Wilm M, 664 et al. A novel U2 and U11/U12 snRNP protein that associates with the pre‐mRNA 665 branch site. EMBO J. 2001;20:4536–46. 666 29. Will CL, Urlaub H, Achsel T, Gentzel M, Wilm M, Lührmann R. 667 Characterization of novel SF3b and 17S U2 snRNP proteins, including a human 668 Prp5p homologue and an SF3b DEAD‐box protein. EMBO J. 2002;21:4978–88. 669 30. Guo Z, Yang X, Sun F, Jiang R, Linn DE, Chen H, et al. A Novel Androgen 670 Receptor Splice Variant Is Up-regulated during Prostate Cancer Progression and 671 Promotes Androgen Depletion–Resistant Growth. Cancer Res. 2009;69:2305–13. 672 31. Hafeez BB, Adhami VM, Asim M, Siddiqui IA, Bhat KM, Zhong W, et al. 673 Targeted Knockdown of Notch1 Inhibits Invasion of Human Prostate Cancer Cells 674 Concomitant with Inhibition of Matrix Metalloproteinase-9 and Urokinase 675 Plasminogen Activator. Clin Cancer Res. 2009;15:452–9. 676 32. Stoyanova T, Riedinger M, Lin S, Faltermeier CM, Smith BA, Zhang KX, et 677 al. Activation of Notch1 synergizes with multiple pathways in promoting 678 castration-resistant prostate cancer. Proc Natl Acad Sci. 2016;113:E6457–66. 679 33. Bonnal S, Vigevani L, Valcárcel J. The spliceosome as a target of novel 680 antitumour drugs. Nat Rev Drug Discov. 2012;11:847–59. 681 34. Kotake Y, Sagane K, Owa T, Mimori-Kiyosue Y, Shimizu H, Uesugi M, et 682 al. Splicing factor SF3b as a target of the antitumor natural product pladienolide. Nat 683 Chem Biol. 2007;3:570–5. 684 35. Sveen A, Kilpinen S, Ruusulehto A, Lothe RA, Skotheim RI. Aberrant RNA 685 splicing in cancer; expression changes and driver mutations of splicing factor genes. 686 Oncogene. 2016;35:2413–27. 687 36. Lee SC-W, Dvinge H, Kim E, Cho H, Micol J-B, Chung YR, et al. 688 Modulation of splicing catalysis for therapeutic targeting of leukemia with mutations 689 in genes encoding spliceosomal proteins. Nat Med. 2016;22:672–8. 690 37. Shirai CL, Ley JN, White BS, Kim S, Tibbitts J, Shao J, et al. Mutant 691 U2AF1 Expression Alters Hematopoiesis and Pre-mRNA Splicing In Vivo. Cancer 692 Cell. 2015;27:631–43. 693 38. Stockley J, Markert E, Zhou Y, Robson CN, Elliott DJ, Lindberg J, et al.

