DOCSLIB.ORG

MSH2 in Contrast to MLH1 and MSH6 Is Frequently Inactivated by Exonic and Promoter Rearrangements in Hereditary Nonpolyposis Colorectal Cancer1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
MSH2 in Contrast to MLH1 and MSH6 Is Frequently Inactivated by Exonic and Promoter Rearrangements in Hereditary Nonpolyposis Colorectal Cancer1 [CANCER RESEARCH 62, 848–853, February 1, 2002] MSH2 in Contrast to MLH1 and MSH6 Is Frequently Inactivated by Exonic and Promoter Rearrangements in Hereditary Nonpolyposis Colorectal Cancer1 Franc¸oise Charbonnier, Sylviane Olschwang, Qing Wang, Ce´cile Boisson, Cosette Martin, Marie-Pierre Buisine, Alain Puisieux, and Thierry Frebourg2 Laboratoire de Ge´ne´tique Mole´culaire, CHU de Rouen et Institut National de la Sante´et de la Recherche Me´dicale EMI 9906, Faculte´deMe´decine et de Pharmacie, IFRMP, 76183 Rouen [F. C., C. M., T. F.]; Unite´ d’Oncologie Mole´culaire, Institut National de la Sante´ et de la Recherche Me´dicale U453, Centre Le´on Be´rard, 69373 Lyon [Q. W., A. P.]; Fondation Jean Dausset-Centre d’Etude du Polymorphisme Humain, Paris [S. O., C. B.]; and Laboratoire de Biochimie et Biologie Mole´culaire, CHU de Lille 59037 Lille [M-P. B.], France ABSTRACT MLH1 mutations may be explained by: (a) alterations of MSH2 or MLH1 missed by conventional screening methods based on PCR To estimate the relative frequency of mismatch repair genes, rear- amplification of each exon; (b) the involvement of other MMR genes; rangements in hereditary nonpolyposis colorectal cancer (HNPCC) fam- or (c) the existence of HNPCC not related to a defect within the MMR ilies without detectable mutations in MSH2 or MLH1, we have analyzed by multiplex PCR of short fluorescent fragments MSH2, MLH1, and MSH6 pathway. The first case of a MLH1 genomic deletion, involving exon in 61 families, either fulfilling Amsterdam criteria or including cases of 16, was reported in 1995 by Albert de la Chapelle’s group in Finnish multiple primary cancers belonging to the HNPCC spectrum. We detected families. This deletion, detected by RT-PCR analysis, was shown to 13 different genomic rearrangements of MSH2 in 14 families (23%), result from an Alu-mediated recombination (13). Using also RT-PCR whereas we found no rearrangement of MLH1 and MSH6. Analysis of 31 analysis, we subsequently detected two distinct Alu-mediated dele- other families, partially meeting Amsterdam criteria, revealed no addi- tions removing exons 13–16 and exon 2 of MLH1 in two French tional rearrangement of MSH2. All of the MSH2 rearrangements, except HNPCC families (14, 15). An extensive screening by Southern blot one, corresponded to genomic deletions involving one or several exons. In analysis of 137 HNPCC families, without detectable point mutations 8 of 13 families with a MSH2 genomic deletion, the MSH2 promoter was within the MMR genes, led Wijnen et al. (16) to identify, in 8 also deleted, and the 5؅ breakpoint was located either within or upstream families, four distinct genomic deletions of MSH2, removing exon 1, the MSH2 gene. This study demonstrates the heterogeneity of MSH2 exonic and promoter rearrangements and shows that, in HNPCC families exon 2, exon 3, and exon 6. Two other genomic deletions of MSH2, without detectable MSH2 or MLH1 point mutation, one must consider the involving exons 1–6 and exons 1–7, were identified using the con- presence of MSH2 genomic rearrangements before the involvement of version approach, based on the cell fusion strategy (17). other