Detection and Identification of Plant Viruses Belonging to the Potyviridae

DETECTION AND IDENTIFICATION OF POTYVIRUSES AND GEMINIVIRUSES IN VIETNAM

Cuong Viet Ha

Tropical Crops and Biocommodities Domain

Institute of Health and Biomedical Innovation

A thesis submitted for the degree of Doctor of Philosophy to the Queensland University of Technology

2007

ABSTRACT

Prior to the commencement of this project, few plant viruses had been identified from Vietnam despite virus-like symptoms being commonly observed on many crops and weeds. In limited surveys in the late 1990’s, preliminary evidence was obtained indicating that potyviruses and geminiviruses were causing significant diseases. As a result, this study was aimed at developing generic PCR-based methods for the rapid detection of viruses belonging to viruses in the families Potyviridae and

Geminiviridae in plant samples collected from Vietnam, and to characterise the viruses at the molecular level.

Novel degenerate PCR primers were developed for the identification of begomoviruses. Using these primers, 17 begomoviruses species infecting seven crop and nine weed species in Vietnam were identified and characterised. Sequence analyses showed that ten of the viruses (six monopartite and four bipartite) were new species. Of the seven previously characterized begomoviruses, five were identified in

Vietnam for the first time. Additionally, eight DNA-ß and three nanovirus-like DNA-

1 molecules were also found associated with the monopartite viruses. Five of the

DNA-β molecules were putatively novel.

Two novel bipartite begomoviruses, named Corchorus yellow vein virus (CoYVV) and Corchorus golden mosaic virus (CoGMV), were isolated from jute plants.

Analysis of these viruses showed that they were more similar to New World begomoviruses than to viruses from the Old World. This was based on the absence of an AV2 open reading frame, the presence of an N-terminal PWRLMAGT motif in

the coat protein and phylogenetic analysis of the DNA A and DNA B nucleotide and deduced amino acid sequences. This is the first known occurrence of Old World viruses bearing features of New World viruses, and their presence in Vietnam suggests the presence of a “New World” virus in the Old World prior to Gondwana separation. Other interesting features relating to begomoviruses identified in Vietnam were; (i) the detection of several recombination events, particularly between the newly identified Tomato yellow leaf curl Vietnam virus (TYLCVNV), and the previously characterised, Tomato leaf curl Vietnam virus (ToLCVV), (ii) the identification of new natural hosts of Sida leaf curl virus (SiLCV), Papaya leaf curl

China virus (PaLCuCNV) and Alternanthera yellow vein virus (AlYVV), (iii) the first report of variation in the geminivirus stem-loop nonanucleotide sequence

(CoGMV sequence was TATTATTAC rather than TAATATTAC) and (iv) the first report of different stem sequences in the stem-loop structure of two genomic components from a bipartite begomovirus, Kudzu mosaic virus (KuMV). The sequence and phylogenetic analyses of the begomoviruses and begomovirus- associated DNAs identified in this study suggested that South East Asia, and

Vietnam in particular, may be a centre of begomovirus diversity.

Two pairs of degenerate primers, designed in the CI gene (CIFor/CIRev) and HC-Pro gene (HPFo/HPRev), were developed for the detection of viruses in the genus

Potyvirus. Using these primers, three novel potyviruses from Vietnam were detected, namely Telosma mosaic virus (TelMV) infecting telosma (Telosma cordata), Peace lily mosaic virus (PeLMV) infecting peace lily (Spathiphyllum patinii) and Wild tomato mosaic virus (WTMV) infecting wild tomato (Solanum torvum). The fragments amplified by the two sets of primers enabled additional PCR and complete

iii

genomic sequencing of these three viruses and a Banana bract mosaic virus

(BBrMV) isolate from the Philippines. All four viruses shared genomic features typical of potyviruses. Sequence comparisons and phylogenetic analyses indicated that WTMV was most closely related to Chilli veinal mottle virus (ChiVMV) and

Pepper veinal mottle virus (PVMV) while PeLMV, TelMV were related to different extents with members of the BCMV subgroup.

The incidence of potyviruses infecting plants in Vietnam was investigated using the potyvirus-specific primers. Fifty two virus isolates from 13 distinct potyvirus species infecting a broad range of crops were identified in Vietnam by PCR and sequence analysis of the 3’ region of the genome. The viruses were Bean common mosaic virus (BCMV), Potato virus Y (PVY), Sugarcane mosaic virus (SCMV), Sorghum mosaic virus (SrMV), Chilli veinal mottle virus (ChiVMV), Zucchini yellow mosaic virus (ZYMV), Leek yellow stripe virus (LYMV), Shallot yellow stripe virus

(SYSV), Onion yellow dwarf virus (OYDV), Turnip mosaic virus (TuMV), Dasheen mosaic virus (DsMV), Sweet potato feathery mottle virus (SPFMV) and a novel potyvirus infecting chilli, which was tentatively named Chilli ringspot virus

(ChiRSV). With the exception of BCMV and PVY, this is first report of these viruses in Vietnam. Further, rabbit bell (Crotalaria anagyroides) and typhonia (Typhonium trilobatum) were identified as new natural hosts of the Peanut stunt virus (PStV) strain of BCMV and of DsMV, respectively. Sequence and phylogenetic analyses, based on the nucleotide sequence of the entire CP-coding region of all 52 virus isolates, revealed considerable variability in BCMV, SCMV, PVY, ZYMV and

DsMV. The phylogenetic analyses also suggested the possible presence of ancestral groups of BCMV, SCMV and ZYMV in Vietnam.

Keywords: ssDNA viruses, Geminiviridae, begomovirus, ssDNA satellites, begomovirus-associated DNA β, begomovirus-associated DNA 1, ssRNA viruses,

Potyviridae, potyvirus, degenerate primer, nanovirus, Vietnam.

PUBLICATIONS

Publications related to this PhD thesis

1. Ha, C., Coombs, S., Revill, P., Harding, R., Vu, M., and Dale, J. (2006) Corchorus yellow vein virus, a New World geminivirus from the Old World. Journal of General Virology 87: 997-1003.

2. C. Ha, S. Coombs, P. Revill, R. Harding, M. Vu and J. Dale. (2007). Molecular characterization of begomoviruses and DNA satellites from Vietnam – additional evidence that New World geminiviruses were present in the Old World prior to continental separation. Accepted for publication in Journal of General Virology.

3. C Ha, S. Coombs, P. Revill, R. Harding, M. Vu and J. Dale. (2007). Design and application of two novel degenerate primer pairs for the detection and complete genomic characterization of potyviruses. Accepted for publication in Archives of Virology.

4. C. Ha, P. Revill, R. Harding, M. Vu and J. Dale. (2007). Identification and sequence analysis of potyviruses infecting crops in Vietnam. Accepted for publication in Archives of Virology.

Papers unrelated to this PhD thesis

5. Revill, P.A., Ha, C.V., Porchun, S.C., Vu, M.T., and Dale, J.L. (2003) The complete nucleotide sequence of two distinct geminiviruses infecting cucurbits in Vietnam. Archives of Virology 148: 1523-1541.

6. Revill, P.A., Ha, C.V., Lines, R.E., Bell, K.E., Vu, M.T., and Dale, J.L. (2004) PCR and ELISA-based virus surveys of banana, papaya and cucurbit crops in Vietnam. Asia Pacific Journal of Molecular Biology and Biotechnology 12: 27 - 32.

7. Bell, K.E., Dale, J.L., Ha, C.V., Vu, M.T., and Revill, P.A. (2002) Characterisation of Rep-encoding components associated with banana bunchy top nanovirus in Vietnam. Archives of Virology 147: 695-707.

8. Bateson, M.F., Lines, R.E., Revill, P., Chaleeprom, W., Ha, C.V., Gibbs, A.J., and Dale, J.L. (2002) On the evolution and molecular epidemiology of the potyvirus Papaya ringspot virus. Journal of General Virology 83: 2575-2585.

vii

TABLE OF CONTENTS

ABSTRACT...... ii PUBLICATIONS…………………………...... vi TABLE OF CONTENTS...... viii LIST OF ABBREVIATIONS...... xii STATEMENT OF ORIGINAL AUTHORSHIP...... xiv ACKNOWLEDGEMENTS...... xv

CHAPTER 1: AIMS AND OBJECTIVES………………………………………..1

CHAPTER 2: LITERATURE REVIEW……………………………………… 5

2.1. THE FAMILY GEMINIVIRIDAE ……………………………………..…… 6 2.1.1. INTRODUCTION ...... 6 2.1.2. TAXONOMY...... 6 2.1.3. GENOME ORGANIZATION...... 11 2.1.3.1. Genome organization of begomoviruses...... 11 2.1.3.2. Genome organization of mastreviruses...... 15 2.1.3.3. Genome organization of curtoviruses and topocuviruses...... 16 2.1.4. FUNCTIONS OF GENES...... 16 2.1.4.1. Replication-associated protein (Rep)...... 16 2.1.4.2. Coat protein (CP)...... 18 2.1.4.3. Genes on DNA-B of bipartite begomovirus...... 21 2.1.4.4. C4 protein...... 22 2.1.4.5. Replication enhancer protein (REn)...... 23 2.1.4.6. Transcriptional activator protein (TrAP)...... 23 2.1.4.7. Movement protein (MP) (AV2, V2 protein)...... 24 2.1.5. REPLICATION...... 25 2.1.6. RECOMBINATION...... 26

viii

2.1.7. CIRCULAR SSDNA MOLECULES ASSOCIATED WITH GEMINIVIRUSES...... 28 2.1.7.1. Tomato leaf curl virus (ToLCV) satellite DNA (ToLCV-sat)...... 28 2.1.7.2. Nanovirus-like DNA-1...... 31 2.1.7.3. DNA-β...... 32 2.1.8. DIAGNOSIS...... 33 2.1.8.1. Serological techniques...... 33 2.1.8.2. Genomic DNA-based techniques...... 35 2.1.8.2.1. DNA hybridization...... 35 2.1.8.2.2. Polymerase chain reaction (PCR)...... 36

2.2. THE FAMILY POTYVIRIDAE...... 37 2.2.1. INTRODUCTION ...... 37 2.2.2. TAXONOMY...... 41 2.2.3. GENOME ORGANIZATION...... 41 2.2.4. FUNCTIONS OF GENES...... 45 2.2.4.1. P1 protein...... 45 2.2.4.2. HC-Pro protein...... 46 2.2.4.3. P3 protein...... 48 2.2.4.4. CI protein...... 48 2.2.4.5. 6K proteins...... 49 2.2.4.6. Genome-linked viral protein (VPg)...... 49 2.2.4.7. NIa-Pro protein...... 51 2.2.4.8. NIb protein...... 51 2.2.4.9. CP (coat protein)...... 51 2.2.5. DIAGNOSIS...... 54 2.2.5.1. Serological techniques...... 54 2.2.5.2. Nucleic acid - based techniques...... 55 2.2.5.2.1. Hybridization techniques...... 55 2.2.5.2.2. Reverse transcriptase - polymerase chain reaction (RT-PCR)…………...55 2.3. REFERENCES………………………………………………………………....57

CHAPTER 3: CORCHORUS YELLOW VEIN VIRUS, A NEW WORLD GEMINIVIRUS FROM THE OLD WORLD……………………………………91

ABSTRACT……………………………………………………………………..….93 INTRODUCTION………………………………...……………………………...…94 METHODS…………………………………………………………………….……96 RESULTS………………………………………………………………….………102 DISCUSSION……………………………………………………………….……..109 REFERENCES……………………………………………………….……………114

CHAPTER 4: MOLECULAR CHARACTERIZATION OF BEGOMOVIRUSES AND DNA SATELLITES FROM VIETNAM - ADDITIONAL EVIDENCE THAT NEW WORLD GEMINIVIRUSES WERE PRESENT IN THE OLD WORLD PRIOR TO CONTINENTAL SEPARATION………………………………………………………………….119

ABSTRACT…………………………………………………………………… 121 INTRODUCTION…………………………………………………………………122 METHODS………………………………………….……………………………..126 RESULTS...... 130 DISCUSSION...... 156 REFERENCES...... 162

CHAPTER 5: DESIGN AND APPLICATION OF TWO NOVEL DEGENERATE PRIMER PAIRS FOR THE DETECTION AND COMPLETE GENOMIC CHARACTERISATION OF POTYVIRUSES……………….….169

SUMMARY...... 170 INTRODUCTION...... 171 MATERIALS AND METHODS...... 173 RESULTS...... 180 DISCUSSION...... 195 REFERENCES...... 198

CHAPTER 6: IDENTIFICATION AND SEQUENCE ANALYSIS OF POTYVIRUSES INFECTING CROPS IN VIETNAM ………………………203 SUMMARY………………………………………………………………………204. INTRODUCTION...... 205 MATERIALS AND METHODS...... 206 RESULTS...... 213 DISCUSSION……………………………………………………………………..235 REFERENCES...... 239

CHAPTER 7: GENERAL DISCUSSION AND CONCLUSIONS...... 245

LIST OF ABBREVIATIONS

µg microgram

µL microlitre

µM micromolar

µm micrometre

ATPase adenosine triphosphatase

CTAB cetyl trimethyl ammonium bromide

DMSO dimethyl sulfoxide

DNA deoxyribonucleic acid

EDTA ethylenediaminetetraacetic acid

ELISA enzyme linked immunosorbent assay g gram g gravity

GUS beta-glucuronidase h hour

IPTG isopropyl-β-D-thiogalactopyranoside

ISEM immunosorbent electron microscopy kb kilobase kPa kilopascal

L litre

LB Luria-Bertani broth

M molar

MAb monoclonal antibody

MES 2-(N-morpholino) ethanesulfonic acid monohydrate mg milligram

xii

mL milliliter mM millimolar

MS Murashige and Skoog

NTP nucleotide triphosphate

NTPase nucleotide triphosphatase

PAb polyclonal antibody

PCR polymerase chain reaction pM picomolar pmol picomole

RNA ribonucleic acid rpm revolutions per minute

RT room temperature

RT-PCR reverse transcriptase - PCR s second

SDS sodium dodecyl sulfate

SOB super optimal broth

SSC saline sodium citrate

TAE tris-acetate-EDTA

TAS-ELISA triple antibody sandwich - ELISA

TE tris-EDTA

U unit

UV ultraviolet

V volt

X-Gal 5-bromo-4-chloro-3-indolyl-β-D-galactoside

X-Gluc 5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid, cyclohexylammonium salt

xiii

STATEMENT OF ORIGINAL AUTHORSHIP

The work contained in this thesis has not been previously submitted to meet requirements for an award at this or any other higher education institution. To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made.

Signature:

Date:

xiv

ACKNOWLEDGEMENTS

First and foremost, my sincere thank goes to Professor James Dale, my principal supervisor, for his ongoing support and suggestions through my PhD. Without him, this PhD project would not have been possible. My sincere thank also goes to my associate supervisors, Associate Professor Rob Harding, Professor Man Vu for all their help and encouragement during my PhD and particularly to Dr. Peter Revill who helped to shape my research skills. As an international student, I was lucky to study in a great working environment created by the staff, scientists and students of the Plant Biotechnology Group. They were all very friendly and helpful to me and I would like to thank all of them; Associate Professor Chris Collet, Dr. Terry Walsh, Dr. Marion Bateson, Dr. Doug Becker, Dr. Ben Dugdale, Dr. Jason Geijskes, Dr. Mark Harrison, Dr. Harjeet Khanna, Ms Susan Porchun, Dr. Rosemarie Lines, Brett Williams, Matthew Webb, Kathryn Bell, Kay Taylor, Nishantha Jayathilake, Srimek Chowpongpang, Clair Bolton, Aurelie Chanson, Michelle Dowling, Suzanne Facy, Bulukani Mlalazi, Priver Namanya, Jean-Yves Paul, Steven Pirlo, Theresa Tsao, Suzelle Waggett, Don Catchpoole, Jennifer Kleidon and Maiko Kato. I would like to thank Diana O’Rourke who helped me a lot during my 1999, 2000 and 2001 training courses and PhD time at QUT. I would also like to thank the Queensland University of Technology where I received the International Postgraduate Research Scholarship (IPRS), living allowance support and great study conditions.

I would like to thank to all staff of the Plant Pathology Department (Hanoi Agricultural University, Vietnam) who always supported and encouraged me during my PhD time in Australia. I would also like to thank the staff of the Post-Import Plant Quarantine Center I (Vietnam), Sugarcane Research Institute (Vietnam) and Coffee Research Institute (Vietnam) for their help during my field surveys in Vietnam in 2004.

Last, but not least, I thank my wife and daughter for their patience and for supporting me through all these years.

CHAPTER 1

AIMS AND OBJECTIVES

Description of scientific problem investigated

Viruses are considered one of the major constraints to agricultural production in

Vietnam. However, accurate data on the range and impact of plant virus diseases is not available due to a lack of diagnostic techniques and capacity. To address this problem, a collaborative project between QUT and Hanoi Agricultural University

(HAU), and funded by the Australian Centre for International Agricultural Research

(ACIAR), commenced in 1999 with a major aim being to improve the diagnostic capability at HAU and to gain a better understanding of the viruses affecting important agricultural crops in Vietnam. Preliminary surveys throughout the country between 1999 and 2002 indicated that several plant viruses, mostly geminiviruses, nanoviruses and potyviruses, were causing major diseases in banana, papaya and several cucurbit crops. As a consequence of these preliminary findings, further research towards the identification and characterization of plant viruses in Vietnam was undertaken, focusing specifically on viruses in the important families

Geminiviridae and Potyviridae.

Overall objectives of the study

A key component to the control of plant virus diseases is the availability of diagnostic tools for the rapid and accurate identification of the virus causing the disease. PCR is gaining increasing popularity as a diagnostic tool for plant viruses

and, with the number of plant virus sequences deposited in public databases increasing exponentially, opportunities are now arising to design degenerate PCR primers for the detection of viruses at genus, and sometimes family, levels. The overall objective of this study was to develop generic PCR-based methods to enable the detection and subsequent characterisation of plant viruses belonging to the families Potyviridae and Geminiviridae in Vietnam. Such information will be important in the development of control strategies and for matters of plant quarantine.

Specific aims of the study

The specific aims of this project were to (i) develop generic PCR-based methods for the rapid detection of viruses belonging to the families Potyviridae and

Geminiviridae (and their associated satellites), (ii) utilise these generic methods to identify viruses belonging to the families Potyviridae and the Geminiviridae (and their associated satellites) in samples collected from selected crops and weeds in

Vietnam and (iii) characterise, at the molecular level, any “new” virus species in the families Potyviridae and Geminiviridae identified during the study.

Account of scientific progress linking the scientific papers

The first two papers focused on the identification and characterization of begomoviruses in Vietnam. The first paper (Chapter 3) describes the development of novel degenerate PCR primers to detect begomoviruses, and the use of these primers to detect and characterize a novel, bipartite begomovirus (Corchorus yellow vein virus (CoYVV)) infecting Jute mallow (Corchorus capsularis, Tilliaceae). This

paper provided the first example of an indigenous Old World begomovirus that has all of the distinguishing characteristics of a New World virus. The ramifications of this finding for current theories on begomovirus evolution were discussed.

The second paper (Chapter 4) describes the identification and characterisation of geminiviruses and associated DNA molecules infecting crop and weed species in

Vietnam. Sixteen begomoviruses were identified and their genomes cloned, sequenced and analysed. Nine of the viruses were shown to be new species and five of them were identified in Vietnam for the first time. Eight DNA-ß (five putatively novel) and three nanovirus-like DNA-1 molecules were also found associated with some of the monopartite viruses. A second bipartite begomovirus, Corchorus golden mosaic virus (CoGMV), with similar genomic features to the previously characterised, Corchorus yellow vein virus (CoYVV), was also identified which supported the hypothesis that New World-like viruses are present in the Old World.

The final two papers focussed on the identification and characterision of potyviruses in Vietnam. Paper three (Chapter 5) describes the development of two alternative sets of degenerate PCR primers to amplify sequences from the 5’ (HC-Pro) and central

(CI) regions of potyviral genomes. These primers were used to identify 15 potyviruses in Vietnam, of which three were novel, Telosma mosaic virus (TelMV),

Peace lily mosaic virus (PeLMV) and Wild tomato mosaic virus (WTMV). The complete genomes of these three novel viruses, in addition to a Banana bract mosaic virus (BBrMV) isolate from the Philippines, were completely sequenced and analysed.

The final paper (Chapter 6) describes the characterisation and analysis of the 3’ region of 52 virus isolates from 13 distinct potyviruses identified in Vietnam, namely

Bean common mosaic virus (BCMV), Potato virus Y (PVY), Sugarcane mosaic virus (SCMV), Sorghum mosaic virus (SrMV), Chilli veinal mottle virus (ChiVMV),

Zucchini yellow mosaic virus (ZYMV), Leek yellow stripe virus (LYMV), Shallot yellow stripe virus (SYSV), Onion yellow dwarf virus (OYDV), Turnip mosaic virus

(TuMV), Dasheen mosaic virus (DsMV), Sweet potato feathery mottle virus

(SPFMV) and a novel potyvirus infecting chilli, which was tentatively named Chilli ringspot virus (ChiRSV). Eleven of these viruses were reported in Vietnam for the first time. Sequence and phylogenetic analyses of the complete CP-coding region revealed considerable sequence variability in many of the viruses, and also suggested the presence of the ancestral groups of BCMV, SCMV and ZYMV in Vietnam.

CHAPTER 2

LITERATURE REVIEW

2.1. THE FAMILY GEMINIVIRIDAE

2.1.1. Introduction

The Geminiviridae is one of the largest families of plant viruses, containing 209 definite and tentative members (Fauquet and Stanley, 2005) (Table 2.1). All members of the family have circular, single-stranded DNA genomes that are approximately 2.7 kb in length and encapsidated within twinned (geminate) icosahedral particles (Figure 2.1). Geminiviruses can be either monopartite, if their genome contains only one DNA molecule, or bipartite if it consists of two molecules

(Stanley et al., 2005).

Many economically important virus diseases of crops are caused by geminiviruses

(Moffat, 1999). Some of the most important ones are Maize streak virus (MSV)

(Bosque-Perez, 2000) and those that infect cassava (Legg and Fauquet, 2004), cotton

(Briddon, 2003; Briddon and Markham, 2000) and tomato (Moriones and Navas-

Castillo, 2000).

2.1.2. Taxonomy

Based on the genome arrangement and biological properties, geminiviruses are currently classified into four genera, Mastrevirus, Curtovirus, Topocuvirus and

Begomovirus (Stanley et al., 2005). Of them, the genus Begomovirus is increasingly important with 185 species (Table 2.1).

Table 2.1. Current classification of the family Geminiviridae

Number of species† Genus Type species Genome* Vector Definitive Tentative Total

Mastrevirus Maize streak virus (MSV) M Leafhopper 11 6 17

Curtovirus Beet curly top virus (BCTV) M Leafhopper 5 1 6

Topocuvirus Tomato pseudo-curly top virus (TPCTV) M Treehopper 1 0 1

Begomovirus Bean golden yellow mosaic virus (BGMV) M, B Whitefly 132 53 185

149 60 209

* M: Monopartite, B: Bipartite

† The number of species is derived from Fauquet & Stanley (2005).

A B

Figure 2.1. Morphology of geminiviruses. A. Purified geminate particles of Tomato yellow leaf curl virus (TYLCV), bar = 100 nm (Gafni, 2003). B. A cryoEM reconstruction of Maize streak virus (MSV) (Zhang et al., 2001).

2.1.3. Genome organization

2.1.3.1. Genome organization of begomoviruses

Begomoviruses have either a bipartite genome, with components known as DNA-A and DNA-B, or a monopartite genome resembling DNA-A. DNA-A typically harbours six open reading frames (ORF): AV1 (known as AR1; coat protein, CP) and

AV2 (known as AR2; AV2 protein or movement protein, MP) on the virion-sense strand; AC1 (known as AL1; replication protein, Rep), AC2 (known as AL2; transcriptional activator, TrAP), AC3 (known as AL3; replication enhancer, REn) and AC4 (known as AL4; AC4 protein) on the complementary-sense strand. DNA-B contains two ORFs encoding proteins involved in movement: BV1 (known as BR1; nuclear shuttle protein, NSP) on the virion-sense strand and BC1 (known as BL1; movement protein, MPB) on the complementary-sense strand (Seal et al., 2006;

Stanley et al., 2005). The genome organization of begomoviruses is shown in Figure

2.2.

Based on phylogenetic studies and genome arrangement, begomoviruses have been broadly divided into two groups, the Old World viruses (Eastern Hemisphere,

Europe, Africa, Australasia) and the New World viruses (Western Hemisphere, The

Americas) (Padidam et al., 1999; Paximadis et al., 1999; Rybicki, 1994).

Begomovirus genomes have a number of characteristics that distinguish Old World and New World viruses. All New World begomoviruses are bipartite, whereas both bipartite and monopartite begomoviruses are present in the Old World. In addition,

Rep binding

AC4 (=AL4) AV2 (MP) CR (=V1, AR2) CR

Begomovirus Begomovirus AC1 (Rep) (=AL1) DNA-A AV1 (CP) DNA-B (=AR1) BV1 (NSP) BC1 (MP) (=BR1) (=BL1)

AC3 (REn) AC2 (TrAP) (=AL3) (=AL2)

V3 (MP) V1 (MP) C4 LIR

V2 C1 (Rep A) Mastrevirus C1 (Rep) Curtovirus V2 (CP) V1 (CP)

C1:C2 (Rep) SIR “Primer-like molecule” C2 C2 C3 (REn)

C4 V2

Topocuvirus C1 (Rep) V1 (CP)

C2 C3 (REn)

Figure 2.2. Genome organization of the four genera of the family Geminiviridae. The ORFs are denoted according to their orientation as V (virion-sense) or C (complementary-sense). The ORFs of the monopartite begomoviruses should not have the “prefix” A. The dotted borderline of the AV2 ORF of DNA-A of the genus Begomovirus indicates that this ORF is absent in members from the New World. The common region (CR) of the two components of the genus Begomovirus is illustrated in more detail with a solid arrow indicating the nicking position. Two open boxes in the mastrevirus genome indicate introns. LIR; large intergenic region, SIR; small intergenic region, MP; movement protein, CP; coat protein, Rep; replication-associated protein, REn; replication enhancer, TrAP; transcriptional activator protein.

DNA-A of bipartite begomoviruses from the New World lacks an AV2 ORF

(Rybicki, 1994; Stanley et al., 2005).

The opposing transcription units on DNA-A and -B are separated by an intergenic region (IR) that, in most cases, shares a highly conserved region of ~ 200 nts, called the common region (CR) (Lazarowitz, 1992). The CR contains an origin of replication (ori) organized modularly including a stem-loop structure containing an invariant nonanucleotide TAATATTAC sequence, whose T7-A8 site is required for cleaving and joining of the viral DNA during replication (Laufs et al., 1995a). The ori posses a virus-specific recognition region located upstream of the stem-loop, which contains conserved reiterated sequences (iterons) required for specific recognition and binding by Rep during replication (Fontes et al., 1994a; Fontes et al.,

1994b).

2.1.3.2. Genome organization of mastreviruses

The monopartite mastreviruses (Figure 2.2) have genomes containing a long (or large) and small intergenic region (LIR and SIR, respectively) located opposite to each other on the genome. The LIR contains the ori for the virion strand synthesis similar to that of begomoviruses. The SIR contains the ori for the synthesis of the complementary strand and a short ssDNA sequence (~70-80 nts). This primer-like sequence is annealed to the encapsidated genomic ssDNA and is thought to prime the minus strand synthesis. The genome of mastreviruses encodes four proteins, Rep and

RepA on the complementary-sense strand, MP and CP on the virion-sense strand.

While RepA is produced from unspliced transcripts containing the C1 ORF, Rep is

expressed from spliced transcripts with fused C1 and C2 ORFs. The excised sequence contains signals typical of plant introns (Boulton, 2002; Gutierrez, 2002;

Gutierrez et al., 2004; Hanley-Bowdoin et al., 2000; Palmer and Rybicki, 1998).

2.1.3.3. Genome organization of curtoviruses and topocuviruses

The genome organization of curtoviruses and topocuviruses (Figure 2.2) is similar to that of monopartite begomoviruses, except that the genome of curtoviruses encodes one extra protein (V2 protein) on the virion-sense strand that is involved in regulation of the levels of ss and dsDNA (Stanley et al., 2005).

2.1.4. Functions of genes

2.1.4.1. Replication-associated protein (Rep)

The Rep protein of geminiviruses is a multifunctional protein with a number of important functions including:

DNA binding. For initiating of replication, Rep is required to bind to the dsDNA template. Rep recognizes its cognate DNA ori in a sequence- and site-specific manner, and this process involves iteron sequences upstream of the stem-loop structure (Fontes et al., 1994b). Although the natural substrate for Rep binding in vivo is dsDNA, Rep binds to ssDNA in vitro (Fontes et al., 1994a). Jupin et al.

(1995) demonstrated that the 116 N-terminal amino acids of TYLCV Rep are responsible for binding.

Cleavage and joining activities. Rep initiates the virion-strand replication by

7 8 introducing a nick between nucleotides 7 and 8 (TAATATT OH-PA C) of the nonanucleotide sequence in the stem-loop (Laufs et al., 1995b). The Rep domain responsible for cleavage activity was mapped to the first 211 amino acids of TYLCV

Rep (Heyraud-Nitschke et al., 1995) and the first 120 amino acids in Tomato golden mosaic virus (TGMV) (Orozco et al., 1997). This N-terminal domain contains three motifs conserved among the Reps of all geminiviruses (Laufs et al., 1995a). Motif I

(FLTY) has an unknown function, motif II (HLH) is a putative metal ion binding site, and motif III contains a highly conserved Y residue that is essential for both cleavage and joining activities (Laufs et al., 1995a; Orozco et al., 1997). The linear ssDNAs generated from RCR replication (see section 2.1.5) are recircularized into circular ssDNAs by the joining activity of Rep by transferring the 5’ terminal phosphate of the linear ssDNA to the 3’OH end (Laufs et al., 1995b). These ssDNAs can either be encapsidated or go back into the replication cycle.

Oligomerization. Formation of protein complexes is an essential property for origin recognition and replication in many organisms that replicate by RCR. Settlage et al.

(1996) showed that the Rep of Tomato golden mosaic virus (TGMV) and BGMV formed oligomers. The authors demonstrated that this oligomerization occurred in a virus non-specific manner as Reps of the two viruses complexed with each other and the addition of heterologous Rep had no effect on the efficiency of replication. The

Rep domain responsible for the oligomerization was mapped to between amino acids

120 and 181 in TGMV. This domain contained two characteristic α-helices that were essential for the oligomerization (Orozco et al., 1997; 2000).

Interaction with host factors associated with replication machinery. Replication of geminiviruses can occur in plant tissue that is not actively dividing (Horns and Jeske,

1991). In addition, geminiviruses do not encode a nucleic acid polymerase.

Therefore, after establishing an infection, geminiviruses need to induce the replication machinery of the host cells. There is some evidence demonstrating the interaction between Rep and replication factors of the host. For example, Ach et al.

(1997) found that Rep of TGMV can bind to the RRB1, a maize retinoblastoma- related protein that is a negative regulator responsible for the G1 to S phase transition of the cell cycle. Recently, Rep of Tomato yellow leaf curl Sardinia virus (TYLCSV) was found to interact with PCNA (proliferating cell nuclear antigen) in Arabidopsis.

PCNA is a ring-like protein that functions as a mobile platform or “sliding clamp” for docking of enzymes necessary for the replication of DNA (Castillo et al., 2003).

For mastreviruses, RepA is responsible for interaction with host factors. The interaction of RepA with RRB is performed through an LXCXE motif that is located close to the splicing site (Boulton, 2002).

ATPase activity. The Rep C-terminal region contains a conserved motif similar to the

P-loop motif of other NTP hydrolysing proteins. Desbiez et al. (1995) showed that

Rep of TYLCV exhibited an ATPase activity in vitro and demonstrated that the ability of Rep to bind and hydrolyse ATP was essential for replication. However, the nature of this activity in the replication process remains unclear because it was shown that cleavage and ligation activities do not require the participation of ATPase activity (Heyraud-Nitschke et al., 1995).

2.1.4.2. Coat protein (CP)

The CP of geminiviruses is a multifunctional protein required for a range of functions associated with encapsidation, accumulation of viral ssDNA, insect transmission and both intra- and inter-cellular movement (Boulton, 2002). However, these functions vary according to genus.

Encapsidation. The most important function of CP is to form the shell in which genomic ssDNA is encapsidated. Initial studies on geminivirus capsid structure were done on Chloris striate mosaic virus (Hatta and Francki, 1979). A study based on

MSV, using cryo-electron microscopy and three dimensional image reconstruction

(Zhang et al., 2001), revealed that geminate particles are assembled from 110 protein subunits, organized as 22 pentameric capsomers forming 2 abutting incomplete T=1 icosahedra joined together (Figure 2.1.B). Assembly and stability of the geminivirus particles relies on interactions between CP molecules. It was suggested that the N- terminal region of one CP molecule binds to the C-terminal amino acids of another

(Hallan and Gafni, 2001).

Transmission by vectors. The CP plays a key role in vector transmission and in determination of vector specificity. One important experiment to prove this role was conducted with two members of different genera, in which the CP gene of African cassava mosaic virus (ACMV), a begomovirus, was replaced with that from BCTV, a curtovirus (Briddon et al., 1990). This chimeric genome produced symptoms typical of ACMV infection. The CP gene of BCTV was also expressed in plants and was shown to encapsidate the hybrid ACMV genomic ssDNA. Interestingly,

Circulifera tenellus, the vector of BCTV, transmitted hybrid ACMV virus to N. benthamiana seedlings, but not the original ACMV. This indicated that the CP influences the vector specificity (Briddon et al., 1990). Similarly, a whitefly nontransmissible strain of Abutilon mosaic virus (AbMV), with the CP replaced with that from Sida golden mosaic virus (SiGMV), was acquired and transmitted by whitefly to various host plants, indicating a crucial role of CP in the transmission process

(Hofer et al., 1997). The region associated with vector transmission was identified within positions 124-174. The mutation in this region altered virus transmission by the vector by either preventing particle assembly, or inhibiting passage of the virus from gut to haemocoel or from the haemocoel to the salivary gland of vectors

(Harrison et al., 2002).

Intra-cellular targeting. During infection, many virus-associated products (genomic

DNA, replication intermediates, and proteins) need to move to particular sites in the cells. It has been suggested that this transport is conducted with the participation of viral proteins, host cytoskeletal elements and possibly host nuclear shuttle proteins

(Gafni and Epel, 2002).

Because geminiviruses replicate in the nucleus of infected host cells, following their inoculation into the cytoplasm by vectors, the virus needs to be transported into the nucleus for replication. Although it is still not clear if geminiviruses enter the nucleus in the form of intact virions or as nucleoprotein complexes, the presence of only the viral CP in the nucleus following initial cellular entry suggests it may be involved in the nuclear import of viral DNA. The trafficking of the viral DNA-protein complex between the nucleoplasm and protoplasm occurs through a complex structure called the nuclear pore complex (NPC) and is mediated by host transport receptors known as karyopherins that link to virus-associated proteins and then become associated with the NPC. To be recognized by host receptors, these virus-associated proteins must contain nuclear localizing signals (NLS) (Gafni and Epel, 2002). Such signals have been determined for both monopartite and bipartite geminiviruses and are mainly located in the N-terminal region of the CP; 63 amino acids for TYLCV

(Kunik et al., 1998), 5-22 amino acids for MSV (Liu et al., 1999) and 54 amino acids for ACMV (Unseld et al., 2001). For ACMV, two other domains containing NLS signals, which are located in the central (100-127 amino acids) and C-terminal (201-

258 amino acids) regions, were also determined (Unseld et al., 2001).

The CP of geminiviruses also participates in exporting the viral genome from the nucleus to the cytoplasm. In this case, a nuclear export signal (NES) is required for recognition by a host receptor. A NES signal located in the C-terminal half of the

TYLCV CP has been identified (Rhee et al., 2000). For bipartite begomoviruses, although nuclear export is the responsibility of the BV1 gene product, one NES was identified in the central region of the ACMV CP (Unseld et al., 2001). In brief, CP, in terms of intra-cellular targeting function, serves as a nuclear shuttle protein for monopartite geminiviruses and as a nuclear import protein for bipartite begomoviruses.

2.1.4.3. Genes on DNA-B of bipartite begomoviruses.

DNA-B of bipartite begomoviruses encodes two proteins, BV1 (NSP) and BC1

(MP), both involved in viral movement.

BV1 is a nuclear shuttle protein. BV1 functions as a nuclear shuttle protein that is responsible for transporting viral ssDNA into and out of the nucleus. However, it is not involved in the nuclear import of viral ssDNA during initial infection, which is facilitated by the CP (Gafni and Epel, 2002). The NLS of Squash leaf curl virus

(SqLCV) BV1 was mapped to the N-terminal 113 residues (Pascal et al., 1994) and contained a sequence of 22 amino acids containing the motif SLEKDLLIDLH, resembling the NES of other nuclear shuttling proteins (Ward and Lazarowitz, 1999).

BV1 interacts with BC1 for cell-to-cell movement. BV1 enters the nucleus to form a complex with viral ssDNA that moves to the cytoplasm and is trapped by BC1. The complex BV1:BC1:ssDNA then moves to the plasmodesmata and is transferred to the adjacent cell (Gafni and Epel, 2002). The C-terminal region of the SqLCV BV1 was shown to be essential for interaction with BC1 (Sanderfoot et al., 1996).

BC1 is a movement protein. The function of BC1 as a MP was demonstrated in two cases: (1) Bean dwarf mosaic virus (BDMV) BC1 increased the size exclusion limit

(SEL) of plasmodesmata (Noueiry et al., 1994; Rojas et al., 1998), and (2) SqLCV

BC1 induced formation of a tubular structure derived from the endoplasmic reticulum that facilitated viral translocation between cells (Ward et al., 1997). As mentioned above, it has been proposed that BC1 interacts with BV1 through the

BV1:BC1:ssDNA complex for cell-to-cell movement (Gafni and Epel, 2002).

BC1 is involved in pathogenicity. The association of BC1 with pathogenicity has been proven in transgenic experiments. Tobacco and tomato plants transformed with the BC1 gene of Tomato mottle virus (ToMoV) and BDMV, respectively, expressed characteristic visible symptoms of viral infection. The BC1 genomic region responsible for induction of pathogenicity was mapped to the C-terminus since transgenic lines containing a deletion of this region (eg. 119 amino acids for BC1 of

TMoV), were all symptomless (Duan et al., 1997; Hou et al., 2000).