694 The RNA-binding protein Sam68 regulates expression and transcription function of 695 the androgen receptor splice variant AR-V7. Sci Rep. 2015;5:srep13426. 696 39. Oudin MJ, Jonas O, Kosciuk T, Broye LC, Guido BC, Wyckoff J, et al. 697 Tumor Cell–Driven Extracellular Matrix Remodeling Drives Haptotaxis during 698 Metastatic Progression. Cancer Discov. 2016;6:516–31. 699 40. Karni R, de Stanchina E, Lowe SW, Sinha R, Mu D, Krainer AR. The gene 700 encoding the splicing factor SF2/ASF is a proto-oncogene. Nat Struct Mol Biol. 701 2007;14:185–93. 702 41. Wahl MC, Will CL, Lührmann R. The Spliceosome: Design Principles of a 703 Dynamic RNP Machine. Cell. 2009;136:701–18. 704 42. BERGLUND JA, ROSBASH M, SCHULTZ SC. Crystal structure of a 705 model branchpoint–U2 snRNA duplex containing bulged adenosines. Rna. 706 2001;7:682–691. 707 43. MacMillan AM, Query CC, Allerson CR, Chen S, Verdine GL, Sharp PA. 708 Dynamic association of proteins with the pre-mRNA branch region. Genes Dev. 709 1994;8:3008–20. 710 44. Valcárcel J, Gaur RK, Singh R, Green MR. Interaction of U2AF65 RS 711 Region with Pre-mRNA of Branch Point and Promotion Base Pairing with U2 snRNA. 712 Science. 1996;273:1706–9. 713 45. Singh R, Valcarcel J, Green MR. Distinct binding specificities and 714 functions of higher eukaryotic polypyrimidine tract-binding proteins. Science. 715 1995;268:1173–6. 716 46. Shao C, Yang B, Wu T, Huang J, Tang P, Zhou Y, et al. Mechanisms for 717 U2AF to define 3′ splice sites and regulate alternative splicing in the human genome. 718 Nat Struct Mol Biol. 2014;21:997–1005. 719 47. Misra A, Ou J, Zhu LJ, Green MR. Global Promotion of Alternative Internal 720 Exon Usage by mRNA 3′ End Formation Factors. Mol Cell [Internet]. 2015 [cited 721 2015 Apr 28]; Available from: 722 http://www.sciencedirect.com/science/article/pii/S1097276515001811 723 48. Effenberger KA, Urabe VK, Prichard BE, Ghosh AK, Jurica MS. 724 Interchangeable SF3B1 inhibitors interfere with pre-mRNA splicing at multiple 725 stages. RNA. 2016;22:350–9. 726 49. Eskens FALM, Ramos FJ, Burger H, O’Brien JP, Piera A, Jonge MJA de,

727 et al. Phase I Pharmacokinetic and Pharmacodynamic Study of the First-in-Class 728 Spliceosome Inhibitor E7107 in Patients with Advanced Solid Tumors. Clin Cancer 729 Res. 2013;19:6296–304. 730 50. Hong DS, Kurzrock R, Naing A, Wheler JJ, Falchook GS, Schiffman JS, et 731 al. A phase I, open-label, single-arm, dose-escalation study of E7107, a precursor 732 messenger ribonucleic acid (pre-mRNA) splicesome inhibitor administered 733 intravenously on days 1 and 8 every 21 days to patients with solid tumors. Invest 734 New Drugs. 2014;32:436–44. 735 736 737 FIGURE LEGENDS 738 739 Figure 1. Identification of SF3B2 as a splicing modulating factor associated 740 with AR-V7 expression. (A) Heatmap of 309 genes encoding splicing factors or 741 RNA-binding proteins. Published microarray data for prostate cancers were 742 reanalyzed (17). Specimen types were color-coded, and included CRPC (n = 35), 743 localized prostate cancer (PC) (n = 59), and benign prostate tissue samples (n = 28). 744 (B) Schematic of the screening for candidate genes associated with the splicing for 745 AR-V7. (C) Schematic illustration of AR-FL and AR-V7 splicing and AR-V7-GFP 746 knock-in in CWR22Rv1 prostate cancer cells. (D) FACS analysis of AR-V7-GFP 747 expression in control or SF3B2 gRNA-transfected AR-V7-GFP cells. Light blue, 748 SF3B2 gRNA; Red, control gRNA; Dark blue, overlap area of SF3B2 gRNA and 749 control gRNA. (E) Percentages of AR-V7-GFP-negative cells following transfection 750 with control gRNA and SF3B2 gRNA (n = 3) (F) Correlation between SF3B2 751 expression and CRPC in published microarray data (17) and correlation between 752 SF3B2 and AR-V7 expression in the TCGA data (19). AR-V7 negative (n = 437, 753 RPKM < 1), AR-V7 positive (n = 49, RPKM >1), AR-V7 high positive (n = 12, RPKM 754 > 3) (G) Correlation between SF3B2/AR-FL (full length) /AR-V7 expression and 755 Gleason scores in TCGA data (19). Gleason score 6 (n = 45), 7 (n = 247), 8-10 (n = 756 205). (H) Kaplan-Meier curves of progression-free survival in TCGA prostate cancer 757 patients with SF3B2 high or low expression divided by the median. log, log-rank 758 test. 759