mismatch repair genes. The simplicity and rapidity of their detec- To facilitate the detection of genomic rearrangements, we recently tion, using fluorescent multiplex PCR, led us to recommend to begin the developed a simple and rapid screening method, based on the multi- molecular analysis in HNPCC by screening for MSH2 rearrangements. plex PCR amplification of short fluorescent fragments. This method allowed us to identify two additional deletions of MSH2, removing exon 5 and exons 1–15, and the first case of a partial duplication of INTRODUCTION this gene affecting exons 9–10 (15). However, the frequency of the HNPCC3 is the most common form of inherited colorectal cancer rearrangements in the MMR genes has not been estimated thus far, and (for review, see Ref. 1). In HNPCC, detection of the causal alteration this information is essential to determine the best strategy of the of the MMR gene is essential for a proper management of the families, molecular analyses in HNPCC families. Therefore, we have system- because it allows to identify relatives with high risk for colorectal or atically screened for genomic rearrangements a series of 92 families endometrial cancer, who require the appropriate screening (2, 3) and, without detectable point mutations. conversely, to avoid useless surveillance in noncarrier relatives. The efficiency of the colonoscopy screening, especially in terms of mor- MATERIALS AND METHODS tality, has been demonstrated recently in HNPCC families (4). Mo- lecular diagnosis of HNPCC is complicated by the genetic heteroge- Families. This study included a total of 92 families corresponding to: (a) neity of the syndrome because of the involvement of the different 49 families fulfilling the Amsterdam criteria I or II for HNPCC (at least three MutS and MutL homologues, MSH2 (2p22-p21), MSH6 (2p16), and relatives with CRC, cancer of the endometrium, small bowel, ureter, or renal MLH1 (3p21) and PMS2 (7p22), respectively (5–11). Mutation stud- pelvis, one of whom is a first-degree relative of the other two; at least two ies (12) have shown that MSH2 and MLH1 are involved in approxi- successive generations affected; and at least one diagnosed before age 50; mately half of the families fulfilling the Amsterdam criteria I (at least Refs. 18 and 19); (b) 12 families, partially fulfilling the Amsterdam criteria, but including cases with MPCs belonging to the HNPCC spectrum (CRC, three relatives with CRC, one of whom is a first-degree relative of the cancer of the endometrium, stomach, ovary, small bowel, ureter, or renal other two; at least two successive generations affected; and at least pelvis), the first of which developed before 50 years of age; and (c) 31 families one of the cases of CRC diagnosed before age 50; tumors verified by which met only partial Amsterdam criteria and without cases of MPC. For each pathological examination). family, previous screening of MSH2 and MLH1 by Denaturating Gradient Gel The large number of HNPCC families without detectable MSH2 or Electrophoresis, heteroduplex, and/or direct sequencing analysis, from genomic DNA of the index case, had revealed no point mutation. RT-PCR Received 10/8/01; accepted 12/3/01. analysis had also been performed in 43 families, for which high quality mRNA The costs of publication of this article were defrayed in part by the payment of page was available, and had revealed no alteration. charges. This article must therefore be hereby marked advertisement in accordance with Fluorescent Multiplex PCR. We used a slightly modified version of the 18 U.S.C. Section 1734 solely to indicate this fact. protocol described previously (15). Briefly, short fragments (Ͻ300 bp) of the 1 Supported by l’Association pour la Recherche sur le Cancer and La Fondation pour la Recherche Me´dicale. 