2.1.4.4. C4 protein

C4 protein is involved in movement of monopartite begomoviruses. Through mutation analysis, Jupin et al. (1994) found that the protein encoded by the TYLCV

C4 ORF was necessary for viral systemic movement. Using microinjection and transient expression assays, Rojas et al. (2001) suggested that the TYLCV C4 protein that contains an N-terminal putative myristoylation domain could deliver viral DNA to the plasmodesmata and mediate cell-to-cell transport.

C4 protein is involved in symptom expression of monopartite begomoviruses.

Rigden et al. (1994) showed that plants agro-inoculated with constructs containing

Tomato leaf curl virus (ToLCV) C4 ORF initiation codon mutants showed significantly less symptoms than controls. For bipartite begomoviruses, the ACMV

AC4 protein has been shown to bind miRNA (Chellappan et al., 2005) and suppress

PTGS (Vanitharani et al., 2004).

2.1.4.5. Replication enhancer protein (REn)

REn enhances replication. Sunter et al. (1990) observed that mutation of the AL3

ORF of TGMV created a large reduction in the levels of ss- and dsDNA. They proposed that the association between the AL3 ORF and replication depends on the interaction between Rep and the AL3 protein. Such an interaction has been found in

TGMV and BGMV (Settlage et al., 1996).

REn interacts with cell cycle regulator proteins. The interaction of the AL3 protein of TGMV, a bipartite begomovirus, with a maize retinoblastoma homolog (pRBR1) was demonstrated by Settlage et al. (2001). Using a yeast two-hybrid system,

Castillo et al. (2003) found that REn of TYLCSV, a monopartite begomovirus, also interacted with PCNA of Arabidopsis thaliana and tomato.

2.1.4.6. Transcriptional activator protein (TrAP)

TrAP is a transcriptional activator protein. The AL2 protein is required for efficient transcription of virion sense viral genes such as CP and the BR1 protein (Sunter and

Bisaro, 1992). Using transgenes consisting of complete and truncated versions of the

CP promoter of TGMV fused to the GUS reporter gene, Sunter and Bisaro (1997) found that TrAP activated the CP promoter in mesophyll cells but repressed it in phloem tissue. The biochemical properties of TrAP were also elucidated showing that it (1) had ability to bind to ssDNA in a sequence non-specific manner and to zinc ions, (2) was phosphorylated and (3) contained a minimal transcriptional activation domain comprising 15 C-terminal amino acids (Hartitz et al., 1999).

TrAP is a potential silencing suppressor. The ability of TrAP to act as a suppressor of post-transcriptional gene silencing was first shown with ACMV (Voinnet et al.,

1999). Sunter et al. (2001) demonstrated that transgenic tobacco plants expressing

the AL2 ORF of TGMV showed enhanced susceptibility to infection of TGMV,

BCTV and Tobacco mosaic virus (TMV), an unrelated RNA virus. This function seemed to be independent of the transcriptional activity because the activation domain located in the C-terminal region was truncated in the AL2 transgene.

2.1.4.7. Mastrevirus movement protein (MP)

The movement protein (MP) of mastreviruses (also known as pre-coat protein) was shown to be a movement protein with a similar function to the BC1 protein of bipartite begomoviruses (Boulton, 2002; Gafni and Epel, 2002). The MP of MSV associated with secondary plasmodesmata of infected maize cells (Dickinson et al.,

1996). It was also suggested that, like the BC1 protein, the MP of mastreviruses interacts with the CP:ssDNA complex to function in cell-to-cell movement (Liu et al., 2001).

For begomoviruses, the AV2 ORF is present only in viruses from the Old World

(Stanley et al., 2005). The plants (tomato, tobacco and N. benthamiana) inoculated with infectious DNA of Tomato leaf curl New Delhi virus (a bipartite virus) which contained deletions in AV2 developed very mild symptoms and accumulated only low levels of both ss- and ds viral DNA, whereas inoculated protoplasts accumulated both ss- and dsDNA to wild-type levels, showing that AV2 is required for efficient viral movement (Padidam et al., 1996). In TYLCV, a monopartite virus, mutations in the AV2 ORF affected ssDNA accumulation and prevented systemic infection of tomato plants (Wartig et al., 1997). It has been proposed that the AV1 product may enhance the export of the viral DNA of TYLCV from the nuclear periphery to the cell periphery (Rojas et al., 2001).

2.1.5. Replication

Geminivirus DNA replication follows a rolling-circle mechanism. The rolling circle replication (RCR) of geminiviruses can be divided into two phases (Gutierrez, 2000):

1. Conversion of viral ssDNA into dsDNA forms on entering the nucleus of the

initially infected cells. This step of synthesis of viral minus strand is carried out

by cellular enzymes and is still poorly understood.

2. Rolling circle phase to replicate viral ssDNA on dsDNA templates. This step

requires the participation of Rep. Rep is the only viral protein absolutely required

for RCR, as it is responsible for initiating DNA replication. Laufs et al. (1995a)

described in detail the role of Rep in initiation and termination of RCR of

geminiviruses.

Recently, an additional model of replication of geminiviruses and their satellites has been proposed (Alberter et al., 2005; Jeske et al., 2001; Preiss and Jeske, 2003). This model, recombination-dependent replication (RDR), was based on analyses of replication intermediates of AbMV, TYLCV, BCTV, TGMV, ACMV, ToLCV and one satellite molecule, DNA-β, using two-dimensional gel electrophoresis and electron microscopy. Apart from the previously identified RCR intermediates

(Saunders et al., 1991), a range of intermediates suggested an additional RDR pathway. This is analogous to the pathway of T4 bacteriophage (Kreuzer, 2000) that has also been named the “join-copy” pathway (Mosig, 1998), “break-induced replication” (George and Kreuzer, 1996) and “bubble-migration synthesis” (Formosa and Alberts, 1986). The RDR model has three steps (Kreuzer, 2000; Mosig et al.,

2001):

1. Processing of the broken double-stranded DNA to produce the 3’ end single-

stranded DNA required for DNA strand invasion.

2. Invasion of a homologous duplex by 3’ end single-stranded DNA to form a

structure known as the `displacement loop' (D-loop or bubble loop). DNA strand

invasion by the 3' end of ssDNA allows it to serve as a potential primer for DNA

replication.

3. DNA heteroduplex extension (branch migration). At this step, the protein-

directed branch migration occurs at the rear of the loop as DNA polymerase

extends the leading-strand product at the front of the loop. Because both reactions

occur at a similar rate, the size of the loop is roughly unchanged.

This type of RDR does not need a topoisomerase, even when the circular DNA templates are supercoiled, and the two parent strands do not need to separate from each other (Kreuzer, 2000).

RDR of geminiviruses apparently does not require participation of Rep in terms of its cognate virus recognition and nicking of ssDNA at the nonanucleotide sequence for initiation of replication. This possibility is also supported by a recent study (Lin et al., 2003) in which mutants of ToLCV and its sat-DNA molecule, that were impaired in their ability to bind Rep in vitro, were still infectious to tomato.

2.1.6. Recombination

One of the earliest pieces of evidence for recombination amongst geminiviruses was obtained from studies of a severe mosaic disease of cassava in Uganda (Zhou et al.,

1997). Sequence analysis revealed that a virus responsible for the disease, East

African cassava mosaic virus – Uganda (EACMV-UG) had probably arisen by interspecific recombination between East African cassava mosaic virus (EACMV) and ACMV.

Using a program to detect gene conversion, (GENECONV), Padidam et al. (1999) searched for recombination events among geminiviruses from sequences representing 64 distinct species. In total, the analysis identified 420 statistically significant recombinant fragments distributed across the viral genomes. The fragments (391) detected between viruses from different continents and between begomoviruses and curtoviruses were located in the N-terminal region of Rep, suggesting that they are old events that presumably occurred before the geographical isolation. This important analysis suggested that interspecific recombination has resulted in remarkable diversity among geminiviruses and could be a major cause of the emergence of new geminivirus diseases.

At present, the number of new geminiviruses arising as a consequence of recombination is increasing (Fauquet et al., 2005; Garcia-Andres et al., 2006; Girish and Usha, 2005; Idris and Brown, 2005; Kon et al., 2006; Rojas et al., 2005;

Rothenstein et al., 2006; Were et al., 2005). In some cases, the recombinants exhibited a new pathogenic phenotype which is often more virulent than the parents.

For example, a natural recombinant between TYLCSV and TYLCV has been detected which has a wider host range than for the individual viruses and which is becoming prevalent in geminivirus populations infecting tomato in Spain (Monci et al., 2002).

One question relating to the recombination of geminiviruses concerns the mechanism by which a virus acquires a DNA fragment from its counterpart. RCR alone does not seem to explain recombination. The second replication pathway, RDR, which may be widespread among geminiviruses (Jeske et al., 2001; Preiss and Jeske, 2003) may explain the recombination phenomena among geminiviruses.

2.1.7. Circular ssDNA molecules associated with geminiviruses

2.1.7.1. Tomato leaf curl virus (ToLCV) satellite DNA (ToLCV-sat)

The first circular DNA molecule associated with a geminivirus was ToLCV satellite

DNA isolated from ToLCV-infected tomato in Australia (Dry et al., 1997). This satellite DNA (Fig. 2.3) comprised 682 nts and contained two stem-loop structures (I and II). Stem-loop I had a nonanucleotide sequence, TAATATTAC, identical to that of other geminiviruses while stem-loop II contained, within the loop, a Rep-binding motif (iteron), GGTGTCT, identical to that of ToLCV. Another iteron

(AGACACC) is found upstream of the stem-loop II but in a reverse complement orientation. This satellite did not contain any significant ORF, shared no sequence similarity with the genome of its cognate virus, ToLCV, completely depended on the cognate virus for replication, systemic movement and encapsidation, and was not essential for ToLCV replication. Additionally, trans-replication of ToLCV-sat was also supported by other non-cognate geminiviruses such as TYLCV, ACMV and

BCTV (Dry et al., 1997).

SCR

A-rich

DNA-β Nanovirus-like βC1 DNA-1

A-rich Rep

Stem-loop I SCR

ToLCV-satellite

Stem-loop II A-rich

Figure 2.3. Genome organization of the begomovirus satellites. Rep; replication-associated protein, SCR; satellite conserved region.

2.1.7.2. Nanovirus-like DNA-1

The first nanovirus-like DNA molecule associated with geminiviruses was isolated from cotton infected with Cotton leaf curl Multan virus (CLCuV) in Pakistan

(Mansoor et al., 1999). Subsequently, similar molecules were found in many other plants infected with monopartite begomoviruses from the Old World (Briddon et al.,

2004). These DNA molecules, named nanovirus-like DNA-1 (Fig. 2.3), comprised

1375 nt and had a common genome organization including (1) a predicted stem-loop structure containing, within the loop, a conserved TAGTAATAT nonanucleotide sequence typical to that of nanoviruses, (2) a single large ORF in the positive sense encoding a homologue of the nanovirus replication-associated protein (Rep)

(typically 315 amino acids) and (3) an adenine rich (A-rich) region immediately downstream of the coding region (typically 100-200 nts) – the only feature different from nanovirus Rep components (Briddon et al., 2004). The Rep sequences of nanovirus-like DNA-1 are highly conserved (greater than 86 % amino acid sequence similarity) (Briddon et al., 2004). Nanovirus-like DNA-1 molecules can replicate autonomously, but similar to ToLCV-sat, they depend on helper viruses for systemic movement, encapsidation and play no role in symptom induction (Briddon et al.,

2004; Mansoor et al., 2003).

It has been suggested that the nanovirus like-DNA molecules were possibly

“captured” by geminiviruses during mixed infection by trans-encapsidation. This allowed them to be transmitted by geminivirus vectors and, therefore, increased their host range (Mansoor et al., 1999; Saunders et al., 2002).

2.1.7.3. DNA-β

Recently, another group of novel circular ssDNA molecules, named DNA-β (Fig.

2.3), have been found associated with many monopartite begomoviruses infecting a diverse range of plants including cotton, okra, hibiscus, hollyhock and three-lobe false mallow (Malvaceae), honeysuckle (Caprifoliaceae), tomato, tobacco and chilli

(Solanaceae), squash (Cucurbitaceae), zinnia and ageratum (Asteraceae) (Briddon et al., 2003; Zhou et al., 2003). The DNA-β molecules have keenly attracted the attention of virologists since Saunders et al. (2000) and Briddon et al. (2001) showed that typical symptoms of ageratum yellow vein and cotton leaf curl diseases occurred only when Ageratum yellow vein virus (AYVV) and CuLCV, respectively, were co- inoculated with their respective DNA-β components. These molecules have a genome of approximately 1350 nucleotides for the full-length forms or approximately 700 nucleotides for the deleted forms, and contain three characteristic regions (Briddon et al., 2003).

Satellite conserved region (SCR). The satellite conserved region (SCR), a region of

200 nts, contains (i) a putative stem-loop structure containing a nonanucleotide

TAG/ATATTAC sequence typical of the nanoviruses and geminiviruses and (ii) a very highly conserved region of over 100 nts located on the 5’ side of the stem-loop

(Briddon et al., 2003). This conserved region has a very high GC content (~ 70 %)

(Zhou et al., 2003).

Adenine rich region (A rich region). The DNA-β molecules contain an A-rich region (typically 160-180 nts and about 60% A (Briddon et al., 2003)) located between nucleotide ± 700 and ±1000 (Zhou et al., 2003). It was suggested that this

region may be present to increase the size of these molecules to become a fraction

(either half or quarter) of the typical genome size of geminiviruses (Mansoor et al.,

2003). In doing so, the molecules could be tolerated during systemic movement which operates through a stringent size-selection mechanism (Etessami et al., 1989;

Rojas et al., 1998)

Potential coding region. The DNA-β molecules contain an ORF (βC1) on the complementary strand on 3’ side of the stem-loop. This ORF encodes a protein of approximately 118 amino acids. Through mutation analysis, Zhou et al. (2003) demonstrated that the βC1 gene product is associated with symptom induction. The

βC1 protein of DNA-β satellite (Y10β), associated with Tomato yellow leaf curl

China virus Y10 isolate (TYLCCNV-Y10), is nucleophilic and is able to suppress

RNA silencing activity (Cui et al., 2005).

2.1.8. Diagnosis

Several methods, particularly those based on protein or nucleic acid detection, have been developed to identify geminiviruses.

2.1.8.1. Serological techniques

Serological detection techniques, such as ELISA or its variants, are based on the antigenic properties of the viral coat protein. Traditionally, the techniques have been a primary means of virus detection and diagnosis. For mastreviruses, polyclonal and monoclonal antibodies has been used to detect and differentiate the isolates of SMV

(Bosque-Perez, 2000; Peterschmitt et al., 1991; Pinner and Markham, 1990), three distinct viruses, namely Chloris striate mosaic virus (CSMV), Paspalum striate mosaic virus (PaSMV) and Digitaria striate mosaic virus (DDSMV) infecting graminaceous plants from Australia (Pinner et al., 1992) and a Syrian chickpea

isolate of Chickpea chlorotic dwarf virus (CpCDV), a dicot mastrevirus (Kumari et al., 2006).

For begomoviruses, however, serological-based diagnostics have met with limited success because the particles are only moderately immunogenic, are purified with difficulty from plant materials, and occur in only low to moderate concentration in plants tissue. Consequently, serological techniques using polyclonal antibodies

(pAbs) lack both the specificity and sensitivity required for accurate diagnosis

(Harrison and Robinson, 1999; Harrison et al., 2002; Pico et al., 1996). These problems have been resolved, to a certain degree, by several methods including techniques such as ISEM and ELISA using a range of polyclonal and monoclonal antibodies (mAb) (Harrison et al., 2002; Pico et al., 1999). Finally, recombinant pAbs against BGMV, Cabbage leaf curl virus (CaLCuV), Tomato mottle virus

(ToMoV) and TYLCV have been generated using the CP expressed in Escherichia coli as immunogenic sources. These antibodies are inexpensive and have high sensitivity for detection of begomoviruses (Abouzid et al., 2002).

The cross-reactions with heterologous pAbs antibodies have been exploited to detect unrelated viruses. For example, antisera against CaLCuV and TYLCV were used to detect BGMV antigens while the CaLCuV antiserum reacted well with ToMoV antigens and weakly with TYLCV antigens (Abouzid et al., 2002). Harrison et al.

(2002) identified more than 50 distinct begomoviruses originating from over 30 countries of six continents using selected mAbs.

2.1.8.2. Genomic DNA-based techniques

2.1.8.2.1. DNA hybridisation

Hybridisation techniques have been widely used in the diagnosis of plant viruses.

These techniques are based on the base pairing between viral nucleic acid sequences

(target) and labelled probes whose sequence is complementary to that of the targets.

Hull (1993) summarised in detail the factors affecting hybridisation including temperature, nucleic acid composition, sequence length and base mismatch, salt concentration, pH and organic solvents. There are three major formats for DNA hybridisation techniques;

In the dot blot technique, the DNA extracts are dotted onto a nylon membrane for hybridisation (Gilbertson et al., 1991; Harper and Creamer, 1995; Kheyr-Pour et al.,

2000; Polston et al., 1989; Polston et al., 1999; Potter et al., 2003; Stonor et al.,

2003). The dot blot can also be used to estimate relative differences in viral nucleic acid titres in infected tissues (Gilbertson et al., 1991). In the tissue print (or squash plot) technique, the infected tissue is squashed directly onto a nylon membrane for hybridisation. This method provides a specific, rapid, and simple means to detect virus without DNA extractions. The technique has been use to detect geminiviruses in field samples (Czosnek and Laterrot, 1997; Gilbertson et al., 1991; Pico et al.,

1996) and in assessing virus resistance (Martins Santana et al., 2001; Maruthi et al.,

2003; Rubio et al., 2003). In the Southern blot technique, the DNA extracts are electrophoresed through an agarose gel followed by transfer onto nylon membrane for hybridisation. This technique enables the detection of the characteristic replicative forms of viral DNA present in plants, including open circular dsDNA, supercoiled dsDNA and circular ssDNA. The technique has been widely used to

characterise new viruses (Bigarre et al., 2001; Lotrakul et al., 1998), investigate the presence of viruses in whitefly vectors (Ghanim et al., 1998), study gene functions

(Briddon et al., 1990; Noris et al., 1998; Orozco and Hanley-Bowdoin, 1996;

Padidam et al., 1996; Petty et al., 2000; Wartig et al., 1997), study the interaction between host factors and virus (Pooma et al., 1996), to discover the replication intermediates of viruses (Jeske et al., 2001) and to confirm the presence and role of satellite molecules in disease induction (Briddon et al., 2004; Briddon et al., 2001;

Bull et al., 2004; Mansoor et al., 1999).

2.1.8.2.2. Polymerase chain reaction (PCR)

First described in the 1980s by Mullis et al. (1986), PCR has become a powerful technique that has had a great impact on molecular biotechnology. Briefly, PCR allows amplification of specific nucleic acid sequences using two short oligonucleotide primers that flank the target sequence (Henson and French, 1993).

PCR has been widely used in detection and diagnosis of plant viruses because of its rapidity, sensitivity, specificity and reliability (Henson and French, 1993; Hull, 2002;

Martin et al., 2000). PCR, using degenerate (or universal) primers designed from highly conserved regions of virus genomes, has become a rapid and reliable way to screen mixed infections or to detect new geminiviruses in plants or vectors (Deng et al., 1994; Guo and Zhou, 2005; Harrison et al., 1997; Lyttle and Guy, 2004;

Rampersad and Umaharan, 2003; Rojas et al., 1993; Roye et al., 1999; Wyatt and

Brown, 1996) and their satellites (Briddon et al., 2002; Bull et al., 2003; Zhou et al.,

2003).

2.2. THE FAMILY POTYVIRIDAE

2.2.1. Introduction

The Potyviridae (named after Potato virus Y) is the largest family of plant viruses currently recognized containing 218 definite and tentative species (Berger et al.,

2005) (Table 2.2). All members of the family have a genome of positive single stranded RNA and comprise flexuous filamentous particles between 11-15 nm in diameter. The lengths of the viruses range from 650-950 nm for those with monopartite genomes (Fig. 2.4.A) and 200-300 and 500-600 nm for those with bipartite genomes. Each virion comprises 1700-2000 coat protein subunits arranged in a helical manner around a single molecule of viral RNA (Shukla et al., 1998).

Cytopathologically, all the members of the family characteristically induce the formation of three-dimensional crystalline cytoplasmic inclusions (CI) within infected cells (Fig. 2.4.C). These are seen as “pinwheels” in transverse section or as

“bundles” in longitudinal section. Some members of the potyvirus genus induce the formation of crystalline nuclear inclusions (NI) (Fig. 2.4.D) that consist of two proteins, NIa and NIb (Shukla et al., 1998).

Many members of the family are important pathogens on plants. Papaya ringspot virus (PRSV) has been considered the most damaging virus infecting papaya worldwide (Gonsalves, 1998). Turnip mosaic virus (TuMV) is ranked the second most important virus infecting field-grown vegetables (Tomlinson, 1987). Similarly,

Plum pox virus (PPV) is by far the most important virus that infects stone fruits

(Kegler et al., 1998).

Table 2.2. Current classification of the family Potyviridae

Number of species‡ Genus Type species Genome* Vector† Definitive Tentative Total

Potyvirus Potato virus Y (PVY) M Aphids (np) 111 86 197

Ipomovirus Sweet potato mild mottle virus (SPMMV) M Whitefly (np) 3 1 4

Macluravirus Maclura mosaic virus (MacMV) M Aphids (np) 3 1 4

Rymovirus Ryegrass mosaic virus (RGMV) M Mites (pc) 3 0 3

Tritimovirus Wheat streak mosaic virus (WSMV) M Mites (pc) 3 1 4

Bymovirus Barley yellow mosaic virus (BaYMV) B Fungus (z) 6 0 6

129 89 218

* M : Monopartite, B : Bipartite

† np: non-persistent, pc: persistent-circulative, z: zoospore

‡ The number of species is derived from Berger et al. (2005)

A B

C D

Figure 2.4. Virion and inclusion morphology of potyviruses. A. Flexuous filamentous particles of

PVY, bar = 100 nm (http://www.dpvweb.net/notes/showem.php?genus=Potyvirus). B. Schematic drawing showing the linear sequence of the CP subunit, the subunit folding pattern, the surface location of the N- and C-termini and the assembly of PVY particle (Shukla et al., 1998). C. Cylindrical inclusions (CI) of PVY formed in the cytoplasm of an infected tobacco leaf cell; V, vacuole; Mb, microbody; bar = 200 nm; b in parentheses is Figure 3b in Arbatova et al. (1998). D. Nuclear inclusions (arrowed) of Tobacco etch virus (TEV) in Nicotiana benthaminana leaf cell; N, Nucleus; CW, cell wall; Ch, chloroplast; CI, cytoplasmic inclusions; M, mitochondria; bar = 1.4 µm; B at top left corner is Figure 5B in Hajimorad et al. (1996).

2.2.2. Taxonomy

Initially, the family Potyviridae was divided into four genera, Potyvirus, Rymovirus,

Bymovirus and Ipomovirus, on the basis of vector transmission (aphid, mite, fungus and whitefly, respectively) (Barnett, 1992). Currently, six genera of the family are recognized (Berger et al., 2005) including the four former and two new genera,

Macluravirus and Tritimovirus. These genera are distinguished on the bases of their genome organization, vector transmission and genome sequence (Table 2.2).

2.2.3. Genome organization

Members of the family Potyviridae have a genome of single-stranded, positive-sense

RNA. The viruses of five genera (Potyvirus, Macluravirus, Ipomovirus, Rymovirus and Tritimovirus) have a monopartite genome that contains only one RNA molecule.

Viruses of the genus Bymovirus have a bipartite genome which contains two RNA molecules, RNA-1 and RNA-2 (Shukla et al., 1998).

The genome organization of the monopartite genera is quite similar to one another

(Fig. 2.5). They have a genome ~10 kb in length, characterised by an 5’ untranslated region (5’ UTR), a major single ORF and a 3’ UTR region terminated by a poly-A tail. The major ORF encodes a large polyprotein that is co-translationally processed into ten functional proteins (Adams et al., 2005a). In descending order (5’-3’), these proteins are the first protein (P1), helper component protein (HC-Pro), third protein

(P3), 6K1, cylindrical inclusion protein (CI), 6K2, VPg (viral protein genome-

AI CI NIa NIb

6K1 6K2 5’UTR (FY)/S G/G 3’UTR P1 HC-Pro P3 CI VPg NIa-Pro NIb CP Poly-A VPg

Major protease 1. Proteinase Pathogenicity 2. Interact RNA 3. Host defence 1. Genome amplification suppressor RdRp 2. Host specific determinant (GDD) 3. Systemic movement

N - terminus Core region C- terminus N – terminus Core region C- terminus

Replication: anchors replication apparatus Aphid transmission: 1. Proteinase 1. Aphid transmission: HC-Pro Vector binding (KTIC) 2. Cell-to-cell movement binding (DAG) Systemic movement 2. Systemic movement 3. Immunodominant: 1. Replication (IGN) (Virus specific) 2. Systemic movement (CC/CS) 3. Gene silencing suppressor 1. Cell-to-cell movement 2. Replication: Helicase, ATPase, RNA binding 1. Virus assembly 2. Cell-to-cell movement

Figure 2.5. Genome organization of the monopartite genera of the family Potyviridae. AI, amorphous inclusion; CI, cytoplasmic inclusion; NI, nuclear

inclusion; P1, P1 protein; HC-Pro, helper component protein; P3, third protein;

VPg, viral protein genome–linked; NIa-Pro, major protease of small nuclear inclusion protein –NIa; CP, coat protein; UTR, untranslated region. The functions of the genes are also indicated. The crucial motifs of the genes are in parenthesis.

linked), NIa-Pro (major protease of small nuclear inclusion protein -NIa), NIb (large nuclear inclusion protein) and CP (coat protein) (Shukla et al., 1998) (Fig. 2.5).

The RNA-1 of the genus Bymovirus resembles the C-terminal two-thirds of the monopartite genomes and encodes proteins analogous to P3, 6K1, CI, 6K2, NIa, NIb and CP, whereas the RNA-2 encodes a polyprotein which is processed into two proteins, P1 and P2. P1 is similar to HC-Pro of monopartite viruses while P2 is similar to the capsid readthrough protein of furoviruses and is required for virus transmission by fungi. Both RNA-1 and RNA-2 of bymoviruses have a VPg linked to the 5’ terminal nucleotide, a 5’ UTR, a 3’ UTR and a poly-A tail as for monopartite viruses (Shukla et al., 1998).

Sequence analysis revealed that rymoviruses shared strongly sequence identity with the potyviruses and therefore should be included in the genus Potyvirus (Adams et al., 2005b; Shukla et al., 1998).

2.2.4. Functions of genes

2.2.4.1. P1 protein

P1 is a proteinase. P1 is the most variable region of the genome, with the exception of the C-terminal region (Adams et al., 2005b; Urcuqui-Inchima et al., 2001). P1 is a serine proteinase that self-cleaves P1/HC-Pro junction at a conserved YS or FS motif

(Adams et al., 2005a; Verchot et al., 1992; Yang et al., 1998). The region responsible for this activity was identified at the C-terminus of P1 with a catalytic

triad H-(X7-11)-D-(X30-36)-S. The D residue of this triad was replaced by E for potyviruses of the BCMV subgroup (Adams et al., 2005a).

P1 interacts with RNA. P1 binds non-specifically to the RNA and it has been suggested that P1 may be involved in viral movement (Brantley and Hunt, 1993).

This was supported by the finding that P1 was localized in association with CI in cytoplasm (Arbatova et al., 1998).

P1 participates in suppression of host defence. The fusion of P1 and HC-Pro enhances viral pathogenicity through suppression of posttranscriptional gene silencing (PTGS) in the host (Kasschau and Carrington, 1998). Maki-Valkama et al.

(2000) showed that the mechanism and strain specificity of the resistance in plants transformed with the PVY P1 gene was based on PTGS.

2.2.4.2. Helper component protein (HC-Pro)

HC-Pro is a multifunctional protein required for viral acquisition by the vector, systemic and cell-to-cell movement and suppression of PTGS.

HC-Pro is required for transmission through interaction with virions and vectors.

When testing the virus transmission efficiency of four aphid species, Wang et al.

(1998) found that different aphid species transmitted virus more efficiently than others. They showed that the food canal of aphids differed in its ability to interact with HC-Pro, which, therefore, affected the ability of aphids to retain virions in the stylets. Through mutation analysis, Blanc et al. (1998) determined that the N- terminal region of HC-Pro, which contains a highly conserved K(I/L)(T/S)C motif

(known as KITC motif), was required for interaction of HC-Pro with the aphid mouthpart. Similarly, a PTK motif in the core region of HC-Pro was identified as important for virion-binding (Peng et al., 1998). PTK mutants reduced or abolished

the ability of HC-Pro to bind to the virions. These results confirmed the “bridge hypothesis” of potyvirus transmission proposed by Pirone and Blanc (1996), whereby HC-Pro acts as a bi-functional molecule, with one domain located at the core region binding to CP and other located at the N-terminal region interacting with the aphid mouthpart.

HC-Pro is involved in systemic movement. Cronin et al. (1995) showed that a mutant in the highly conserved CC/CS motif in the core region of the Tobacco etch virus (TEV) HC-Pro was not capable of systemic movement. Systemic movement was restored, however, in transgenic plants provided with the intact HC-Pro.

HC-Pro is involved in cell-to-cell movement. HC-Pro was shown to pass from cell- to-cell, to increase the size exclusion limit (SEL) of plasmodesmata and therefore to facilitate passage of viral RNA between cells. The region responsible for this activity was located in the C-terminal part of HC-Pro (Rojas et al., 1997).

HC-Pro is involved in viral replication. Kasschau et al. (1997) used mutation analysis to show that the central region of the TEV HC-Pro, that contains an IGN motif, was important for viral amplification. This hypothesis has been supported by the results of Urcuqui-Inchima et al. (2000) who showed that two independent domains, designated A and B, which confer the binding of HC-Pro to RNA, were located in the central region of HC-Pro.

HC-Pro is involved in suppression of gene silencing. It has been proposed that in the absence of the functional HC-Pro, viral RNA or a replication intermediate is targeted by the natural silencing response of the host cells (Kasschau and Carrington,

1998). Mallory et al. (2001) demonstrated that expression of HC-Pro in transgenic plants suppressed PTGS at a step before accumulation of small RNAs.

HC-Pro has proteinase activity. The C-terminal region of HC-Pro has cysteine proteinase-like activity required for auto-cleavage between HC-Pro and P3 at its C- terminus. Carrington and Herndon (1992) determined the cleavage site between HC-

Pro and P3 in TEV was G763-G764 and four amino acids surrounding this cleavage site were important for auto-recognition by HC-Pro. The cleave site (G-G) was conserved in all the members of the family, except for bymoviruses (Adams et al.,

2005b).

2.2.4.3. P 3 protein

P3, together with P1, are the two most variable proteins in the family Potyviridae

(Adams et al., 2005b). P3 is also the least well characterised potyvirus protein

(Urcuqui-Inchima et al., 2001). However, P3 has been shown to have a role in pathogenicity through interaction with other viral proteins; for instance, the C- terminal region of the P3-6K1 complex carries a pathogenicity determinant in PPV

(Saenz et al., 2000). Similarly, Suehiro et al., (2004) showed that TuMV contained an important determinant in the P3 C-terminal region, which conferred the ability of virus to infect different hosts.

2.2.4.4. Cylindrical inclusion protein (CI)

CI is a major component of the replication complex. The CI protein belongs to

“super family 2” of helicase proteins that are characterised by seven conserved segments, I, Ia, II, III, IV, V and VI (Kadare and Haenni, 1997). These fragments occupy the N-terminal half of the protein and have NTP binding, NTPase, RNA binding and RNA helicase activities (Fernandez and Garcia, 1996; Fernandez et al.,

1997; Fernandez et al., 1995). Because replication of potyviruses requires a polymerase, a primer and a helicase to separate dsRNA templates, CI was considered

to be a major component of a multicomponent, membrane-associated replication complex of CI, VPg/NIa and NIb (Shukla et al., 1998). In this case, CI can unwind

RNA duplexes with 3’ overhangs in the 3’ to 5’ direction (Fernandez et al.,

1995;1997).

CI is involved in cell-to-cell movement. Although the CI is not a true movement protein like CP or HC-Pro (Rojas et al., 1997), the presence of ATPase activity in plasmodesmata of Maize dwarf mosaic virus (MDMV)-infected cells (Chen et al.,

1994) suggested that cell-to-cell movement requires energy released from ATP hydrolysis. Therefore, since CI is the only virus-encoded protein that has ATPase activity, it may participate in this process. On the other hand, an analysis using alanine scanning mutagenesis based on the CI/TEV system supported a model in which CI interacts directly with plasmodesmata and CP-containing ribonucleoprotein complex to facilitate cell-to-cell movement (Carrington et al., 1998).

2.2.4.5. 6K proteins

While 6K1, in conjunction with P3, carries a determinant for the pathogenicity as mentioned in Section 2.2.4.3, it was proposed that 6K2 is required for genome replication because it anchors the replication apparatus to the endoplasmic reticulum

(Schaad et al., 1997a).

2.2.4.6. Genome-linked viral protein (VPg)

The VPg is the N-terminal part of NIa and, apart from CP, the only viral protein present in virions and covalently linked to the 5’ end of viral RNA via a tyrosine (Y) residue (Murphy et al., 1991).

VPg is involved in genome replication. The role of VPg in genome replication was shown indirectly in Tobacco vein mottling virus (TVMV) using mutations to the tyrosine residue (Tyr1860) that links the VPg to the viral RNA. The mutant virus did not accumulate to detectable levels in infected plants and was not infectious in protoplasts (Murphy et al., 1996). In a recent study, Anindya et al. (2005) showed that the VPg tyrosine 66 of Pepper vein banding virus (PVBV) was uridylylated by

NIb, and the uridylylated VPg might function as a primer for viral RNA synthesis.

VPg is involved in systemic movement. A study based on chimeric TEV genomes

(Schaad et al., 1997b) suggested that VPg interacts either directly or indirectly with host components to facilitate long-distance movement. Dunoyer et al. (2004) identified a cellular factor, namely Potyvirus VPg-interacting protein (PVIP), that interacts with the VPg N-terminal region of a diverse range of potyviruses. The interaction affected systemic symptoms involving both cell-to-cell and systemic movement in infected plants.

VPg interacts with plant translational initiation factors. VPg was reported to interact with plant translational initiation factors like eIF4E and eIF(iso)4E (Leonard et al., 2000, 2004; Wittmann et al., 1997). However, the direct role of this interaction in potyviral translation remains unknown because the VPg was not required for efficient cap-independent translation of TuMV (Basso et al., 1994; Niepel and

Gallie, 1999).

VPg is an avirulent determinant. Several recessive resistance genes to potyviruses have been identified in plants including pvr1 (pepper), mo1 (lettuce), sbm1 (pea) and rym4/5 (barley). These genes (with different alleles) encode the translational initiation factor, eIF4E. This property of VPg was identified based on observations

that the resistance genes, at homozygous state, containing point mutants which interrupted the interaction of eIF4E and VPg, created resistance phenotypes at different levels (viral accumulation, cell-to-cell and long movements) (Kang et al.,

2005)

2.2.4.7. Small nuclear inclusion protein ( NIa)

The N-terminal region of NIa harbours the VPg, whereas the C-terminal region is a major trypsin-like protease (NIa-Pro) that cleaves the junctions of P3/6K1, 6K1/CI,

CI/6K2, 6K2/VPg, VPg/NIa-Pro, NIa-Pro/NIb and NIb/CP. The cleavage motifs for this protease were V-xx-Q(E)-(ASGE or V) (Adams et al., 2005a; Shukla et al.,

1998).

2.2.4.8. Large nuclear inclusion protein (NIb)

NIb is a RNA dependent RNA polymerase (RdRp). This function was demonstrated in TVMV in which the TVMV NIb had poly(U) polymerase activity and was able to utilize full-length TVMV RNA as a template for RNA synthesis. In addition, the mutation of the highly conserved GDD motif, which is present in many other viral

RdRps, significantly reduced the polymerase activity of the TVMV NIb (Hong and

Hunt, 1996). As discussed in Section 2.2.4.6, the uryldylation activity of NIb has also been demonstrated recently in PVMV (Anindya et al., 2005).

2.2.4.9. Coat protein (CP)

The CP is a well-characterised potyviral protein, and is roughly divided into three domains: The N domain is highly variable and contains the major virus-specific epitopes; the core and C domains are more conserved. The variation in the core

region is similar to that of the whole genome and, therefore, is a reliable index for genetic relatedness (Shukla et al., 1998).

CP is involved in aphid transmission. The CP N-terminal region that is exposed on the virion surface contains a highly conserved DAG motif located near the N- terminus. Site-directed mutagenesis analyses showed that the motif is essential for aphid transmission (Atreya et al., 1995). However, the context in which the DAG or equivalent motif is found is also important for efficient transmission (Lopez-Moya et al., 1999). A specific interaction between CP and HC-Pro with the involvement of the DAG and KITC motifs in each component, respectively, was essential for aphid transmission (Blanc et al., 1997; Flasinski and Cassidy, 1998). This interaction supports the “bridge hypothesis” mentioned previously.

CP is involved in cell-to cell and systemic movement. Dolja et al. (1994, 1995) used mutation analyses to show that the N- and C-terminal regions of TEV CP were indispensable for systemic viral movement, while the core region was essential for cell-to-cell movement. In contrast, Arazi et al. (2001) showed that deletion or substitution with foreign peptides encoding up to 33 amino acids of the N-terminal region of the CP did not alter systemic infectivity of ZYMV. This finding was later supported by Kimalov et al. (2004) who showed that maintenance of the CP N- terminal neutralized net charge, but not primary sequence, was essential for ZYMV systemic infectivity. It was elucidated that CP (and HC-Pro as well) are two movement proteins that are able to increase the size exclusion limit (SEL) of plasmodesmata and, therefore, facilitate cell-to-cell virus movement (Rojas et al.,

1997). Apparently, CP and HC-Pro co-ordinate viral accumulation and movement

(Andrejeva et al., 1999)

CP is a structural protein for encapsidation. The mechanism of assembly of flexuous viruses, such as potyviruses, is still poorly understood. PVY CP subunits, in the absence of the viral RNA and under suitable conditions, self-assemble to form 16

S disk- or ring-like intermediates made up of 7-8 subunits, which then form non- helical virus-like particles (McDonald et al., 1976) (Fig. 1.4.A). The role of the CP

N- and C-terminal regions in particle assembly is undefined. Two lines of evidence suggested that these two regions are not necessary for assembly. Firstly, the N- and

C-terminal regions were known to be surface-exposed and could be removed by trypsin treatment without affecting reassembly of the CP subunits (Shukla et al.,

1991). Secondly, mutation analyses showed that the core region of CP is indispensable for this function, but not the N- and C-termini (Dolja et al., 1995;

Dolja et al., 1994; Voloudakis et al., 2004). However, recent studies showed both regions were required for assembly (Anindya and Savithri, 2003; Kang et al., 2006).