760 Figure 2. SF3B2-depletion decreases the expression of AR-V7 and 761 androgen-response genes. (A, B) Western blots of the indicated proteins in 762 SF3B2 gRNA-transfected CWR22Rv1 cells (A) and LNCaP95 cells (B). The 763 intensity of each band was normalized that of ACTB. (C) FACS analysis of SF3B2 764 gRNA-transfected AR-V7-GFP cells showing the “upper” and “lower” cell 765 populations. (D) Western blots of lower SF3B2 protein expression in AR-V7-GFP 766 cells with “lower” GFP expression compared with those with “upper” GFP 767 expression. (E) Western blots of the indicated proteins in SF3B2-depleted 768 AR-V7-GFP cells. (F) Western blots of SF3B2 in AR-V7-depleted AR-V7-GFP cells. 769 (G) Heatmap of expression data showing decreased expression of the AR-target 770 genes in SF3B2-depleted or non-target gRNA-transfected AR-V7-GFP cells. (H) 771 TMPRSS2 and KLK3 mRNA expression in SF3B2-depleted AR-V7-GFP cells. 772 773 Figure 3. Identification of SF3B2-binding RNA regions. (A) Upper: 774 Autoradiograph of 32P-labeled RNA crosslinked with TAP-tagged SF3B2 775 (SF3B2-TAP) protein separated by SDS-PAGE. Lower: western blot of SF3B2. (B) 776 Pie chart of ~63,000 SF3B2-binding sites with T-to-C mutations above threshold. 777 (C) The SF3B2-recognizing RNA motif. A total of 3,154 clusters excluding repeats 778 and rRNA were analyzed. (D) Sequence alignment of representative SF3B2-binding 779 sites. Red characters indicate the SF3B2-recognizing motif. xRPM, 780 crosslinked-reads per million. (E) mRNA expression and SF3B2 PAR-CLIP signals 781 in AR. (F) RNA precipitation analysis of endogenous SF3B2 with Halo-tag knock-in. 782 Upper: primer positions. Lower: enrichment of RNAs by RNA precipitation of 783 SF3B2-Halo. *, p < 0.05; (n = 3). 784 785 Figure 4. Depletion of SF3B2 results in alterations of splicing and gene 786 expression. (A-C) Changes in gene expression in SF3B2-depleted cells compared 787 with control cells. Cumulative plots of changes in gene expression binned by 788 SF3B2-binding regions (A), numbers of SF3B2-binding sites (B), and numbers of 789 xRPM of SF3B2-binding sites (C). P values were calculated by the pairwise 790 Wilcoxon test with Bonferroni adjustment. (D-G) Meta-analysis of SF3B2-bound 791 exons or introns. Meta-exon analysis of SF3B2 binding sites along with the heatmap 792 of SF3B2 binding (D) and transcripts (F) in the SF3B2-binding exons (n = 2240).

793 Meta-intron analysis of the SF3B2 binding sites along with the heatmap of SF3B2 794 binding (E) and transcripts (G) in SF3B2-binding introns (n = 14,621). P values were 795 calculated using the Kolmogorov-Smirnov test. 796 797 Figure 5. Validation of the function of SF3B2 for the regulation of splicing in 798 AR. (A) Schema of the cryptic exon 3 of AR with the position of two gRNAs or 799 control gRNA and the SF3B2-binding site. Red characters show the 800 SF3B2-recognizing motif. (B-C) FACS analysis of the indicated gRNA-transfected 801 AR-V7-GFP cells (n = 3). (D) The position of primers for detecting splicing of AR-FL 802 and AR-V7. (E-F) Relative splicing of AR-FL and AR-V7 in the GFP-negative 803 population in gRNA against the cryptic exon 3-transfected AR-V7-GFP (E) or SF3B2 804 stably expressed-22Rv1 cells (F). 805 806 Figure 6. Effects of SF3B2 overexpression on tumor growth in vivo and gene 807 expression. (A, B) Western blots of SF3B2 stably overexpressing 22Rv1 (A) or 808 LNCaP95 cells (B). The intensity of each band was normalized that of ACTB. (C) 809 Relative expression of AR-V7 normalized to the full length of AR. (n = 3) (D, E) 810 Tumor growth of SF3B2 stable-overexpression or SF3B2 stable-overexpression and 811 AR-V7 KO 22Rv1 (D, n = 11 - 12) or LNCap95 cells (E, n = 6 - 8) in NOD/SCID mice 812 under castration conditions. (F-G) Meta-exon (F, n = 2240) or -intron (G, n = 14,621) 813 analysis of transcripts in SF3B2-binding exons or introns. (H) mRNA expression of 814 KLK3 and KLK4 in SF3B2 stable-overexpression or GFP stable-expression 22Rv1 815 cells. (I) Representative gene ontology terms with p < 0.001 in SF3B2 816 stable-overexpression 22Rv1 cells. 817 818 Figure 7. Therapeutic effect of pladienolide B on prostate cancer. (A) 819 Schematic of the purification of the SF3B2 complex and pladienolide B (PLA-B) 820 treatment. (B) Upper: silver staining of the purified SF3B2 complex with or without 821 20mM PLA-B. Proteins identified by MS are shown on the left. Lower: Western blot 822 of SF3B2 as an internal control. (C) FACS analysis of the AR-V7-GFP-negative 823 population in PLA-B-treated AR-V7-GFP cells (n = 3). (D) Relative splicing of AR-FL 824 and AR-V7 in PLA-B-treated cells. The position of primers was indicated in Figure 825 5D. (E) Relative in vivo tumor growth of SF3B2 stably expressing 22Rv1 cells with