16 MSH2, 19 MLH1, and 10 MSH6 coding exons (Table 1) or of the MSH2 2 To whom requests for reprints should be addressed, at Institut National de la Sante´ upstream region (Table 2) were simultaneously PCR amplified, using 6-Fam et de la Recherche Me´dicale EMI 9906, Faculte´deMe´decine et de Pharmacie, 22 labeled primers. For MSH2 and MLH1, two multiplex PCRs were necessary to Boulevard de Gambetta, 76183 Rouen, France. cover all of the exons (Table 1). An additional fragment, corresponding to 3 The abbreviations used are: HNPCC, hereditary nonpolyposis colorectal cancer; MMR, mismatch repair; RT-PCR, reverse transcription-PCR; CRC, colorectal cancer; another gene used as a control, was systematically amplified in each multiplex MPC, multiple primary cancers. PCR. PCR was performed in a final volume of 25 ␮l containing 100 ng of 848 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2002 American Association for Cancer Research. FREQUENCY OF MMR GENES REARRANGEMENTS IN HNPCC Table 1 Primers used for the fluorescent multiplex PCR analysis of the MMR gene exonsa Size of the Exon Sense primer Antisense primer ampliconb MSH2c 15Ј TTCGTGCGCTTCTTTCAG 3Јd 5Ј TGGGTCTTGAACACCTCCCG 3Ј 127 25Ј GGTTAAGGAGCAAAGAATCTGC 3Јd 5Ј ATGCCAAATACCAATCATTC 3Ј 158 35Ј GGATATGTCAGCTTCCATTGGT 3Јd 5Ј GGTAAAACACATTCCTTTGG 3Ј 190 45Ј TCATATCAGTGTCTTGCACA 3Јd 5Ј TTTTGTGGAAAAGTCAGCTT 3Ј 200 55Ј GGACTGTCTGCGGTAATCAAGT 3Јd 5Ј AAAGGTTAAGGGCTCTGACT 3Ј 133 65Ј TAATGAGCTTGCCATTCTTT 3Јd 5Ј GAGAGGCTGCTTAATCCAC 3Ј 152 75Ј CAAGCAGCAAACTTACAAGA 3Јd 5Ј ACCACCACCAACTTTATGAG 3Ј 176 85Ј GGGGAAGCTTTGAGTGCTACAT 3Јd 5Ј AGAGGAGTCACAAAAACTGC 3Ј 265 95Ј GGTGACTTGGAAAAGAAGATGC 3Јd 5Ј GGGCTTGTTTAAATGACATC 3Ј 229 10 5Ј GGTTTCGTGTAACCTGTAAGGAA 3Јd 5Ј GGGCTATTTAACAAATGGTG 3Ј 262 11 5Ј GATACTTTGGATATGTTTCA 3Јd 5Ј CCAGGTGACATTCAGAACA 3Ј 225 12 5Ј GGTTAGGAAATGGGTTTTGAAT 3Јd 5Ј ATGCCTGGATGCTTTTAAT 3Ј 275 13 5Ј ATTGTGGACTGCATCTTAGC 3Јd 5Ј AAAGTCCACAGGAAAACAAC 3Ј 242 14 5Ј GGCTACGATGGATTTGGGTTAG 3Јd 5Ј TTTCCCATTACCAAGTTCTG 3Ј 242 15 5Ј GGGCTGTCTCTTCTCATGCTGT 3Јd 5Ј GATAGCACTTCTTTGCTGCT 3Ј 217 16 5Ј GGCTGTCCAAGGTGAAACAAAT 3Јd 5Ј CCATTACTGGGATTTTTCAC 3Ј 162 MSH6e 15Ј GGGTACAGCTTCTTCCCCAAGT 3Јd 5Ј CCTCCGTTGAGGTTCTTC 3Ј 207 25Ј GGCTGCCTTTAAGGAAACTTGA 3Јd 5Ј ACATGAACACGGACTGATTT 3Ј 195 35Ј GGGGAGGTCATTTTTACAGTGC 3Јd 5Ј CCTCCATCTCTTCTTCCTCT 3Ј 147 45Ј GGGGAGGAAGGAAGCAGTGATG 3Јd 5Ј GGGCTTGGGATTCAGAATTT 3Ј 246 55Ј GGTTTACTGTGCCTGGCTAACT 3Јd 5Ј ACAAGCACACAATAGGCTTT 3Ј 223 65Ј GGATTCACAGGCTGGCTTATTA 3Јd 5Ј TGAGAACTTAAGTGGGAAACA 3Ј 160 75Ј GGTTGTTGAATTAAGTGAAACTGC 3Јd 5Ј TCTTCAAATGAGAAGTTTAATGTC 3Ј 105 85Ј GGAACAGGAAGAGGTACTGCAA 3Јd 5Ј TGAATGGTAGTGAGTTGAAAA 3Ј 113 95Ј GGCATGCATGGTAGAAAATGAA 3Јd 5Ј ACTTCCTCTGGGAGATTAGC 3Ј 134 10 5Ј GGCTGGCTAGTGAAAGGTCAAC 3Јd 5Ј AGAAAATGGAAAAATGGTCA 3Ј 185 a Sequences of the MLH1 primers have been published previously (15). b In bp. c For MSH2, the two multiplex PCRs corresponded to exons 2, 3, 5, 9, 10, 12, 14, and 15 and exons 1, 4, 6–8, 11, 13, and 16, respectively. d 5Ј (6-FAM) labelled. e For MSH6, the multiplex PCR was performed in the presence of 10% of DMSO to facilitate amplification of exon 1. genomic DNA, 0.2–1 ␮M of each pair of primers, and 1 unit of Taq DNA RESULTS polymerase (Eurobio, Les Ulis, France).