CP is involved in regulation of viral RNA synthesis. The interaction between the

CP and the NIb through the GDD motif of NIb (Hong et al., 1995) suggested that the

CP may be involved in regulation of RNA synthesis. Based on mutation analyses,

Mahajan et al. (1996) identified that the CP-coding sequence appeared to stimulate genome amplification through two distinct mechanisms: (1) translation continues until codons 138 and 189 of the TEV CP-coding sequence (but neither the CP-coding sequence up to codon 189 nor the product encoded by this sequence is required for amplification) and (2) one or more signals (at RNA level) located between codons

211-246 of the TEV CP might control viral RNA replication in a cis-acting manner.

These signals appeared to be involved in series of stem-loop structures in this region as confirmed later by Haldeman-Cahill et al. (1998).

2.2.5. Diagnosis

2.2.5.1. Serological techniques

Serological relationships among distinct potyviruses using polyclonal antibodies are complex for several reasons; (1) most definitive members are serologically related to at least one of other member in the group and in many cases to several others; (2) the specificity of antisera of the same virus prepared under different conditions

(laboratories, dissociated CP vs. intact virions, immunization procedures) may be very inconsistent; and (3) strains of one species may differ considerably in their serological affinities (Shukla et al., 1992; Shukla and Ward, 1989; Shukla et al.,

1998).

The molecular basis of potyvirus serology is well established. As mentioned in

Section 1.3.4.7, the N- and C-termini of the CP are surface-located. The N-terminus is the most variable and immunodominant region in the CP gene. The epitopes contained in this region, therefore, generate virus-specific antibodies. The N- and C- termini of CP are easily degraded during purification and storage. The conservation of the CP core region in different potyviruses enables production of antibodies which can be used to detect a broad range of potyviruses (Shukla et al., 1992, 1998; Shukla and Ward, 1989) PAbs and MAbs are currently available at both the laboratory and commercial levels against most economically important potyviruses. In general, serological methods, particularly used with MAbs, are widely used in the diagnosis of potyviruses (van der Vlugt et al., 1999; Koch and Salomon, 1994: Desbiez et al.,

2002: Kantrong and Sako, 1993; Mink and Silbernagel, 1992; Mink et al., 1999;

Vetten et al., 1992; Crosslin et al., 2005; Ellis et al., 1996; Llave et al., 1999;

Ounouna et al., 2002 ; Balamuralikrishnan et al., 2002; Oertel et al., 1999; Villamor et al., 2003; Hammond et al., 1992; Karyeija et al., 2000).

2.2.5.2. Nucleic acid - based techniques

2.2.5.2.1. Hybridisation techniques

The most widely used hybridisation techniques are dot blot and tissue print (see

Section 1.2.8.2). In the traditional procedures, the viral RNA is immobilised onto a nylon membrane followed by hybridisation with labelled cDNA probes synthesized using RT-PCR (Ali et al., 1998; Frenkel et al., 1992; Tracy et al., 1992). Recently,

Hsu et al. (2005) developed a modified hybridisation technique, named reverse dot blot hybridisation, for rapid detection and identification of six potyviruses. In this technique, the cDNA probes synthesized by RT-PCR with species-specific primers were immobilized onto nylon membrane, and then hybridised with DIG-labeled RT-

PCR products amplified by potyvirus degenerate primers. This technique is similar to a microarray-based method developed by Boonham et al. (2003) for diagnosis of potato RNA viruses.

2.2.5.2.2. Reverse transcriptase - polymerase chain reaction (RT-PCR)

Besides using specific primers designed from known sequences, the PCR-based methods for the detection and identification of potyviruses rely on degenerate primers designed to conserved sequences of the genome. Since most published potyvirus sequences are from the 3’ region of the genome, universal primers to identify potyviruses have mostly been designed based on the conserved sequences such as WCIEN box or QMKAA motif in the CP gene (Bateson and Dale, 1995;

Colinet and Kummert, 1993; Langeveld et al., 1991; Pappu et al., 1993; Zerbini et

al., 1995). Recently, the consensus motif (GNNSGQPSTVVDN) in the NIb gene has been shown to be highly conserved among members of the family Potyviridae

(Gibbs et al., 2003). The forward degenerate primers corresponding to the

GNNSGQP sequence of this motif are specific for numerous members of the family

(Chen and Adams, 2001; Gibbs and Mackenzie, 1997; Mackenzie et al., 1998).

SUMMARY

Geminiviruses and potyviruses are two of the most economically important and diverse groups of plant viruses identified to date. Although a small number of viral species have been identified in Vietnam, it is important to characterise the viruses present in the region to enable the development of appropriate diagnostic and control measures. This will be achieved by cloning, sequencing and characterisation of the genome sequence of geminiviruses and potyviruses infecting a wide range of crop and putative reservoir species throughout Vietnam.

2.3. REFERENCES

Abouzid, A. M., Freitas-Astua, J., Purcifull, D. E., Polston, J. E., Beckham, K. A.,

Crawford, W. E., Petersen, M. A., Peyser, B., Patte, C., and Hiebert, E.

(2002). Serological studies using polyclonal antisera prepared against the

viral coat protein of four begomoviruses expressed in Escherichia coli. Plant

Disease 86, 1109-1114.

Ach, R. A., Durfee, T., Miller, A. B., Taranto, P., Hanley-Browdoin, L., Zambryski,

P. C., and Gruissem, W. (1997). RRB1 and RRB2 encode maize

retinoblastoma-related proteins that interact with a Plant D-type cyclin and

geminivirus replication protein. Molecular and Cellular Biology 17, 5077-

5086.

Adams, M. J., Antoniw, J. F., and Beaudoin, F. (2005). Overview and analysis of the

polyprotein cleavage sites in the family Potyviridae. Molecular Plant

Pathology 6, 471-487.

Adams, M. J., Antoniw, J. F., and Fauquet, C. M. (2005). Molecular criteria for

genus and species discrimination within the family Potyviridae. Archives of

Virology 150, 459-479.

Alberter, B., Ali Rezaian, M., and Jeske, H. (2005). Replicative intermediates of

Tomato leaf curl virus and its satellite DNAs. Virology 331, 441-448.

Ali, A., Randles, J. W., and Hodgson, R. A. J. (1998). Sensitive detection of pea seed

borne mosaic potyvirus by dot blot and tissue print hybridisation assays.

Australian Journal of Agricultural Research 49, 191-197.

Andrejeva, J., Puurand, U., Merits, A., Rabenstein, F., Jarvekulg, L., and Valkonen,

J. P. (1999). Potyvirus helper component-proteinase and coat protein (CP)

have coordinated functions in virus-host interactions and the same CP motif

affects virus transmission and accumulation. Journal of General Virology 80,

1133-9.

Anindya, R., Chittori, S., and Savithri, H. S. (2005). Tyrosine 66 of Pepper vein

banding virus genome-linked protein is uridylylated by RNA-dependent RNA

polymerase. Virology 336, 154-62.

Anindya, R., and Savithri, H. S. (2003). Surface-exposed amino- and carboxy-

terminal residues are crucial for the initiation of assembly in Pepper vein

banding virus: a flexuous rod-shaped virus. Virology 316, 325-36.

Arazi, T., Shiboleth, Y. M., and Gal-On, A. (2001). A nonviral peptide can replace

the entire N terminus of zucchini yellow mosaic potyvirus coat protein and

permits viral systemic infection. Journal of Virology 75, 6329-36.

Arbatova, J., Lehto, K., Pehu, E., and Pehu, T. (1998). Localization of the P1 protein

of potato Y potyvirus in association with cytoplasmic inclusion bodies and in

the cytoplasm of infected cells. Journal of General Virology 79, 2319-23.

Atreya, P. L., Lopez-Moya, J. J., Chu, M., Atreya, C. D., and Pirone, T. P. (1995).

Mutational analysis of the coat protein N-terminal amino acids involved in

potyvirus transmission by aphids. Journal of General Virology 76, 265-70.

Balamuralikrishnan, M., Doraisamy, S., Ganapathy, T., and Viswanathan, R. (2002).

Serological specificity and titre of Sugarcane mosaic virus polyclonal antisera

raised under varying immunization procedures and bleeding time. Journal of

Plant Diseases and Protection 109, 646-654.

Barnett, O. W. (1992). A summary of potyvirus taxonomy and definitions. Archives

of Virology (Suppl.) 5, 435-44.

Basso, J., Dallaire, P., Charest, P. J., Devantier, Y., and Laliberte, J. F. (1994).

Evidence for an internal ribosome entry site within the 5' non-translated

region of turnip mosaic potyvirus RNA. Journal of General Virology 75,

3157-65.

Bateson, M. F., and Dale, J. L. (1995). Banana bract mosaic virus: characterisation

using potyvirus specific degenerate PCR primers. Archives of Virology 140,

515-27.

Berger, P. H., Adams, M. J., Barnett, O. W., Brunt, A. A., Hammond, J., Hill, J. H.,

Jordan, R. L., Kashiwazaki, S., Rybicki, E., Spence, N., Stenger, D. C., Ohki,

S. T., Uyeda, I., van Jaayen, A., Valkonen, J., and Vetten, H. J. (2005).

Potyviridae. In "Virus Taxonomy. VIIIth Report of the International

Committee on Taxonomy of Viruses" (C. M. Fauquet, M. A. Mayo, J.

Maniloff, U. Desselberger, and L. A. Ball, Eds.). Elsevier/Academic Press,

London.

Bigarre, L., Chazly, M., Salah, M., Ibrahim, M., Padidam, M., Nicole, M.,

Peterschmitt, M., Fauquet, C., and Thouvenel, J. C. (2001). Characterization

of a new begomovirus from Egypt infecting hollyhock (Althea rosea).

European Journal of Plant Pathology 107, 701-711.

Blanc, S., Ammar, E. D., Garcia-Lampasona, S., Dolja, V. V., Llave, C., Baker, J.,

and Pirone, T. P. (1998). Mutations in the potyvirus helper component

protein: effects on interactions with virions and aphid stylets. Journal of

General Virology 79, 3119-22.

Blanc, S., Lopez-Moya, J. J., Wang, R., Garcia-Lampasona, S., Thornbury, D. W.,

and Pirone, T. P. (1997). A specific interaction between coat protein and

helper component correlates with aphid transmission of a potyvirus. Virology

231, 141-7.

Boonham, N., Walsh, K., Smith, P., Madagan, K., Graham, I., and Barker, I. (2003).

Detection of potato viruses using microarray technology: towards a generic

method for plant viral disease diagnosis. Journal of Virological Methods 108,

181-187.

Bosque-Perez, N. A. (2000). Eight decades of maize streak virus research. Virus

Research 71, 107-21.

Boulton, M. I. (2002). Functions and interactions of mastrevirus gene products.

Physiological and Molecular Plant Pathology 60, 243-255.

Brantley, J. D., and Hunt, A. G. (1993). The N-terminal protein of the polyprotein

encoded by the potyvirus tobacco vein mottling virus is an RNA-binding

protein. Journal of General Virology 74, 1157-62.

Briddon, R. W. (2003). Cotton leaf curl disease, a multicomponent begomovirus

complex. Molecular Plant Pathology 4, 427-434.

Briddon, R. W., Bull, S. E., Amin, I., Idris, A. M., Mansoor, S., Bedford, I. D.,

Dhawan, P., Rishi, N., Siwatch, S. S., and Abdel-Salam, A. M. (2003).

Diversity of DNA β, a satellite molecule associated with some monopartite

begomoviruses. Virology 312, 106-121.

Briddon, R. W., Bull, S. E., Amin, I., Mansoor, S., Bedford, I. D., Rishi, N., Siwatch,

S. S., Zafar, Y., Abdel-Salam, A. M., and Markham, P. G. (2004). Diversity

of DNA 1: a satellite-like molecule associated with monopartite

begomovirus-DNA β complexes. Virology 324, 462-474.

Briddon, R. W., Bull, S. E., Mansoor, S., Amin, I., and Markham, P. G. (2002).

Universal primers for the PCR-mediated amplification of DNA β - a molecule

associated with some monopartite begomoviruses. Molecular Biotechnology

20, 315-318.

Briddon, R. W., Mansoor, S., Bedford, I. D., Pinner, M. S., Saunders, K., Stanley, J.,

Zafar, Y., Malik, K. A., and Markham, P. G. (2001). Identification of DNA

components required for induction of cotton leaf curl disease. Virology 285,

234-243.

Briddon, R. W., and Markham, P. G. (2000). Cotton leaf curl virus disease. Virus

Research 71, 151-159.

Briddon, R. W., Pinner, M. S., Stanley, J., and Markham, P. G. (1990). Geminivirus

coat protein gene replacement alters insect specificity. Virology 177, 85-94.

Bull, S. E., Briddon, R. W., and Markham, P. G. (2003). Universal primers for the

PCR-mediated amplification of DNA 1: A satellite-like molecule associated

with begomovirus-DNA beta complexes. Molecular Biotechnology 23, 83-86.

Bull, S. E., Tsai, W. S., Briddon, R. W., Markham, P. G., Stanley, J., and Green, S.

K. (2004). Diversity of begomovirus DNA beta satellites of non-malvaceous

plants in east and south east Asia - Brief report. Archives of Virology 149,

1193-1200.

Carrington, J. C., and Herndon, K. L. (1992). Characterization of the potyviral HC-

pro autoproteolytic cleavage site. Virology 187, 308-15.

Carrington, J. C., Jensen, P. E., and Schaad, M. C. (1998). Genetic evidence for an

essential role for potyvirus CI protein in cell-to-cell movement. Plant Journal

14, 393-400.

Castillo, A. G., Collinet, D., Deret, S., Kashoggi, A., and Bejarano, E. R. (2003).

Dual interaction of plant PCNA with geminivirus replication accessory

protein (REn) and viral replication protein (Rep). Virology 312, 381-94.

Challappan, P., Vanitharani, R. and Fauquet, C.M. (2005). MicroRNA-binding viral

protein interferes with Arabidopsis development. PNAS 102, 10381-10386.

Chen, J., and Adams, M. J. (2001). A universal PCR primer to detect members of the

Potyviridae and its use to examine the taxonomic status of several members

of the family. Archives of Virology 146, 757-766.

Chen, S., Das, P., and Hari, V. (1994). In situ localization of ATPase activity in cells

of plants infected by Maize dwarf mosaic potyvirus. Archives of Virology

134, 433-9.

Colinet, D., and Kummert, J. (1993). Identification of a sweet potato feathery mottle

virus isolate from China (SPFMV-Ch) by the polymerase chain-reaction with

degenerate primers. Journal of Virological Methods 45, 149-159.

Cronin, S., Verchot, J., Haldeman-Cahill, R., Schaad, M. C., and Carrington, J. C.

(1995). Long-distance movement factor: a transport function of the potyvirus

helper component proteinase. Plant Cell 7, 549-59.

Crosslin, J. M., Hamm, P. B., Shiel, P. J., Hane, D. C., Brown, C. R., and Berger, P.

H. (2005). Serological and molecular detection of tobacco veinal necrosis

isolates of Potato virus Y (PVYN) from potatoes grown in the western United

States. American Journal of Potato Research 82, 263-269.

Cui, X. F., Li, G. X., Wang, D. W., Hu, D. W., and Zhou, X. P. (2005). A

begomovirus DNA β-encoded protein binds DNA, functions as a suppressor

of RNA silencing and targets the cell nucleus. Journal of Virology 79, 10764-

10775.

Czosnek, H., and Laterrot, H. (1997). A worldwide survey of tomato yellow leaf curl

viruses. Archives of Virology 142, 1391-406.

Deng, D., McGrath, P. F., Robinson, D. J., and Harrison, B. D. (1994). Detection and

differentiation of whitefly-transmitted geminiviruses in plants and vector

insects by the polymerase chain-reaction with degenerate primers. Annals of

Applied Biology 125, 327-336.

Desbiez, C., David, C., Mettouchi, A., Laufs, J., and Gronenborn, B. (1995). Rep

protein of tomato yellow leaf curl geminivirus has an ATPase activity

required for viral DNA replication. Proceedings of the National Academy of

Sciences of the United States of America 92, 5640-4.

Desbiez, C., Wipf-Scheibel, C., and Lecoq, H. (2002). Biological and serological

variability, evolution and molecular epidemiology of Zucchini yellow mosaic

virus (ZYMV, Potyvirus) with special reference to Caribbean islands. Virus

Research 85, 5-16.

Dickinson, V. J., Halder, J., and Woolston, C. J. (1996). The product of maize streak

virus ORF V1 is associated with secondary plasmodesmata and is first

detected with the onset of viral lesions. Virology 220, 51-9.

Dolja, V. V., Haldeman-Cahill, R., Montgomery, A. E., Vandenbosch, K. A., and

Carrington, J. C. (1995). Capsid protein determinants involved in cell-to-cell

and long distance movement of tobacco etch potyvirus. Virology 206, 1007-

16.

Dolja, V. V., Haldeman, R., Robertson, N. L., Dougherty, W. G., and Carrington, J.

C. (1994). Distinct functions of capsid protein in assembly and movement of

tobacco etch potyvirus in plants. EMBO Journal 13, 1482-91.

Dry, I. B., Krake, L. R., Rigden, J. E., and Rezaian, M. A. (1997). A novel subviral

agent associated with a geminivirus: The first report of a DNA satellite.

Proceedings of the National Academy of Sciences of the United States of

America 94, 7088-7093.

Duan, Y. P., Powell, C. A., Purcifull, D. E., Broglio, P., and Hiebert, E. (1997).

Phenotypic variation in transgenic tobacco expressing mutated geminivirus

movement/pathogenicity (BC1) proteins. Molecular Plant-Microbe

Interactions 10, 1065-74.

Dunoyer, P., Thomas, C., Harrison, S., Revers, F., and Maule, A. (2004). A cysteine-

rich plant protein potentiates potyvirus movement through an interaction with

the virus genome-linked protein VPg. Journal of Virology 78, 2301-9.

Ellis, P., StaceSmith, R., Bowler, G., and Mackenzie, D. J. (1996). Production of

monoclonal antibodies for detection and identification of strains of potato

virus Y. Canadian Journal of Plant Pathology 18, 64-70.

Etessami, P., Watts, J., and Stanley, J. (1989). Size reversion of African cassava

mosaic virus coat protein gene deletion mutants during infection of Nicotiana

benthamiana. Journal of General Virology 70, 277-289.

Fauquet, C. M., Sawyer, S., Idris, A. M., and Brown, J. K. (2005). Sequence analysis

and classification of apparent recombinant begomoviruses infecting tomato in

the nile and Mediterranean basins. Phytopathology 95, 549-555.

Fauquet, C. M., and Stanley, J. (2005). Revising the way we conceive and name

viruses below the species level: A review of geminivirus taxonomy calls for

new standardized isolate descriptors. Archives of Virology 150, 2151-2179.

Fernandez, A., and Garcia, J. A. (1996). The RNA helicase CI from plum pox

potyvirus has two regions involved in binding to RNA. FEBS Letters 388,

206-10.

Fernandez, A., Guo, H. S., Saenz, P., Simon-Buela, L., Gomez de Cedron, M., and

Garcia, J. A. (1997). The motif V of plum pox potyvirus CI RNA helicase is

involved in NTP hydrolysis and is essential for virus RNA replication.

Nucleic Acids Research 25, 4474-80.

Fernandez, A., Lain, S., and Garcia, J. A. (1995). RNA helicase activity of the plum

pox potyvirus CI protein expressed in Escherichia coli. Mapping of an RNA

binding domain. Nucleic Acids Research 23, 1327-32.

Flasinski, S., and Cassidy, B. G. (1998). Potyvirus aphid transmission requires helper

component and homologous coat protein for maximal efficiency. Archives of

Virology 143, 2159-72.

Fontes, E., Eagle, P., Sipe, P., Luckow, V., and Hanley-Bowdoin, L. (1994a).

Interaction between a geminivirus replication protein and origin DNA is

essential for viral replication. Journal of Biological Chemistry 269, 8459-

8465.

Fontes, E. P., Gladfelter, H. J., Schaffer, R. L., Petty, I. T., and Hanley-Bowdoin, L.

(1994b). Geminivirus replication origins have a modular organization. Plant

Cell 6, 405-16.

Formosa, T., and Alberts, B. M. (1986). DNA synthesis dependent on genetic

recombination: characterization of a reaction catalyzed by purified

bacteriophage T4 proteins. Cell 47, 793-806.

Frenkel, M. J., Jilka, J. M., Shukla, D. D., and Ward, C. W. (1992). Differentiation of

potyviruses and their strains by hybridization with the 3' noncoding region of

the viral genome. Journal of Virological Methods 36, 51-62.

Gafni, Y. (2003). Tomato yellow leaf curl virus. Molecular Plant Pathology 4, 9-15.

Gafni, Y., and Epel, B. L. (2002). The role of host and viral proteins in intra- and

inter-cellular trafficking of geminiviruses. Physiological and Molecular Plant

Pathology 60, 231-241.

Garcia-Andres, S., Monci, F., Navas-Castillo, J., and Moriones, E. (2006).

Begomovirus genetic diversity in the native plant reservoir Solanum nigrum:

Evidence for the presence of a new virus species of recombinant nature.

Virology 350, 433-442.

George, J. W., and Kreuzer, K. N. (1996). Repair of double-strand breaks in

bacteriophage T4 by a mechanism that involves extensive DNA replication.

Genetics 143, 1507-20.

Ghanim, M., Morin, S., Zeidan, M., and Czosnek, H. (1998). Evidence for

transovarial transmission of tomato yellow leaf curl virus by its vector, the

whitefly Bemisia tabaci. Virology 240, 295-303.

Gibbs, A., and Mackenzie, A. (1997). A primer pair for amplifying part of the

genome of all potyvirids by RT-PCR. Journal of Virological Methods 63, 9-

16.

Gibbs, A. J., Mackenzie, A. M., and Gibbs, M. J. (2003). The 'potyvirid primers' will

probably provide phylogenetically informative DNA fragments from all

species of Potyviridae. Journal of Virological Methods 112, 41-44.

Gilbertson, R. L., Hidayat, S. H., Martinez, R. T., Leong, S. A., Faria, J. C., Morales,

F., and Maxwell, D. P. (1991). Differentiation of bean-infecting

geminiviruses by nucleic-acid hybridization probes and aspects of bean

golden mosaic in Brazil. Plant Disease 75, 336-342.

Girish, K. R., and Usha, R. (2005). Molecular characterization of two soybean-

infecting begomoviruses from India and evidence for recombination among

legume-infecting begomoviruses from South-East Asia. Virus Research 108,

167-176.

Gonsalves, D. (1998). Control of papaya ringspot virus in papaya: A case study.

Annual Review of Phytopathology 36, 415-437.

Guo, X., and Zhou, X. (2005). Molecular characterization of Alternanthera yellow

vein virus: a new Begomovirus species infecting Alternanthera philoxeroides.

Journal of Phytopathology 153, 694-696.

Gutierrez, C. (2000). DNA replication and cell cycle in plants: learning from

geminiviruses. EMBO Journal 19, 792-799.

Gutierrez, C. (2002). Strategies for geminivirus DNA replication and cell cycle

interference. Physiological and Molecular Plant Pathology 60(5), 219-230.

Gutierrez, C., Ramirez-Parra, E., Castellano, M. M., Sanz-Burgos, A. P., Luque, A.,

and Missich, R. (2004). Geminivirus DNA replication and cell cycle

interactions. Veterinary Microbiology 98, 111-119.

Haldeman-Cahill, R., Daros, J. A., and Carrington, J. C. (1998). Secondary structures

in the capsid protein coding sequence and 3' nontranslated region involved in

amplification of the tobacco etch virus genome. Journal of Virology 72,

4072-9.

Hallan, V., and Gafni, Y. (2001). Tomato yellow leaf curl virus (TYLCV) capsid

protein (CP) subunit interactions: implications for viral assembly. Archives of

Virology 146, 1765-73.

Hammond, J., Jordan, R. L., Larsen, R. C., and Moyer, J. W. (1992). Use of

polyclonal antisera and monoclonal-antibodies to examine serological

relationships among 3 filamentous viruses of sweet-potato. Phytopathology

82, 713-717.

Hanley-Bowdoin, L., Settlage, S. B., Orozco, B. M., Nagar, S., and Robertson, D.

(2000). Geminiviruses: models for plant DNA replication, transcription, and

cell cycle regulation. Critical Reviews in Biochemistry and Molecular

Biology 35, 105-40.

Harper, K., and Creamer, R. (1995). Hybridization detection of insect-transmitted

plant-viruses with digoxigenin-labeled probes. Plant Disease 79, 563-567.

Harrison, B., and Robinson, D. (1999). Natural genomic and antigenic variation in

whitefly-transmitted geminiviruses (begomoviruses). Annual Review of

Phytopathology 37, 369-398.

Harrison, B. D., Liu, Y. L., Khalid, S., Hameed, S., OtimNape, G. W., and Robinson,

D. J. (1997). Detection and relationships of cotton leaf curl virus and allied

whitefly-transmitted geminiviruses occurring in Pakistan. Annals of Applied

Biology 130, 61-75.

Harrison, B. D., Swanson, M. M., and Fargette, D. (2002). Begomovirus coat

protein: serology, variation and functions*1. Physiological and Molecular

Plant Pathology 60, 257-271.

Hartitz, M. D., Sunter, G., and Bisaro, D. M. (1999). The tomato golden mosaic virus

transactivator (TrAP) is a single-stranded DNA and zinc-binding

phosphoprotein with an acidic activation domain. Virology 263, 1-14.

Hatta, T., and Francki, R.I.B. (1979). The fine structure of chloris striate mosaic

virus. Virology 92, 428-435.

Henson, J. M., and French, R. (1993). The polymerase chain-reaction and plant-

disease diagnosis. Annual Review of Phytopathology 31, 81-109.

Heyraud-Nitschke, F., Schumacher, S., Laufs, J., Schaefer, S., Schell, J., and

Gronenborn, B. (1995). Determination of the origin cleavage and joining

domain of geminivirus Rep proteins. Nucleic Acids Research 23, 910-6.

Hofer, P., Bedford, I. D., Markham, P. G., Jeske, H., and Frischmuth, T. (1997). Coat

protein gene replacement results in whitefly transmission of an insect

nontransmissible geminivirus isolate. Virology 236, 288-95.

Hong, Y., and Hunt, A. G. (1996). RNA polymerase activity catalyzed by a

potyvirus-encoded RNA-dependent RNA polymerase. Virology 226, 146-51.

Hong, Y., Levay, K., Murphy, J. F., Klein, P. G., Shaw, J. G., and Hunt, A. G.

(1995). A potyvirus polymerase interacts with the viral coat protein and VPg

in yeast cells. Virology 214, 159-66.

Horns, T., and Jeske, H. (1991). Localization of abutilon mosaic virus (AbMV) DNA

within leaf tissue by in situ hybridization. Virology 181, 580-8.

Hou, Y. M., Sanders, R., Ursin, V. M., and Gilbertson, R. L. (2000). Transgenic

plants expressing geminivirus movement proteins: abnormal phenotypes and

delayed infection by Tomato mottle virus in transgenic tomatoes expressing

the Bean dwarf mosaic virus BV1 or BC1 proteins. Molecular Plant-Microbe

Interactions 13, 297-308.

Hsu, Y. C., Yeh, T. J., and Chang, Y. C. (2005). A new combination of RT-PCR and

reverse dot blot hybridization for rapid detection and identification of

potyviruses. Journal of Virological Methods 128, 54-60.

Hull, R. (1993). Nucleic acid hybridization procedures. In "Diagnosis of Plant Virus

Diseases" (R. E. F. Matthews, Ed.). CRC Press.

Hull, R. (2002). "Matthews's Plant Virology." Fourth ed. Academic Press.

Idris, A. M., and Brown, J. K. (2005). Evidence for interspecific-recombination for

three monopartite begomoviral genomes associated with the tomato leaf curl

disease from central Sudan. Archives of Virology 150, 1003-1012.

Jeske, H., Lutgemeier, M., and Preiss, W. (2001). DNA forms indicate rolling circle

and recombination-dependent replication of Abutilon mosaic virus. EMBO

Journal 20, 6158-67.

Jupin, I., De Kouchkovsky, F., Jouanneau, F., and Gronenborn, B. (1994). Movement

of tomato yellow leaf curl geminivirus (TYLCV): involvement of the protein

encoded by ORF C4. Virology 204, 82-90.

Jupin, I., Hericourt, F., Benz, B., and Gronenborn, B. (1995). DNA replication

specificity of TYLCV geminivirus is mediated by the amino-terminal 116

amino acids of the Rep protein. FEBS Letters 362, 116-20.

Kadare, G., and Haenni, A. L. (1997). Virus-encoded RNA helicases. Journal of

Virology 71, 2583-2590.

Kang, B. C., Yeam, I., and Jahn, M. M. (2005). Genetics of plant virus resistance.

Annual Review of Phytopathology 43, 581-621.

Kang, S. H., Lim, W. S., Hwang, S. H., Park, J. W., Choi, H. S., and Kim, K. H.

(2006). Importance of the C-terminal domain of soybean mosaic virus coat

protein for subunit interactions. Journal of General Virology 87, 225-9.

Kantrong, S., and Sako, N. (1993). Characterization of epitopes recognized by

monoclonal antibodies to aphid transmissible and non-transmissible strains of

turnip mosaic virus. Archives of Virology 133, 11-20.

Karyeija, R. F., Kreuze, J. F., Gibson, R. W., and Valkonen, J. P. T. (2000). Two

serotypes of Sweetpotato feathery mottle virus in Uganda and their

interaction with resistant sweetpotato cultivars. Phytopathology 90, 1250-

1255.

Kasschau, K. D., and Carrington, J. C. (1998). A counterdefensive strategy of plant

viruses: suppression of posttranscriptional gene silencing. Cell 95, 461-70.

Kasschau, K. D., Cronin, S., and Carrington, J. C. (1997). Genome amplification and

long-distance movement functions associated with the central domain of

tobacco etch potyvirus helper component-proteinase. Virology 228, 251-62.

Kegler, H., Fuchs, E., Gruntzig, M., and Schwarz, S. (1998). Some results of 50

years of research on the resistance to plum pox virus. Acta Virol 42, 200-15.

Kheyr-Pour, A., Bananej, K., Dafalla, G. A., Caciagli, P., Noris, E., Ahoonmanesh,

A., Lecoq, H., and Gronenborn, B. (2000). Watermelon chlorotic stunt virus

from the Sudan and Iran: sequence comparisons and identification of a

whitefly-transmission determinant. Phytopathology 90, 629-635.

Kimalov, B., Gal-On, A., Stav, R., Belausov, E., and Arazi, T. (2004). Maintenance

of coat protein N-terminal net charge and not primary sequence is essential

for zucchini yellow mosaic virus systemic infectivity. Journal of General

Virology 85, 3421-3430.

Koch, M., and Salomon, R. (1994). Serological detection of onion yellow dwarf

virus in garlic. Plant Disease 78, 785-788.

Kon, T., Hidayat, S. H., Hase, S., Takahashi, H., and Ikegami, M. (2006). The

natural occurrence of two distinct begomoviruses associated with DNA β and

a recombinant DNA in a tomato plant from Indonesia. Phytopathology 96,

517-525.

Kreuzer, K. N. (2000). Recombination-dependent DNA replication in phage T4.

Trends in Biochemical Sciences 25, 165-73.

Kumari, S. G., Makkouk, K. M., and Attar, N. (2006). An improved antiserum for

sensitive serologic detection of Chickpea chlorotic dwarf virus. Journal of

Phytopathology 154, 129-133.

Kunik, T., Palanichelvam, K., Czosnek, H., Citovsky, V., and Gafni, Y. (1998).

Nuclear import of the capsid protein of tomato yellow leaf curl virus

(TYLCV) in plant and insect cells. Plant Journal 13, 393-9.

Langeveld, S. A., Dore, J. M., Memelink, J., Derks, A., Vandervlugt, C. I. M., Asjes,

C. J., and Bol, J. F. (1991). Identification of potyviruses using the polymerase

chain-reaction with degenerate primers. Journal of General Virology 72,

1531-1541.

Laufs, J., Jupin, I., David, C., Schumacher, S., Heyraud-Nitschke, F., and

Gronenborn, B. (1995a). Geminivirus replication: genetic and biochemical

characterization of Rep protein function, a review. Biochimie 77, 765-773.

Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S. G., Schell, J., and

Gronenborn, B. (1995b). In vitro cleavage and joining at the viral origin of

replication by the replication initiator protein of tomato yellow leaf curl virus.

Proceedings of the National Academy of Sciences of the United States of

America 92, 3879-83.

Lazarowitz, S. G. (1992). Geminiviruses - genome structure and gene function.

Critical Reviews in Plant Sciences 11, 327-349.

Legg, J. P., and Fauquet, C. M. (2004). Cassava mosaic geminiviruses in Africa.

Plant Molecular Biology 56, 585-599.

Leonard, S., Plante, D., Wittmann, S., Daigneault, N., Fortin, M. G., and Laliberte, J.

F. (2000). Complex formation between potyvirus VPg and translation

eukaryotic initiation factor 4E correlates with virus infectivity. Journal of

Virology 74, 7730-7737.

Leonard, S., Viel, C., Beauchemin, C., Daigneault, N., Fortin, M. G., and Laliberte,

J. F. (2004). Interaction of VPg-Pro of turnip mosaic virus with the

translation initiation factor 4E and the poly(A)-binding protein in planta.

Journal of General Virology 85, 1055-63.

Lin, B., Akbar Behjatnia, S. A., Dry, I. B., Randles, J. W., and Rezaian, M. A.

(2003). High-affinity Rep-binding is not required for the replication of a

geminivirus DNA and its satellite. Virology 305, 353-363.

Liu, H., Boulton, M. I., Oparka, K. J., and Davies, J. W. (2001). Interaction of the

movement and coat proteins of Maize streak virus: implications for the

transport of viral DNA. Journal of General Virology 82, 35-44.

Liu, H., Boulton, M. I., Thomas, C. L., Prior, D. A., Oparka, K. J., and Davies, J. W.

(1999). Maize streak virus coat protein is karyophyllic and facilitates nuclear

transport of viral DNA. Molecular Plant-Microbe Interactions 12, 894-900.

Llave, C., Martinez, B., Diaz-Ruiz, J. R., and Lopez-Abella, D. (1999). Serological

analysis and coat protein sequence determination of potato virus Y (PVY)

pepper pathotypes and differentiation from other PVY strains. European

Journal of Plant Pathology 105, 847-857.

Lopez-Moya, J. J., Wang, R. Y., and Pirone, T. P. (1999). Context of the coat protein

DAG motif affects potyvirus transmissibility by aphids. Journal of General

Virology 80, 3281-8.

Lotrakul, P., Valverde, R. A., Clark, C. A., Sim, J., and Torre, R. d. l. (1998).

Detection of a geminivirus infecting sweet potato in the United States. Plant

Disease 82, 1253-1257.

Lyttle, D. J., and Guy, P. L. (2004). First record of Geminiviruses in New Zealand:

Abutilon mosaic virus and Honeysuckle yellow vein virus. Australasian

Plant Pathology 33, 321-322.

Mackenzie, A. M., Nolan, M., Wei, K.-J., Clements, M. A., Gowanlock, D., Wallace,

B. J., and Gibbs, A. J. (1998). Ceratobium mosaic potyvirus: another virus

from orchids. Archives of Virology 143, 903-914.

Mahajan, S., Dolja, V. V., and Carrington, J. C. (1996). Roles of the sequence

encoding tobacco etch virus capsid protein in genome amplification:

requirements for the translation process and a cis-active element. Journal of

Virology 70, 4370-9.

Maki-Valkama, T., Valkonen, J. P., Kreuze, J. F., and Pehu, E. (2000). Transgenic

resistance to PVY(O) associated with post-transcriptional silencing of P1

transgene is overcome by PVY(N) strains that carry highly homologous P1

sequences and recover transgene expression at infection. Molecular Plant-

Microbe Interactions 13, 366-73.

Mallory, A. C., Ely, L., Smith, T. H., Marathe, R., Anandalakshmi, R., Fagard, M.,

Vaucheret, H., Pruss, G., Bowman, L., and Vance, V. B. (2001). HC-Pro

suppression of transgene silencing eliminates the small RNAs but not

transgene methylation or the mobile signal. Plant Cell 13, 571-83.

Mansoor, S., Briddon, R. W., Zafar, Y., and Stanley, J. (2003). Geminivirus disease

complexes: an emerging threat. Trends in Plant Science 8, 128-134.

Mansoor, S., Khan, S. H., Bashir, A., Saeed, M., Zafar, Y., Malik, K. A., Briddon,

R., Stanley, J., and Markham, P. G. (1999). Identification of a novel circular

single-stranded DNA associated with cotton leaf curl disease in Pakistan.

Virology 259, 190-199.

Martin, R. R., James, D., and Levesque, C. A. (2000). Impacts of molecular

diagnostic technologies on plant disease management. Annual Review of

Phytopathology 38, 207-239.

Martins Santana, F., Ribeiro, S. D., Moita, A. W., Moreira, D. J., and Giordano, L.

D. (2001). Sources of resistance in Lycopersicon spp. to a bipartite whitefly-

transmitted geminivirus from Brazil. Euphytica 122, 45-51.

Maruthi, M. N., Czosnek, H., Vidavski, F., Tarba, S. Y., Milo, J., Leviatov, S.,

Venkatesh, H. M., Padmaja, A. S., Kulkarni, R. S., and Muniyappa, V.

(2003). Comparison of resistance to Tomato leaf curl virus (India) and

Tomato yellow leaf curl virus (Israel) among Lycopersicon wild species,

breeding lines and hybrids. European Journal of Plant Pathology 109, 1-11.

McDonald, J. G., Beveridge, T. J., and Bancroft, J. B. (1976). Self-assembly of

protein from a flexuous virus. Virology 69, 327-31.

Mink, G. I., and Silbernagel, M. J. (1992). Serological and biological relationships

among viruses in the bean common mosaic-virus subgroup. Archives of

Virology Suppl 5, 397-406.

Mink, G. I., Vetten, H. J., Wyatt, S. D., Berger, P. H., and Silbernagel, M. J. (1999).

Three epitopes located on the coat protein amino terminus of viruses in the

bean common mosaic potyvirus subgroup. Archives of Virology 144, 1173-

1189.