826 PLA-B or vehicle (DMSO) treatment (5 mg / kg) under castration conditions (n = 5). 827 (F) Relative in vivo tumor growth of SF3B2 or GFP-stable expressed 22Rv1 cells 828 with PLA-B treatment (5 mg / kg) under castration conditions (n = 5). 829

Downloaded from cancerres.aacrjournals.org on October 7, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3965 Author manuscripts have been peer reviewedFigure and accepted 1 for publication but have not yet been edited.

A B Genes encoding splicing factors and RNA-binding proteins (309 genes)

02468 −4−2 Microarray data set (n = 122) TCGA data set (RNA-seq n = 498) Grasso et al. Nature 2012 AR-V7 low PC vs highly positive PC Localized prostate cancer vs mCRPC Genes whose expression are increased in AR-V7 Genes whose expression are increased in CRPC highly positive PCa

41 genes 21 genes 12 genes

C AR-FL AR-V7 1 2 3 4 5 6 7 8 2 31 cryptic exon 3

UGA AUG UGA AUG AR in 22Rv1 cells cryptic exon 3 cryptic exon 3 exon 1 2 3 3 4 5 6 7 8 5’ 3’ 309 genes encoding splicing factors and RNA-binding proteins tandem duplication CRPC Localized PC stop codon Benign stop codon 5’ CE3 3’ 5’ CE3 3’

5’ homology arm 3’ homology arm cryptic exon 3 Knock-in exon 1 2 3 4 5 6 7 8 5’ 3’ GFP T2A Neo R 3’ GFP-2A-Neo R stop codon

D control gRNA E F p < 0.0001 15000 p = 0.0083

SF3B2 gRNA 40 p < 0.0001 100 35 13 p = 0.6047 12000 30 80 25 12 9000 60 20 15

Count 40 10 11 6000 SF3B2 expression 20 5 Percentage of AR-V7 negative population 0 10 3000 0 0 1 2 3 10 10 10 10 Benign CRPC

AR-V7-GFP control gRNA Localized PC AR-V7 negativeAR-V7 positive SF3B2 gRNASF3B2 #1 gRNASF3B2 #2 gRNA #3 AR-V7 high positive

G H Prostate cancer (TCGA) p < 0.0001 3000 p = 0.9856 p < 0.0001 1.0 SF3B2 High (n = 242) p = 0.0069 p = 0.0718 p = 0.9208 16000 7.5 p = 0.0044 0.8 SF3B2 Low (n = 242) 2000 12000 5.0 0.6 p = 0.9844 1000 8000 2.5 0.4 p = 0.0042 AR-FL expression AR-V7 expression SF3B2 expression 0 0.2 4000 0 Progression free survival 6 7 8-10 6 7 8-10 6 7 8-10 0.0 Gleason score Gleason score Gleason score 0 20 40 60 80 100 120 140 160 180 Postoperative months