Load more

Recommended publications
  • Arsenic Disruption of DNA Damage Responses—Potential Role in Carcinogenesis and Chemotherapy
    Biomolecules 2015, 5, 2184-2193; doi:10.3390/biom5042184 OPEN ACCESS biomolecules ISSN 2218-273X www.mdpi.com/journal/biomolecules/ Review Arsenic Disruption of DNA Damage Responses—Potential Role in Carcinogenesis and Chemotherapy Clarisse S. Muenyi 1, Mats Ljungman 2 and J. Christopher States 3,* 1 Department of Pharmacology and Toxicology, University of Louisville School of Medicine, Louisville, KY 40292, USA; E-Mail: [email protected] 2 Departments of Radiation Oncology and Environmental Health Sciences, University of Michigan, Ann Arbor, MI 48109-2800, USA; E-Mail: [email protected] 3 Department of Pharmacology and Toxicology, University of Louisville School of Medicine, Louisville, KY 40292, USA * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-502-852-5347; Fax: +1-502-852-3123. Academic Editors: Wolf-Dietrich Heyer, Thomas Helleday and Fumio Hanaoka Received: 14 August 2015 / Accepted: 9 September 2015 / Published: 24 September 2015 Abstract: Arsenic is a Class I human carcinogen and is widespread in the environment. Chronic arsenic exposure causes cancer in skin, lung and bladder, as well as in other organs. Paradoxically, arsenic also is a potent chemotherapeutic against acute promyelocytic leukemia and can potentiate the cytotoxic effects of DNA damaging chemotherapeutics, such as cisplatin, in vitro. Arsenic has long been implicated in DNA repair inhibition, cell cycle disruption, and ubiquitination dysregulation, all negatively impacting the DNA damage response and potentially contributing to both the carcinogenic and chemotherapeutic potential of arsenic. Recent studies have provided mechanistic insights into how arsenic interferes with these processes including disruption of zinc fingers and suppression of gene expression.
    [Show full text]
  • Epigenetic Regulation of DNA Repair Genes and Implications for Tumor Therapy ⁎ ⁎ Markus Christmann , Bernd Kaina
    Mutation Research-Reviews in Mutation Research xxx (xxxx) xxx–xxx Contents lists available at ScienceDirect Mutation Research-Reviews in Mutation Research journal homepage: www.elsevier.com/locate/mutrev Review Epigenetic regulation of DNA repair genes and implications for tumor therapy ⁎ ⁎ Markus Christmann , Bernd Kaina Department of Toxicology, University of Mainz, Obere Zahlbacher Str. 67, D-55131 Mainz, Germany ARTICLE INFO ABSTRACT Keywords: DNA repair represents the first barrier against genotoxic stress causing metabolic changes, inflammation and DNA repair cancer. Besides its role in preventing cancer, DNA repair needs also to be considered during cancer treatment Genotoxic stress with radiation and DNA damaging drugs as it impacts therapy outcome. The DNA repair capacity is mainly Epigenetic silencing governed by the expression level of repair genes. Alterations in the expression of repair genes can occur due to tumor formation mutations in their coding or promoter region, changes in the expression of transcription factors activating or Cancer therapy repressing these genes, and/or epigenetic factors changing histone modifications and CpG promoter methylation MGMT Promoter methylation or demethylation levels. In this review we provide an overview on the epigenetic regulation of DNA repair genes. GADD45 We summarize the mechanisms underlying CpG methylation and demethylation, with de novo methyl- TET transferases and DNA repair involved in gain and loss of CpG methylation, respectively. We discuss the role of p53 components of the DNA damage response, p53, PARP-1 and GADD45a on the regulation of the DNA (cytosine-5)- methyltransferase DNMT1, the key enzyme responsible for gene silencing. We stress the relevance of epigenetic silencing of DNA repair genes for tumor formation and tumor therapy.
    [Show full text]
  • Expression of MSH2 and MSH6 on a Tissue Microarray in Patients with Osteosarcoma
    ANTICANCER RESEARCH 34: 6961-6972 (2014) Expression of MSH2 and MSH6 on a Tissue Microarray in Patients with Osteosarcoma THORSTEN JENTZSCH1,2, BERNHARD ROBL1, MAREN HUSMANN1, BEATA BODE-LESNIEWSKA3 and BRUNO FUCHS1 1Laboratory for Orthopedic Research, Department of Orthopedics, Balgrist University Hospital, Zürich, Switzerland; 2Division of Trauma Surgery, Department of Surgery, University Hospital Zürich, Zürich, Switzerland; 3Institute of Surgical Pathology, University Hospital Zürich, Zürich, Switzerland Abstract. Background/Aim: Reliable prognostic factors for and head (4, 5). Following neoadjuvant chemotherapy, surgical the outcome of patients with osteosarcoma (OS) remain elusive. tumor resections provide tissue specimens for the assessment We analyzed the relationship between immunohistochemical of tumor necrosis rate, histology, grading and evaluation of expression of deoxyribonucleic acid (DNA) mismatch repair tumor biomarkers before further adjuvant chemotherapy may (MMR) proteins, MutS protein homolog 2 (MSH2) and MSH6 be initiated (6-8). Despite advances in therapeutic approaches, using a tissue microarray (TMA) with respect to OS patient five-year overall survival rates have been reported as 78% (9) demographics and survival time. Materials and Methods: We and are usually lower for non-responders to chemotherapy retrieved tumor tissue specimens from bone tissue originating (10) and patients with metastasis (11, 12). from surgical primary tumor specimens of OS patients to Albeit the limited number of studies (8, 13-17) on tumor generate a TMA and stained sections with antibodies against biomarkers, these are important for treatment decisions, MSH2 and MSH6. Results: Tumor resections of 67 patients patient discrimination regarding the response to with a mean follow-up of 98 months were evaluated. MSH2 chemotherapy and the incidence of metastasis, prediction of was expressed in nine (13%), MSH6 in ten (15%) and patient survival times and patient education (18-21).