Moffat, A. S. (1999). Geminiviruses emerge as a serious crop threat. Science 286,

1835.

Monci, F., Sanchez-Campos, S., Navas-Castillo, J., and Moriones, E. (2002). A

natural recombinant between the geminiviruses Tomato yellow leaf curl

Sardinia virus and Tomato yellow leaf curl virus exhibits a novel pathogenic

phenotype and is becoming prevalent in Spanish populations. Virology 303,

317-326.

Moriones, E., and Navas-Castillo, J. (2000). Tomato yellow leaf curl virus, an

emerging virus complex causing epidemics worldwide. Virus Research 71,

123-134.

Mosig, G. (1998). Recombination and recombination-dependent DNA replication in

bacteriophage T4. Annual Review of Genetics 32, 379-413.

Mosig, G., Gewin, J., Luder, A., Colowick, N., and Vo, D. (2001). Two

recombination-dependent DNA replication pathways of bacteriophage T4,

and their roles in mutagenesis and horizontal gene transfer. Proceedings of

the National Academy of Sciences of the United States of America 98, 8306-

8311.

Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., and Erlich, H. (1986).

Specific enzymatic amplification of DNA in vitro: the polymerase chain

reaction. Cold Spring Harbor Symposia on Quantitative Biology 51, 263-73.

Murphy, J. F., Klein, P. G., Hunt, A. G., and Shaw, J. G. (1996). Replacement of the

tyrosine residue that links a potyviral VPg to the viral RNA is lethal. Virology

220, 535-8.

Murphy, J. F., Rychlik, W., Rhoads, R. E., Hunt, A. G., and Shaw, J. G. (1991). A

tyrosine residue in the small nuclear inclusion protein of tobacco vein

mottling virus links the VPg to the viral RNA. Journal of Virology 65, 511-3.

Niepel, M., and Gallie, D. R. (1999). Identification and characterization of the

functional elements within the tobacco etch virus 5' leader required for cap-

independent translation. Journal of Virology 73, 9080-8.

Noris, E., Vaira, A. M., Caciagli, P., Masenga, V., Gronenborn, B., and Accotto, G.

P. (1998). Amino acids in the capsid protein of tomato yellow leaf curl virus

that are crucial for systemic infection, particle formation, and insect

transmission. Journal of Virology 72, 10050-7.

Noueiry, A.O., Lucas, W.J. and Gilbertson, R.L. (1994).Two proteins of a plant

DNA virus coordinate nuclear and plasmodesmal transport. Cell 76, 925-932.

Oertel, U., Fuchs, E., and Hohmann, F. (1999). Differentiation of isolates of

Sugarcane mosaic potyvirus (SCMV) on the basis of molecular, serological

and biological investigations. Journal of Plant Diseases and Protection 106,

304-313.

Orozco, B., and Hanley-Bowdoin, L. (1996). A DNA structure is required for

geminivirus replication origin function. Journal of Virology 70, 148-158.

Orozco, B. M., Kong, L.-J., Batts, L. A., Elledge, S., and Hanley-Bowdoin, L.

(2000). The multifunctional character of a geminivirus replication protein is

reflected by its complex oligomerization properties. Journal of Biological

Chemistry 275, 6114-6122.

Orozco, B. M., Miller, A. B., Settlage, S. B., and Hanley-Bowdoin, L. (1997).

Functional domains of a geminivirus replication protein. Journal of

Biological Chemistry 272, 9840-9846.

Ounouna, H., Kerlan, C., Lafaye, P., Loukili, M. J., and ElGaaied, A. (2002).

Production of monoclonal antibodies against synthetic peptides of the N-

terminal region of Potato virus Y coat protein and their use in PVY strain

differentiation. Plant Pathology 51, 487-494.

Padidam, M., Beachy, R. N., and Fauquet, C. M. (1996). The role of AV2 ("precoat")

and coat protein in viral replication and movement in tomato leaf curl

geminivirus. Virology 224, 390-404.

Padidam, M., Sawyer, S., and Fauquet, C. M. (1999). Possible emergence of new

geminiviruses by frequent recombination. Virology 265, 218-225.

Palmer, K. E., and Rybicki, E. P. (1998). The molecular biology of mastreviruses.

Advances in Virus Research 50, 183-234.

Pappu, S. S., Brand, R., Pappu, H. R., Rybicki, E. P., Gough, K. H., Frenkel, M. J.,

and Niblett, C. L. (1993). A polymerase chain reaction method adapted for

selective amplification and cloning of 3' sequences of potyviral genomes -

application to Dasheen mosaic virus. Journal of Virological Methods 41, 9-

20.

Pascal, E., Sanderfoot, A. A., Ward, B. M., Medville, R., Turgeon, R., and

Lazarowitz, S. G. (1994). The geminivirus BR1 movement protein binds

single-stranded DNA and localizes to the cell nucleus. Plant Cell 6, 995-

1006.

Paximadis, M., Idris, A. M., Torres-Jerez, I., Villarreal, A., Rey, M. E. C., and

Brown, J. K. (1999). Characterization of tobacco geminiviruses in the Old

and New World. Archives of Virology 144, 703-717.

Peng, Y. H., Kadoury, D., Gal-On, A., Huet, H., Wang, Y., and Raccah, B. (1998).

Mutations in the HC-Pro gene of zucchini yellow mosaic potyvirus: effects

on aphid transmission and binding to purified virions. Journal of General

Virology 79, 897-904.

Peterschmitt, M., Reynaud, B., Sommermeyer, G., and Baudin, P. (1991).

Characterization of maize streak virus isolates using monoclonal and

polyclonal antibodies and by transmission to a few hosts. Plant Disease 75,

27-32.

Petty, I. T. D., Carter, S. C., Morra, M. R., Jeffrey, J. L., and Olivey, H. E. (2000).

Bipartite geminivirus host adaptation determined cooperatively by coding and

noncoding sequences of the genome. Virology 277, 429-438.

Pico, B., Diez, M. J., and Nuez, F. (1996). Viral diseases causing the greatest

economic losses to the tomato crop. II. The Tomato yellow leaf curl virus - a

review. Scientia Horticulturae 67, 151-196.

Pico, B., Diez, M. J., and Nuez, F. (1999). Improved diagnostic techniques for

tomato yellow leaf curl virus in tomato breeding programs. Plant Disease 83,

1006-1012.

Pinner, M. S., and Markham, P. G. (1990). Serotyping and strain identification of

maize streak virus isolates. Journal of General Virology 71, 1635-40.

Pinner, M. S., Markham, P. G., Rybicki, E. P., and Greber, R. S. (1992). Serological

relationships of geminivirus isolates from Gramineae in Australia. Plant

Pathology 41, 618-625.

Pirone, T. P., and Blanc, S. (1996). Helper-dependent vector transmission of plant

viruses. Annual Review of Phytopathology 34, 227-247.

Polston, J. E., Dodds, J. A., and Perring, T. M. (1989). Nucleic-acid probes for

detection and strain discrimination of cucurbit geminiviruses. Phytopathology

79, 1123-1127.

Polston, J. E., McGovern, R. J., and Brown, L. G. (1999). Introduction of tomato

yellow leaf curl virus in Florida and implications for the spread of this and

other geminiviruses of tomato. Plant Disease 83, 984-988.

Pooma, W., Gillette, W. K., Jeffrey, J. L., and Petty, I. T. D. (1996). Host and viral

factors determine the dispensability of coat protein for bipartite geminivirus

systemic movement. Virology 218, 264-268.

Pooma, W., and Petty, I. T. (1996). Tomato golden mosaic virus open reading frame

AL4 is genetically distinct from its C4 analogue in monopartite

geminiviruses. Journal of General Virology 77, 1947-51.

Potter, J. L., Nakha, M. K., Mejia, L., and Maxwell, D. P. (2003). PCR and DNA

hybridization methods for specific detection of bean-infecting begomoviruses

in the Americas and Caribbean. Plant Disease 87, 1205-1212.

Preiss, W., and Jeske, H. (2003). Multitasking in replication is common among

geminiviruses. Journal of Virology 77, 2972-80.

Rampersad, S. N., and Umaharan, P. (2003). Detection of begomoviruses in clarified

plant extracts: A comparison of standard, direct-binding, and immunocapture

polymerase chain reaction techniques. Phytopathology 93, 1153-1157.

Rhee, Y., Gurel, F., Gafni, Y., Dingwall, C., and Citovsky, V. (2000). A genetic

system for detection of protein nuclear import and export. Nature

Biotechnology 18, 433-7.

Rigden, J. E., Krake, L. R., Rezaian, M. A., and Dry, I. B. (1994). ORF C4 of tomato

leaf curl geminivirus is a determinant of symptom severity. Virology 204,

847-50.

Rojas, A., Kvarnheden, A., Marcenaro, D., and Valkonen, J. P. T. (2005). Sequence

characterization of Tomato leaf curl Sinaloa virus and Tomato severe leaf

curl virus: phylogeny of New World begomoviruses and detection of

recombination. Archives of Virology 150, 1281-1299.

Rojas, M. R., Gilbertson, R. J., Russell, D. R., and Maxwell, D. P. (1993). Use of

degenerate primers in the polymerase chain-reaction to detect whitefly-

transmitted geminiviruses. Plant Disease 77, 340-347.

Rojas, M. R., Jiang, H., Salati, R., Xoconostle-Cazares, B., Sudarshana, M. R.,

Lucas, W. J., and Gilbertson, R. L. (2001). Functional analysis of proteins

involved in movement of the monopartite begomovirus, tomato yellow leaf

curl virus. Virology 291, 110-125.

Rojas, M. R., Noueiry, A. O., Lucas, W. J., and Gilbertson, R. L. (1998). Bean dwarf

mosaic geminivirus movement proteins recognize DNA in a form- and size-

specific manner. Cell 95, 105-13.

Rojas, M. R., Zerbini, F. M., Allison, R. F., Gilbertson, R. L., and Lucas, W. J.

(1997). Capsid protein and helper component-proteinase function as

potyvirus cell-to-cell movement proteins. Virology 237, 283-95.

Rothenstein, D., Haible, D., Dasgupta, I., Dutt, N., Patil, B. L., and Jeske, H. (2006).

Biodiversity and recombination of cassava-infecting begomoviruses from

southern India. Archives of Virology 151, 55-69.

Roye, Wernecke, McLaughlin, Nakhla, and Maxwell (1999). Tomato dwarf leaf curl

virus, a new bipartite geminivirus associated with tomatoes and peppers in

Jamaica and mixed infection with tomato yellow leaf curl virus. Plant

Pathology 48, 370-378.

Rubio, L., Herrero, J. R., Sarrio, J., Moreno, P., and Guerri, J. (2003). A new

approach to evaluate relative resistance and tolerance of tomato cultivars to

begomoviruses causing the tomato yellow leaf curl disease in Spain. Plant

Pathology 52, 763-769.

Rybicki, E. P. (1994). A phylogenetic and evolutionary justification for 3 genera of

geminiviridae. Archives of Virology 139, 49-77.

Saenz, P., Cervera, M. T., Dallot, S., Quiot, L., Quiot, J. B., Riechmann, J. L., and

Garcia, J. A. (2000). Identification of a pathogenicity determinant of Plum

pox virus in the sequence encoding the C-terminal region of protein

P3+6K(1). Journal of General Virology 81, 557-566.

Sanderfoot, A. A., Ingham, D. J., and Lazarowitz, S. G. (1996). A viral movement

protein as a nuclear shuttle. The geminivirus BR1 movement protein contains

domains essential for interaction with BL1 and nuclear localization. Plant

Physiology 110, 23-33.

Saunders, K., Bedford, I. D., Briddon, R. W., Markham, P. G., Wong, S. M., and

Stanley, J. (2000). A unique virus complex causes Ageratum yellow vein

disease. Proceedings of the National Academy of Sciences of the United

States of America 97, 6890-6895.

Saunders, K., Bedford, I. D., and Stanley, J. (2002). Adaptation from whitefly to

leafhopper transmission of an autonomously replicating nanovirus-like DNA

component associated with ageratum yellow vein disease. Journal of General

Virology 83, 907-913.

Saunders, K., Lucy, A., and Stanley, J. (1991). DNA forms of the geminivirus

African cassava mosaic virus consistent with a rolling circle mechanism of

replication. Nucleic Acids Research 19, 2325-30.

Schaad, M. C., Jensen, P. E., and Carrington, J. C. (1997). Formation of plant RNA

virus replication complexes on membranes: role of an endoplasmic reticulum-

targeted viral protein. EMBO Journal 16, 4049-59.

Schaad, M. C., Lellis, A. D., and Carrington, J. C. (1997). VPg of tobacco etch

potyvirus is a host genotype-specific determinant for long-distance

movement. Journal of Virology 71, 8624-31.

Seal, S. E., vandenBosch, F., and Jeger, M. J. (2006). Factors influencing

begomovirus evolution and their increasing global significance: Implications

for sustainable control. Critical Reviews in Plant Sciences 25, 23-46.

Settlage, S. B., Miller, A. B., Gruissem, W., and Hanley-Bowdoin, L. (2001). Dual

interaction of a geminivirus replication accessory factor with a viral

replication protein and a plant cell cycle regulator. Virology 279, 570-6.

Settlage, S. B., Miller, A. B., and Hanley-Bowdoin, L. (1996). Interactions between

geminivirus replication proteins. Journal of Virology 70, 6790-5.

Shukla, D. D., Frenkel, M. J., and Ward, C. W. (1991). Structure and function of the

potyvirus genome with special reference to the coat protein coding region.

Canadian Journal of Plant Pathology 13, 178-191.

Shukla, D. D., Lauricella, R., and Ward, C. W. (1992). Serology of potyviruses:

current problems and some solutions. Archives of Virology (Suppl.) 5, 57-69.

Shukla, D. D., and Ward, C. W. (1989). Identification and classification of

potyviruses on the basis of coat protein sequence data and serology. Brief

review. Archives of Virology 106, 171-200.

Shukla, D. D., Ward, C. W., Brunt, A. A., and Berger, P. H. (1998). Potyviridae

family. In "Description of Plant Viruses, No. 366". Association of Applied

Biologists (AAB).

Stanley, J., Bisaro, D. M., Briddon, R. W., Brown, J. K., Fauquet, C. M., Harrison,

B. D., Rybicki, E. P., and Stenger, D. C. (2005). Geminiviridae. In "Virus

Taxonomy. VIIIth Report of the International Committee on Taxonomy of

Viruses" (C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger, and L.

A. Ball, Eds.), pp. 301 - 326. Elsevier/Academic Press, London.

Stonor, J., Hart, P., Gunther, M., DeBarro, P., and Rezaian, M. A. (2003). Tomato

leaf curl geminivirus in Australia: occurrence, detection, sequence diversity

and host range. Plant Pathology 52, 379-388.

Suehiro, N., Natsuaki, T., Watanabe, T., and Okuda, S. (2004). An important

determinant of the ability of Turnip mosaic virus to infect Brassica spp.

and/or Raphanus sativus is in its P3 protein. Journal of General Virology 85,

2087-98.

Sunter, G., and Bisaro, D. M. (1992). Transactivation of geminivirus AR1 and BR1

gene expression by the viral AL2 gene product occurs at the level of

transcription. Plant Cell 4, 1321-31.

Sunter, G., and Bisaro, D. M. (1997). Regulation of a geminivirus coat protein

promoter by AL2 protein (TrAP): evidence for activation and derepression

mechanisms. Virology 232, 269-80.

Sunter, G., Hartitz, M. D., Hormuzdi, S. G., Brough, C. L., and Bisaro, D. M. (1990).

Genetic analysis of tomato golden mosaic virus: ORF AL2 is required for

coat protein accumulation while ORF AL3 is necessary for efficient DNA

replication. Virology 179, 69-77.

Sunter, G., Sunter, J. L., and Bisaro, D. M. (2001). Plants expressing tomato golden

mosaic virus AL2 or beet curly top virus L2 transgenes show enhanced

susceptibility to infection by DNA and RNA viruses. Virology 285, 59-70.

Tomlinson, J. A. (1987). Epidemiology and control of virus diseases of vegetables.

Annals of Applied Biology 110, 661-681.

Tracy, S. L., Frenkel, M. J., Gough, K. H., Hanna, P. J., and Shukla, D. D. (1992).

Bean yellow mosaic, clover yellow vein, and pea mosaic are distinct

potyviruses - evidence from coat protein gene-sequences and molecular

hybridization involving the 3' noncoding regions. Archives of Virology 122,

249-261.

Unseld, S., Hohnle, M., Ringel, M., and Frischmuth, T. (2001). Subcellular targeting

of the coat protein of African cassava mosaic geminivirus. Virology 286, 373-

83.

Urcuqui-Inchima, S., Haenni, A. L., and Bernardi, F. (2001). Potyvirus proteins: a

wealth of functions. Virus Research 74, 157-175.

Urcuqui-Inchima, S., Maia, I. G., Arruda, P., Haenni, A. L., and Bernardi, F. (2000).

Deletion mapping of the potyviral helper component-proteinase reveals two

regions involved in RNA binding. Virology 268, 104-11.

Vanitharani, R., Challappan, P., Pita, J.S. and Fauquet, C.M. (2004). Differential

roles of AC2 and AC4 of cassava geminiviruses in mediating synergism and

suppression of post-transcriptional gene silencing. Journal of Virology 78,

9487-9498. van der Vlugt, R. A. A., Steffens, P., Cuperus, C., Barg, E., Lesemann, D. E., Bos,

L., and Vetten, H. J. (1999). Further evidence that shallot yellow stripe virus

(SYSV) is a distinct potyvirus and reidentification of Welsh onion yellow

stripe virus as a SYSV strain. Phytopathology 89, 148-155.

Verchot, J., Herndon, K. L., and Carrington, J. C. (1992). Mutational analysis of the

tobacco etch potyviral 35-kDa proteinase: identification of essential residues

and requirements for autoproteolysis. Virology 190, 298-306.

Vetten, H. J., Lesemann, D. E., and Maiss, E. (1992). Serotype-a and serotype-B

strains of bean common mosaic virus are 2 distinct potyviruses. Archives of

Virology Suppl 5, 415-431.

Villamor, D. E. V., Bajet, N. B., and Lockhart, B. E. (2003). Purification and

production of antiserum against abaca mosaic potyvirus. Philippine

Agricultural Scientist 86, 368-376.

Voinnet, O., Pinto, Y. M., and Baulcombe, D. C. (1999). Suppression of gene

silencing: a general strategy used by diverse DNA and RNA viruses of plants.

Proceedings of the National Academy of Sciences of the United States of

America 96, 14147-52.

Voloudakis, A. E., Malpica, C. A., Aleman-Verdaguer, M. E., Stark, D. M., Fauquet,

C. M., and Beachy, R. N. (2004). Structural characterization of Tobacco etch

virus coat protein mutants. Archives of Virology 149, 699-712.

Wang, R. Y., Powell, G., Hardie, J., and Pirone, T. P. (1998). Role of the helper

component in vector-specific transmission of potyviruses. Journal of General

Virology 79, 1519-24.

Ward, B. M., and Lazarowitz, S. G. (1999). Nuclear export in plants. Use of

geminivirus movement proteins for a cell-based export assay. Plant Cell 11,

1267-76.

Ward, B. M., Medville, R., Lazarowitz, S. G., and Turgeon, R. (1997). The

geminivirus BL1 movement protein is associated with endoplasmic

reticulum-derived tubules in developing phloem cells. Journal of Virology 71,

3726-33.

Wartig, L., Kheyr-Pour, A., Noris, E., De Kouchkovsky, F., Jouanneau, F.,

Gronenborn, B., and Jupin, I. (1997). Genetic analysis of the monopartite

tomato yellow leaf curl geminivirus: roles of V1, V2, and C2 ORFs in viral

pathogenesis. Virology 228, 132-140.

Were, H. K., Takeshita, M., Furuya, N., and Takanami, Y. (2005). Molecular

characterization of a new begomovirus infecting tobacco in Kagoshima,

Japan: an evidence for interspecific recombination. Journal of the Faculty of

Agriculture Kyushu University 50, 83-91.

Wittmann, S., Chatel, H., Fortin, M. G., and Laliberte, J. F. (1997). Interaction of the

viral protein genome linked of turnip mosaic potyvirus with the translational

eukaryotic initiation factor (iso) 4E of Arabidopsis thaliana using the yeast

two-hybrid system. Virology 234, 84-92.

Wyatt, S. D., and Brown, J. K. (1996). Detection of subgroup III geminivirus isolates

in leaf extracts by degenerate primers and polymerase chain reaction.

Phytopathology 86, 1288-1293.

Yang, L. J., Hidaka, M., Masaki, H., and Uozumi, T. (1998). Detection of potato

virus Y P1 protein in infected cells and analysis of its cleavage site.

Bioscience, Biotechnology, and Biochemistry 62, 380-2.

Zerbini, F. M., Koike, S. T., and Gilbertson, R. L. (1995). Biological and molecular

characterization of lettuce mosaic potyvirus isolates from the Salinas Valley

of California. Phytopathology 85, 746-752.

Zhang, W., Olson, N. H., Baker, T. S., Faulkner, L., Agbandje-McKenna, M.,

Boulton, M. I., Davies, J. W., and McKenna, R. (2001). Structure of the

maize streak virus geminate particle. Virology 279, 471-477.

Zhou, X., Liu, Y., Calvert, L., Munoz, C., Otim-Nape, G. W., Robinson, D. J., and

Harrison, B. D. (1997). Evidence that DNA-A of a geminivirus associated

with severe cassava mosaic disease in Uganda has arisen by interspecific

recombination. Journal of General Virology 78, 2101-11.

Zhou, X. P., Xie, Y., Tao, X. R., Zhang, Z. K., Li, Z. H., and Fauquet, C. M. (2003).

Characterization of DNA beta associated with begomoviruses in China and

evidence for co-evolution with their cognate viral DNA-A. Journal of

General Virology 84, 237-247.

CHAPTER 3

Corchorus yellow vein virus, a New World geminivirus from the Old World

Cuong Ha1, Steven Coombs2, Peter Revill1,†, Rob Harding1, Man Vu3 and James Dale1

1Tropical Crops and Biocommodities Domain, Institute of Health and Biomedical Innovation, Queensland University of Technology, GPO Box 2434, Brisbane, QLD 4001, Australia

2Centre for Information Technology Innovation, Faculty of Information Technology, Queensland University of Technology, Brisbane, QLD 4001, Australia

3Department of Plant Pathology, Hanoi Agriculture University, Gia Lam, Hanoi, Vietnam

† Present address: Victorian Infectious Diseases Reference Laboratory, 10 Wreckyn Street, North Melbourne, VIC 3051, Australia.

Journal of General Virology (2006), 87: 997–1003

Statement of joint authorship

Cuong Ha:

Executed the work (collected plant samples, designed and conducted all laboratory experiments, analysed and interpreted data) and wrote initial manuscript.

Steven Coombs:

Provided initial alignments of geminivirus sequences for design of degenerate primers.

Peter Revill:

Conceived project idea, collected plant samples, supervised execution of the work, critically interpreted data and significantly contributed to final manuscript.

Rob Harding:

Conceived project idea, collected plant samples, supervised execution of the work, critically interpreted data and contributed to final manuscript.

Man Vu:

Conceived project idea and collected samples.

James Dale:

Conceived project idea, collected plant samples, supervised execution of the work, critically interpreted data, contributed to final manuscript.

SUMMARY

A bipartite begomovirus infecting Jute mallow (Corchorus capsularis, Tilliaceae) in

Vietnam was identified using novel degenerate PCR primers. Analysis of this virus, which was named Corchorus yellow vein virus (CoYVV), showed that it was more similar to New World begomoviruses than to viruses from the Old World. This was based on the absence of an AV2 open reading frame, the presence of an N-terminal

PWRLMAGT motif in the coat protein and phylogenetic analysis of the DNA A and

DNA B nucleotide and deduced amino acid sequences. Evidence is provided that

CoYVV is probably indigenous to the region and may be the remnant of a previous population of New World begomoviruses in the Old World.

The GenBank/EMBL/DDBJ accession numbers for the sequences reported in this paper are AY727903 and AY27904.

INTRODUCTION

The Geminiviridae are a family of plant viruses with circular single-stranded DNA

(ssDNA) genomes encapsidated in twinned particles. Based on their genome arrangement and biological properties, geminiviruses are classified into one of four genera, Mastrevirus, Curtovirus, Topocuvirus and Begomovirus (Stanley et al.,

2005). Members of the genus Begomovirus are transmitted by whiteflies to a wide range of dicotyledonous plants and many have bipartite genomes, known as DNA A and DNA B. DNA A has either one or two open reading frames (ORFs) in the virion sense (AV1, AV2) and up to four major ORFs in the complementary sense (AC1,

AC2, AC3, AC4). The DNA B component has one major ORF in each of the virion

(BV1) and complementary (BC1) orientations. The DNA A and DNA B components share little sequence similarity, except for ~170 nt of sequence in the intergenic region (IR), termed the common region (CR) (reviewed by Hanley-Bowdoin et al.,

1999). Although the CR sequence is usually almost identical in both components, there are examples where the CRs differ substantially between DNA A and DNA B.

For example, the CRs of Tomato leaf curl Gujarat virus (ToLCGV) and Cotton leaf crumple virus (CLCrV) differed by 40 and 37%, respectively (Chakraborty et al.,

2003; Idris & Brown, 2004). Despite these differences, sequences critical for replication are identical between components of each individual virus. These comprise iterative sequences (iterons) that are recognized and bound by Rep protein

(Fontes et al., 1994; Orozco et al., 1998) and a conserved inverted repeat sequence with the potential to form a stem–loop where rolling circle replication initiates (Laufs et al., 1995; Stanley, 1995). Microprojectile bombardment of seedlings with infectious clones of the respective CLCrV and ToLCGV DNA A and DNA B

molecules resulted in typical disease symptoms and confirmed that both components are from the same infectious unit (Chakraborty et al., 2003; Idris & Brown, 2004).

Phylogenetic studies show that begomoviruses can be broadly divided into two groups, the Old World viruses (eastern hemisphere, Europe, Africa, Asia) and the

New World viruses (western hemisphere, the Americas) (Padidam et al., 1999;

Paximadis et al., 1999; Rybicki, 1994). Begomovirus genomes have a number of characteristics that distinguish Old World and New World viruses. All New World begomoviruses are bipartite, whereas both bipartite and monopartite begomoviruses are present in the Old World. In addition, all Old World begomoviruses have an extra

AV2 ORF in DNA A that is not present in New World begomoviruses (Rybicki,

1994; Stanley et al., 2005). New World begomoviruses also have an N-terminal

PWRsMaGT motif in the coat protein (CP) encoded by AV1, which is absent from

Old World begomoviruses (Harrison et al., 2002). In most Old World begomoviruses, there are two iterons upstream of the AC1 TATA box, with a complementary iteron downstream. This downstream iteron is lacking in most New

World begomoviruses (Arguello-Astorga et al., 1994). Rybicki (1994) proposed that most New World viruses arose more recently than Old World viruses and suggested that they may have evolved after the continental separation of the Americas from

Gondwana approximately 130 million years ago. Rybicki (1994) speculated that whiteflies moving from Asia to the Americas may have transmitted viruses that were the ancestors of New World viruses that we observe today. These viruses subsequently evolved separately from Old World viruses and this evolution would also have been accompanied by the early loss of the AV2 gene (originally named

AV1), which would explain its absence from all New World viruses characterized to

date. In more recent times, there is evidence of New World begomoviruses in the Old

World and vice versa, due to the increased range of the B biotype of the Bemisia tabaci whitefly vector and/or the distribution of infected propagating material. For example, strains of Tomato yellow leaf curl virus (TYLCV) have been identified in the New World (Caribbean Islands and Florida) (reviewed by Czosnek & Laterrot,

1997; Polston et al., 1999) and the New World virus Abutilon mosaic virus (AbMV) has been identified in ornamental Abutilon spp. in the UK (Brown et al., 2001) and

New Zealand (Lyttle & Guy, 2004). However, these are apparently recent introductions and there are no known examples of indigenous viruses from the Old

World with genome organization and/or phylogenetic similarity to New World viruses and vice versa. In this paper, we describe the first example of an indigenous

Old World begomovirus that has all of the distinguishing characteristics of a New

World virus and discuss the ramifications of this finding for current theories on begomovirus evolution.

METHODS

Degenerate primers and PCR

Although degenerate PCR primers have been used to amplify DNA A from a number of begomoviruses, most primer pairs only amplify small fragments of approximately

500 nt in the AV1 gene (Revill et al., 2003; Wyatt & Brown, 1996). To design degenerate primers that would amplify a larger region of DNA A, we aligned begomovirus DNA A sequences from the GenBank database using the CLUSTAL X program (Thompson et al., 1997) and identified two conserved regions, one at the 5’ end of the AV1 gene (CP) and the other at the 3’ end of the AC1 gene (Rep), approximately 1200 nt apart. Degenerate primers, BegoAFor1 (5’-

TGYGARGGiCCiTGYAARGTYCARTC-3’) (i=inosine) and BegoARev1 (5’-

ATHCCMDCHATCKTBCTiTGCAATCC-3’), were designed in each region and used in PCRs comprising a 1 μl aliquot of template DNA, 15 mM MgCl2 buffer

(Roche), 10 pmol dNTPs, 40 pmol of each primer and 2.5 U Taq polymerase

(Roche). The reactions were denatured at 94 OC for 5 min and then subjected to 40 cycles at 94 OC (30 s), 50 OC (30 s) and 72 OC (90 s), terminating with 10 min at 72

OC.

The primers were initially tested on total DNA extracted (DNeasy; Qiagen) from several known begomovirus-infected samples from Vietnam, namely Squash leaf curl virus-China (SLCCNV), Luffa yellow mosaic virus (LYMV) and TYLCV and in each case a fragment of the expected size (~1.2 kbp) was amplified. Sequence analysis of the cloned amplicon from the SLCCNV-infected sample confirmed the presence of SLCCNV. DNA was subsequently extracted from various samples that had been collected during a virus survey of Vietnam during 2000. These samples included weeds that were exhibiting typical geminivirus symptoms (stunting, bright yellow mosaics and vein yellowing) and Jute (Corchorus capsularis), a leaf vegetable and medicinal herb, collected from Hoa Binh province in northern

Vietnam, which was showing vein yellowing.

The DNA A-specific primers BegoAFor1 and BegoARev1 amplified a 1.2 kbp product from several of the samples tested, including the Jute sample, which was chosen for further analysis. To amplify DNA B from the Jute sample, the degenerate primer PBL1v2040 (Rojas et al., 1993) was used in combination with an antisense

primer (201CRRev 59-CAGAGACTTTGGTGTGTACC-39) located in the DNA A

IR to amplify a product of ~700 bp. This primer pair was used in a PCR as described above, but at an annealing temperature of 46 OC.

Amplification and cloning of DNA A and DNA B

To amplify the remaining sequence of DNA A and DNA B from the virus infecting

Jute, outwardly extending specific primers (DNA A: 201For 5’-

TCCTCTTCGAAGAACTCCT-3’, 201Rev 5’-TGTATGAGCAATATCGTGAC-3’;

DNA B: 201BFor 5’-GAAGGTATGATGTCTTCCTG-3’, 201BRev 5’-

AATCACAATTAGCTCAAGC-3’) were used in PCRs comprising a 1 μl aliquot of template DNA, 15 mM MgCl2 buffer, 10 pmol dNTPs, 40 pmol of each primer and

2.5 U Taq polymerase. The reactions were denatured at 94 OC for 5 min, followed by

40 cycles at 94 OC (30 s), 52 OC (30 s) and 72 OC (90 s), terminating with 10 min at

72 OC. For DNA B, the annealing temperature was reduced to 46 OC. The complete

DNA A sequence was also amplified using Expand polymerase (Roche) with adjacent outwardly extending primers (201For and 201Rev1 5’-

AAAGAACAAAGCAATCAATGAC-3’) at an annealing temperature of 50 OC.

PCR products were gel-purified, ligated into plasmid vector pGEM-T Easy

(Promega), introduced into Escherichia coli and sequenced. Consensus sequences were determined using the SeqMan program (DNASTAR) and nucleotide and deduced amino acid sequences from three clones for each molecule were analysed using EditSeq (DNASTAR) and Vector NTI. Sequences were compared with the

GenBank database using the BLAST programs available at the National Centre for

Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/blast). The complete DNA A and DNA B nucleotide sequences and the nucleotide and deduced amino acid sequences of the AC1, AV1, BC1 and BV1 genes were aligned using

CLUSTAL X (Thompson et al., 1997) with analogous sequences from 29 Old World and 11 New World begomoviruses (Table 1). Neighbor-joining trees were generated using TREEVIEW (Page, 1996). Nucleotide identities were calculated with the

MegAlign program (DNASTAR) using the CLUSTALW algorithm.

Replication studies

To confirm that the DNA A and DNA B molecules identified in this study were from the same bipartite begomovirus, replication studies were performed on cloned components. To the best of our knowledge, Corchorus yellow vein virus (CoYVV) is not present in Australia and therefore Australian quarantine regulations did not permit co-inoculation experiments with DNA A and DNA B infectious clones. To determine whether the DNA A Rep sequence could initiate replication of DNA B,

Nicotiana tabacum (NT1) cells were co-bombarded with a plasmid expressing the

DNA A Rep/TraP/REn sequences encoded by AC1, AC2 and AC3, respectively, and a plasmid containing a 1.5-mer copy of the DNA B molecule.

Constructs

DNA B 1.5-mer replicon

The complete DNA B sequence was amplified by PCR using the Expand Long

Template PCR system (Roche Diagnostics) using a pair of adjacent outwardly

Table 1. GenBank accession numbers for the begomoviruses used in the phylogenetic analysis

Accession no. Acronym Species DNA A DNA B

New World AbMV Abutilon mosaic virus X15983 X15984 BDMV Bean dwarf mosaic virus M88179 M88180 SLCV Squash leaf curl virus M38183 M38182 DiYMoV Dicliptera yellow mottle virus AF139168 AF170101 MaMPRV Macroptilium mosaic Puerto Rico virus AF449192 AF449193 RhGMV Rhynchosia golden mosaic virus AF239671 - SiGMCRV Sida golden mosaic Costa Rica virus X99550 X99551 SiGMV Sida golden mosaic virus AF049336 AJ250731 SiMoV Sida mottle virus AY090555 - SMLCV Squash mild leaf curl virus AF421552 AF421553 CabLCuV Cabbage leaf curl virus U65529 U65530 ToGMoV Tomato golden mottle virus AF132852 - ToMoTV Tomato mottle Taino Virus AF012300 AF012301

Old World ACMV African cassava mosaic virus AF126802 AF126803 AEV Ageratum enation virus AJ437618 - AYVV Ageratum yellow vein virus X74516 - CLCuRV Cotton leaf curl Rajasthan virus AF363011 - EACMV East African cassava mosaic virus AF126806 AF126807 EpYVV Eupatorium yellow vein virus AJ438936 - ICMV Indian cassava mosaic virus AJ314739 AJ314740 MYMIV Mungbean yellow mosaic India virus AF126406 AF142440 LYMV Luffa yellow mosaic virus AF509739 AF509740 MYMV Mungbean yellow mosaic virus D14703 D14704 PaLCuCNV Papaya leaf curl China virus AJ558124 - PepLCBV Pepper leaf curl Bangladesh virus AF314531 - SACMV South African cassava mosaic virus AF155806 AF155807 SbCLV Soybean crinkle leaf virus AB050781 - SLCCNV Squash leaf curl virus-China AF509743 AF509742 StaLCV Stachytarpheta leaf curl virus AJ495814 - TbLCYNV Tobacco leaf curl Yunnan virus AJ566744 - ToLCLV Tomato leaf curl Laos virus AF195782 - ToLCVV Tomato leaf curl Vietnam virus AF264063 - ToLCV Tomato leaf curl virus S53251 - TYLCTHV Tomato yellow leaf curl virus- Thailand AY514630 AY514633

100

extending primers, CorBSacFor (5’-GAGCTCCTCTCTCTGTACGACGACCA-3’, nt 448–473) and CorBSacRev (5’-GAGCTCCATGTCTATACCGCATAGTATAC-

3’, nt 453–425). PCRs were set up as described above using an annealing temperature of 55 OC and the amplicon was gel purified (Qiax II; Qiagen) and ligated into the pGEM-T Easy vector to produce pCoY/B-1.0. The fragment containing the potential stem–loop sequence in the DNA B CR was excised from pCoY/B-1.0 and ligated into the pGEM-T Easy vector to form pCoY/B-0.5. The complete DNA B sequence was excised from pCoY/B-1.0 and ligated to pCoY/A-0.5 to form pCoY/B-

1.5, which contained the complete DNA B sequence flanked by two DNA B stem– loop sequences.

Rep/TraP/REn gene expression

The complete DNA A sequence was amplified using adjacent outwardly extending primers, CorAPstFor (5’-CTGCAGTTCGTGCATCTGTACTTCTTC-3’, nt 2314–

2340) and CorAPstRev (5’-CTGCAGATTGTTCGATCTATCCAATCC-3’, nt

2319–2293), as described above. The amplicon was ligated into the pGEM-T Easy vector to produce pCoY/A-1.0. The sequence encompassing the complete AC1 ORF through to the end of the REn gene was amplified using the Expand Long Template

PCR system from the pCoY/A-1.0 template, with primers 201RepFor (5’-

AGGCACCATGGGAAGTCGTTTTG-3’) and 201REnRev (5’-

CTGCACGTGAGATACGGATCTAC-3’). The amplicon was ligated into the pTEST expression vector (a gift from Dr B. Dugdale, Queensland University of

Technology) containing a 35S promoter and a Nos terminator in a pGEM-T Easy backbone, to form p35SRep/REn.

101

Microprojectile bombardment and Southern hybridization

NT1 cells were co-bombarded with either pCoY/B-1.5 alone (1 μg) or pCoY/B-1.5 and p35SRep/REn (0.5 μg) together, as described by Dugdale et al. (1998) and harvested three days post-inoculation. DNA was extracted using the CTAB method of Stewart & Via (1993) and 40 μg DNA was loaded onto each lane of a 1% agarose gel. Southern hybridization was performed using the DIG (Roche) protocol, with a

1157 nt DNA B probe amplified from the pCoY/B-0.5 plasmid using primers

CorBEcoFor (5’-GAATTCAACTGTAGAACAATCTCTGTTAG-3’, nt 2021–2043) and CorBSacRev.

RESULTS

CoYVV sequence

Complete nucleotide sequences of DNA A and DNA B were obtained and we named the virus Corchorus yellow vein virus (CoYVV). The DNA A molecule was 2724 nt in length, whereas the DNA B molecule comprised 2691 nt. DNA A encoded one major ORF in the sense orientation (AV1) and four in the complementary sense

(AC1, AC2, AC3 and AC4). DNA A did not encode an AV2 ORF. DNA B encoded two major ORFs, BV1 on the virion strand and BC1 on the complementary strand.