Figure 2

A B C 22Rv1 LNCaP95 control gRNA SF3B2 gRNA 250K

200K

150K

control-gRNA SF3B2-gRNA FSC control-gRNA SF3B2-gRNA (bulk) (bulk) (bulk) (bulk) 100K SF3B2 SF3B2 1 0.2 1 0.8 50K control lower upper AR-FL AR-FL 1 1.1 1 1 0 AR-V7 AR-V7 101 102 103 104 101 102 103 104 1 0.06 1 0.7 ACTB ACTB AR-V7-GFP 1 1 1 1 D E F

control SF3B2-depletion control AR-V7 KO AR-FL SF3B2 control-gRNA SF3B2-gRNA (upper) SF3B2-gRNA (lower) SF3B2 AR-V7 ACTB SF3B2 ACTB ACTB

G 0.20 H 0.15 0-100 0.10 0.05 0.00 Control 0-100

0-100

RNAseq SF3B2 0-100 log10 FPKM + 1 dep

2 TMPRSS2 TMPRSS2 1 KLK3 0-300

Control 0-300

NKX3-1 KLK4 0-300

RNAseq SF3B2 dep 0-300

Control KLK3

SF3B2 depletion

Downloaded from cancerres.aacrjournals.org on October 7, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3965 Author manuscripts have been peer reviewed andFigure accepted for 3 publication but have not yet been edited. A TAP B Other 2.1% Promoter 9.3% 5’UTR 0.75% Exon 9.5% GFP-TAP SF3B2-TAP Intergenic 39.5% 150kDa Intron 31.8%

100kDa TTS 3’UTR 3.4% 75kDa 3.6%

50kDa C 2.0 P < 1E-08 37kDa 1.5

Bits 1.0 0.5 25kDa 0.0 SF3B2 1 2 3 4 5

D Gene name Representative PAR-CLIP clusters xRPM FPKM AR ------AGCAACUGUGUCUGUCUGAGGUUCCUGUGGCCAUCUUU------9.0 100.9 WDR74 ------CCACUCCACGCAUCGACCUGGUAUUGCAGUACUUCC------139.0 25.1 NEMF --UUGCCUAAGGAGGGGUGAACCGGCCCAGGUCGGAAACGGAGCAGGUCAAAACUCCCGUGCUGAUCAGUAGUGGGAUUGCGCCUGUG- 157.0 8.0 TRAF4 ------AAGCUGGCAAUGGCACGGCAUGUGGAGGAGAGUGUGA------12.9 55.7 POLR3GL ------AGAUGUCAGGUCCGAUUGA------13.9 11.7 MALAT1 ------AGACAGGUGGGAGAUUAUGAUCA------22.9 332.5 NOTCH1 ------AGGAGGCCGCCGCCCGGGCGCAGAGGGCAGCCGGUGGGGAGGCA------79.2 18.6 EIF4G3 ------UUCUCGGGUUGGAAUUU------13.7 12.4 RAB3B ------CCUGGUUAGUACUUGGAUGGG------1.8 5.4 ZC3H3 UUGAUUCGGCUGAUCUGGCUGGCUAGGCGGGUGUCCCCUUCCUUCCUCACUGCUUCAUGUGCGUCCCUCCCGAAGCU------420.7 11.7 MATR3 ------UACACUGCUGGGAGAACAGCAGCCAAUAGCUGGUUGGCAUUCUGGCCCUGGUU------12.4 97.9 NAGLU ------AGGUGCUGGCUAGUGACAGCCGCUUCUUGCUGGGCA------55.6 23.3 SETD1B ------UCUAGAGCCUCGUGGGUAACGGCAUAGUGUGGCCAGGUGUGUAGGGAAUG------44.1 22.5 RNF187 ------AACUCAGGUCUUCAGGGAGAG------18.4 128.7 ATP5O ------GUUCAGGUAUACGGUAUUGAAGGUC------6.9 32.5 CCNK ------AGUAGGAACUGGUAUGGAUG------18.3 16.7 RIT1 ------GAGGGGUCACAGGUCAGUGCCGGAGCCUCCGCGAGUGAAGGAA 3.8 22.0 ANKS3 ------ACUCCCCAGCCCCCAGCCCUCCUCAUCCUUGUC------2.4 3.8 DHX34 ------CUGGCCCUGGCUGGUGCCACACACAGGCCU------3.0 14.6 MLL5 ------AAAGACAUCAAAUUAAUCUUGUGAAUGCAG------2.4 17.5