    [Show full text]
  • Involvement of Nucleotide Excision and Mismatch Repair Mechanisms in Double Strand Break Repair
    250 Current Genomics, 2009, 10, 250-258 Involvement of Nucleotide Excision and Mismatch Repair Mechanisms in Double Strand Break Repair Ye Zhang1,2,*, Larry H. Rohde2 and Honglu Wu1 1NASA Johnson Space Center, Houston, Texas 77058 and 2University of Houston at Clear Lake, Houston, Texas 77058, USA Abstract: Living organisms are constantly threatened by environmental DNA-damaging agents, including UV and ioniz- ing radiation (IR). Repair of various forms of DNA damage caused by IR is normally thought to follow lesion-specific re- pair pathways with distinct enzymatic machinery. DNA double strand break is one of the most serious kinds of damage induced by IR, which is repaired through double strand break (DSB) repair mechanisms, including homologous recombi- nation (HR) and non-homologous end joining (NHEJ). However, recent studies have presented increasing evidence that various DNA repair pathways are not separated, but well interlinked. It has been suggested that non-DSB repair mecha- nisms, such as Nucleotide Excision Repair (NER), Mismatch Repair (MMR) and cell cycle regulation, are highly involved in DSB repairs. These findings revealed previously unrecognized roles of various non-DSB repair genes and indicated that a successful DSB repair requires both DSB repair mechanisms and non-DSB repair systems. One of our recent studies found that suppressed expression of non-DSB repair genes, such as XPA, RPA and MLH1, influenced the yield of IR- induced micronuclei formation and/or chromosome aberrations, suggesting that these genes are highly involved in DSB repair and DSB-related cell cycle arrest, which reveals new roles for these gene products in the DNA repair network.
    [Show full text]
  • The Properties of Msh2–Msh6 ATP Binding Mutants Suggest a Signal
    ARTICLE cro Author’s Choice The properties of Msh2–Msh6 ATP binding mutants suggest a signal amplification mechanism in DNA mismatch repair Received for publication, August 19, 2018, and in revised form, September 17, 2018 Published, Papers in Press, September 20, 2018, DOI 10.1074/jbc.RA118.005439 William J. Graham, V‡, Christopher D. Putnam‡§, and X Richard D. Kolodner‡¶ʈ**1 From the ‡Ludwig Institute for Cancer Research San Diego, Departments of §Medicine and ¶Cellular and Molecular Medicine, ʈMoores-UCSD Cancer Center, and **Institute of Genomic Medicine, University of California School of Medicine, San Diego, La Jolla, California 92093-0669 Edited by Patrick Sung DNA mismatch repair (MMR) corrects mispaired DNA bases synthesis (1–6). MMR also acts on some forms of chemically and small insertion/deletion loops generated by DNA replica- damaged DNA bases as well as on mispairs present in hetero- tion errors. After binding a mispair, the eukaryotic mispair rec- duplex DNA intermediates formed during recombination ognition complex Msh2–Msh6 binds ATP in both of its nucle- (1–6). MMR proteins also act in a pathway that suppresses otide-binding sites, which induces a conformational change recombination between homologous but divergent DNAs resulting in the formation of an Msh2–Msh6 sliding clamp that (1–6) and function in a DNA damage response pathway for releases from the mispair and slides freely along the DNA. How- different types of DNA-damaging agents, including some che- ever, the roles that Msh2–Msh6 sliding clamps play in MMR motherapeutic agents (2). As a result of the role that MMR plays remain poorly understood.