The CRs of DNA A and DNA B comprised 228 and 254 nt, respectively, with 70.2% identity. This low identity was due, in part, to a 21 base insertion in the DNA B CR between the TATA box and the stem–loop sequence; the remainder of the CR sequences were 84% identical. Each CR contained two identical iterons, both upstream of the AC1 TATA box, as well as identical stem–loop sequences that included the conserved TAATATTAC nonanucleotide sequence present in the CRs

102

of all characterized geminiviruses (Fig. 1). A PWRLMAGT motif was identified at the N terminus of the deduced CoYVV CP sequence encoded by AV1 (Table 2).

Replication analysis

Southern hybridization experiments using a DIG-labelled DNA B-specific probe showed that microprojectile bombardment of NT1 cells with a construct expressing the DNA A Rep/TraP/REn sequences initiated replication of DNA B, released from a plasmid harbouring a 1.5-mer copy of DNA B. No DNA B replication was observed in the absence of the Rep/TraP/REn gene product (Fig. 2).

Phylogenetic analysis

BLAST searches and nucleotide sequence alignments showed that CoYVV DNA A was more closely related to New World begomoviruses than to those from the Old

World, and with closest overall nucleotide identity (60.2%) to Macroptilium mosaic

Puerto Rico virus (data not shown). Sequence alignments showed that CoYVV DNA

B was also more closely related to New World begomoviruses with closest overall nucleotide identity to Tomato mottle Taino virus (ToMoTV; 45.9%). Higher similarity was observed for the deduced amino acid sequence of the BC1 gene, which was 75% similar to the analogous sequence of Bean dwarf mosaic virus

(BDMV) from Columbia (data not shown). In addition, the CoYVV DNA A lacked the AV2 ORF that is present in Old World begomoviruses, but absent from all New

103

**************************************************************************************** DNA A CTTGCGTTTTATATCGGTACACACCAAAGTCTCTGTGTACCGATATATCGGTACACAATATATACTAGTGGCCTCTATAATGCTACTA- DNA B CTTGCGTTTTATATCGGTACACACCAAAGTCTCTGTGTACCGATATATCGGTACACAATATATACTAGTGGCCTCTATAATGCTACTAA

********* ** ** * * ** ******* * *** *** * * * ** ** * DNA A GGCGTGCAGCGCCTTGATATTCCGGACGCGAGGGGTATTCATGGTCATTT-GCCACTCAGTT------TAGCGC DNA B GGCGTGCAGTTCCACC-TAGGCGTGGGAAGAAGGGTATTTAGTGTCTTTTCACTATTTGTTTGTAAAGGGTTTGATATCCGCATAAGGG

***** ** * ** **************** *********************** **************** DNA A TATTTTTGGG---TTCCGATCCGCTGCTGCACGCCTATAATATTACCGTGCAGCAGCCCC-GCTTTTGCCGTACGCT DNA B TATTTGTGTAACTTACCACACCGCTGCTGCACGCCTTTAATATTACCGTGCAGCAGCCCCCGCTTTTGCCGTACGCT

Fig. 1. Comparison of the CR sequences of CoYVV DNA A and DNA B. The putative iteron sequences are underlined, the TATA motif is boxed and stem–loop forming sequences are underlined and in bold. Asterisks indicate identical nucleotides. A comparison of the N-terminal amino acid sequences of the CP of CoYVV and several representative New World and Old World begomoviruses is given in Table 2.

104

Table 2. Comparison of the N-terminal amino acid sequences of the CP of CoYVV and several representative New World (the Americas) and Old World (Asia, Africa) begomoviruses (Harrison et al., 2002).

The conserved motif PWRsMaGT is highlighted in bold. The initial methionine residue (M) is the first amino acid of the CP. GenBank accession numbers for these sequences and the virus names are provided in Table 1.

Virus N terminus of the CP Origin

MAMPRV MPKRDAPWRSSAGTSKVSRN America SiGMV MPKRELPWRSMAGTSKVSRN America ToGMoV MPKRDAPWRLMGGTSKVSRS America RhGMV MPKRDAPWRLSAGTSKVSRS America BDMV MPKRDAPWRSMAGTTKVSRN America

CoYVV MPKRDAPWRLMAGTSKVSRS This study

LYMV MSKRPADIIISTPASKVRRR Asia SLCCNV MSKRPADIIISTPASKVRRR Asia ToLCVV MSKRPADIVISTPASKVRRR Asia ICMV MSKRPADIIISTPASKVRRR Asia TYLCTHV MSKRPADILISTPVSKVRRR Asia TLCLV MSKRPGDIIISTPVSKVRRR Asia ACMV MSKRPGDIIISTPGSKVRRR Africa EACMV MSKRPGDIIISAPVSKVRRR Africa

105

106

1 2 3 4 5 6 7 8 9

Fig. 2. Southern blot analysis of DNA extracted from NT1 cells bombarded with a 1.5-mer copy of the CoYVV DNA B sequence (pCoY/B-1.5) alone (lanes 1–3), pCoY/B-1.5 co-bombarded with a plasmid expressing the

CoYVV Rep/TraP/REn genes (p35SRep/REn) (lanes 4–6), unshot and p35SRep/REn controls (lanes 7 and 8, respectively) and 270 pg pCoY/B-1.5 DNA (lane 9). The blots were hybridized with a DNA B-specific probe. Open circular and supercoiled DNA are indicated by the top and bottom arrows, respectively.

107

108

World begomoviruses. Other similarities to many begomoviruses from the New

World included the presence of a PWRLMAGT motif at the CoYVV CP N terminus and the absence of a complementary iteron downstream of the AC1 TATA box.

Phylogenetic analysis using the complete DNA A and DNA B nucleotide sequences showed that CoYVV grouped more closely with New World begomoviruses, but was the most distant of the New World begomoviruses (100% bootstrap support) (Fig. 3).

A similar tree topology was obtained using the AV1 nucleotide and deduced amino acid sequences and the AC1, BC1 and BV1 nucleotide sequences (data not shown).

DISCUSSION

We have identified a bipartite virus from the Old World that is more similar to New

World geminiviruses than to other indigenous Old World viruses. This conclusion is based on the absence of an AV2 ORF, the presence of an N-terminal PWRLMAGT motif in the CP, the absence of a complementary iteron downstream of the stem–loop sequence and phylogenetic analysis of the DNA A and DNA B nucleotide and deduced amino acid sequences. Although the nucleotide sequences of the CoYVV

DNA A and DNA B CRs were only 70.2 % identical, due in part to a 21 nt insertion in the DNA B CR, they shared identical iterons and stem–loop sequences, suggesting that they represented two components of the one virus. This was supported by microprojectile bombardment of NT1 cells, which showed that a construct harbouring the DNA A Rep/TraP/REn sequence initiated episomal replication of

DNA B released from a plasmid harbouring a 1.5-mer copy of the DNA B molecule.

Our results confirmed that the CoYVV DNA A and DNA B molecules represented a biologically functional unit from the same begomovirus.

109

(a) (b)

New World New World

SiMoV SiGMCRV CaLCuV BDMV MaMPRV ToGMoV ToMoTV AbMV SiGMV ToMoTV 1000 DiYMoV CoYVV AbMV CaLCuV DiYMoV 995 1000 SLCV 1000 BDMV

728 560 SMLCV 646 675 1000 SiGMCRV 1000 MYMV 551 960 1000 SMLCV 1000 1000 1000 SiGMV

958 SLCV 1000 1000 879 SACMV CoYVV MYMIV 1000 MaMPRV 1000 1000 1000 EACMV SACMV RhGMV 1000 985 1000 1000 EACMV 870 ToLCV TYLCTHV 1000 644 724 958 1000

ACMV 819 EpYVV 1000 1000 MYMV 891 ICMV 863 TYLCTHV 1000 970 ToLCVV 1000 883 1000 ICMV SLCCNV-[VN] 712 PaLCuCNV 1000 821 1000 MYMIV TbLCYNV AYVV PepLCBV AEV SbCLV LYMV StaLCV ToLCLV LYMV ACMV CLCuRV SLCCNV

0.1 0.1

Fig. 3. Phylogenetic analysis of the complete CoYVV DNA A (a) and DNA B (b) nucleotide sequences. CoYVV is circled and underlined. Bootstrap values are indicated (1000 replicates). The full name and GenBank accession numbers for the sequences used in the analysis are presented in Table 1.

110

CoYVV is not the only Old World geminivirus to bear some relationship to New

World geminiviruses. Phylogenetic analysis of the CP, BC1, BC2 and IRA/IRB sequences of the Old World Mungbean yellow mosaic virus (MYMV) showed that they were closely related to viruses from the New World (Rybicki, 1994). Our phylogenetic analysis of the complete DNA A sequence from a large number of Old and New World geminiviruses showed that, whereas MYMV was distal to other Old

World viruses, it was still more closely related to Old World geminiviruses than to

New World viruses. The complete MYMV DNA B sequence was even more closely related to Old World viruses, whereas the CoYVV DNA A and DNA B sequences were both more closely related to New World viruses. It should also be noted that

MYMV encodes an AV2 ORF, although the sequence in GenBank (e.g. accession no. D14703) appears to contain a frameshift error in AV2 that results in two AV2 genes.

The distal position of CoYVV on phylogenetic trees relative to the New World begomoviruses with which it shares closest similarity suggests that CoYVV is not a

New World virus that has been recently introduced into Vietnam. Rather, it is more likely that it has been in Vietnam for a considerable period. Jute is a native of southern China (http://www.hear.org/gcw/html/autogend/species/5199.htm) and is propagated as a vegetable and fibre crop by seed, not cuttings. There are no reports of seed transmission of begomoviruses, which suggests that CoYVV has either been transmitted to Jute in Vietnam or CoYVV-infected plants entered Vietnam from nearby southern China. Although some Old World and New World begomoviruses have been detected in the New and Old Worlds, respectively, these are probably recent introductions either as a result of spread of the B biotype of the B. tabaci

111

whitefly vector (reviewed by Czosnek & Laterrot, 1997; Polston et al., 1999) or the direct importation of infected plants (Brown et al., 2001; Lyttle & Guy, 2004).

Therefore, CoYVV appears to be the first indigenous begomovirus identified from the Old World with closer similarity to New World begomoviruses. Rybicki (1994) suggested that New World viruses may have evolved from Old World viruses after continental separation from Gondwana, possibly as a result of whitefly transmission of ancestral Old World viruses to the New World. Rybicki (1994) also suggested that the absence of the AV2 ORF from all New World bipartite geminiviruses could be explained by its early loss after arrival in the New World and the subsequent evolution of AV2-deficient New World viruses. The occurrence of CoYVV in

Vietnam strongly suggests that New World and Old World viruses have been present together in this region for some considerable time. It also suggests that the common ancestor of New World viruses originated in the Old World and that both the New

World and Old World begomoviruses had evolved prior to continental separation. It is possible that CoYVV may be a remnant from the population of New World begomoviruses that previously existed in the Old World. Alternatively, the begomoviruses may have evolved in the Old World, and a progenitor of the current

New World begomoviruses moved to the New World by unknown means. Although it is possible that whiteflies transmitted a CoYVV-like virus to the Americas, it is tempting to speculate that Asian ancestors of American Indians (for discussion see http://www.hrw.com/science/si-science/biology/evolution/origin/origin.html) or very early Chinese traders may have moved the virus(es) to the New World.

Vietnam appears to be a major centre for plant virus diversity. In previous studies, we have shown that sequence variability of one genome component of the ssDNA

112

Banana bunchy top virus (BBTV) in Vietnam was almost double that observed elsewhere in the world (Bell et al., 2002). High levels of sequence variability were also observed in the ssRNA potyvirus, Papaya ringspot virus (PRSV; Bateson et al.,

2002). We have also previously identified two begomoviruses infecting Vietnamese cucurbits with CP genes that appear to have a recombinant origin (SLCCNV and

LYMV; Revill et al., 2003). The discovery of CoYVV further emphasizes the degree of virus diversity present in Vietnam. We are currently characterizing geminiviruses and associated ssDNA molecules infecting a large range of crops and weeds in

Vietnam, to determine whether additional viruses similar to CoYVV are present and provide us with further insights into begomovirus evolution.

ACKNOWLEDGEMENTS

This work was funded by the Australian Centre for International Agricultural

Research (ACIAR) and the Australian Research Council. The authors thank Brett

Williams for assistance with the construction of plasmids for the in vitro replication studies and Jennifer Kleidon for maintenance of the NT1 cell lines.

113

REFERENCES

Arguello-Astorga, G. R., Guevara-Gonzalez, R. G., Herrera-Estrella, L. R. &

Rivera-Bustamante, R. F. (1994). Geminivirus replication origins have a group- specific organization of iterative elements: a model for replication. Virology 203, 90-

100.

Bateson, M. F., Lines, R. E., Revill, P., Chaleeprom, W., Ha, C. V., Gibbs, A. J.

& Dale, J. L. (2002). On the evolution and molecular epidemiology of the potyvirus

Papaya ringspot virus. J Gen Virol 83, 2575-2585.

Bell, K. E., Dale, J. L., Ha, C. V., Vu, M. T. & Revill, P. A. (2002).

Characterisation of Rep-encoding components associated with banana bunchy top nanovirus in Vietnam. Arch Virol 147, 695-707.

Brown, J. K., Idris, A. M., Torres-Jerez, I., Banks, G. K. & Wyatt, S. D. (2001).

The core region of the coat protein gene is highly useful for establishing the provisional identification and classification of begomoviruses. Arch Virol 146, 1581-

1598.

Chakraborty, S., Pandey, P. K., Banerjee, M. K., Kalloo, G. & Fauquet, C. M.

(2003). Tomato leaf curl Gujarat virus, a new Begomovirus species causing a severe leaf curl disease of tomato in Varanasi, India. Phytopathology 93, 1485-1495.

114

Czosnek, H. & Laterrot, H. (1997). A worldwide survey of tomato yellow leaf curl viruses. Arch Virol 142, 1391-1406.

Dugdale, B., Beetham, P. R., Becker, D. K., Harding, R. M. & Dale, J. L. (1998).

Promoter activity associated with the intergenic regions of banana bunchy top virus

DNA-1 to –6 in transgenic tobacco and banana cells. J Gen Virol 79, 2301-2311.

Fontes, E. P., Gladfelter, H. J., Schaffer, R. L., Petty, I. T. & Hanley-Bowdoin,

L. (1994). Geminivirus replication origins have a modular organization. Plant Cell 6,

405-416.

Hanley-Bowdoin, L., Settlage, S. B., Orozco, B. M., Nagar, S. & Robertson, D.

(1999). Geminiviruses: models for plant DNA replication, transcription, and cell cycle regulation. Crit Rev Pl Sci 18, 71-106.

Harrison, B. D., Swanson, M. M. & Fargette, D. (2002). Begomovirus coat protein: serology, variation and functions. Physiol Mol Pl Path 60, 257-271.

Idris, A. M. & Brown, J. K. (2004). Cotton leaf crumple virus is a distinct Western

Hemisphere begomovirus species with complex evolutionary relationships indicative of recombination and reassortment. Phytopathology 94, 1068-1074.

115

Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S.G., Schell, J. &

Gronenborn, B. (1995). In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus. Proc

Natl Acad Sci U S A 92, 3879-3883.

Lyttle, D. J. & Guy, P. L. (2004). First record of geminiviruses in New Zealand:

Abutilon mosaic virus and Honeysuckle yellow vein virus. Aust Plant Pathol 33, 321-

322.

Orozco, B. M., Gladfelter, H. J., Settlage, S. B., Eagle, P. A., Gentry, R. N. &

Hanley-Bowdoin, L. (1998). Multiple cis elements contribute to geminivirus origin function. Virology 242, 346-356.

Padidam, M., Sawyer, S. & Fauquet, C. M. (1999). Possible emergence of new geminiviruses by frequent recombination. Virology 265, 218-224.

Page, R. D. (1996). TREEVIEW: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12, 357-358.

Paximadis, M., Idris, A. M., Torres-Jerez, I., Villarreal, A., Rey, M. E. &

Brown, J. K. (1999). Characterization of tobacco geminiviruses in the Old and New

World. Arch Virol 144, 703-717.

116

Polston, J. E., McGovern, R. J. & Brown, L. G. (1999). Introduction of tomato yellow leaf curl virus in Florida and implications for the spread of this and other geminiviruses of tomato. Plant Disease 83, 984-988.

Revill, P. A., Ha, C. V., Porchun, S. C., Vu, M. T. & Dale, J. L. (2003). The complete nucleotide sequence of two distinct geminiviruses infecting cucurbits in

Vietnam. Arch Virol 148, 1523-1541.

Rojas, M. R., Gilbertson, R. L., Russell, D. R. & Maxwell, D. P. (1993). Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant Disease 77, 340-347.

Rybicki, E. P. (1994). A phylogenetic and evolutionary justification for three genera of Geminiviridae. Arch Virol 139, 49-77.

Stanley, J. (1995). Analysis of African cassava mosaic virus recombinants suggests strand nicking occurs within the conserved nonanucleotide motif during the initiation of rolling circle DNA replication. Virology 206, 707-712.

Stanley, J., Bisaro, D. M., Briddon, R. W., Brown, J. K., Fauquet, C. M.,

Harrison, B. D., Rybicki, E. P. & Stenger, D. C. (2005). Geminiviridae. In: Virus

Taxonomy. VIIIth Report of the International Committee on Taxonomy of Viruses.

(C. M. Fauquet, M. A Mayo, J. Maniloff, U. Desselberger and L. A. Ball, eds) 301-

326, Elsevier/Academic Press, London.

117

Stewart, C. N. & Via, L. E. (1993). A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications. BioTechniques 14, 748-751.

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G.

(1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 4876-

4882.

Wyatt, S. D. & Brown, J. K. (1996). Detection of subgroup III geminivirus isolates in leaf extracts by degenerate primers and polymerase chain reaction.

Phytopathology 86, 1288-1293.

118 CHAPTER 4

Molecular characterization of begomoviruses and DNA satellites from Vietnam - additional evidence that the New World geminiviruses were present in the Old World prior to continental separation

Cuong Ha1,2, Steven Coombs1, Peter Revill1,*, Rob Harding1, Man Vu2

and James Dale1

1Tropical Crops and Biocommodities Domain, Institute of Health and Biomedical

Innovation, Queensland University of Technology, Brisbane, 4001, Australia.

2Department of Plant Pathology, Hanoi Agriculture University, Gialam, Hanoi,

Vietnam.

*Current address: Victorian Infectious Diseases Reference Laboratory, 10 Wreckyn

St, Nth Melbourne, Victoria, 3051, Australia.

This paper has been accepted for publication in Journal of General Virology.

The formatting and presentation style within this chapter are consistent with Journal

of General Virology

119

STATEMENT OF JOINT AUTHORSHIP

Cuong Ha:

Executed the work (collected plant samples, designed and conducted all laboratory experiments, analysed and interpreted data) and wrote initial manuscript.

Steven Coombs:

Provided initial alignments of geminivirus sequences for design of degenerate primers.

Peter Revill:

Conceived project idea, collected plant samples, supervised the work, critically interpreted data and significantly contributed to final manuscript.

Rob Harding:

Conceived project idea, collected plant samples, supervised the work, critically interpreted data and contributed to final manuscript.

Man Vu:

Conceived project idea and collected samples.

James Dale:

Conceived project idea, collected plant samples, supervised the work, critically interpreted data, contributed to final manuscript.

120 CHAPTER 5

Design and application of two novel degenerate primer pairs for the detection and complete genomic characterization of potyviruses

C. Ha1,2, S. Coombs1, P.A. Revill1,*, R.M. Harding1, M. Vu2 and J.L Dale1

1Tropical Crops and Biocommodities Domain, Institute of Health and Biomedical Innovation, Queensland University of Technology, Brisbane, 4001, Australia.

2Department of Plant Pathology, Hanoi Agriculture University, Gialam, Hanoi, Vietnam.

*Current address: Victorian Infectious Diseases Reference Laboratory, 10 Wreckyn St, Nth Melbourne, Victoria, 3051, Australia.

This paper has been accepted for publication in Archives of Virology

The formatting and presentation style within this chapter are consistent with Archives

of Virology

169

Summary. Two pairs of degenerate primers were designed from sequences within the potyviral CI (CIFor/CIRev) and HC-Pro-coding regions (HPFo/HPRev) and these were shown to be highly specific to members of the genus Potyvirus. Using the

CIFor and CIRev primers, three novel potyviruses infecting crop and weed species from Vietnam were detected, namely Telosma mosaic virus (TelMV) infecting telosma (Telosma cordata, Asclepiadaceae), Peace lily mosaic virus (PeLMV) infecting peace lily (Spathiphyllum patinii, Araceae) and Wild tomato mosaic virus

(WTMV) infecting wild tomato (Solanum torvum, Solanaceae). The fragments amplified by the two sets of primers enabled additional PCR and complete genomic sequencing of these viruses and a Banana bract mosaic virus (BBrMV) isolate from the Philippines. All four viruses shared genomic features typical of potyviruses.

Sequence comparisons and phylogenetic analyses indicated that WTMV was most closely related to Chilli veinal mottle virus (ChiVMV) and Pepper veinal mottle virus (PVMV) while PeLMV, TelMV and BBrMV were related to different extents with members of the Bean common mosaic virus (BCMV) subgroup.

The GenBank accession numbers of the sequences reported in this manuscript are:

DQ851493 (TelMV), DQ851494 (PeLMV), DQ851495 (WTMV) and DQ851496

(BBrMV)

170 Introduction

The Potyviridae is the largest family of positive-sense, single-stranded RNA

(ssRNA) plant viruses currently recognized. Based on their transmission vectors and genomic characteristics, the members of the family are classified into six genera,

Potyvirus, Ipomovirus, Macluravirus, Tritimovirus, Bymovirus and Rymovirus, the largest of which is the genus Potyvirus [5].

Members of the Potyvirus genus have particles at least 700 nm in length which encapsidate a monopartite ssRNA genome ~ 10 kb in length. The genome is characterized by a 5’untranslated region (5’ UTR) which is linked to a terminal, genome-linked protein (VPg), a single major open reading frame (ORF) and a 3’

UTR region terminating in a polyadenylated (polyA) tail. The ORF encodes a single large polyprotein that is co-translationally processed into ten functional proteins [1]; namely, the first protein (P1), helper component protease (HC-Pro), third protein

(P3), 6K1, cylindrical inclusion protein (CI), 6K2, small nuclear inclusion protein

(NIa; including the VPg and protease (NIa-Pro) domains), large nuclear inclusion protein (NIb; replicase) and coat protein (CP) [26]. Members of the Potyvirus genus are transmitted by aphids in a non-persistent manner and infect a wide range of both monocotyledonous and dicotyledonous plants [26].

PCR-based methods for the detection and identification of potyviruses are primarily based on the use of degenerate primers to conserved sequences in the viral genomes. The vast majority of these primers have been designed to sequences at the

3’ end of the genome, such as the CP and NIb-coding regions [3, 4, 7, 8, 11, 12, 14,

171 18, 22, 34]. In particular, primers corresponding to the GNNS motif in the NIb- coding region are specific for members of the entire family Potyviridae [7, 11, 12].

The use of degenerate primers has not only facilitated the rapid detection of many potyviruses, but has also enabled partial genomic sequencing for taxonomic purposes. Recently however, the accuracy of taxonomic classifications based on the analysis of the 3’ sequences, particularly those derived from the CP, has been questioned [2]. Adams et al. [2] suggested that the most accurate molecular criterion for genus and species discrimination within the family Potyviridae was the phylogenetic analysis of the nucleotide sequences of the entire ORF. Further, comparisons using the CI-coding region most accurately reflected those for the complete ORF and this region was deemed to be the most suitable for diagnostic and taxonomy purposes if the complete sequence could not be obtained.

Complete potyvirus genome sequences have typically been obtained by constructing viral cDNA libraries [13, 23] or, more recently, by primer walking in which regions of the genome are amplified in overlapping fragments using degenerate primers designed on conserved genomic regions [29, 33]. However, due to the large size of the potyviral genome and the absence of highly conserved sequences in many coding regions, the number of fully sequenced potyviruses (45 by

2005, http://www.ncbi.nlm.nih.gov) is small in comparison to the number of recognized species (197 in 2005, [5]). In this paper, we describe the development of two alternative sets of degenerate PCR primers to amplify sequences from the 5’

(HC-Pro) and central (CI) regions of potyviral genomes that can be used as diagnostic tools. Further, we demonstrate the utility of these primers to facilitate additional amplification and sequencing of the complete genomes of three previously

172 uncharacterized potyviruses from Vietnam and Banana bract mosaic virus (BBrMV) from the Philippines.

Materials and methods

Virus isolates

Leaf samples showing characteristic symptoms of virus infection including puckering, mottling, mosaic and stunting were collected from a range of crops and weeds during field surveys across Vietnam in 2000/1 and 2004. Samples were dried under silica gel and stored at room temperature until use. In addition, samples known to be infected with the potyviruses, Johnsongrass mosaic virus (JGMV), Lily mottle virus (LMoV) and Potato virus Y (PVY) from Australia and BBrMV from the

Philippines were stored at –80oC and used as positive controls to test the specificity of the degenerate primers.

Design of primers

All primers used in this study are shown in Table 1. The CI-specific primers, CIFor and CIRev, were designed based on the alignment of 56 complete sequences

(available in 2003) from isolates representing 22 potyviruses, one bymovirus, one rymovirus and one tritimovirus. The HC-Pro-specific primers, HPFor and HPRev, and NIb gene-specific primer, NIbFor1, were designed based on the alignment of

149 complete sequences of 38 potyviruses (available in 2005).

RT-PCR

Total RNA was extracted from dried (~20 mg) or frozen (~100 mg) leaf tissue using an RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions. For

173

174 Table 1. Primers used for the detection and cloning of potyvirus genomes Conserved Primer Sequence* (5’ – 3’) motif† or Use position

Potyvirus-specific CIFor GGIVVIGTIGGIWSIGGIAARTCIAC GxVGSGKST Potyvirus CI gene specific primer CIRev‡ ACICCRTTYTCDATDATRTTIGTIGC ATNIIENGV Potyvirus CI gene specific primer HPFor TGYGAYAAYCARYTIGAYIIIAAYG CDNQLDxN Potyvirus HC-Pro gene specific primer HPRev GAICCRWAIGARTCIAIIACRTG HVxDSY/FGS Potyvirus HC-Pro gene specific primer NIbFor1 GGICARCCITCIACIGTIGT GQPSTVV Potyvirus NIb gene specific primer PV2IT7§ TAATACGACTCACTATAGGGIAAYAAYAGYGGICARCC GNNSGQP Potyvirus NIb gene specific primer 5' end

Anchor25dT GTACTGAACCTGCGTGACAGTCGTC(T)25V 5’RACE second-strand primer

Anchor17T2A|| GTACTGAACCTGCGTGACAGTCGTC(T)17AA 5’RACE second-strand primer Anchor GTACTGAACCTGCGTGACAGTCGTCT 5’RACE PCR primer, general Anchor2 GTACTGAACCTGCGTGACAGTCGTC 5’RACE PCR primer, general 3' end

N1T GACCACGCGTATCGATGTCGAC(T)17V General 3’end first-strand primer N1 GACCACGCGTATCGATGTCGAC General 3’end PCR primer TelMV-specific TelMVHPFor GAGGCACCTGGTAGTTGGTGCATCAG 2072 - 2097 TelMV major gap 1 PCR primer, TelMVHPRev CTGATGCACCAACTACCAGGTGCCTC 2072 - 2097 TelMV 5’RACE PCR primer TelMVCIFor CACAGCACCCAGTCAAACTCAAGGTAG 4351 - 4377 TelMV major gap 2 PCR primer TelMVCIRev CTACCTTGAGTTTGACTGGGTGCTGTG 4351 - 4377 TelMV major gap 1 PCR primer TelMVNIbRev GCACAAATAGCCTCTGTCCTGTGCATG 8348 - 8374 TelMV major gap 2 PCR primer PelMV-specific PelMVHPFor CTTCGTGTATCCATGTTGTTGCGTGAC 1961 - 1987 PelMV major gap 1 PCR primer PelMVHPRev GTCACGCAACAACATGGATACACGAAG 1961 - 1987 PelMV 5’RACE-PCR primer PelMVCIFor CAGCAACTCCACCTGGAAAAGAGTGTG 4270 - 4296 PelMV major gap 2 PCR primer PelMVCIRev CACACTCTTTTCCAGGTGGAGTTGCTG 4270 - 4296 PelMV major gap 1 PCR primer PelMVNIbRev TCCTGGTATTCAATCCCTCTGTGTGAC 8213 - 8239 PelMV major gap 2 PCR primer WTMV- specific WTMVHPFor GACGATGGTACTCCTTTGCTCTCAGAG 1919 - 1945 WTMV major gap 1 PCR primer WTMVHPRev CTCTGAGAGCAAAGGAGTACCATCGTC 1919 - 1945 WTMV 5’RACE-PCR primer WTMVCIFor GAACTATGAAATCAGGAGCAACCGAGA 4446 - 4472 WTMV major gap 2 PCR primer WTMVCIRev TCTCGGTTGCTCCTGATTTCATAGTTC 4446 - 4472 WTMV major gap 1 PCR primer WTMVNIbRev CCATGTGTTGTGTGGTTTGACAGCTAC 8057 - 8083 WTMV major gap 2 PCR primer BBrMV-specific BBrMVHPFor CACAGTATCGAAGCCCATCTGCAAGAC 2026 - 2052 BBrMV major gap1 PCR primer BBrMVHPRev GTCTTGCAGATGGGCTTCGATACTGTG 2026 - 2052 BBrMV 5’RACE first-strand primer BBrMVHPRev1 TGGTGAGAGGTTCCCTCTGTATCG 1921 - 1944 BBrMV 5’RACE-PCR primer BBrMVCIFor GCTTCAGCAATGGCGTTCTATTGTCTAC 4224 - 4251 BBrMV major gap 2 PCR primer BBrMVCIRev GTAGACAATAGAACGCCATTGCTGAAGC 4224 - 4251 BBrMV major gap 1 PCR primer BBrMVNIbRev TTCCTGCAGTTTGTCAAGTGTACAAGC 8130 - 8156 BBrMV major gap 2 PCR primer

* In the primer sequences, I = inosine, Y = C/T, R = G/A, W = A/T, V = A/C/G, S = C/G and D = A/G/T † x in the conserved motifs = any amino acid ‡ CIRev was also used as 5’RACE first-strand primer § PV2IT7 is from Mackenzie et al. [19] || Anchor17T2A contains two 3’ terminal adenosine residues exploiting the fact that the 5’ end of potyviral genomes contains several A residues

175 176 use as a general potyvirus diagnostic test, RNA (1µL) was used directly for RT-PCR using a Titan One Tube RT-PCR System (Roche) in a final reaction volume of 25 µL containing 0.2 mM each dNTP, 20 pmoles of each degenerate primer, 5 mM DTT, 5

U RNase Inhibitor and 0.5 µL of Titan Enzyme mix. The reactions were incubated at

42 ○C for 30 min, 94 ○C for 3 min, followed by 40 cycles of 94 ○C for 30 s, 40 ○C for

30 s and 68 ○C for 1 min, and a final incubation for 5 min at 68 ○C. Initially, the degenerate primers were used to amplify the partial HC-Pro, CI and 3’ end fragments. Virus-specific primers (Table 1) were subsequently designed from the cloned sequences to amplify the intervening sequences and 5’ end fragments.

Amplification of 3’ ends

RNA extract (10 µL) was used to synthesize first-strand cDNA using primer N1T and SuperScript™ III Reverse Transcriptase (Invitrogen) as recommended by the manufacturer. The cDNAs were used as templates to amplify the 3’ end fragments

(of TeLMV, PeLMV and WTMV) in a 25 µL reaction containing 0.4 mM each dNTP, 20 pmoles of primer NIbFor1, 10 pmoles of primer N1 and 0.5 µL of Taq

(Roche). The reactions were incubated at 94 ○C for 4 min, followed by 35 cycles of

94 ○C for 30 s, 50 ○C for 30 s and 72 ○C for 90 s, terminating with 10 min at 72 ○C.

In the case of BBrMV, the 3’ end fragment was amplified directly from the RNA extract (1µL) using a Titan One Tube RT-PCR System (Roche) in a final reaction volume of 25 µL containing 0.4 mM each dNTP, 20 pmoles of each primer PV2IT7 and N1T, 5 mM DTT, 5 U RNase Inhibitor, 2.5 mM MgCl2 and 0.5 µL of Titan

Enzyme mix. The reactions were incubated at 45 ○C for 30 min, 94 ○C for 3 min, followed by 35 cycles of 94 ○C for 30 s, 54 ○C for 40 s and 68 ○C for 2 min, terminating with 5 min at 68 ○C.

177 Amplification of intervening sequences

The intervening sequences between the HC-Pro and CI fragments (~2.5 kb) and between the CI and 3’ end fragments (~3.5 kb) of each genome were amplified using specific primers designed from the HC-Pro, CI and 3’ end fragments (Table 1). The reactions were done using either the Titan One Tube RT-PCR System with RNA extracts as template or using the Expand Long Template PCR System (Roche) and

N1T-primed cDNA as template.

Amplification of 5’ ends

The 5’ end (~ 2 kb) fragments were amplified using 5’ Rapid Amplification of cDNA

Ends (5’ RACE) [10]. RNA extract (23 µL) was used to synthesize the first-strand cDNA using SuperScript™ III Reverse Transcriptase (Invitrogen) as recommended by the manufacturer. The first-strand primers were CIRev (for TeLMV, PeLMV and

WTMV) and BBrMVHPRev (for BBrMV). The cDNAs were treated with RNase A and H (Invitrogen) as recommended by the manufacturer and purified directly using a High Pure PCR Product Purification Kit (Roche). The purified cDNAs were dA- tailed at 37 ○C for 25 min in a 10 µL reaction containing 7 µL cDNA, 1 µL Taq 10x

PCR buffer (Roche), 2 pmoles dATP and 100 U terminal transferase (Roche). The dA-tailed cDNAs were used as template for the single tube, two-step 5’RACE reactions. In step 1 (second-strand synthesis), the 25 µL reaction mixtures, containing 2 µL of dA-tailed cDNA, 0.35-0.5 mM each dNTP, 10 pmoles primer

Anchor25dT or 5 pmoles primer Anchor17T2A and 0.5 µL of Enzyme mix (Expand

Long Template PCR System), were incubated at 94 ○C for 2-3 min, 45-50 ○C for 5-

10 min and 68 ○C for 5 min. For step 2 (amplification), 10 pmoles of each virus- specific 5’RACE-PCR primer and Anchor or Anchor2 primer were added to the tube and incubated under the following conditions: 94 ○C for 3 min, followed by 40

178 cycles of 94 ○C for 30 s, 54 ○C for 45 s and 68 ○C for 90 s, terminating with 7 min at

68 ○C.

Cloning and sequencing

Amplicons were purified from agarose gels using a High Pure PCR Product

Purification Kit (Roche), ligated into the plasmid vector pGEM-T Easy (Promega) and transformed into E. coli XL1-Blue competent cells (Stratagene) as recommended by the manufacturers. Putative recombinant plasmids were purified with a Wizard

Miniprep Kit (Promega) and inserts were verified by restriction enzyme digestion.

Two independent clones of each amplicon were sequenced in both directions using the ABI Prism® BigDyeTM Terminator Kit (PE Applied Biosystem) and sent to the

Australia Genomic Research Facility (University of Queensland) for analysis.

Sequence analyses

The sequences were initially compared to known viral sequences using the BLAST program available at the National Centre for Biotechnology Information (NCBI)

(http://www.ncbi.nlm.nih.gov/BLAST/). ORFs were identified using Vector NTI

Suite7 program and sequences were aligned using ClustalX [30]. Overlapping sequences were assembled using SeqMan (DNASTAR, Madison, WI). Sequence identities were calculated from “Sequence Identity Matrix” option in BioEdit program version 7.05 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html).

Phylogenetic trees were constructed from the ClustalX-aligned sequences using

MEGA version 3.1 [17] using a Neighbor-Joining method and a Kimura 2-Parameter model for estimating the distances and conducting the bootstrap analysis (1000 replicates).

179 Results

Specificity of potyvirus degenerate primers

CI-coding region primers

Based on the alignment of 56 complete nucleotide sequences from viruses within the family Potyviridae, two degenerate primers, designated CIFor and CIRev, were designed to conserved sequences within the CI-coding region to amplify a ~700 bp product (Fig. 1). To evaluate their specificity, the primers were initially tested on

RNA extracted from leaves of several known potyvirus-infected samples, namely

JGMV, PVY and LMoV from Australia, PRSV from Vietnam and BBrMV from the

Philippines. In each case, a major product of the expected size (~700 bp) was amplified. Sequence analysis confirmed that all the amplicons were virus-specific and were ~680 nucleotides, with the exception of JGMV, which contained 42 additional nucleotides located immediately upstream of the CIRev primer sequence.

RNA was subsequently extracted from various samples that had been collected during virus surveys in Vietnam and which were showing virus-like symptoms. The

CIFor and CIRev primers amplified a band of ~700 bp from numerous plant samples including Chinese radish, leek, sweet potato, bean, sugarcane, taro, chilli pepper, pumpkin and shallot. Sequence analysis of the amplicons derived from these samples showed high identity to sequences of Turnip mosaic virus (TuMV), Leek yellow stripe virus (LYSV), Sweet potato feathery mottle virus (SPFMV), Bean common mosaic virus (BCMV), Sugarcane mosaic virus (SCMV), Sorghum mosaic virus

(SrMV), Dasheen mosaic virus (DsMV), Chilli veinal mottle virus (ChiVMV),

180

5’ UTR 3’ UTR P1 HC-Pro P3 6K1 CI 6K2 VPg NIa-Pro NIb CP An

HC-Pro CI 3’end (~ 0.7 kb) (~ 0.7 kb) (~ 1.7 kb)

HPFor HPRev CIFor CIRev PV2IT7 N1T NIbFor1 N1 5’end Intervening sequence 2 (~ 2 kb) (~ 3.5 kb)

Anchor25dT Virus 5’RACE Virus major gap 2 Virus major gap 2 Ancho17T2A PCR primers PCR primers PCR primers Anchor Anchor2 Intervening sequence 1 (~ 2.5 kb)

Virus major gap 1 Virus major gap 1 PCR primers PCR primers

Fig. 1. Relative position of the primers and the strategy to amplify and sequence the complete potyvirus genome.