E F F1 AR F1 F1

0-3000 0-3000 exon 1 2 3 4 5 6 7 8 9 Control 0-3000 0-3000 5’ 3’

0-3000 0-3000

RNAseq SF3B2 0-3000 0-3000 R1 cryptic exon 3 R1 R1 dep * 0-100 0-2000 2.5 SF3B2 PAR CLIP 0-100 0-2000 2.0 AR 1.5 exon1 exon 3 cryptic exon 3 1.0 0.5

Relative SF3B2-binding 0 ex1 CE3 ex8 ex1 CE3 ex8 SF3B2-Halo + -

Figure 4

A B 1 binding site (n = 2987) p = 1.00 C Intron (n = 4522) p = 2.4E-07 2 binding sites (n = 1737) p = 0.00552 Exon (n = 1049) p = 1.00 3 binding sites (n = 953) p = 0.00079 < 1 xRPM (n = 6580) p = 2.4E-09 Intergenic region (n = 1885) p = 1.00 4 binding sites (n = 524) p = 1.2E-06 1-10 xRPM (n = 771) p = 1.00 Intron and Exon (n = 1314) p = 0.00048 >=5 binding sites (n = 687) p = 9.0E-10 > 10 xRPM (n = 400) p = 0.851 Control (n = 4511) Control (n = 6396) Control (n = 6396) 1.00 1.00 1.00

0.75 0.75 0.75

0.50 0.50 0.50

0.25 0.25 0.25 Cumulative distributuin Cumulative distributuin Cumulative distributuin 0.00 0.00 0.00

0.0 2.5 5.0 -5.0 -2.5 0.0 2.5 5.0 -5.0 -2.5 0.0 2.5 5.0 -5.0 -2.5 Log2 fold change of gene expression Log2 fold change of gene expression Log2 fold change of gene expression (SF3B2 depletion / Control) (SF3B2 depletion / Control) (SF3B2 depletion / Control) D E F 6 150 Control SF3B2 depletion 200 4 100

100 p = 1E-11 2 50 SF3B2 binding SF3B2 binding expression level SF3B2-bound Exon 0 0 0 5’ 3’ Exon G 12.5 Control SF3B2 depletion 10.0

7.5

5’ 3’ 5’ 3’ 5.0 p = 2E-15 Intron

Exon expression level

SF3B2-bound Intron 2.5

5’ 3’ Intron

Figure 5 A C AR p<0.0001 exon 1 2 3 4 5 6 7 8 9 20 p=0.0001 5’ 3’

cryptic exon 3 16

12 genomic region for a potential SF3B2-binding RNA sequence 8 stop codon gRNA #2

Percentage of AR-V7 depleted population 4

control gRNA gRNA #1 0 coding sequence of cryptic exon 3 PAM gRNA #1 gRNA #2 gRNA #2 GGACACCGGTAGAAATAAACACA 5’ AGCAACTGTGTCTGTCTGAGGTTCCTGTGGCCATCTTTATTTGTGT 3’ Control gRNA |||||||||||||||||||||||||||||||||||||||||||||| 3’ TCGTTGACACAGACAGACTCCAAGGACACCGGTAGAAATAAACACA 5’ gRNA #1 GTGTCTGTCTGAGGTTCCTGTGG PAM

B Control gRNA gRNA #1 gRNA #2 1000 1000 1000

800 800 800

600 600 600 FSC 400 2.25% 400 16.4% 400 16.1%

200 200 200

0 0 0 0 1 2 3 0 1 2 3 0 1 2 3 10 10 10 10 10 10 10 10 10 10 10 10 AR-V7-GFP D AR exon 3 (ex.3) exon 4 (ex.4) F1 cryptic exon 3 (c.ex.3)

5’ 3’

R2 R1 E F N.A. 2.5 GFP-OE p=0.0095 NT gRNA SF3B2-OE 1.6 CE3 gRNA-lower 1.4 2 1.2 p=0.0002 p=0.0528 1.5 1 N.A. 0.8 1 0.6

0.4 Relative splicing

Relative splicing 0.5 0.2 0 0 F1+R1 F1+R2 F1+R1 F1+R2 exon7-8 ex.3-ex.4 ex.3-c.ex.3 ex.3-ex.4 ex.3-c.ex.3