    [Show full text]
  • AML) by Targeting DNA Repair and Restoring Topoisomerase II to the Nucleus
    Author Manuscript Published OnlineFirst on June 29, 2016; DOI: 10.1158/1078-0432.CCR-15-2885 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. XPO1 Inhibition Using Selinexor Synergizes With Chemotherapy in Acute Myeloid Leukemia (AML) by Targeting DNA Repair and Restoring Topoisomerase II to the Nucleus Parvathi Ranganathan1*, Trinayan Kashyap2*, Xueyan Yu1*, Xiaomei Meng1, Tzung-Huei Lai1, Betina McNeil1, Bhavana Bhatnagar1, Sharon Shacham2, Michael Kauffman2, Adrienne M. Dorrance1, William Blum1, Deepa Sampath1, Yosef Landesman2± and Ramiro Garzon1± 1The Ohio State University, Columbus, OH, USA; 2Karyopharm Therapeutics Inc, Newton, MA, USA * P.R., T.K. and X.Y. contributed equally to this study. ± These two senior authors (Y.L and R.G) contributed equally to this study. Corresponding Author: Ramiro Garzon, MD. The Ohio State University, Comprehensive Cancer Center, Biomedical Research Tower Room 1084; 460 West 12th Avenue, Columbus, OH 43210, USA. E-mail: [email protected] Phone: 614-685-9180. Fax: 614-293-3340. Running Title: XPO1 inhibition synergizes with chemotherapy in AML Keywords: XPO1, AML, DNA repair Text word count: 4058 Abstract word count: 249 Figures: 6 References: 50 Category: Cancer Therapy- Preclinical Abbreviations Used: AML: acute myeloid leukemia, Topo II: Topoisomerase II, IDA: Idarubicin, HR: homologous recombination 1 Downloaded from clincancerres.aacrjournals.org on September 29, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on June 29, 2016; DOI: 10.1158/1078-0432.CCR-15-2885 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Statement of Translational relevance The standard treatment for acute myeloid leukemia (AML) in the US is induction chemotherapy with anthracycline and cytarabine followed by post-remission consolidation chemotherapy or/and allogeneic stem cell transplants.
    [Show full text]
  • MSH2 Gene Muts Homolog 2
    MSH2 gene mutS homolog 2 Normal Function The MSH2 gene provides instructions for making a protein that plays an essential role in repairing DNA. This protein helps fix errors that are made when DNA is copied (DNA replication) in preparation for cell division. The MSH2 protein joins with one of two other proteins, MSH6 or MSH3 (each produced from a different gene), to form a two-protein complex called a dimer. This complex identifies locations on the DNA where errors have been made during DNA replication. Another group of proteins, the MLH1-PMS2 dimer, then binds to the MSH2 dimer and repairs the errors by removing the mismatched DNA and replicating a new segment. The MSH2 gene is one of a set of genes known as the mismatch repair (MMR) genes. Health Conditions Related to Genetic Changes Constitutional mismatch repair deficiency syndrome About 10 mutations in the MSH2 gene have been associated with a condition called constitutional mismatch repair deficiency (CMMRD) syndrome. Individuals with this condition are at increased risk of developing cancers of the colon (large intestine) and rectum (collectively referred to as colorectal cancer), brain, and blood (leukemia or lymphoma). These cancers usually first occur in childhood, with the vast majority of cancers in CMMRD syndrome diagnosed in people under the age of 18. Many people with CMMRD syndrome also develop changes in skin coloring (pigmentation), similar to those that occur in a condition called neurofibromatosis type 1. Individuals with CMMRD syndrome inherit two MSH2 gene mutations, one from each parent, while people with Lynch syndrome (described below) have a mutation in one copy of the MSH2 gene.