181 182 Zucchini yellow mosaic virus (ZYMV) and Shallot yellow stripe virus (SYSV), respectively.

Samples were also collected from Telosma cordata, a fragrant climber whose edible flowers are used as a vegetable and for medicinal purposes, Peace lily

(Spathiphylum patinii), a popular ornamental, and wild tomato (Solanum torvum), all of which were showing mosaic symptoms. A band of ~700 bp was also amplified from these samples, however, sequence analysis indicated that these plants were infected by three different, as yet uncharacterized, potyviruses.

HC-Pro-coding region primers

Based on the alignment of 149 complete nucleotide sequences from viruses within the genus Potyvirus, degenerate primers HPFor and HPRev were designed to amplify a ~700 bp fragment within the HC-Pro-coding region (Fig. 1). Using the same RNA extracts as above, products of the expected size were amplified from the known potyvirus-infected samples as well as from the samples which previously tested positive using the CIFor and CIRev primers. Sequence analysis again confirmed that these products were virus-specific. Consistent with previous results, a ~700 bp product was also amplified from the peace lily, telosma and wild tomato samples with sequence analysis confirming the presence of three, as yet uncharacterized, potyviruses.

183 Molecular characterization of the three novel potyviruses and BBrMV

Amplification and sequencing of the complete genomes

A PCR-based strategy, utilising the new degenerate primer pairs, was devised to amplify the entire genome of potyviruses. This strategy involved the initial amplification of the 5’ and central regions of the potyvirus genome using the

HPFor/HPRev and CIFor/CIRev primers, and subsequent PCR using virus-specific primers to amplify the intervening sequences and 3’ end of the genome. 5’ RACE was used to amplify the 5’ terminal sequence (Fig. 1). This strategy was used to obtain the entire genomic sequences of a partially characterized BBrMV isolate from the Philippines and the three uncharacterized potyviruses infecting telosma (Hanoi isolate), peace lily (Haiphong isolate) and wild tomato (Laichau isolate) from

Vietnam. The three potyviruses from Vietnam were named Telosma mosaic virus

(TelMV), Peace lily mosaic virus (PeLMV) and Wild tomato mosaic virus (WTMV), based on their natural host and symptoms.

Genome organization and analysis of conserved motifs

Based on genome size and organization, and the presence of conserved sequence motifs, all four viruses were typical potyviruses (Fig. 2). The genomes comprised

9689 nt (TelMV), 9882 nt (PeLMV), 9659 nt (WTMV) and 9711 nt (BBrMV), excluding polyA tails but including the 5’ and 3’UTRs which comprised 188/255

(TelMV), 179/466 (PeLMV), 136/298 (WTMV) and 128/208 nt (BBrMV), respectively. The 5’UTRs of all four viruses were A/T rich, ranging from 60.2%

(BBrMV) to 70.6% (WTMV), and typical of other potyviruses, terminated in several

184

TelMV PeLMV WTMV BBrMV Complete genome Length (nt) 9689 9882 9659 9711 3’UTR Length (nt) 255 466 298 208 5’UTR Length (nt) 188 179 136 128 % A+T 67.0 66.5 70.6 60.2 Potybox a (11) AACTCGAAAAGACAATTA (11) AACTCAATACAACATATG (11) AACTACAAAACACATACA (10) ATCTCAGCAAGACATTCA Potybox b (54) TTCTCAAGCAAAC (35) CGATCAAGCAATC (55)TTCTCGAGCATTC (42) ACCTTACGCAACT

“Context” of the initiation code AGCATGGCA GAAATGGCA GCAATGGCA CAAATGGCG

Polyprotein Length (aa) 3082 3079 3075 3125 P1 Length (aa) 317 309 298 329

Catalytic triad H-X8-E-X29-GDSG H-X8-E-X30-GWSG H-X8-D-X31-GDSG H-X8-E-X30-GWSG HC-Pro Length (aa) 457 456 457 457

Catalytic sites GYCY-X71-H GYCY-X71-H GYCY-X71-H GYCY-X71-H Aphid transmission KLSC KLTC RITC RISC Aphid transmission PTK PTK PTK PSA RNA amplification IKS IGN IGN IGR Systemic movement CCC CCC CC CCC P3 Length (aa) 347 344 347 347 6K1 Length (aa) 52 52 54 52 CI Length (aa) 634 634 644 634 Motif I LVRGAVGSGKSTGLP LVRGAVGSGKSTGLP LIRGAVGSGKSTGLP LIRGAVGSGKSTGLP Motif II YIIIDECH YIIIDECH FIMFDECH FIILDECH Motif V FIVATNIIENGVTLDVDCVVD FVVATNIIENGVTLDIDVVVD FIVATNIIENGVTIDIDAVVD FVVATNIIENGVTLDIDVVVD Motif VI SYGERIQRLGRVGR NYGERLQRLGRVGR NYGERIQRLGRVGR GFGERVQRLGRVGR 6K2 Length (aa) 53 52 53 53 VPg Length (aa) 190 190 191 190 Viral RNA attachment HMYG HMYG NMYG NMYG NIa Length (aa) 243 246 242 243

Catalytic sites H-X34-D-X67-GFCG-X14-H H-X34-D-X67-GDCG-X14-H H-X34-D-X67-GHCG-X14-H H-X34-D-X67-GDCG-X14-H NIb Length (aa) 517 516 519 520 RdRP GDD GDD GDD GDD CP Length (aa) 272 280 270 300 Aphid transmission and movement DAG DAG DAG DAG

Encapsidation LRQ-X41-FDF FRQ-X41-FDF FRQ-X41-FDF FRQ-X41-FDF

Fig. 2. Sizes and the important functional motifs of TelMV, PeLMV, WTMV and BBrMV. The “potybox a and -b”-like sequences are underlined. The initiation codon ATG is in bold. See Adams et al. [1], Urcuqui- Inchima et al. [32] and Kadare & Haenni [15] for the functional motifs and their essential residues (boxed) in the genes.

185 186 A residues. The 5’UTRs also contained two potybox–like blocks which, in PeLMV, were identical to those previously reported (ACAACAT and TCAAGCA) [20, 29].

The genomes of TelMV, PeLMV, WTMV and BBrMV each encoded putative polyproteins of 3082, 3079, 3075 and 3125 amino acids, respectively. The first in- frame ATG codons of the four genomes were AGCATGG, GAAATGG,

GCAATGG and CAAATGG, respectively. The cleavage sites of the putative polyproteins (Fig. 3), predicted following the guidelines of Adams et al. [1], were similar to those reported for other potyviruses except that the D residue at the CI-

6K2 junction of PeLMV has not been reported in the same position for any other potyvirus.

Analysis of the putative amino acid sequences of all four viruses revealed the presence of many well characterized functional motifs (Fig. 2). Most of these motifs were highly conserved in comparison with other reported potyviruses with the exception that the T and K residues of the PTK motif in the HC-Pro-coding region of

BBrMV were replaced by S and A, respectively. These replacements were unexpected because this motif is identical in all potyviruses with fully sequenced genomes. The sequence was verified, however, by PCR using specific primers to amplify across this region.

Sequence comparisons

The nucleotide sequences of the entire genome and ORF of all four potyviruses were compared to other viral sequences using the BLAST program. These comparisons

187 188 TelMV YS318 GG775 QG1122 QS1174 QS1808 QG1861 ES2051 QS2294 QS2811 PeLMV YS310 GG766 QS1110 QS1162 QD1796 QG1848 EG2038 QS2284 QS2800 WTMV FS299 GG756 QA1103 QS1157 QS1801 QA1854 EA2045 QS2287 QS2806 BBrMV YS330 GG787 QS1134 QN1186 QN1820 EG1873 EG2063 QH2306 QS2826

5’UTR 3’UTR P1 HC-Pro P3 6K1 CI 6K2 VPg NIa NIb CP An

Fig. 3. The genome map of TelMV, PeLMV, WTMV and BBrMV. The position and dipeptide motif of the cleavage sites are indicated.

189 190 revealed that TeLMV, PeLMV, WTMV and BBrMV showed most similarity to

Soybean mosaic virus-G7 (SMV-G7)(66.2% genome, 67.4% ORF), Beet mosaic virus (BtMV) (61%, 63.3%), Chilli veinal mottle virus (ChiVMV) (65.7%, 66.5%) and BtMV (51%, 51.9%), respectively. However, when comparisons were made using all nucleotide sequence available on databases, TeLMV, PeLMV, WTMV and

BBrMV showed most similarity to Trycirtis virus (a putative potyvirus)(74.3% in the

CP-coding region), BtMV, Pepper veinal mottle virus (PVMV)(77.2% in the CP) and

BBrMV-P3 isolate (98.7% in the CP), respectively.

Phylogenetic analyses

To determine the relationship of the four viruses with other potyviruses, phylogenetic trees were constructed based on the nucleotide sequences of the entire genomes, ORF and CP-coding region. With the exception of BBrMV, the trees all had a similar topology. In analyses using either the entire nucleotide sequence (Fig. 4A) or that of the ORF (data not shown), WTMV always grouped with ChiVMV while PeLMV grouped tightly with BtMV, which was shown to be related to the members of the

BCMV subgroup. TelMV also branched within the BCMV subgroup while BBrMV formed a distinct branch that was distally, but basally, related to the BCMV subgroup and the cluster of PeLMV, BtMV and Peanut mottle virus (PeMoV).

In analyses based on the CP genes (Fig. 4B), the phylogenetic relationships of

TelMV, PeLMV and WTMV were similar to those described above. TelMV still grouped within the BCMV subgroup, PeLMV paired tightly with BtMV to form a branch that was related (but not well supported) to the BCMV subgroup while

191

192 (A) (B) 99 PVMV-AJ780968 99 PVMV-AJ780967 99 PVMV-AJ780966 98 TuMV PVMV-AJ780970 100 69 ScMV PVMV-AJ780969 68 99 76 JYMV WTMV 53 LMV ChiVMV 62 PPV JYMV LMoV PPV LMV 85 PRSV TuMV TFMV ScMV ClYVV 99 96 61 LYSV 100 BYMV TVMV TVMV PVA 64 LYSV TEV 93 TEV SPFMV 82 YMV TFMV SPFMV PVY PepMoV 82 PVA 99 WPMV PVY PLDMV 89 PTV subgroup WTMV 99 77 PVV 100 ChiVMV JGMV PVY 54 PLDMV PepMoV PRSV 100 PVY PTV subgroup PSbMV 100 WPMV 99 OYDV 100 SYSV 99 PVV BYMV PSbMV 99 ClYVV BBrMV 98 BBrMV 100 PeLMV 99 BBrMV-P3 69 BtMV BBrMV- AP1 100 PeMoV SCMV SCMV DsMV PenMV 100 99 MDMV subgroup ZYMV 70 100 SrMV CABMV 85 LMoV BCMV 100 CSV BCMNV 61 BCMV 72 YMV TelMV subgroup PeMoV EAPV 99 BtMV WVMV PeLMV 95 WMV DsMV 100 60 SMV-N ZYMV 100 95 CABMV 100 SMV-G7 EAPV CSV 60 Trycirtis potyvirus JGMV BCMV 100 BCMNV PenMV TelMV subgroup 99 SCMV SCMV BCMV 100 MDMV subgroup WVMV 100 95 SrMV WMV 98 SYSV SMV-G7 99 SMV-N 100 OYDV 99

0.05 0.05

Fig. 4. Neighbor–joining trees based on the nucleotide sequences of the complete genomes (A) and CP genes (B) of the four potyviruses from this study (dotted, underlined and in bold) and 43 fully sequenced species of the Potyvirus genus (with the CP sequences of Trycirtis potyvirus (AY864850), BBrMV (-[P3], AF071586 and –[AP1], AY953427) and Pepper veinal mottle virus (PVMV, AJ780966 – 70) added in B). The previously assigned subgroups are indicated (see Berger et al. [6], Shukla et al. [25] and Melgarejo et al. [20] for the BCMV, SCMV and PVY subgroups, respectively). The bootstrap values greater 50% (1000 replicates) are denoted. The full names and Acc. Numbers are: Bean common mosaic virus (BCMV, AJ312437); Bean common mosaic necrosis virus (BCMNV, U19287); Bean yellow mosaic virus (BYMV, D83749); Beet mosaic virus (BtMV, AY206394); Chili veinal mottle virus (ChiVMV, AJ237843); Clover yellow vein virus (ClYVV, AB011819); Cocksfoot streak virus (CSV, AF499738); Cowpea aphid-borne mosaic virus (CABMV, AF348210); Dasheen mosaic virus (DsMV, AJ298033); East Asian Passiflora virus (EAPV, AB246773); Johnsongrass mosaic virus (JGMV, Z26920); Leek yellow stripe virus (LYSV, AJ307057); Lettuce mosaic virus (LMV, X97705); Lily mottle virus (LMoV, AJ564636); Maize dwarf mosaic virus (MDMV, AJ001691); Onion yellow dwarf virus (OYDV, AJ510223) Papaya ringspot virus (PRSV, X67673); Pea seed-borne mosaic virus (PSbMV, D10930); Peanut mottle virus (PeMoV, AF023848); Pennisetum mosaic virus (PenMV, AY642590); Pepper mottle virus (PepMoV, M96425); Peru tomato mosaic virus (PTV, AJ437280); Plum pox virus (PPV, D13751); Potato virus A (PVA, AJ296311); Potato virus Y (PVY, X12456); Potato virus V (PVV, AJ243766); Scallion mosaic virus (ScMV, AJ316084); Shallot yellow stripe virus (SYSV, AJ865076); Sorghum mosaic virus (SrMV, AJ310197); Soybean mosaic virus (SMV-N, D00507; -G7, AY216010); Sugarcane mosaic virus (SCMV, AJ297628); Sweet potato feathery mottle virus (SPFMV, D86371); Thunberg fritillary virus (TFMV, AJ851866); Tobacco etch virus (TEV, M11458); Tobacco vein mottling virus (TVMV, X04083); Turnip mosaic virus (TuMV, AF169561); Watermelon mosaic virus (WMV, AY437609); Wild potato mosaic virus (WPMV, AJ437279); Wisteria vein mosaic virus (WVMV, AY656816); Yam mosaic virus (YMV, U42596); Zucchini yellow mosaic virus (ZYMV, AF127929); Japanese yam mosaic virus (JYMV, AB027007) and Papaya leaf distortion mosaic virus (PLDMV, BD171712).

193 194 WTMV formed a group with ChiVMV and PVMV that received strong bootsrap support. Unlike the trees based on the nucleotide sequence of the entire genome and

ORF, however, BBrMV was found to group with the SCMV subgroup. A similar result was also obtained in analyses based on the amino acid sequence of the CP- coding region (data not shown).

Discussion

In this study, we have designed two pairs of degenerate primers to detect potyviruses and used them in a PCR-based strategy to characterize the entire genomes of three novel potyviruses. The primers were shown to be highly specific for detection of viruses within the genus Potyvirus. The CIFor and CIRev primer sequences were based on the potyvirus motifs I and V, respectively [15]. Although these are highly conserved among all fully sequenced members of the genus Potyvirus, they are less conserved in members of the Rymovirus, Bymovirus, Ipomovirus and Tritimovirus genera. However, since four amino acids in motifs I and V (corresponding to 12 nucleotides at the 3’ end of each primer) were identical with those of the potyviruses, it is possible that these primers could also be used to detect rymoviruses, ipomoviruses and tritimoviruses. In contrast, the conserved motifs on which the

HPFor and HPRev primers were designed were absent from the published genome sequences of rymoviruses, ipomoviruses, bymoviruses and tritimoviruses.

The major advantage of these primers lies in their ability to amplify the central

(CI) and 5’ regions (HC-Pro) of the potyviral genome. As such, they can be easily used in combination with genome-specific primers to facilitate the characterization

195 of complete potyviral genomes. Additionally, Adams et al. [2] concluded that, in the absence of complete genomic sequence, overall sequence identities between potyviruses are most accurately reflected in the CI gene. The amplicon sequences derived using the CIFor/CIRev primer pair may enable the differentiation of potyviruses at the genus and species level. In pairwise analysis using 149 complete genomes representing 38 distinct potyviruses, identities based on the CIFor/CIRev- derived sequences were comparable with those using the entire CI-coding region

(data not shown). Indeed, the three new viruses identified in this study were initially predicted from the sequences of their CIFor/CIRev-derived amplicons.

Using the degenerate primers in combination with genome-specific primers, we characterized the complete genome of three potyviruses from Vietnam, tentatively named TelMV, PeLMV and WTMV, and BBrMV, a potyvirus infecting banana in the southeast Asian region for which only partial 3’ sequences were available [24].

Based on sequence comparisons, and according to the molecular criteria for discrimination of members within the family Potyviridae [2], TelMV, PeLMV and

WTMV are new species within the genus Potyvirus. TelMV, PeLMV, WTMV and

BBrMV all contained the genomic features typical of potyviruses. The first in-frame

ATG codons of TeLMV, PeLMV and WTMV were embedded in the plant optimal initiation contexts with a purine residue (A/G) at the -3 position and a G residue at the +4 position with respect to the A residue of the ATG codon (+1) [9, 27]. In the case of BBrMV, a pyrimidine residue (C) was present at the -3 position rather than a purine. However, the fact that the first few amino acids translated from this putative

BBrMV start codon were highly conserved when compared with those from many other potyviruses, suggests that the first in-frame ATG triplet in this viral genome is

196 the correct initiation codon. One unusual feature of the genome of PeLMV was the occurrence of a D residue at the P1’ position at the CI-6K2 junction of PeLMV.

Although a Q/D cleavage motif has not been reported for any other potyviruses at this position, the cutting motif, DTVQYQ/DKK (corresponding to the modelled common pattern P6P5P4P3P2P1/P1’P2’P3’), is conserved among potyviruses, particularly for the residues V (P4), Q (P1) and K (P2’) [1]. It has also been shown that many amino acids (including D) can be tolerated at the P’ position [16]. Indeed, a D residue at this position is present at the P3-6K1 junction of Peru tomato virus

[28] and Wild potato mosaic virus [29].

The sequence comparisons and phylogenetic analyses showed TeLMV, PeLMV were related to members of the BCMV subgroup that includes several different viruses infecting both monocots and dicots, legume and non-legume plants [6]. This relatedness was also supported by the presence of an E residue, rather than a D residue, in the P1 catalytic triad (H-E-S) of all three viruses [1]. In contrast, BBrMV was not related to other viruses; a reflection of the low identities of the BBrMV CP- coding region, at both the nucleotide and amino acid levels. This finding is consistent with the results of Adams et al. [2] who reported that, using phylogenetic analyses based on the CP-coding region of 89 viruses in the genus Potyvirus, only 20 species received bootstrap values greater than 75%. Further, the use of the entire ORF sequences for analyses provided stronger bootstrap support and much clearer relationships [2].

Using the degenerate primers described in this study, we have detected numerous novel and previously characterized potyviruses infecting plants in Vietnam. In

197 addition to the three newly described viruses, ten viruses, namely TuMV, LYSV,

SPFMV, SCMV, SrMV, DsMV, ChiVMV, ZYMV, SYSV and PVY, were identified in Vietnam for the first time. The use of these primers should expedite the molecular characterization of this important group of viruses.

Acknowledgements

The authors thank the Australian Centre for International Agricultural Research

(ACIAR) for funding this research. HC was supported by a QUT International

Postgraduate Research Scholarship.

References

1. Adams MJ, Antoniw JF, Beaudoin F (2005) Overview and analysis of the

polyprotein cleavage sites in the family Potyviridae. Mol Plant Pathol 6: 471-487

2. Adams MJ, Antoniw JF, Fauquet CM (2005) Molecular criteria for genus and

species discrimination within the family Potyviridae. Arch Virol 150: 459-479

3. Bateson MF, Dale JL (1995) Banana bract mosaic virus - characterization using

potyvirus specific degenerate PCR primers. Arch Virol 140: 515-527

4. Bateson MF, Lines RE, Revill P, Chaleeprom W, Ha CV, Gibbs AJ, Dale JL

(2002) On the evolution and molecular epidemiology of the potyvirus Papaya

ringspot virus. J Gen Virol 83: 2575-2585

198 5. Berger PH, Adams MJ, Barnett OW, Brunt AA, Hammond J, Hill JH, Jordan RL,

Kashiwazaki S, Rybicki E, Spence N, Stenger DC, Ohki ST, Uyeda I, van Jaayen

A, Valkonen J, Vetten HJ (2005) Potyviridae. In: Fauquet CM, Mayo MA,

Maniloff J, Desselberger U and Ball LA (eds) Virus Taxonomy. VIIIth Report of

the International Committee on Taxonomy of Viruses. Elsevier/Academic Press,

London

6. Berger PH, Wyatt SD, Shiel PJ, Silbernagel MJ, Druffel K, Mink GI (1997)

Phylogenetic analysis of the Potyviridae with emphasis on legume-infecting

potyviruses. Arch Virol 142: 1979-1999

7. Chen J, Adams MJ (2001) A universal PCR primer to detect members of the

Potyviridae and its use to examine the taxonomic status of several members of

the family. Arch Virol 146: 757-766

8. Colinet D, Kummert J (1993) Identification of a Sweet potato feathery mottle

virus isolate from China (SPFMV-Ch) by the polymerase chain reaction with

degenerate primers. J Virol Methods 45: 149-159

9. Dreher TW, Miller WA (2006) Translational control in positive strand RNA

plant viruses. Virology 344: 185-197

10. Frohman MA, Dush MK, Martin GR (1988) Rapid production of full-length

cDNAs from rare transcripts - Amplification using a single gene-specific

oligonucleotide primer. Proc Natl Acad Sci USA 85: 8998-9002

11. Gibbs A, Mackenzie A (1997) A primer pair for amplifying part of the genome of

all potyvirids by RT-PCR. J Virol Methods 63: 9-16

199 12. Gibbs AJ, Mackenzie AM, Gibbs MJ (2003) The 'potyvirid primers' will

probably provide phylogenetically informative DNA fragments from all species

of Potyviridae. J Virol Methods 112: 41-44

13. Guyatt KJ, Proll DF, Menssen A, Davidson AD (1996) The complete nucleotide

sequence of bean yellow mosaic potyvirus RNA. Arch Virol 141: 1231-1246

14. Hsu YC, Yeh TJ, Chang YC (2005) A new combination of RT-PCR and reverse

dot blot hybridization for rapid detection and identification of potyviruses. J

Virol Methods 128: 54-60

15. Kadare G, Haenni AL (1997) Virus-encoded RNA helicases. J Virol 71: 2583-

2590

16. Kapust RB, Tozser J, Copeland TD, Waugh DS (2002) The P1' specificity of

tobacco etch virus protease. Biochem Biophys Res Commun 294: 949-955

17. Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for molecular

evolutionary genetics analysis and sequence alignment. Brief Bioinformatics 5:

150-163

18. Langeveld SA, Dore JM, Memelink J, Derks A, Vandervlugt CIM, Asjes CJ, Bol

JF (1991) Identification of potyviruses using the polymerase chain reaction with

degenerate primers. J Gen Virol 72: 1531-1541

19. Mackenzie AM, Nolan M, Wei K-J, Clements MA, Gowanlock D, Wallace BJ,

Gibbs AJ (1998) Ceratobium mosaic potyvirus: another virus from orchids. Arch

Virol 143: 903-914

200 20. Melgarejo TA, Alminaite A, Fribourg C, Spetz C, Valkonen JPT (2004) Strains

of Peru tomato virus infecting cocona (Solanum sessiliflorum), tomato and

pepper in Peru with reference to genome evolution in genus Potyvirus. Arch

Virol 149: 2025-2034

21. Nicolas O, Laliberte JF (1992) The complete nucleotide sequence of Turnip

mosaic potyvirus RNA. J Gen Virol 73: 2785-2793

22. Pappu SS, Brand R, Pappu HR, Rybicki EP, Gough KH, Frenkel MJ, Niblett CL

(1993) A polymerase chain reaction method adapted for selective amplification

and cloning of 3' sequences of potyviral genomes - application to Dasheen

mosaic virus. J Virol Methods 41: 9-20

23. Revers F, Yang SJ, Walter J, Souche S, Lot H, Le Gall O, Candresse T, Dunez J

(1997) Comparison of the complete nucleotide sequences of two isolates of

Lettuce mosaic virus differing in their biological properties. Virus Res 47: 167-77

24. Rodoni BC, Dale JL, Harding RM (1999) Characterization and expression of the

coat protein-coding region of Banana bract mosaic potyvirus, development of

diagnostic assays and detection of the virus in banana plants from five countries

in Southeast Asia. Arch Virol 144: 1725-1737

25. Shukla DD, Frenkel MJ, McKern NM, Ward CW, Jilka J, Tosic M, Ford RE

(1992) Present status of the sugarcane mosaic subgroup of potyviruses. Arch

Virol Suppl 5: 363-373

26. Shukla DD, Ward CW, Brunt AA, Berger PH (1998) Potyviridae family.

CMI/AAB Descriptions of Plant Viruses No 366

201 27. Simon-Buela L, Guo HS, Garcia JA (1997) Cap-independent leaky scanning as

the mechanism of translation initiation of a plant viral genomic RNA. J Gen

Virol 78: 2691-2699

28. Spetz C, Taboada AM, Darwich S, Ramsell J, Salazar LF, Valkonen JPT (2003)

Molecular resolution of a complex of potyviruses infecting solanaceous crops at

the centre of origin in Peru. J Gen Virol 84: 2565-2578

29. Spetz C, Valkonen JPT (2003) Genomic sequence of Wild potato mosaic virus as

compared to the genomes of other potyviruses. Arch Virol 148: 373-380

30. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The

CLUSTAL_X windows interface: flexible strategies for multiple sequence

alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882

31. Turpen T (1989) Molecular cloning of a potato virus Y genome: nucleotide

sequence homology in non-coding regions of potyviruses. J Gen Virol 70: 1951-

1960

32. Urcuqui-Inchima S, Haenni AL, Bernardi F (2001) Potyvirus proteins: a wealth

of functions. Virus Res 74: 157-175

33. Wei CB, Chen J, Zhang QY, Shi YH, Lin L, Zheng HY, Adams MJ, Chen JP

(2005) A new potyvirus from Thunberg fritillary (Fritillaria thunbergii Miq.) in

Zhejiang, China. Arch Virol 150: 1271-1280

34. Zerbini FM, Koike ST, Gilbertson RL (1995) Biological and molecular

characterization of Lettuce Mosaic Potyvirus isolates from the Salinas Valley of

California. Phytopathology 85: 746-752

202

CHAPTER 6

Identification and sequence analysis of potyviruses infecting crops in Vietnam

C. Ha1†, P. Revill1*, R.M. Harding1, M. Vu2 and J.L. Dale1

1Tropical Crops and Biocommodities Domain, Institute of Health and Biomedical Innovation, Queensland University of Technology, Brisbane, 4001, Australia.

2Department of Plant Pathology, Hanoi Agriculture University, Gialam, Hanoi, Vietnam.

† Current address: Department of Plant Pathology, Hanoi Agriculture University, Gialam, Hanoi, Vietnam.

* Current address: Victorian Infectious Diseases Reference Laboratory, 10 Wreckyn St, Nth Melbourne, Victoria, 3051, Australia.

This paper has been accepted for publication in Archives of Virology

The formatting and presentation style within this chapter are consistent with Archives of

Virology

203

Summary. Fifty two virus isolates from 13 distinct potyvirus species infecting crops in Vietnam were identified and the 3’ region of each genome was sequenced. The viruses were Bean common mosaic virus (BCMV), Potato virus Y (PVY), Sugarcane mosaic virus (SCMV), Sorghum mosaic virus (SrMV), Chilli veinal mottle virus

(ChiVMV), Zucchini yellow mosaic virus (ZYMV), Leek yellow stripe virus (LYMV),

Shallot yellow stripe virus (SYSV), Onion yellow dwarf virus (OYDV), Turnip mosaic virus (TuMV), Dasheen mosaic virus (DsMV), Sweet potato feathery mottle virus

(SPFMV) and a novel potyvirus infecting chilli, tentatively named Chilli ringspot virus

(ChiRSV). With the exception of BCMV and PVY, this is first report of these viruses in

Vietnam. Further, rabbit bell (Crotalaria anagyroides) and typhonia (Typhonium trilobatum) were identified as new natural hosts of the Peanut stunt virus (PStV) strain of BCMV and of DsMV, respectively. Sequence and phylogenetic analyses of the entire

CP-coding region revealed considerable variability in BCMV, SCMV, PVY, ZYMV and

DsMV.

204

Introduction

The genus Potyvirus is the largest genus of the family Potyviridae with nearly 200 definite and tentative species [6]. Virions of potyviruses range in length from ~700-900 nm and encapsidate a monopartite, single-stranded RNA genome (~ 10 kb) characterized by a 5’ untranslated region (5’ UTR), a single open reading frame (ORF) and a 3’ UTR which has a polyadenylated (polyA) tail. The ORF encodes a single, large polyprotein that is subsequently processed into ten functional proteins [1]. Potyviruses are mainly transmitted by aphids in a non-persistent manner and infect a wide range of crops in which they cause significant losses. Although worldwide in their distribution, they are most prevalent in tropical and subtropical countries [27].

In limited surveys of papaya, banana and various cucurbits in Vietnam between 1998 and 2002, viruses appeared to be a major factor limiting production [24]. The extent of diseases caused specifically by potyviruses, however, was not thoroughly investigated although typical potyvirus symptoms were observed on many plants. To date, only three potyviruses have been definitively identified in Vietnam based on sequence analysis, namely Banana bract mosaic virus (BBrMV), Papaya ringspot virus (PRSV) and the

Blackeye cowpea mosaic virus strain of Bean common mosaic virus (BCMV-BICM).

BBrMV was detected in a Cavendish banana from North Vietnam in 1999, with identification based on sequence analysis of the CP-coding region and 3’UTR [25].

PRSV has been shown to be a major limiting factor in papaya production in Vietnam

[24]. Phylogenetic analyses, based on the CP sequences from 52 PRSV isolates from

205

Vietnam, showed a high level of divergence of this virus within the country [4]. The third potyvirus reported from Vietnam, BCMV-BICM, was detected in both catjang and yard-long beans (Vigna unguiculata spp.) by IC-PCR; 687 nucleotides of the CP-coding region has been sequenced [17].

We have previously identified a high degree of virus diversity in Vietnam in a range of virus groups including babuviruses [5], geminiviruses [16] and PRSV [4]. The high degree of geminivirus diversity and sequence variability suggested that Vietnam may be a centre of origin for this important group of viruses. Although only three potyviruses had been identified in Vietnam prior to the current study, we were interested to determine whether this important group of viruses was similarly diverse. The major aim of this study was to conduct a more thorough investigation into the incidence of potyviruses infecting plants in Vietnam. In this paper, we report the identification of 13 distinct potyviruses in Vietnam using PCR-based diagnostic tests. We also report the sequence variability in the 3’ region of the viral genomes and discuss the possible evolutionary implications of these findings.

Materials and methods

Plant samples

Plant samples showing characteristic symptoms of viral infection were collected from a range of crops during field surveys throughout Vietnam in 2000/2001 and 2004. The samples were dried under silica gel and stored at room temperature until use.

206

PCR detection of potyviruses

Total RNAs were extracted from the samples using an RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions. In all cases, RT-PCRs were directly performed from RNA extracts using a Titan One Tube RT-PCR System (Roche).

Potyviruses were initially detected using two degenerate primers, CIFor and CIRev

(Table 1), which amplified a product of ~0.7 kbp from the CI-coding region. PCRs were done in a reaction volume of 25 µl containing 1 µl template RNA, 0.5 µl dNTPs (10 mM each), 1 µl of each primer (20 µM), 1.25 µl DTT (100 mM), 5 U RNase Inhibitor and

0.5 µl enzyme mix. The Tgo proofreading polymerase in this enzyme mix had a three- fold higher fidelity than Taq DNA polymerase, thereby minimizing PCR induced sequence errors. The reactions were done at 42○C for 30 min, 94○C for 3 min, and then subjected to 40 cycles of 94○C (30 s), 40○C (30 s) and 68○C (1 min), terminating with 5 min at 68○C. The 3’ end of each genome, spanning a region from the highly conserved motif, GNNSGQPSTVVDN, in the NIb-coding region [15] to the 3’ end of the viral genome, was amplified using different protocols as described below.

1. PVY and TuMV: The 25 µl reaction volume contained 1.5 µl template RNA, 1 µl

dNTPs (10 mM each), 1 µl of NIbFor2 primer (20 µM) (Table 1), 0.5 µl of 3’ end-

specific primers (20 µM each) (Table 1), 1.25 µl DTT (100 mM), 1.5 µl MgCl2 (25

mM), 5 U RNase Inhibitor and 0.5 µl enzyme mix. The reactions were done at 50○C

for 40 min, 94○C for 4 min, and then subjected to 35 cycles of 94○C (30 s), 54○C (30

s) and 68○C (2 min), terminating with 5 min at 68○C.

207

208

Table 1. Primer sequences used in this study

Primer Sequence (5’ – 3’)

CIFor GGiVViGTiGGiWSiGGiAARTCiAC CIRev ACiCCRTTYTCDATDATRTTiGTiGC NIBFor2 AAYAGYGGiCARCCiTCiACiGTiGT PV2IT7* TAATACGACTCACTATAGGGiAAYAAYAGYGGiCARCC

N1T GACCACGCGTATCGATGTCGAC(T)17V N1 GACCACGCGTATCGATGTCGAC SCMV3EndRev GTCTCTCACCAAGAGACTCGCAGCAC SrMV3EndRev GTCTCTTGCCACAAGACTCGCAGCAC PVY3EndRev GTCTCCTGATTGAAGTTTACAGTCAC TuMV3EndRev GTCCCTTGCATCCTATCAAATGTTAAG ZYMV3EndRev AGGCTTGCAAACGGAGTCTAATCTCG SPFMV3EndRev GCTCGATCACGAACCAAAAAGGCT LYSV3EndRev GTCTCTTACTGCAACATAAGAACACAC BCMV3EndRev1 GGAACAACAAACATTGCCGTAGC DsMV3EndRev GAACACCGTGCACGAAGCATCTC SYSV3EndRev GTCTCCCTAACAAAACGTACAACAC ChiVMV3EndRev CGCCACTATTGAATAGCTTGAACGA

* From Mackenzie et al. [19]

209

210

2. SPFMV, ZYMV, LYSV, SYSV, OYDV, DsMV, SCMV, SrMV and BCMV: In

most cases, two rounds of PCR were used to amplify these viral genomes. In the first

round, the RT-PCRs were done as described for PVY and TuMV, except that

primers PV2IT7 [19] and N1T (Table 1) were used and the reaction parameters were

45○C for 40 min, 94○C for 3 min, then 35 cycles of 94○C (40 s), 54○C (40 s) and

68○C (2 min), terminating with 5 min at 68○C. With the exception of OYDV and

SYSV, a second round of PCR was done using the Expand Long Template PCR

System (Roche) with buffer 3. The reactions (25 µl) contained 0.5 µl of reaction mix

from the initial PCR (diluted 1/10 in water), 1 µl of NIbFor2 primer (20 µM), 0.5 µl

of 3’ end-specific primers (20 µM) (Table 1) and 0.5 µl Enzyme mix. The cycling

parameters were the same those of the first round excluding the cDNA synthesis

step.

3. ChiVMV and ChiRSV: First-strand cDNAs were synthesized using SuperScript™

III Reverse Transcriptase (Invitrogen) and N1T primer as first-strand primer, treated

with RNase A and H and purified using a High Pure PCR Product Purification Kit

(Roche). PCR was performed using the Expand Long Template PCR System with

buffer 3. The reactions (25 µl) contained 1.5 µl of purified cDNA, 1 µl of PV2IT7

primer (20 µM), 0.5 µl of N1 primer (20 µM) (Table 1), 1 µl dNTPs (10 mM each)

and 0.5 µl Enzyme mix. The reaction conditions were 94○C for 3 min, then 35 cycles

of 94○C (30 s), 50○C (45 s) and 68○C (2 min), terminating with 5 min at 68○C. For

ChiVMV, a second round of PCR was performed, as described above.

211

Cloning and sequencing

The PCR products were purified from agarose gels using a High Pure PCR Product

Purification Kit (Roche), ligated to the plasmid vector pGEM-T Easy (Promega) and transformed into E. coli XL1-Blue competent cells (Stratagene). Cloned plasmids were purified with a Wizard Miniprep Kit (Promega) and inserts were verified by restriction digestion. Sequences were generated from overlapping clones and multiple clones were sequenced in areas where sequences were ambiguous. The clones were sequenced using the ABI Prism®BigdyeTM Terminator Kit (PE Applied Biosystem) and sent to the

Australia Genomic Research Facility (University of Queensland) for analysis.

Sequence analyses

Virus sequences were aligned using the ClustalX program [30], while sequence identities were calculated using the “Sequence Identity Matrix” option in BioEdit program version 7.05 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). The phylogenetic trees were constructed from the ClustalX-aligned sequences using a

MEGA version 3.1 program [18] using the Neighbor-Joining method and a Kimura 2-

Parameter model for estimating the distances and bootstrapped (1000 replicates). All sequence comparisons and phylogenetic analyses were done using the nucleotide sequence of the CP-coding region.

212

Results

In most cases, the samples were initially tested for the presence of potyviruses using the degenerate potyvirus primers, CIFor and CIRev. Amplicons derived from these reactions were sequenced to confirm their identity. Once the sequence was confirmed, the NIb-3’ end fragment of each viral genome was amplified, cloned and sequenced.

Using primers CIFor and CIRev, an amplicon of the expected size was generated from 52 plant samples. Sequence analysis of these amplicons confirmed the presence of

13 distinct potyviruses (Table 2), namely BCMV, Potato virus Y (PVY), Sugarcane mosaic virus (SCMV), Sorghum mosaic virus (SrMV), Chilli veinal mottle virus

(ChiVMV), Chilli ringspot virus (ChiRSV), Zucchini yellow mosaic virus (ZYMV),

Leek yellow stripe virus (LYMV), Shallot yellow stripe virus (SYSV), Onion yellow dwarf virus (OYDV), Turnip mosaic virus (TuMV), Dasheen mosaic virus (DsMV) and

Sweet potato feathery mottle virus (SPFMV). This was the first report of ChiRSV infecting chilli.