SF3B2-bound Exon exogenous SF3B2 SF3B2-bound Intron Tumor volume (mm3) 1000 1200 100 150 expression level 200 400 600 800 10 expression level 50 0 0 5 0 Downloaded from 5’ 5’ Author manuscriptshavebeenpeerreviewedandacceptedforpublicationbutnotyetedited. Author ManuscriptPublishedOnlineFirstonAugust20,2019;DOI:10.1158/0008-5472.CAN-18-3965 7 4 1 8 35 28 21 14 7 0 SF3B2 overexpression GFP overexpression SF3B2 overexpression GFP overexpression AR-V7 AR-FL SF3B2/V7KO SF3B2 GFP ACTB Days afterinnoculation Intron Exon 1 1 1 GFP #1 cancerres.aacrjournals.org 22Rv1 p <2E-16 p <2E-16

GFP #2 22Rv1 .1 11.4 1.41.1 0.9 0.81.2 3’ 3’ 11 SF3B2 #1

1 SF3B2 #2 I H B

GO termes RNAseq exogenous SF3B2 Figure 6 SF3B2-OE on October 7,2021. ©2019 American Association forCancer enriched in N.S. p = 0.0133 GFP-OE Research. 4 3 2 1 0 -1 -2 -3 -4 downregulated cellular responsetooxygen- p = 0.0002 genes mitochondrion organization translational termination E AR-V7 AR-FL containing compound ACTB ribosome biogenesis 0-300 0-300 0-300 0-300 Tumor volume (mm3) 600 700 100 200 300 400 500 0 Multi-test adjustedp-value(log10) LNCaP95

1 1 2.4 1 1 1 GFP 4 12 54 49 42 35 28 21 147 0 KLK3 SF3B2/V7KO SF3B2 GFP SF3B2 Days afterinnoculation C cholesterol biosyntheticprocess

LNCaP95 Relative expression of

0-1500 0-1500 0-1500 0-1500 AR-V7/ AR-FL 0.2 0.4 0.6 0.8 1.2 1.4 1.6 1.0 0 F SF3B2 GFP AKT1 * p=0.0028 22Rv1

p =0.0029 p =0.0371

in upregulated genes upregulated in GO termes enriched enriched termes GO -4 -3 -2 -1

p < 0.0001 Author Manuscript Published OnlineFirst on August 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3965 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Figure 7

A B DMSO PLA-B complex calmodulin binding peptide 250kDa

SF3B2 IgG beads SF3B1 protein A SF3B2 150kDa TEV protease cleavage site SF3B3 SF3A1 1st elution from IgG beads 100kDa by TEV protease cleavage

75kDa SF3B2 calmodulin beads SF3A3 50kDa SF3B4 DMSO Pladienolide B 37kDa

Wash

SF3B2 calmodulin calmodulin 25kDa beads SF3B2 beads 20kDa 2nd elution from calmodulin beads 15kDa

SF3B2 SF3B2 SF3B2

C D 22Rv1 DMSO p=0.0271 100 p=0.0092 PLA-B 1.4 p=0.0162 80 1.2 60 1 0.8 40 0.6 20

Relative splicing 0.4 0 0.2 % AR-V7 depleted population

0nM 4nM 8nM 0 12nM 16nM 20nM F1+R1 F1+R2 Pladienolide B concentration ex.3-ex.4 ex.3-c.ex.3

E SF3B2-overexpressed 22Rv1 F DMSO PLA-B * 1000 * PLA-B GFP * 600 SF3B2 * 800 *

600 400 * * * p < 0.05 400 * p < 0.01 * * * * 200 200 Relative tumor volume (%) Relative tumor volume (%)

0 0 0 7 14 21 28 0 7 14 21 28 days after initiation of treatment days after initiation of treatment Downloaded from cancerres.aacrjournals.org on October 7, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3965 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

SF3B2-mediated RNA splicing drives human prostate cancer progression

Norihiko Kawamura, Keisuke Nimura, Kotaro Saga, et al.

Cancer Res Published OnlineFirst August 20, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-18-3965

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2019/08/20/0008-5472.CAN-18-3965.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet Manuscript been edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2019/08/20/0008-5472.CAN-18-3965. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.