    [Show full text]
  • DNA Repair Pathway Profiling and Microsatellite Instability in Colorectal Cancer Jinshengyu,1, 6 Mary A
    Human Cancer Biology DNA Repair Pathway Profiling and Microsatellite Instability in Colorectal Cancer JinshengYu,1, 6 Mary A. Mallon,2 Wanghai Zhang,1, 6 Robert R. Freimuth,1,4 Sharon Marsh,1, 6 Mark A.Watson,4,6 PaulJ. Goodfellow,2,3,6 andHowardL.McLeod1,3,5,6 Abstract Background: The ability to maintain DNA integrity is a critical cellular function. DNA repair is conducted by distinct pathways of genes, many of which are thought to be altered in colorectal cancer. However, there has been little characterization of these pathways in colorectal cancer. Method: By using the TaqMan real-time quantitative PCR, RNA expression profiling of 20 DNA repair pathway genes was done in matched tumor and normal tissues from 52 patients with Dukes’C colorectal cancer. Results: The relative mRNA expression level across the 20 DNA repair pathway genes varied considerably, and the individual variability was also quite large, with an 85.4 median fold change in the tumor tissue genes and a 127.2 median fold change in the normal tissue genes. Tumor- normal differential expression was found in 13 of 20 DNA repair pathway genes (only XPA had a lower RNA level in the tumor samples; the other 12 genes had significantly higher tumor levels, all P < 0.01). Coordinated expression of ERCC6, HMG1, MSH2,andPOLB (RS z 0.60) was observed in the tumor tissues (all P < 0.001). Apoptosis index was not correlated with expression of the 20 DNA repair pathway genes. MLH1 and XRCC1 RNA expression was correlated with microsatellite instability status (P = 0.045 and 0.020, respectively).
    [Show full text]
  • Immunohistochemical Pattern of MLH1/MSH2 Expression Is Related
    Immunohistochemical Pattern of MLH1/MSH2 Expression Is Related to Clinical and Pathological Features in Colorectal Adenocarcinomas with Microsatellite Instability Giovanni Lanza, M.D., Roberta Gafà, M.D., Iva Maestri, M.Sc., Alessandra Santini, M.D., Maurizio Matteuzzi, M.Sc., Luigi Cavazzini, M.D. Department of Experimental and Diagnostic Medicine, Section of Anatomic Pathology, University of Ferrara (GL, RG, IM, MM, LC); and Division of Clinical Oncology, St. Anna Hospital (AS), Ferrara, Italy cinomas more frequently died of disease than did Detection of colorectal carcinomas with high- patients with MLH1/MSH2-positive and MSH2- frequency microsatellite instability (MSI-H) is clin- negative MSI-H tumors, but the difference was not ically important for several reasons. Recent studies statistically significant. The results of the present suggested that immunohistochemical analysis of investigation strongly indicate that immunohisto- MLH1 and MSH2 expression is a rapid and accurate chemical analysis of MLH1 and MSH2 expression is method for identifying large bowel tumors of the a practical and reliable method for the routine de- MSI-H phenotype. In this study, we evaluated by tection of the vast majority of MSI-H large bowel immunohistochemistry MLH1 and MSH2 protein adenocarcinomas. Our data also point out that expression in 132 MSI-H, 23 MSI-L (low-frequency MSI-H MLH1/MSH2-positive colorectal carcinomas MSI), and 150 microsatellite stable (MSS) colorectal are characterized by distinctive pathological adenocarcinomas. Loss of MLH1 or MSH2 expres- features. sion was detected in 120 (90.9%) MSI-H carcinomas, whereas all MSI-L and MSS tumors showed normal KEY WORDS: Colorectal carcinoma, DNA mismatch expression of both proteins.
    [Show full text]
  • Oligonucleotide-Directed Mutagenesis Screen to Identify Pathogenic Lynch Syndrome-Associated MSH2 DNA Mismatch Repair Gene Variants
    Oligonucleotide-directed mutagenesis screen to identify pathogenic Lynch syndrome-associated MSH2 DNA mismatch repair gene variants Hellen Houlleberghsa, Marleen Dekkera, Hildo Lantermansa, Roos Kleinendorsta, Hendrikus Jan Dubbinkb, Robert M. W. Hofstrac, Senno Verhoefd, and Hein te Rielea,1 aDivision of Biological Stress Response, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; bDepartment of Pathology, Erasmus Medical Center, 3015 CN Rotterdam, The Netherlands; cDepartment of Clinical Genetics, Erasmus Medical Center, 3015 CN Rotterdam, The Netherlands; and dFamily Cancer Clinic, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands Edited by James E. Haber, Brandeis University, Waltham, MA, and approved January 26, 2016 (received for review October 21, 2015) Single-stranded DNA oligonucleotides can achieve targeted base-pair predisposition that is characterized by the early onset of colorectal substitution with modest efficiency but high precision. We show that cancer and cancers at extracolonic sites such as the endometrium, “oligo targeting” can be used effectively to study missense muta- ovaries, and stomach. It is caused by mutations in MSH2, MLH1, tions in DNA mismatch repair (MMR) genes. Inherited inactivating MSH6,orPMS2 DNA MMR genes that destroy gene function. mutations in DNA MMR genes are causative for the cancer predispo- Patients usually have a heterozygous germline mutation in one of sition Lynch syndrome (LS). Although overtly deleterious mutations the DNA MMR genes. Upon somatic loss of the wild-type allele, in MMR genes can clearly be ascribed as the cause of LS, the func- MMR-deficient cells arise, and a general mutator phenotype de- tional implications of missense mutations are often unclear. We de- velops that increases the chance of mutations arising in oncogenes veloped a genetic screen to determine the pathogenicity of these and tumor-suppressor genes and hence the development of ma- variants of uncertain significance (VUS), focusing on mutator S ho- lignancies (7).