Bean common mosaic virus (BCMV)

Nine BCMV isolates were identified from a variety of symptomatic legumes, including black bean, red bean, yard-long bean, soybean and rabbit bell, a cover crop used in coffee plantations. Sequence comparisons and phylogenetic analyses based on the nucleotide sequences of the CP-coding region suggested these isolates were three different strains of BCMV;

213

214

Table 2. List of the potyviruses identified in Vietnam Identity Accession (%) Isolate number Location Natural host in the CP nt Most closely related virus in database sequence*

Bean common mosaic virus (BCMV) BCMV-BlC-VN/BB1 DQ925417 Hoa Binh Black bean (Phaseolus vulgaris) 96.6 AY575773-BlCMV-[TW]-Taiwan BCMV-BlC-VN/BB2-6† DQ925423 Hoa Binh Black bean (P. vulgaris) 96.6 AY575773-BlCMV-[TW]-Taiwan BCMV-BlC-VN/RB1 DQ925420 Hue Red bean (P. vulgaris) 96.6 AY575773-BlCMV-[TW]-Taiwan BCMV-BlC-VN/RB2 DQ925421 Hue Red bean (P. vulgaris) 96.6 AY575773-BlCMV-[TW]-Taiwan BCMV-BlC-VN/YB1 DQ925424 Vinh Phuc Yard-long bean (Vigna unguiculata) 98.0 AJ312438-BlCMV-[Y]-China-cowpea BCMV-PSt-VN/SB1 DQ925418 Dak Lak Soybean (Glycine max) 98.4 Y11774-PStV-[T7]-Thailand-peanut BCMV-PSt-VN/Ca1 DQ925419 Dak Lak Rabbit bell (Crotalaria anagyroides) 97.3 Y11774-PStV-[T7]-Thailand-peanut BCMV-VN/BB2-5† DQ925422 Hoa Binh Black bean (P. vulgaris) 76.1 (80.1) Z15057-BCMV-[J8]-Spain BCMV-VN/YB2 DQ925425 Yenbai Yard-long bean (V. unguiculata) 76.3 (80.9) Z15057-BCMV-[J8]-Spain

Sugarcane mosaic virus (SCMV) and Sorghum mosaic virus (SrMV) SCMV-VN/AR1 DQ925432 Son La Arrowroot (Maranta arundinacea) 89.7 AJ310105-SCMV-China-maize SCMV-VN/M1 DQ925426 Hoa Binh Maize (Zea mays) 94.3 AY629312-SCMV-Thailand-sugarcane SCMV-VN/M2 DQ925429 Ha Tay Maize (Z. mays) 98.2 AY629312-SCMV-Thailand-sugarcane SCMV-VN/SC1 DQ925431 Yen Bai Sugarcane (Saccharum officinarum) 98.5 AY629312-SCMV-Thailand-sugarcane SCMV-VN/SC2 DQ925427 Hoa Binh Sugarcane (S. officinarum) 76.6 AJ310107-SCMV-China-maize SCMV-VN/SC3 DQ925430 Bac Giang Sugarcane (S. officinarum) 76.4 AJ310105-SCMV-China-maize SCMV-VN/SC4 DQ925428 Ha Noi Sugarcane (S. officinarum) 79.1 AJ310107-SCMV-China-maize SrMV-VN/SC5 DQ925433 Hoa Binh Sugarcane (S. officinarum) 95.7 AJ310195-SrMV-China-sugarcane SrMV-VN/SC6 DQ925434 Ha Tay Sugarcane (S. officinarum) 96.0 AJ310195-SrMV-China-sugarcane

Potato virus Y (PVY), Chilli veinal mottle virus (ChiVMV) and Chilli ringspot virus (ChiRSV) PVY-VN/P1 DQ925435 Da Lat Potato (Solanum tuberosum) 98.8 DQ157179-PV YN:O –[OR1]-USA-potato PVY-VN/P2 DQ925437 Ha Noi Potato (S. tuberosum) 99.7 AJ390290 PVYNTN –[v951156-2]-UK-potato PVY-VN/C10 DQ925436 Da Lat Chili (Capsicum annuum) 95.3 AJ439544-PVY-[SON41]-France-black nightshade ChiVMV-VN/C1 DQ925440 Ha Noi Chilli (C. annuum) 93.9 U72193-ChiVMV-Thailand-chilli ChiVMV-VN/C2 DQ925441 Ha Noi Chilli (C. annuum) 93.1 U72193-ChiVMV-Thailand-chilli ChiVMV-VN/C3 DQ925442 Ha Noi Chilli (C. annuum) 94.0 U72193-ChiVMV-Thailand-chilli ChiVMV-VN/C4 DQ925443 Yen Bai Chilli (C. annuum) 92.7 U72193-ChiVMV-Thailand-chilli ChiVMV-VN/C5 DQ925444 Ho Chi Minh Chilli (C. annuum) 96.5 U72193-ChiVMV-Thailand-chilli ChiVMV-VN/C6 DQ925446 Vinh Phuc Chilli (C. annuum) 94.8 AB012221-ChiVMV-[CM1]-Thailand-chilli ChiVMV-VN/C7 DQ925445 Hue Chilli (C. annuum) 94.6 AB012221-ChiVMV-[CM1]-Thailand-chilli ChiRSV-VN/C8 DQ925438 Ninh Thuan Chilli (C. annuum) 73.5 (60.0) AB020524-TVBMV-[SOL4]-tobacco ChiRSV-VN/C9 DQ925439 Dien Bien Phu Chilli (C. annuum) 73.0 (58.9) AB020524-TVBMV-[SOL4]-tobacco

Zucchini yellow mosaic virus (ZYMV) ZYMV-VN/Cs1 DQ925449 Son La Cucumber (Cucumis sativus) 94.3 AJ515911-ZYMV-[WM]-China-watermelon ZYMV-VN/Cm1 DQ925448 Son La Pumpkin (Cucurbita moschata) 95.2 AJ515911-ZYMV-[WM]-China-watermelon ZYMV-VN/Cm2 DQ925450 Hoa Binh Pumpkin (C. moschata) 95.5 AJ515911-ZYMV-[WM]-China-watermelon ZYMV-VN/Cm3 DQ925447 Vinh Phuc Pumpkin (C. moschata) 88.8 AF014811-ZYMV-Singapore-cucumber ZYMV-VN/Bh1 DQ925451 Ho Chi Minh Waxy gourd (Benincasa hispida) 91.1 AY074808-ZYMV-[Shanxi]-China-pumpkin

Shallot yellow stripe virus (SYSV), Leek yellow stripe virus (LYSV) and Onion yellow dwarf virus (OYDV) SYSV-VN/S1 DQ925456 Hue Shallot (Allium ascalonicum) 98.1 AJ865077-SYSV-[ZQ1]-China-Welsh onion SYSV-VN/S2 DQ925457 Hung Yen Shallot (A. ascalonicum) 98.4 AJ865077-SYSV-[ZQ1]-China-Welsh onion SYSV-VN/L1 DQ925458 Bac Ninh Leek (A. porrum) 90.8 AB000473-SYSV-Japan-Japanese Allium LYSV-VN/L2‡ DQ925452 Son la Leek (A. porrum) 82.6 AF538950-LYSV-Taiwan-garlic LYSV-VN/L3§ DQ925453 Ha Noi Leek (A. porrum) 84.1 AF538950-LYSV-Taiwan-garlic OYDV-VN/L4‡ DQ925454 Son La Leek (A. porrum) 90.4 AJ409312-OYDV-[YN1]-China-garlic OYDV-VN/L5§ DQ925455 Ha Noi Leek (A. porrum) 89.2 AJ307033-OYDV-[Xixia]-China-garlic

Turnip mosaic virus (TuMV) TuMV-VN/Rs1 DQ925459 Dak Lak Chinese radish (Raphanus sativus) 98.4 AB105134-TuMV-[TU3]-Japan-cabbage TuMV-VN/Rs2 DQ925463 Lai Chau Chinese radish (R. sativus) 98.1 AB180026-TuMV-[CQS1]-Korea-Chinese cabbage TuMV-VN/Bj1 DQ925460 Dak Lak Chinese mustard (Brassica juncea) 97.7 AB105134-TuMV-[TU3]-Japan-cabbage TuMV-VN/Bj2 DQ925461 Hoa Binh Chinese mustard (B. juncea) 98.6 AF530056-TuMV-Taiwan-radish TuMV-VN/Bj3 DQ925462 Lai Chau Chinese mustard (B. juncea) 98.4 AB105134-TuMV-[TU3]-Japan-cabbage

Dasheen mosaic virus (DsMV) DsMV-VN/Ce1 DQ925464 Yen Bai Taro (Colocasia esculenta) 79.0 AJ298036-DsMV-[TW]-Japan-taro DsMV-VN/Ce2 DQ925465 Ho Chi Minh Taro (C. esculenta) 90.5 AJ298036-DsMV-[TW]-Japan-taro DsMV-VN/Tt1 DQ925466 Ha Noi Typhonia (Typhonium trilobatum) 77.6 AJ616721-VaMVV-[CI-NAT]-Cook Islands-vanilla

Sweet potato feathery mottle virus (SPFMV) SPFMV-VN/SP1 DQ925467 Hue Sweet potato (Ipomoea batatas) 96.2 AY459599-SPFMV-[Port/EA strain]-Portugal SPFMV-VN/SP2 DQ925468 Bac Giang Sweet potato (I. batatas) 96.1 AY523550-SPFMV-[Ruk55/EA strain]-Uganda *Percentage identity with the most closely related sequence in databases; the number in brackets refers to identity in the 3’ UTR †, ‡ and §: The isolates with the same symbol were isolated from the same plant sample

215

216

1. Five isolates were grouped as BlCMV strains and were designated BCMV-BlC-

VN/BB1, -VN/BB2-6, -VN/RB1, -VN/RB2 and –VN/YB1 (Table 2). The nucleotide sequences of these isolates showed high identities both amongst themselves (95.8–99%) and with the sequences of published BlCMV isolates. The most closely related viruses to the Vietnamese BlCMV isolates were BlCMV isolates from Taiwan (96.6%) and China

(98%) (Table 2). Phylogenetic analyses based on the nucleotide sequences of the CP- coding region (Fig. 1) showed that all the five BlCMV isolates from Vietnam were grouped within the well-supported BlCMV cluster.

2. Two isolates, from soybean and rabbit bell, were grouped as Peanut stunt virus

(PStV) strains and designated BCMV-PSt-VN/SB1 and –VN/Ca1, respectively. The two isolates shared 98.1% nucleotide identity with each other, shared greater than 93% identity with other reported PStV isolates and less than 90% identity with other non-

PStV isolates. The closest virus to each isolate was a PStV-[T7] isolate from Thailand

(Table 2). Phylogenetic analyses confirmed that the two isolates were grouped within the

PStV cluster and with the Thai isolates (Fig. 1).

3. This group included two isolates from black bean and yard-long bean (designated

BCMV-VN/BB2-5 and –VN/YB2, respectively). The two isolates shared 99.3% nucleotide identity in the CP-coding region but were only very distally related to other viruses of the BCMV group (Fig. 1). They shared approximately 75% identity with other isolates from Vietnam and between 74.1-76.3% with other reported isolates (maximum

76.1 and 76.3% identity, respectively, with Spanish isolate BCMV-[J8], Table 2).

However, they shared less than 68% identity with other non-BCMV viruses of the

“BCMV subgroup”. In comparisons made using the amino acid sequence of the CP and

217

218

77 L19474-BCMV-[US7] 78 L19539-BCMV-[CH1]-Capsicum annuum 79 L12740-BCMV-[US1] 54 AF083559-BCMV-[NY 68-95] S66252-BCMV-[NY15] S66251-BCMV-[NL1] L15332-BCMV-[NL1] AY112735-BCMV-[NL1]-Phaseolus vulgaris U37073-BCMV-[US3]-P. vulgaris 82 65 75 U37072-BCMV-[US10]-P. vulgaris DQ054366-BCMV-Australia 87 Z15057-BCMV-[J8] AY863025-BCMV-[RU1]-USA-P. vulgaris 99 U37077-BCMV-[RU1]-P. vulgaris L19472-BCMV-[NL2] AF361337-BCMV-[93/65]-South Africa-P. vulgaris 92 69 U37074-BCMV-[US4]-P. vulgaris AB012663-AzMV-[H] U23564-DeMV-USA-Dendrobium superbum 69 76 85 U60100-AzMV 87 AY575773-BlCMV-[TW]-Taiwan 92 Y17823-BlCMV-[Florida]-cowpea S66253-BlCMV-[W] 99 79 AJ312438-BlCMV-[Y]-China-cowpea 96 AJ312437-BlCMV-[R]-China-cowpea BlCMV strain BlCMV-VN/YB1

58 BlCMV-VN/BB2-6 BlCMV-VN/RB1 99 BlCMV-VN/BB1 57 72 BlCMV-VN/RB2 99 AF045065-BCMV-[GGSUS]-USA-Cyamopsis tetragonolaba AF045066-BCMV-[GGSSA]-South Africa-C. tetragonolaba U37075-BCMV-[N17]-P. vulgaris 87 BCMV L21767-BCMV-[BR1]-Puerto Rico 99 L11890-BCMV-[Mexican] 82 89 L19473-BCMV-[US5] AF200623-PStV-[SN-Nib2]-Thailand 99 95 AF073380-PStV-[T6-97]-Thailand-peanut Y11773-PStV-[T6]-Thailand-peanut 97 Y11771-PStV-[T3]-Thailand-peanut 72 Y11776-PStV-[T1]-Thailand-peanut Y11774-PStV-[T7]-Thailand-peanut 94 Y11772-PStV-[T5]-Thailand-peanut

52 PStV-VN/SB1 91 PStV-VN/Ca1 AF063222-PStV-[Ts]-Taiwan-peanut 99 AY968604-PStV-[Ts]-Taiwan-peanut U34972-PStV-[Blotch]-China-peanut 88 X63559-PStV-[Blotch]-China-peanut PStV strain 92 U05771-PStV-[Blotch]-China-peanut 99 97 AJ132143-PStV-[G]-China-peanut 84 AJ132144-PStV-[W]-China-peanut Y11775-PStV-[95/399] 99 DQ367846-PStV[Hongan]-China-peanut Fig. 1. A bootstrap con Z21700-PStV-[370]-Indonesia-peanut 66 AJ132155-PStV-[I12]-Indonesia-peanut 63 AJ132156-PStV-[I13]-Indonesia-peanut AJ132147-PStV-[I2]-Indonesia-peanut 99 AJ132146-PStV-[I1]-Indonesia-peanut AJ132149-PStV-[I5]-Indonesia-peanut 99 BCMV-VN/BB2-5 BCMV-VN/YB2 WVMV-AY656816 WMV-AY437609 96 99 SMV-AY216010 DsMV-AJ298033 CABMV-AF348210 Other viruses of the BCMNV-U19287 “BCMV subgroup” ZYMV-AF127929 50 51 EAPV-AB246773

0.05 Fig. 1. A bootstrap consensus tree based on the complete CP nt sequences of the nine BCMV isolates from Vietnam (dotted, in bold and highlighted in grey) and 62 database sequences. Other viruses of the “BCMV subgroup” were included as an outgroup. Only bootstrap values (%) greater than 50% (1000 replicates) are indicated. WVMV, Wisteria vein mosaic virus; WMV, Watermelon mosaic virus; SMV, Soybean mosaic virus; CABMV, Cowpea aphid-borne mosaic virus; BCMNV, Bean common mosaic necrosis virus; EAPV, East Asian Passiflora virus. 219

220

the nucleotide sequence of the 3’ UTR, they shared 75.9-80.1% and 74.3-80.9% identity, respectively, with all other BCMV isolates. Isolates BCMV-VN/BB2-5 and -

BlC-VN/BB2-6 were amplified from the same black bean sample, indicating a mixed infection with two distinct, but closely related viruses (Table 2).

Sugarcane mosaic virus (SCMV) and Sorghum mosaic virus (SrMV)

Seven SCMV isolates from maize, sugarcane and arrowroot and two SrMV isolates from sugarcane were identified from North Vietnam (Table 2).

SCMV

Sequence and phylogenetic analyses showed that the SCMV isolates from Vietnam were extremely diverse and were divided into three groups;

1. This group consisted of an isolate from arrowroot, designated SCMV-VN/AR1. This isolate shared 75.1-80.7% CP nucleotide identity with other SCMV isolates from

Vietnam and had highest identity (89.7%) with a maize isolate from China (Table 2).

2. Two isolates from maize (designated SCMV-VN/M1, -VN/M2) and one isolate from sugarcane (-VN/SC1) were included in this group. They shared high CP nucleotide identities with each other (93.7-98%) but shared only 72.7-80.7% identity with other

SCMV isolates from Vietnam. When compared with other reported isolates, they had highest identities (94.3, 98.2 and 98.5%, respectively) with one isolate infecting sugarcane from Thailand (Table 2).

221

3. This group consisted of three sugarcane isolates (SCMV-VN/SC2, -VN/SC3 and -

VN/SC4). Isolates in this group was considerably more diverse than isolates in the group

2, sharing 87.3-91.8% CP nucleotide identity between each other and 72.7-76.7% identity with other SCMV isolates from Vietnam. SCMV-VN/SC2, -VN/SC3 and -

VN/SC4 also showed low identities with other published SCMV isolates; the highest identities were 76.6%, 76% and 79.1%, respectively, with a maize isolate from China.

In phylogenetic analyses based on the CP nucleotide sequences (Fig. 2), all SCMV sequences on databases, including the Vietnamese sequences, were grouped into four well supported Clusters (I, II, III and IV). Cluster I was most diverse in terms of hosts

(maize, sugarcane, banana and arrowroot), geographical origins (Asia, Europe and

America) and sequence distances (branch lengths). The Vietnamese SCMV isolates belonging to Groups 1 and 2 fell within this cluster. Consistent with the sequence comparisons, SCMV-VN/AR1 (SCMV Group 1) formed a distinct branch independent from all other isolates. Further, all three Vietnamese SCMV Group 2 isolates grouped tightly with the isolates from Thailand to form a monophyletic Viet-Thai sub-cluster.

The three Vietnamese SCMV Group 3 isolates from sugarcane grouped together to form

Cluster 4. There were no Vietnamese isolates in Cluster II, which only comprised isolates from Brazil, or Cluster III, which included sugarcane isolates from different continents.

SrMV

The two SrMV isolates, designated SrMV-VN/SC5 and –VN/SC6, were 98% identical in CP nucleotide sequence but showed only 63.3 - 66.8% identity with other

222

AJ310106-[DY]-China-maize AJ310107-[JS]-China-maize AJ310110-[HB]-China-maize AJ297628-[HZ]-China-maize AY639645-China-maize 58 AY149118-[SD]-China-maize 100 AF494510-China-maize 66 AY042184-[Beijing]-China-maize 88 AY569692-[XS]-China-maize X98167-[Borsdorf]-Germany-maize Sugarcane, AJ006202-[G96]-Germany maize, Musa, 100 X98169-[Hoendstedt]-Germany-maize arrowroot 62 86 AM110759-[Sp]-Spain-maize 0.05 52 55 X98168-[Boetzingen]-Germany-maize China 52 AJ006200-[G952]-Germany Thailand 58 AY195610-[Mx]-Mexico-maize I X98165-[Seehausen/S26]-Germany-maize Vietnam 93 Philippines 62 99 X98166-[Seehausen/S288]-Germany-maize 100 AJ006201-[Bg]-Bulgaria-maize Mexico 62 AJ310105-[GD]-China-maize Germany SCMV-VN/AR1 Bulgaria AJ310104-[YH]-China-sugarcane Spain 83 100 AJ310102-[LP]-China-sugarcane 99 AJ310103-[XgS]-China-sugarcane AY222743-[Abaca]-Philippines-Musa textilis SCMV-VN/M1 80 78 AY630923-[UT6TH]-Thailand-sugarcane 99 100 AY629310-[UT6.2]-Thailand-sugarcane AY629311-[UD7TH]-Thailand-sugarcane 100 AY629312-[SBC2TH]-Thailand-maize SCMV 90 SCMV-VN/M2 58 SCMV-VN/SC1 68 DQ315495-[BR11]-Brazil 99 DQ315494-[BR10]-Brazil 57 DQ315489-[BR01]-Brazil DQ315497-[BR14]-Brazil Unknown DQ315492-[BR08]-Brazil II 100 DQ315493-[BR09]-Brazil DQ315498-[BR15]-Brazil Brazil DQ315496-[BR13]-Brazil 58 100 DQ315491-[BR06]-Brazil 59 DQ315490-[BR02]-Brazil 100 94 DQ369960-[KhzL66]-Iran-sugarcane DQ438949-[KhzQ86]-Iran-sugarcane 99 U57357-[E]-USA-sugarcane 100 AY836523-[E]-USA-sugarcane AF006737-[USFL]-USA-sugarcane Sugarcane AY953351-[D]-China-sugarcane 100 64 U57355-[B]-USA-sugarcane U57356-[D]-USA-sugarcane Iran AF006738-[SA]-South Africa-sugarcane USA III U57354-[A]-USA-sugarcane China 99 AF006736-[USLA]-USA-sugarcane South Africa 100 D00948-[SC]-Australia-sugarcane India AY241923-India Australia 88 AF006732-[Nambour 2]-Australia-sugarcane AF006733-[Nambour 7]-Australia-sugarcane AF006730-[Isis 5]-Australia-sugarcane AF006734-[Brisbane]-Australia-sugarcane AJ278405-[A/Brisbane]-Australia-sugarcane AF006735-[Bundaberg]-Australia-sugarcane AF006728-[Isis 3]-Australia-sugarcane 58 60 AF006729-[Isis 2]-Australia-sugarcane 75 AF006731-[Isis 7]-Australia-sugarcane 100 SCMV-VN/SC4 Sugarcane 100 SCMV-VN/SC2 IV SCMV-VN/SC3 Vietnam 74 AJ310197-[XoS]-China-sugarcane 93 AJ310194-[XgS]-China-sugarcane AJ310198-[YH]-China-sugarcane 71 Sugarcane 93 AJ310195-[LP]-China-sugarcane I 100 SrMV-VN/SC5 China, Vietnam 94 SrMV-VN/SC6 SrMV 76 AJ310196-[LH]-China-sugarcane U57360-[SCM]-USA-sugarcane 80 U57358-[SCH]-USA-sugarcane 100 Sugarcane II U07219-SCH 92 USA 57 U57359-[SCI]-USA-sugarcane 70 MDMV-AJ001691-CP.SEQ PenMV-AY642590-CP.SEQ Other viruses of the ZeMV-AF228693-CP.SEQ JGMV-Z26920-CP.SEQ “SCMV subgroup”

Fig. 2. A bootstrap consensus tree based on the complete CP nt sequences of the six SCMV and two SrMV isolates from Vietnam (dotted, in bold and highlighted in grey) and 60 SCMV and nine SrMV database sequences. Other viruses of the “SCMV subgroup were also included as an outgroup. Only bootstrap values (%) greater than 50% (1000 replicates) are indicated. MDMV, Maize dwarf mosaic virus; PenMV, Pennisetum mosaic virus; ZeMV, Zea mosaic virus; JGMV, Johnsongrass mosaic virus.

223

224

SCMV isolates from Vietnam. When compared with the CP sequences of other SrMV isolates, the highest identities (95.7 and 96.0%, respectively) were with a sugarcane isolate from China (Table 2). Phylogenetic analysis identified two distinct clusters of

SrMV isolates; one contained isolates from USA while the other included isolates from

China and Vietnam (Fig. 2).

Potyviruses infecting solanaceous plants: PVY, ChiVMV and ChiRSV

Twelve different potyviral sequences were amplified from diseased chilli and potato plants (Table 2). Analyses revealed that the 12 sequences comprised three isolates of

PVY, seven isolates of ChiVMV and two isolates of ChiRSV.

Of the three PVY isolates, two were amplified from potato (PVY-VN/P1 and -

VN/P2) and one was amplified from chilli (-VN/C10). The sequences showed 89.6-92%

CP nucleotide identity between themselves and greater than 87% identity with other reported PVY isolates (using 148 CP sequences). PVY-VN/P1 was most closely related

(98.8%) to a potato isolate from USA, PVY-VN/P2 was nearly identical (99.7%) to a potato isolate from the UK, while the chilli isolate had highest identity (96.3%) with a

PVY isolate originating from black nightshade in France (Table 2). Phylogenetic analyses of the Vietnamese isolates and their closest sequenced partners, including the sequences of PVY isolates previously shown to be grouped into three phylogenetic lineages, PVYN, PVYO and PVYNP (non-potato) [11], three distinct clusters were evident

(Fig. 3). Each of the three clusters contained a Vietnamese isolate, with the PVY-VN/P1,

-VN/P2 and -VN/C10 isolates grouped within the PVYO, PVYN and PVYNP clusters, respectively.

225

Seven isolates of ChiVMV were identified and were named ChiVMV-VN/C1-7.

These isolates showed 89.7-98.7% identity with each other and 88.9-96.5% identity with other published ChiVMV isolates from Thailand and India (although the Vietnamese isolates always showed higher identities with the Thai isolates than with the Indian isolate) (Table 2). Phylogenetic analysis showed that all the ChiVMV isolates formed a well-supported distinct cluster and consistent with sequence comparisons, were more closely related to the Thai isolates reflecting their close geographical relatedness (Fig.

3).

Two sequences were amplified from chilli which, based on sequence comparisons, appeared to be novel potyviruses. The two sequences shared 91.8 and 93% identity to each other in the CP gene and 3’UTR, respectively, while the most closely related sequences on databases were with four isolates of Tobacco vein banding mosaic virus

(TVBMV), with identities ranging from 72.3-73.5% and 58.4-60% identity over the CP gene and 3’UTR, respectively. Based on the nucleotide identity thresholds for species discrimination of potyviruses (76% for both the CP gene and 3’UTR [2]), these two sequences were clearly from two isolates of a novel potyvirus which we provisionally named Chilli ringspot virus (ChiRSV) based on the characteristic symptoms and host plant. The two isolates were designated ChiRSV-VN/C8 and –VN/C9. In a phylogenetic tree (Fig. 3), the two ChiRSV isolates formed a separate branch consistent with the sequence comparison data. Further, their relative branch lengths compared with those of

TVBMV confirmed the two viruses being distinct species.

226

64 AJ390290-[NTN/v951156-2]-UK-potato PVY-[VN/P2]-Vietnam-potato X68223-[Europe-H]-Hungary-potato AF321554-[NTN]-Slovenia-potato 82 AJ133454-[NTN]-Netherlands-petunia AJ535662-[NTN-Ca/H]-Hungary-pepper 0.05 99 M95491-Hungary N 99 AY166866-[NTN-Tu660]-Canada-potato PVY D12570-[T]-Japan-potato 92 AF255660-[NBR]-Brazil-potato 100 M22470-[N]-New Zealand-potato 88 100 67 X97895-[N-605]-Switzerland S74813-[T13] AJ390296-[NTN-NN-UK-N]-UK-potato 98 AJ390308--NTN-S-RBS96]-UK-potato 69 AF525081-Solanum palinacanthum X12456-[N]-France-potato U09509-[O]-Canada-potato 98 X68222-[O-US]-USA-potato 100 Z70238-[N-Wilga]Poland-potato 100 O 100 Z70239-[O-LW]-Poland-potato PVY AF118153-[O]-India-eggplant DQ157179-[N:O-OR1]-USA-potato 61 PVY-[VN/P1]-Vietnam-potato AJ223593-[O-768]-Switzerland 76 AJ390305-[O-Des]-UK-potato AF012028-[C-30]-Germany 92 AF463399-[MrNs]-USA-tobacco X68224-[NsNr]-USA-tobacco 74 PVY-[VN/C10]-Vietnam-chilli 86 93 AJ303096-[PN-82]-Spain-pepper 80 AJ439544-[Son41]-France-Solanum nigrum NP 77 AJ005639-[P21-82]-Spain-pepper PVY AJ390307-[C-O-Tom]-Portugal-tomato (Non-potato) AF012027-[C-28]-Germany AF012029-[C-45]-Germany 100 80 AJ303093-[Si15]-Italy-pepper AJ303094-[K16.94]-Tunisia-pepper AF237963-[nnp]-Italy-pepper 97 AJ303095-[Tu12.3]-Turkey-pepper AJ439545-[LYE84.2]-Spain-tomato PepSMV-X66027 PepMoV-M96425 99 PepYMV-AF348610 73 TVBMV-X77637 97 TVBMV-L28816 100 TVBMV-AB020524 99 TVBMV-AF274315 ChiRSV-[VN/C8]-Vietnam-chilli ChiRSV 100 ChiRSV-[VN/C9]-Vietnam-chilli 100 PVMV-AJ780968 99 PVMV-AJ780967 100 PVMV-AJ780966 PVMV-AJ780970 90 78 PVMV-AJ780969 WTMV-DQ851495 62 ChiVMV-[VN/C6]-Vietnam-chilli 99 100 ChiVMV-[VN/C7]-Vietnam-chilli AB012221- [CM1]-Thailand-chilli 93 U72193- Thailand-chilli 100 52 ChiVMV-[VN/C5]-Vietnam-chilli ChiVMV AJ237843- India-chilli

79 ChiVMV-[VN/C3]-Vietnam-chilli ChiVMV-[VN/C4]-Vietnam-chilli 98 ChiVMV-[VN/C1]-Vietnam-chilli 58 98 ChiVMV-[VN/C2]

Fig. 3. A bootstrap consensus tree based on the complete CP nt sequences of solanaceous plant- infecting potyviruses identified from Vietnam (dotted, in bold and highlighted in grey) and in databases. Only bootstrap values (%) greater than 50% (1000 replicates) are indicated. PepSMV, Pepper severe mosaic virus; PepMoV, Pepper mottle virus; PepYMV, Pepper yellow mosaic virus; PVMV, Pepper veinal mottle virus; WTMV, Wild tomato mosaic virus.

227

228

Zucchini yellow mosaic virus (ZYMV)

Cucurbits showing a range of typical viral symptoms were commonly observed throughout Vietnam. Samples were initially tested for potyviruses using the CI primers and those that tested positive were subsequently tested for the commonly found PRSV using specific primers MB12A and MB11 [3]. From the samples testing positive for potyviruses but negative for PRSV, we detected five ZYMV isolates infecting cucumber

(ZYMV-VN/Cs1), pumpkin (ZYMV-VN/Cm1, -Cm2 and –Cm3) and waxy gourd

(ZYMV-VN/Bh1) (Table 2). Sequence and phylogenetic analyses showed that the

ZYMV isolates were very diverse (79.4-98.9% identity with each other) and could be divided into three groups.

1. This group included only one isolate, ZYMV-VN/Cm3, from pumpkin. The isolate shared very low identity with other Vietnamese ZYMV isolates (maximum 81.8%), with the most closely related virus originating from Singapore (88% identity).

2. This group also included a single isolate, ZYMV-VN/Bh1, from waxy gourd. This isolate had low identity with other Vietnamese isolates (maximum 86.4%) but shared a much higher identity (91.1%) with one Chinese ZYMV isolate (AY074808).

3. Three isolates were included in this group, ZYMV-VN/Cs1, -VN/Cm1 and –

VN/Cm2. These three isolates shared high sequence similarity (95.9-98.9% identity), and when compared to other sequences, shared the highest identities (95.2, 94.3 and

95.5%, respectively) with a Chinese ZYMV isolate from watermelon (Table 2).

229

Phylogenetic analysis of the five Vietnamese isolates and 56 database sequences revealed that the ZYMV isolates were grouped into three major clusters (I, II, III) (Fig.

4). The viruses that were in Cluster I had a worldwide distribution; none of the

Vietnamese isolates fell in this cluster. ZYMV-VN/Cm3 (Group 1), along with two isolates from Singapore and Reunion Island, formed Cluster II, while Cluster III comprised the remaining four Vietnamese ZYMV isolates and six Chinese isolates. On the bases of the branch lengths and bootstrap support, Cluster III could be divided into two sub-clusters, each of which would contain Vietnamese ZYMV isolates from either group 1 or 2.

Potyviruses infecting bulb crops from Vietnam: OYDV, LYSV and SYSV

Three distinct potyviruses, SYSV, LYSV and OYDV, were detected in symptomatic bulb plants. Of the three SYSV isolates, two were found in shallot (SYSV-VN/S1 and -

VN/S2) and one in leek (SYSV-VN/L1). Two isolates each of LYSV and OYDV were detected in leek, and these were designated LYSV-VN/L2 and -VN/L3 and OYDV-

VN/L4 and -VN/L5, respectively (Table 2). Interestingly, the pairings of LYSV-VN/L2 with OYDV-VN/L4, and LYSV-VN/L3 with OYDV-VN/L5, were each isolated from different leek plants, indicating mixed infection of different potyviruses in the one plant

(Table 2).

230

AJ420014-[Austria 6]-Austria-Cucurbita pepo AJ459956-[H272-8]-Hungary-C. pepo AJ459955-[H272-6]-Hungary-C. pepo 72 AJ459954-[H266-2]-Hungary-C. pepo 97 AJ251527-[10]-Hungary-Cucumis sativus AJ420013-[Austria 5]-Austria-C. pepo 65 AJ420018-[Slovenia 1]-Slovenia-C. pepo AJ420019-[Berlin 1]-Germany-C. pepo 87 AY188994-B 76 69 M35095-[NAT]-Israel-C. sativus 100 AB127936-[Pak]-Pakistan-Lageneria siceneria AB004641-[M]-Japan AB063251[-M39]-Japan-Cucumis melo 89 AF513550-[Shangyu]-China- Cucurbita moschata 92 AY074809-[Beijing]-China 98 AY611021-China-C. moschata AF513551-[Ningbo 2]-China-C. moschata 99 AY074810-[Ningbo]-China-C. melo 94 AJ316229-[WG]-China-Benicasa hispida 97 D13914-[Florida]-USA-C. moschata 81 AF127933-[NT1]-Taiwan-C. sativus 86 100 AB188115-[Z5-1]-Japan-C. sativus 0.05 AB188116-[Z5-1/2002]-Japan-C. sativus World wide AJ420020-[Italy 1]-Italy-C. pepo I D00692-[Connecticut]-USA 90 100 L31350-[California]-USA-C. moschata AJ307036-[CU]-China-C. sativus 96 AY611022-[99/90]-China-C. melo 100 AY611024-[99/246]-China-squash ZYMV AY279000-[KR-PS]-Korea-C. moschata 100 AF486822-[Dongyang]-China-C. moschata 99 AF062518-[CU]-Korea-C.sativus 79 AY597207-[Hefei]-China AY611023-[193/90]-China-squash 62 AY278998-[KR-PA]-Korea-C. moschata 66 AF486823-[Hainan]-China-B. hispida AB004640-[169]-Japan-C. melo 69 AF127930-[TW-CY2]-Taiwan-L. cylindrica AF127934-[TW-PT5]-Taiwan-Momordica charantia 96 98 AJ316227-[P]-China-C. moschata 99 99 AJ316228-[SG]-China-L. cylindrica AF127931-[TW-TC1]-Taiwan-C. maxima 73 AF127929-[TW-TN3]-Taiwan-L. cylindrica 77 AJ429071-[A]-Korea-Altheae rosea AF435425-[Hangzhou]-China-C. moschata AY611026-[HN-01]-China-C. lanatus AF127932-[TW-TNML1]-Taiwan-C. melo 100 AY995216-New Zealand-zucchini L29569-[Reunion]-Reunion Island-M. charantia Vietnam AF014811-[Singapore]-Singapore-C. sativus 93 Reunion, II 52 ZYMV-VN/Cm3 Singapore 87 AF513552-[Shandong]-China 100 AY074808-[Shanxi]-China-C. moschata ZYMV-VN/Bh1 100 ZYMV-VN/Cm1 Vietnam 93 99 ZYMV-VN/Cs1 China III ZYMV-VN/Cm2 100 AY611025-[BJ-03]-China-C. lanatus AJ515911-[WM]-China-C. lanatus 52 AJ515907-[SXS]-China-C. moschata 99 84 AJ515908-[MM]-China-C. melo EAPV- AB246773 DsMV- AJ298033 BCMV- AJ312437 CABMV-AF348210 BCMNV-U19287 Other viruses of the WVMV-AY656816 “BCMV subgroup” WMV- AY437609 99 97 SMV- AY216010

Fig. 4. A bootstrap consensus tree based on the complete CP nt sequences of the five ZYMV isolates from Vietnam (dotted, in bold and highlighted in grey) and 56 database sequences. Other viruses of the “BCMV subgroup” were also included as an outgroup. Only bootstrap values (%) greater than 50% (1000 replicates) are indicated.

231

232

The sequences of the two SYSV isolates from shallot (SYSV-VN/S1 and -VN/S2) were nearly identical (98.9% identity) and shared lower identities (90.1 and 90.6%, respectively) with the leek isolate. When compared with other reported SYSV isolates,

SYSV-VN/S1 and -VN/S2 showed very high identities (98.1 and 98.4%, respectively) with a Welsh onion SYSV isolate from China, whereas the leek isolate SYSV-VN/L1 showed highest identity (90.8%) with a Japanese SYSV isolate infecting Japanese

Allium (Table 2).

For LYSV, the two isolates, LYSV-VN/L2 and –VN/L3, shared 93.4% identity, and showed between 77.5-84.1% identity with other reported LYSV isolates. The highest identities (82.6 and 84.1%, respectively) were with a garlic isolate from Taiwan (Table

2).

For OYDV, isolates OYDV-VN/L4 and –VN/L5 shared 86.7% identity, and showed between 79.8-90.4% identity with other reported OYDV isolates. The highest identities

(90.4 and 89.2%, respectively) were with two garlic isolates from China (Table 2).

Turnip mosaic virus (TuMV)

Five TuMV isolates were identified; two from Chinese radish (TuMV-VN/Rs1 and –

VN/Rs2) and three from Chinese mustard (-VN/Bj1, -VN/Bj2 and –VN/Bj3) (Table 2).

When compared to each other, the sequences showed between 94.2-97.6% identity.

Interestingly, these isolates showed higher identities to East Asian TuMV isolates than

233

to each other. Isolates, TuMV-VN/Rs1, -VN/Bj1 and –VN/Bj3, had highest identities

(98.4, 97.7 and 98.4%, respectively) with the cabbage TuMV-TU3 isolate from Japan

(Table 2). Similarly, the TuMV-VN/Rs2 and –VN/Bj2 isolates shared highest identities with a Chinese cabbage isolate from Korea and a radish isolate from Taiwan (98.1 and

98.6%, respectively) (Table 2). In phylogenetic analysis (not shown), all Vietnamese isolates grouped with the East Asian isolates.

Dasheen mosaic virus (DsMV)

Three DsMV isolates were isolated; two from taro (DsMV-VN/Ce1 and –VN/Ce2) and one (-VN/Tt1) from typhonia (Typhonium trilobatum), a medicinal herb (Table 2). The sequence identities between all three isolates were low, ranging from 68.1-74.1%.

Similarly, when the sequences of DsMV–VN/Ce1 and –VN/Tt1 were compared with other reported isolates, the highest identities were only 79% and 77.6%, respectively

(Table 2). In the case of DsMV–VN/Ce2, the most closely related virus was a Japanese

DsMV taro isolate (90.7% identity) (Table 2).