    [Show full text]
  • Immunohistochemistry for Microsatellite Instability Fact Sheet
    Immunohistochemistry (IHC) for Microsatellite Instability Fact Sheet Frequently Asked Questions What is Lynch Syndrome? Lynch syndrome is a hereditary cancer syndrome associated with a significantly increased lifetime risk for colon, uterine, ovarian, stomach, and other cancers. If identified, patients can receive additional screening and prevention measures to help prevent cancer in the future. How is IHC useful in identifying patients with Lynch syndrome? IHC looks at the four mismatch repair proteins associated with Lynch syndrome. If these proteins are not present in the tumor, this means that the colon cancer could be due to Lynch syndrome. Why was this test done on my patient? Norton Hospital routinely performs IHC for Lynch syndrome on all colorectal resection specimens in order to maximize the identification of patients who are at increased risk for a second cancer and who have family members at significantly increased risk for cancer. Recent studies in the scientific literature have indicated this is the most effective way to identify patients with Lynch syndrome. This process has been approved by the Medical Executive Committee. How is this information helpful to me and my patient? Individuals with Lynch syndrome are at a significantly increased risk for developing cancer in the future. This information will be helpful in determining the ongoing management of your patient and may also aid in treatment decisions or eligibility for research studies. Patients can benefit from this information by understanding the cause of their cancer, their risk for subsequent cancers, and the risks for their family members. The family members of a patient can also be tested for Lynch syndrome, giving them the ability to make screening and prevention decisions that can prevent cancer in the future or allow it to be diagnosed at the earliest possible stage, when the cancer is most treatable.
    [Show full text]
  • WRN-Mutated Colorectal Cancer Is Characterized by a Distinct Genetic Phenotype
    cancers Article WRN-Mutated Colorectal Cancer Is Characterized by a Distinct Genetic Phenotype Kai Zimmer 1, Alberto Puccini 2 , Joanne Xiu 3, Yasmine Baca 3, Gilbert Spizzo 1,4, Heinz-Josef Lenz 2, Francesca Battaglin 2 , Richard M. Goldberg 5 , Axel Grothey 6, Anthony F. Shields 7, Mohamed E. Salem 8, John L. Marshall 9, W. Michael Korn 3, Dominik Wolf 1, Florian Kocher 1 and Andreas Seeber 1,* 1 Department of Hematology and Oncology, Comprehensive Cancer Center Innsbruck, Innsbruck Medical University, 6020 Innsbruck, Austria; [email protected] (K.Z.); [email protected] (G.S.); [email protected] (D.W.); fl[email protected] (F.K.) 2 Norris Comprehensive Cancer Center, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033, USA; [email protected] (A.P.); [email protected] (H.-J.L.); [email protected] (F.B.) 3 Caris Life Sciences, Phoenix, AZ 85040, USA; [email protected] (J.X.); [email protected] (Y.B.); [email protected] (W.M.K.) 4 Department of Internal Medicine, Oncologic Day Hospital, Bressanone Hospital (SABES-ASDAA), 39042 Bressanone-Brixen, Italy 5 West Virginia University Cancer Institute, Morgantown, WV 26506, USA; [email protected] 6 West Cancer Center, Germantown, TN 38138, USA; [email protected] 7 Department of Oncology, Karmanos Cancer Institute, Wayne State University, Detroit, MI 48201, USA; [email protected] 8 Levine Cancer Institute, Charlotte, NC 28204, USA; [email protected] 9 Ruesch Center for the Cure of Gastrointestinal Cancers, Lombardi Comprehensive Cancer Center, Georgetown University Medical Center, Washington, DC 20057, USA; [email protected] * Correspondence: [email protected]; Tel.: +43-50504-23001 Received: 20 March 2020; Accepted: 19 May 2020; Published: 22 May 2020 Abstract: Werner syndrome gene (WRN) contributes to DNA repair.
    [Show full text]