The size of the CP-coding region in the three Vietnamese DsMV isolates varied considerably, comprising 1008 nucleotides (336 amino acids) for DsMV–VN/Ce1, 939 nucleotides (313 amino acids) for DsMV–VN/Ce2 and 855 nucleotides (283 amino acids) for DsMV–VN/Tt1. Analysis of these CP sequences revealed that the N-terminal region, located between the DAG motif and the conserved sequence, KDVNA, was

234

highly variable and contained repeated motifs comprising uncharged amino acids, such as G, T, P and N.

Sweet potato feathery mottle virus (SPFMV)

Two SPFMV sequences were isolated from symptomatic sweet potato plants, and were designated SPFMV-VN/SP1 and -VN/SP2 (Table 2). The sequences of the two isolates shared 94.8% identity. When compared with the other sequences, SPFMV-VN/SP1 had highest identity (96.2%) with a SPFMV isolate from Portugal, whereas SPFMV–

VN/SP2 had highest identity (96.1%) with an isolate from Uganda.

A phylogenetic tree, constructed using 69 available SPFMV CP nucleotide sequences, showed that SPFMV isolates were grouped into four distinct clusters corresponding to the four SPFMV strains, namely RC (russet crack), C (common), EA

(East Africa) and O (result not shown). The two Vietnamese isolates grouped within the

EA cluster; this cluster was unusual in that, of the 33 SPFMV sequences, 31 originated from African countries while the remaining two were from Portugal and Spain.

Discussion

With the exception of BCMV and PVY, which have been previously reported in

Vietnam, this is the first report of SCMV, SrMV, ChiVMV, ZYMV, LYMV, SYSV,

OYDV, TuMV, DsMV and SPFMV in Vietnam. Further, a novel potyvirus associated

235

with distinctive ringspot symptoms was identified in chilli plants and designated

ChiRSV.

Two isolates of the PStV strain of BCMV, infecting soybean and rabbit bell, were reported in Vietnam for the first time. Although PStV is considered a peanut-infecting strain of BCMV [21], it has also often been found infecting other legumes, particularly soybean [33]. The identification of rabbit bell (Crotalaria anagyroides) as a natural host of PStV indicates the virus has a wider natural host range than previously known. Two isolates of BCMV, isolated from black bean and yard-long bean (BCMV-VN/BB2-5 and

-YB2, respectively), showed surprisingly high variability in the CP gene. Both isolates shared low sequence identities with other BCMV isolates, and their N-terminal regions did not contain the three epitopes, B/3 (QPQPPI), B3A (GVES) and B/4

(VV/LDAGV/ADTV), which are specific for the BlCMV, PStV and many other strains of BCMV [20]. These isolates also formed a distinct phylogenetic cluster that was intermediate between the major BCMV cluster and that comprising other viruses of the

“BCMV subgroup”. The complete sequences of these isolates will be required to further clarify their relationships with other BCMV isolates.

The SCMV isolates from Vietnam were extremely diverse. Interestingly, the SCMV-

VN/AR1 isolated from arrowroot was distinct from the SCMV-Abaca strain that naturally infects arrowroot in the Philippines [13]. Within the diverse Cluster I of the

SCMV phylogenetic tree, several sub-clusters have been defined based on hosts or geographical origins [9, 14]. The three Vietnamese isolates, SCMV-VN/M1, –VN/M2

236

and –VN/SC1, together with the isolates from Thailand, formed such a sub-cluster which was closely related to isolates infecting sugarcane and maize from Thailand.

Phylogenetic analyses also showed that three sugarcane isolates, SCMV-VN/SC2, -

VN/SC3 and –VN/SC4, comprised a distinct cluster, Cluster IV. The basal position of this cluster and their highly divergent CP sequences suggested that these three isolates may have evolved from a common ancestor.

PVY, and many other potyviruses that currently infect solanaceous plants, are thought to have originated from Peru [28]. Although the exact origin of PVY in Vietnam is unknown, it is thought that the virus was introduced into Vietnam, probably from infected potato originating from Europe, sometime in the 19th century. The presence of three different phylogenetic lineages of PVY in Vietnam, however, indicates that this might not be the case and that the introduction of the virus into Vietnam might have arisen from both potato and non-potato sources.

Phylogenetic analysis showed that the ZYMV isolates in Vietnam were very diverse.

Surprisingly, none of the Vietnamese isolates grouped in Cluster I which comprised

ZYMV isolates distributed worldwide and is equivalent to the “Group A” ZYMV isolates described by Desbiez et al. [10] or Group I and II ZYMV isolates described by

Zhao et al. [34]. ZYMV-VN/Cm3 grouped with two ZYMV isolates from Singapore and

Reunion Island to form Cluster II which was considered “Group B” by Desbiez et al.

[10] or “Out group” by Zhao et al. [34]. The four Vietnamese isolates (ZYMV-VN/Bh1,

ZYMV-VN/Cs1, -VN/Cm1 and –VN/Cm2), together with six Chinese isolates, formed

237

Cluster III, which was equivalent to the Group III by Zhao et al. [34] and clearly distal and basal to all other clusters.

Although this is the first report of TuMV from brassica plants in Vietnam, the virus has been previously reported infecting calla lily bulbs imported into Taiwan from

Vietnam [7]. In phylogenetic analysis, all Vietnamese TuMV isolates grouped with East

Asian isolates within the cluster equivalent to the World-B group defined by Tomimura et al. [32]. The World-B group includes most of the TuMV isolates isolated from brassica plants. This group appeared to be split into 2 sub-populations, one from West

Eurasia and other continents, which included B type (infect only Brassica plants) isolates, and another from East Asia (China, Korea and Japan) which contained both B and BR type (infect both Brassica and Raphanus plants) isolates [22, 29, 31, 32].

This study identified typhonia (Typhonium trilobatum) as a new natural host of

DsMV. Further, consistent with previous studies [8, 12, 23, 26], sequence analyses revealed that the CP sequences of the DsMV isolates from Vietnam were highly variable and contained repeated motifs in the N-terminal region.

In conclusion, we have identified many new potyviruses in Vietnam, infecting a broad range of plant species. The high degree of sequence diversity and the basal position of many of the viral sequences in phylogenetic trees, suggests that potyviruses have been present in Vietnam for a considerable period.

238

Acknowledgements

The authors thank the Australian Centre for International Agricultural Research

(ACIAR) for funding this research. HC was supported by a QUT International

Postgraduate Research Scholarship.

References

1. Adams MJ, Antoniw JF, Beaudoin F (2005) Overview and analysis of the

polyprotein cleavage sites in the family Potyviridae. Mol Plant Pathol 6: 471-487

2. Adams MJ, Antoniw JF, Fauquet CM (2005) Molecular criteria for genus and

species discrimination within the family Potyviridae. Arch Virol 150: 459-479

3. Bateson MF, Henderson J, Chaleeprom W, Gibbs AJ, Dale JL (1994) Papaya

ringspot potyvirus - isolate variability and the origin of PRSV type-P (Australia).

J Gen Virol 75: 3547-3553

4. Bateson MF, Lines RE, Revill P, Chaleeprom W, Ha CV, Gibbs AJ, Dale JL

(2002) On the evolution and molecular epidemiology of the potyvirus Papaya

ringspot virus. J Gen Virol 83: 2575-2585

5. Bell KE, Dale JL, Ha CV, Vu MT, Revill PA (2002) Characterisation of Rep-

encoding components associated with Banana bunchy top nanovirus in Vietnam.

Arch Virol 147: 695-707

239

6. Berger PH, Adams MJ, Barnett OW, Brunt AA, Hammond J, Hill JH, Jordan

RL, Kashiwazaki S, Rybicki E, Spence N, Stenger DC, Ohki ST, Uyeda I, van

Jaayen A, Valkonen J, Vetten HJ (2005) Potyviridae. In: Fauquet CM, Mayo

MA, Maniloff J, Desselberger U and Ball LA (eds) Virus Taxonomy. VIIIth

Report of the International Committee on Taxonomy of Viruses.

Elsevier/Academic Press, London

7. Chen CC, Chao CH, Yeh SD, Tsai HT, Chang CA (2003) Identification of

Turnip mosaic virus isolates causing yellow stripe and spot on calla lily. Plant

Dis 87: 901-905

8. Chen J, Chen JP, Chen JS, Adams MJ (2001) Molecular characterisation of an

isolate of Dasheen mosaic virus from Zantedeschia aethiopica in China and

comparisons in the genus Potyvirus. Arch Virol 146: 1821-1829

9. Chen J, Chen JP, Adams MJ (2002) Characterisation of potyviruses from

sugarcane and maize in China. Arch Virol 147: 1237-1246

10. Desbiez C, Wipf-Scheibel C, Lecoq H (2002) Biological and serological

variability, evolution and molecular epidemiology of Zucchini yellow mosaic

virus (ZYMV, Potyvirus) with special reference to Caribbean islands. Virus Res

85: 5-16

11. Fanigliulo A, Comes S, Pacella R, Harrach B, Martin DP, Crescenzi A (2005)

Characterisation of Potato virus Y nnp strain inducing veinal necrosis in pepper:

a naturally occurring recombinant strain of PVY. Arch Virol 150: 709-720

240

12. Farreyrol K, Pearson MN, Grisoni M, Cohen D, Beck D (2006) Vanilla mosaic

virus isolates from French Polynesia and the Cook Islands are Dasheen mosaic

virus strains that exclusively infect vanilla. Arch Virol 151: 905-919

13. Gambley CF, Thomas JE, Magnaye LV, Herradura L (2004) Abaca mosaic

virus: a distinct strain of Sugarcane mosaic virus. Australas Plant Pathol 33: 475-

484

14. Gemechu AL, Chiemsombat P, Attathom S, Reanwarakorn K, Lersrutaiyotin R

(2006) Cloning and sequence analysis of coat protein gene for characterization of

Sugarcane mosaic virus isolated from sugarcane and maize in Thailand. Arch

Virol 151: 167-172

15. Gibbs AJ, Mackenzie AM, Gibbs MJ (2003) The 'potyvirid primers' will

probably provide phylogenetically informative DNA fragments from all species

of Potyviridae. J Virol Methods 112: 41-44

16. Ha C, Coombs S, Revill P, Harding R, Vu M, Dale J (2006) Corchorus yellow

vein virus, a New World geminivirus from the Old World. J Gen Virol 87: 997-

1003

17. Hao NB, Albrechtsen SE, Nicolaisen M (2003) Detection and identification of

the blackeye cowpea mosaic strain of Bean common mosaic virus in seeds of

Vigna unguiculata sspp. from North Vietnam. Australas Plant Pathol 32: 505-

509

241

18. Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for molecular

evolutionary genetics analysis and sequence alignment. Brief Bioinform 5: 150-

163

19. Mackenzie AM, Nolan M, Wei KJ, Clements MA, Gowanlock D, Wallace BJ,

Gibbs AJ (1998) Ceratobium mosaic potyvirus: another virus from orchids. Arch

Virol 143: 903-914

20. Mink GI, Vetten HJ, Wyatt SD, Berger PH, Silbernagel MJ (1999) Three

epitopes located on the coat protein amino terminus of viruses in the bean

common mosaic potyvirus subgroup. Arch Virol 144: 1173-1189

21. Mishra A, Gohel VR, Valand GB, Patel JG, Shukla DD (1993) Peanut stripe

virus-disease of groundnut - a review. Int J Pest Manag 39: 210-215

22. Ohshima K, Yamaguchi Y, Hirota R, Hamamoto T, Tomimura K, Tan ZY, Sano

T, Azuhata F, Walsh JA, Fletcher J, Chen JS, Gera A, Gibbs A (2002) Molecular

evolution of Turnip mosaic virus: evidence of host adaptation, genetic

recombination and geographical spread. J Gen Virol 83: 1511-1521

23. Pappu S, Pappu H, Rybicki E, Niblett C (1994) Unusual amino-terminal

sequence repeat characterizes the capsid protein of Dasheen mosaic potyvirus. J

Gen Virol 75: 239-242

24. Revill PA, Ha CV, Lines RE, Bell KE, Vu MT, Dale JL (2004) PCR and ELISA-

based virus surveys of banana, papaya and cucurbit crops in Vietnam. Asia Pac J

Mol Biol Biotechnol 12: 27-32

242

25. Rodoni BC, Dale JL, Harding RM (1999) Characterization and expression of the

coat protein-coding region of Banana bract mosaic potyvirus, development of

diagnostic assays and detection of the virus in banana plants from five countries

in southeast Asia. Arch Virol 144: 1725-1737

26. Shi YH, Hong XY, Chen J, Adams MJ, Zheng HY, Lin L, Qin BX, Chen JP

(2005) Further molecular characterisation of potyviruses infecting aroid plants

for medicinal use in China. Arch Virol 150: 125-135

27. Shukla DD, Ward CW, Brunt AA, Berger PH (1998) Potyviridae family. AAB

Descriptions of Plant Viruses No. 366

28. Spetz C, Taboada AM, Darwich S, Ramsell J, Salazar LF, Valkonen JPT (2003)

Molecular resolution of a complex of potyviruses infecting solanaceous crops at

the centre of origin in Peru. J Gen Virol 84: 2565-2578

29. Tan ZY, Wada Y, Chen JS, Ohshima K (2004) Inter- and intralineage

recombinants are common in natural populations of Turnip mosaic virus. J Gen

Virol 85: 2683-2696

30. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The

CLUSTAL_X windows interface: flexible strategies for multiple sequence

alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882

31. Tomimura K, Gibbs AJ, Jenner CE, Walsh JA, Ohshima K (2003) The

phylogeny of Turnip mosaic virus; comparisons of 38 genomic sequences reveal

a Eurasian origin and a recent 'emergence' in East Asia. Mol Ecol 12: 2099-2111

243

32. Tomimura K, Spak J, Katis N, Jenner CE, Walsh JA, Gibbs AJ, Ohshima K

(2004) Comparisons of the genetic structure of populations of Turnip mosaic

virus in West and East Eurasia. Virology 330: 408-423

33. Vetten HJ, Green SK, Lesemann DE (1992) Characterization of Peanut stripe

virus isolates from soybean in Taiwan. J Phytopathol 135: 107-124

34. Zhao MF, Chen J, Zheng HY, Adams MJ, Chen JP (2003) Molecular analysis of

Zucchini yellow mosaic virus isolates from Hangzhou, China. J Phytopathol 151:

307-311

244

CHAPTER 7

GENERAL DISCUSSION AND CONCLUSIONS

245

SPECIFICITY OF DEGENERATE PRIMERS

Degenerate primers to detect begomoviruses The number of complete geminiviruses sequences in databases, particularly of viruses in the genus Begomovirus has increased dramatically over the past five years

(389 DNA-A sequences by 2005) (Fauquet and Stanley, 2005). This increase in genomic sequences has provided an opportunity to design effective degenerate primers for use in geminivirus-specific PCR-based diagnostic tests. Despite the analysis of all available geminivirus sequences in this study, universal geminivirus- specific primers could not be designed due to a lack of suitably sized, highly conserved sequences. Degenerate primers were designed, however, to specifically detect the DNA-A and DNA-B components of viruses in the genus Begomovirus. For the detection of DNA-A, primer BegoAFor1 was designed to the CEGPCKVQS motif located at the N-end of the CP C-terminal region. This region of the CP gene was highly conserved in all begomoviruses, irrespective of whether they were from the Old or New Worlds. The second primer, BegoARev1, was designed to the highly conserved IPT/A/SIF/VLCNP motif which is about 70 amino acids downstream of the putative P loop sequence in the Rep C-terminal region (Laufs et al., 1995). When used in PCR, this primer pair amplified a product of approximately 1.2 kb product which encompassed over two thirds of the CP gene, the entire REn gene and one third of the Rep gene of DNA-A. Sequence analysis of the amplicons generated with these primers also assisted in the discrimination between new and previously characterised begomoviruses; using known begomovirus-infected samples, the nucleotide sequence of the BegoAFor1/BegoARev1-derived amplicon, in most cases, correlated well with that of the complete published sequence. Using these primers, we were able to detect and characterise a large number of begomoviruses from

246

Vietnam. Interestingly, two of them, CoYVV and CoGMV, were more similar to the

New World viruses than previously characterised viruses from the Old World

(discussed later).

To detect begomovirus DNA-B, primer BegoBFor was designed to the

QVPI/F/VNAxG motif which is involved in infectivity and whose N residue is a potential glycosylation site (Ingham et al., 1995). This motif is located at the N- terminal region of the MP and is approximately 700 bp from the nicking site in the stem-loop. Initial attempts using BegoBFor in combination with a consensus primer designed on the invariable loop sequences of the stem-loop structure were unsuccessful, probably due to the high content of C and G residues in the stem sequences. However, when BegoBFor was used in combination with a new, specific primer designed on the iteron sequences in the CR, amplicons of the expected size were obtained from DNA-B of three bipartite begomoviruses (CoGMV, KuMV and

ClGMV). The use of primers designed from the iteron sequences is preferred as the iteron sequences are identical in both DNA components even in bipartite viruses exhibiting substantial differences in the CR sequences such as ToLCGV, CoYVV,

CaLCV and CLCrV (Chakraborty et al., 2003; Ha et al., 2006; Hill et al., 1998; Idris and Brown, 2004).

Degenerate primers to detect potyviruses The conserved sequences previously used to design degenerate primers for potyvirus detection are mainly located in the 3’ region (NIb and CP-coding regions, and 3’

UTR) of potyvirus genomes. In the NIb-coding region, the consensus motif

(GNNSGQPSTVVDN) was shown to be highly conserved among members of the family Potyviridae (Gibbs et al., 2003), and the use of degenerate primers designed

247

from this motif have been demonstrated for numerous potyviruses (Chen and Adams,

2001; Gibbs and Mackenzie, 1997). In this study, degenerate primers were designed to sequences of the GQPSTVV (NIbFor1) and NSGQPSTVV (NIbFor2) motifs and these were used as diagnostic primers to detect numerous viruses in the genus

Potyvirus. To amplify additional 3’ sequences, primer PV2IT7 primer (Mackenzie et al., 1998) and a dT primer were normally used. In many instances, however, no amplicons were obtained using this primer combination, probably due to a low concentration of viral RNA. To overcome this problem, diluted products from the initial PCR were used in a second round of amplification, using primer NIbFor2 in combination with a 3’ end specific primer; in most cases, a single, strong band was generated.

Due to the large genome size, the complete sequences of members of the family

Potyviridae have usually been obtained from overlapping PCR fragments. In this study, two alternative sets of degenerate primers, HPFor/HPRev and CIFor/CIRev, were developed to amplify genomic sequences in the 5’ (HC-Pro) and central (CI) regions, respectively, of the potyvirus genome. These primers specifically detected members of the genus Potyvirus and their use offered several advantages over existing methods. Arguably, the major advantage of these primers lies in their ability to amplify sequences in the central and 5’ regions of the potyviral genome. The distance from the HPFor/HPRev-derived sequence to the 5’ end of the genome is approximately 2 kb, which, as demonstrated in this study, can be obtained by a

RACE protocol. From the observation that the 5’ ends of potyvirus genomes are terminated in few (usually 2 – 4) adenosine residues, the specificity and yield of 5’

RACE was also improved by using a dT primer terminated by two A’s

248

(Anchor17T2A). The combination of the newly developed primers with currently available primers to amplify the 3’ genome sequences will facilitate the cloning, sequencing and characterisation of complete potyvirus genomes. Indeed, the utility of this strategy was clearly demonstrated by the sequencing and characterisation of the complete genomes of four potyviruses, TelMV, PeLMV, WTMV and BBrMV.

Finally, the use of the CIFor and CIRev primers may also have utility from a taxonomic perspective, since overall sequence identities in potyviruses are most accurately reflected in the CI gene (Adams et al., 2005a). As such, the sequence of the CIFor/CIRev-derived amplicons may provide sufficient genetic information to allow the differentiation of potyviruses at the species level. In support of this statement, the three new viruses identified in this study were initially predicted from the sequences of their CIFor/CIRev-derived amplicons.

SIGNIFICANCE OF THE IDENTIFICATION OF TWO BIPARTITE

BEGOMOVIRUSES INFECTING JUTE PLANTS IN VIETNAM

Two bipartite viruses, CoYVV and CoGMV, were isolated from jute in Vietnam and were shown to be related, but distinct, begomoviruses using sequence and phylogenetic analyses. This distinction was based on the low sequence identities in both DNA-A and –B between the two viruses (71.3% and 50.9%, respectively), the different sequence and arrangement of their iterons and iteron-related domains (IRD) and the lack of evidence for any recombination events involving the two viruses.

249

In addition to their high sequence similarity and close phylogenetic relationships, the genomes of both CoGMV and CoYVV, and other New World viruses, shared several common features including; (i) they were bipartite, (ii) their CP N-terminal region contained a conserved motif, 7-PWRsMaGT, but lacked the second and third basic domains which form an essential part of the nuclear localization signal (NLS) whose role in nuclear targeting has been demonstrated for the Old World viruses, TYLCV

(Kunik et al., 1998), ACMV (Unseld et al., 2001) and MYMV (Guerra-Peraza et al.,

2005) and (iii) they lacked an AV2 gene which plays a role in symptom development, efficient viral movement and viral DNA accumulation (Padidam et al.,

1996; Rigden et al., 1993).

Bipartite viruses are thought to have evolved from monopartite viruses by gene duplication and/or DNA acquisition, with gene products encoded on DNA-B providing enhanced viral movement within the host (Mansoor et al., 2003; Rojas et al., 2005). The evolution of bipartite viruses was also thought to have occurred before continental separation since bipartite viruses are found in both of the Old

World and New World (Rojas et al., 2005). All New World viruses lack the AV2

ORF, and it was proposed that they evolved from a common ancestor that had lost the AV2 ORF after the Gondwana continental separation (Rybicki, 1994). However, the presence of both CoYVV and CoGMV in Vietnam bearing features similar to

New World viruses suggests that viruses with characteristics of New World viruses were present in the Old World prior to continental separation.

250

The presence of putatively New World viruses such as CoYVV and CoGMV in

Vietnam raises the question about the mechanism(s) by which bipartite viruses evolved into distinct Old World and New World populations. It is possible that this process involves the genomic sequences encoding the AV2 ORF and CP N-terminal region. Harrison et al. (2002) and Sharma et al. (2005) observed the apparent variability in the N-terminal 50 residues from 27 and 10 CP sequences, respectively, of viruses originating from different continents. In the current study, comparison of the deduced CP sequences from a large number of the New World and Old World viruses showed that their CPs were clearly divided into distinct N-terminal and C- terminal regions. The C-terminal region was conserved in all begomoviruses, irrespective of whether they were from the Old or New Worlds, supporting the hypothesis that New World viruses emerged more recently (Rybicki, 1994). In contrast, the N-terminal region, which consisted of ~39 amino acids for the New

World viruses and ~45 amino acids for the Old World viruses, was relatively conserved within the two groups but differed markedly between them. The AV2 gene

(~115 amino acids) overlaps the CP gene by approximately 60 amino acids, and thus encompasses the entire CP N-terminal region, suggesting that a change in this region, would affect the function of both the AV2 and CP genes. Both CoYVV and

CoGMV lack these sequences suggesting that they, and their progenitors, required these functions to be encoded on an additional DNA molecule, namely DNA-B. This may explain (i) why all New World viruses have a bipartite genome and (ii) why the

DNA-B of some Old World bipartite viruses, such as TYLCTHV (Rochester et al.,

1990) or Sri Lankan cassava mosaic virus (SLCMV) (Saunders et al., 2002), are dispensable for disease induction.

251

Phylogenetic analysis based on complete begomovirus genome sequences revealed two geographically defined major clusters (the Old World and New World viruses) and three other distinct clusters distinguished on the basis of the host (legume, sweet potato and jute). The intermediate positions of the sweet potato and jute viruses between the Old World and New World populations suggested that the geographical separation appears to play a less important role than previously thought in the evolution of the genus Begomovirus.

Based on above analyses, an evolutionary model of the genus Begomovirus is proposed (Fig. 8.1) to explain the speciation of the New World bipartite virus population. If correct, it is possible that other begomoviruses, similar to the New

World viruses, will be found in the Old World.

A HIGH DEGREE OF BEGOMOVIRUS AND SATELLITE DIVERSITY

WAS IDENTIFIED IN VIETNAM

Using novel degenerate primers, we identified 17 begomovirus species infecting crop and weed species from Vietnam including CoYVV and CoGMV. Analyses based on the complete nucleotide sequences revealed that ten of the viruses (six monopartite and four bipartite) were new species. Of seven previously characterised viruses, five were identified in Vietnam for the first time. Eight DNA-β and three nanovirus-like

DNA-1 molecules were also found associated with the monopartite viruses; five of the DNA-β molecules were putatively novel.

252

Old World New World

Origin: Ancient extrachromosomal ssDNA replicons in DNA-A prokaryotic or primitive eukaryotic ancestors

Ancestral monopartite viruses

DNA-A Recombination or mutation in the overlapping region of the AV2 and CP genes Origin: DNA-B Component and gene duplication/ acquisition Ancestral bipartite viruses DNA-A

DNA-B

Ancestral New World bipartite virus Gondwana separation?

DNA-A DNA-A DNA-A DNA-A DNA-A

Monopartite Origin: DNA-β viruses Unknown DNA-B DNA-B DNA-B

Origin: DNA-1 Nanovirus Old World CoYVV New World bipartite viruses CoGMV bipartite viruses Monopartite virus, DNA-β and DNA-1 complexes

Figure 8.1. An evolutionary model of the genus Begomovirus. The model is based on that proposed by Mansoor et al. (2003) and Rojas et al. (2005), and on the findings from this study. The evolutionary pathway of New World bipartite viruses is based on comparisons of the AV2 and CP genes.

253

254

Ten begomoviruses identified in this study infect many different weed species.

Weeds can serve as reservoirs for crop-infecting geminiviruses (Gilbertson et al.,

1993; Stonor et al., 2003) and it has been proposed that weed-infecting begomoviruses can adapt to infect crops via recombination during mixed infections

(Hofer et al., 1997; Padidam et al., 1999; Roye et al., 1999). The significant similarities in replication-related genomic features (the iterons, IRD motif and Rep protein) observed between distinct viruses such as ErYMV/TYLCCNV,

LuYVVNV/ToLCLV and TYLCVNV/AYVV, suggested that they can replicate in a trans-acting manner similar to that previously reported (Fontes et al., 1994a; Fontes et al., 1994b; Jupin et al., 1995); this may facilitate gene exchanges between them, during mixed infections, via recombination-dependent replication (RDP) (Jeske et al., 2001). Indeed, computer programs detected recombination events between

SiLCV-[Tha:Abu:61] and StaLCuV, ErYMV and TYLCCNV, and between

TYLCVNV and ToLCVV; in the latter case, the non-ToLCVV part of TYLCVNV probably originated from an AYVV-like virus.

One interesting finding from this study was the nonanucleotide sequence of CoGMV comprising TATTATTAC rather than TAATATTAC. Although the third residue of this sequence seems to be relaxed among nanoviruses (TAT/GTATTAC) and animal circoviruses (T/C/AAT/GTATTAC) (Hattermann et al., 2003), this was the first report of such variation in geminiviruses. This study also provided the first report of differences in the stem sequences between two components of a bipartite begomovirus (KuMV). This was unexpected because the sequence of this structure has been found to be almost identical between the two genomic components of

255

geminiviruses, even in those exhibiting low identities in the CR sequences

(Chakraborty et al., 2003; Ha et al., 2006; Hill et al., 1998; Idris and Brown, 2004).

However, since it is the ability to form a stem-loop structure, and not the sequence of the stem itself, that is important for DNA replication (Orozco and Hanley-Bowdoin,

1996), the differences in the putative stem sequences of KuMV should not affect replication.

The high degree of both bipartite and monopartite begomoviruses and satellite diversity, identified from a wide range of plants, suggested that Vietnam is probably a centre of origin for begomovirus evolution.

A HIGH DEGREE OF POTYVIRUS DIVERSITY WAS IDENTIFIED IN

VIETNAM

Four new, and 12 previously characterised, potyviruses were identified in a range of crops and weeds in Vietnam. With the exception of BCMV (BlCMV strain) and

PVY (Hao et al., 2003; Vu, 1984), the remaining viruses were detected in Vietnam for the first time.

The complete genomes of three novel potyviruses, TelMV, PeLMV and WTMV infecting telosma, peace lily and wild tomato, respectively, were sequenced. The complete genome of a Philippines isolate of BBrMV, a characterised potyvirus infecting banana in the Southeast Asian region (Rodoni et al., 1999), was also obtained for the first time. All four viruses possessed genomic features typical of the

256

genus Potyvirus. The sequence comparisons and phylogenetic analyses indicated that

WTMV was most closely related to ChiVMV and PVMV, two potyviruses infecting solanaceous crops, while PeLMV, TelMV and BBrMV were related to members of the BCMV subgroup which includes several different viruses infecting both monocot and dicot, legume and non-legume plants (Berger et al., 1997).

Using degenerate CI primers, 13 potyviruses were detected in a broad range of crops showing typical virus symptoms. The identity of these viruses was subsequently determined by sequencing. To date, the CP-coding region of potyviruses has been mainly used to establish evolutionary relationships at both species and strain levels

(Shukla and Ward, 1989; Ward et al., 1992; Ward and Shukla, 1991) primarily because the majority of potyvirus sequences on databases are derived from this region (Adams et al., 2005b). Therefore, the NIb-3’ end genomic region (which includes the entire CP) of the 13 potyviruses detected in this study was amplified, cloned and sequenced. Interestingly, using degenerate primers specific for the NIb- coding region, a fourth novel potyvirus, ChiRSV, was detected in a chilli sample with ringspot symptoms.

Previously undescribed natural hosts of the PStV strain of BCMV (PStV-VN/Ca1) and DsMV (DsMV-VN/Tt1) were also identified. Rabbit bell (Crotalaria anagyroides), a fabaceous cover crop in coffee plantations, was found to be another fabaceous host for the PStV strain of BCMV, having been previously reported from peanut and soybean (Vetten et al., 1992; this study). Typhonia (Typhonium trilobatum), a medicine herb, was found to be a new host for DsMV.

257

Sequence and phylogenetic analyses based on the complete CP gene revealed considerable variability in many species within Vietnam. The species with unexpected variability in the CP gene were BCMV, SCMV, PVY and ZYMV. The phylogenetic evidence also suggested the presence of the ancestral groups of BCMV,

SCMV and ZYMV in Vietnam.

IMPACT OF THESE STUDIES ON PLANT QUARANTINE IN VIETNAM

At the commencement of this project, only 13 plant viruses had been identified in

Vietnam by either ELISA or sequencing. Currently, the list of quarantine plant viruses in Vietnam is restricted to Rice hoja blanca virus (RHBV), Peanut stripe virus (PStV) strain of BCMV and Coffee ringspot virus (CoRSV) (Ministry of

Agriculture and Rural Development of Vietnam, 2005). The large number of potyviruses and begomoviruses identified in Vietnam in this study will provide valuable information to establish a plant virus list that will be useful for conducting a pest risk analysis (PRA) (FAO, 1996) relating to the movement of plant material imported into, and exported from, Vietnam.

258

REFERENCES

Adams, M. J., Antoniw, J. F., and Beaudoin, F. (2005a). Overview and analysis of

the polyprotein cleavage sites in the family Potyviridae. Molecular Plant

Pathology 6, 471-487.

Adams, M. J., Antoniw, J. F., and Fauquet, C. M. (2005b). Molecular criteria for

genus and species discrimination within the family Potyviridae. Archives of

Virology 150, 459-479.

Berger, P. H., Wyatt, S. D., Shiel, P. J., Silbernagel, M. J., Druffel, K., and Mink, G.

I. (1997). Phylogenetic analysis of the Potyviridae with emphasis on legume-

infecting potyviruses. Archives of Virology 142, 1979-1999.

Chakraborty, S., Pandey, P. K., Banerjee, M. K., Kalloo, G., and Fauquet, C. M.

(2003). Tomato leaf curl gujarat virus, a new begomovirus species causing a

severe leaf curl disease of tomato in Varanasi, India. Phytopathology 93,

1485-1495.

Chen, J., and Adams, M. J. (2001). A universal PCR primer to detect members of the

Potyviridae and its use to examine the taxonomic status of several members

of the family. Archives of Virology 146, 757-766.

FAO (1996). Guidelines for Pest Risk Analysis. International Standards for

Phytosanytary Measures (ISPM). Pub. No. 2. FAO. Rome

Fauquet, C. M., and Stanley, J. (2005). Revising the way we conceive and name

viruses below the species level: A review of geminivirus taxonomy calls for

new standardized isolate descriptors. Archives of Virology 150, 2151-2179.

259

Fontes, E., Eagle, P., Sipe, P., Luckow, V., and Hanley-Bowdoin, L. (1994a).

Interaction between a geminivirus replication protein and origin DNA is

essential for viral replication. Journal of Biological Chemistry 269, 8459-

8465.

Fontes, E., Gladfelter, H. J., Schaffer, R. L., Petty, I., and Hanley-Bowdoin, L.

(1994b). Geminivirus replication origins have a modular organization. Plant

Cell 6, 405-416.

Gibbs, A., and Mackenzie, A. (1997). A primer pair for amplifying part of the

genome of all potyvirids by RT-PCR. Journal of Virological Methods 63, 9-

16.

Gibbs, A. J., Mackenzie, A. M., and Gibbs, M. J. (2003). The 'potyvirid primers' will

probably provide phylogenetically informative DNA fragments from all

species of Potyviridae. J Virol Methods 112, 41-4.

Gilbertson, R. L., Hidayat, S. H., Paplomatas, E. J., Rojas, M. R., Hou, Y. M., and

Maxwell, D. P. (1993). Pseudorecombination between infectious cloned

DNA-components of tomato mottle and bean dwarf mosaic geminiviruses.

Journal of General Virology 74, 23-31.

Guerra-Peraza, O., Kirk, D., Seltzer, V., Veluthambi, K., Schmit, A. C., Hohn, T.,

and Herzog, E. (2005). Coat proteins of Rice tungro bacilliform virus and

Mungbean yellow mosaic virus contain multiple nuclear-localization signals

and interact with importin α. Journal of General Virology 86, 1815-1826.

Ha, C., Coombs, S., Revill, P., Harding, R., Vu, M., and Dale, J. (2006). Corchorus

yellow vein virus, a New World geminivirus from the Old World. Journal of

General Virology 87, 997-1003.

260

Hao, N. B., Albrechtsen, S. E., and Nicolaisen, M. (2003). Detection and

identification of the blackeye cowpea mosaic strain of Bean common mosaic

virus in seeds of Vigna unguiculata sspp. from North Vietnam. Australasian

Plant Pathology 32, 505-509.

Harrison, B. D., Swanson, M. M., and Fargette, D. (2002). Begomovirus coat

protein: serology, variation and functions. Physiological and Molecular Plant

Pathology 60, 257-271.

Hattermann, K., Schmitt, C., Soike, D., and Mankertz, A. (2003). Cloning and

sequencing of Duck circovirus (DuCV). Archives of Virology 148, 2471-

2480.

Hill, J. E., Strandberg, J. O., Hiebert, E., and Lazarowitz, S. G. (1998). Asymmetric

infectivity of pseudorecombinants of cabbage leaf curl virus and squash leaf

curl virus: Implications for bipartite geminivirus evolution and movement.

Virology 250, 283-292.

Hofer, P., Bedford, I. D., Markham, P. G., Jeske, H., and Frischmuth, T. (1997). Coat

protein gene replacement results in whitefly transmission of an insect

nontransmissible geminivirus isolate. Virology 236, 288-295.

Idris, A. M., and Brown, J. K. (2004). Cotton leaf crumple virus is a distinct western

hemisphere begomovirus species with complex evolutionary relationships

indicative of recombination and reassortment. Phytopathology 94, 1068-

1074.

Ingham, D. J., Pascal, E., and Lazarowitz, S. G. (1995). Both bipartite geminivirus

movement proteins define viral host range, but only BL1 determines viral

pathogenicity. Virology 207, 191-204.

261

Jeske, H., Lutgemeier, M., and Preiss, W. (2001). DNA forms indicate rolling circle

and recombination-dependent replication of Abutilon mosaic virus. EMBO

Journal 20, 6158-6167.

Jupin, I., Hericourt, F., Benz, B., and Gronenborn, B. (1995). DNA replication

specificity of TYLCV geminivirus is mediated by the amino-terminal 116

amino acids of the Rep protein. FEBS Letters 362, 116-120.

Kadare, G., and Haenni, A. L. (1997). Virus-encoded RNA helicases. Journal of

Virology 71, 2583-2590.

Kunik, T., Palanichelvam, K., Czosnek, H., Citovsky, V., and Gafni, Y. (1998).

Nuclear import of the capsid protein of tomato yellow leaf curl virus

(TYLCV) in plant and insect cells. Plant Journal 13, 393-399.

Laufs, J., Jupin, I., David, C., Schumacher, S., Heyraud-Nitschke, F., and

Gronenborn, B. (1995). Geminivirus replication: Genetic and biochemical

characterisation of Rep protein function, a review. Biochimie 77, 765-773.

Mackenzie, A. M., Nolan, M., Wei, K.-J., Clements, M. A., Gowanlock, D., Wallace,

B. J., and Gibbs, A. J. (1998). Ceratobium mosaic potyvirus: another virus

from orchids. Archives of Virology 143, 903-914.

Mansoor, S., Briddon, R. W., Zafar, Y., and Stanley, J. (2003). Geminivirus disease

complexes: an emerging threat. Trends in Plant Science 8, 128-134.

Ministry of Agriculture and Rural Development of Vietnam (2005). The list of plant

quarantine pests of Socialist Republic of Vietnam. Decision No:

73/2005/QÐ-BNN (in Vietnamese).

262

Orozco, B., and Hanley-Bowdoin, L. (1996). A DNA structure is required for

geminivirus replication origin function. Journal of Virology 70, 148-158.

Padidam, M., Beachy, R. N., and Fauquet, C. M. (1996). The role of AV2 ("precoat")

and coat protein in viral replication and movement in tomato leaf curl

geminivirus. Virology 224, 390-404.

Padidam, M., Sawyer, S., and Fauquet, C. M. (1999). Possible emergence of new

geminiviruses by frequent recombination. Virology 265, 218-225.

Rigden, J. E., Dry, I. B., Mullineaux, P. M., and Rezaian, M. A. (1993). Mutagenesis

of the virion-sense open reading frames of tomato leaf curl geminivirus.

Virology 193, 1001-1005.

Rochester, D. E., Kositratana, W., and Beachy, R. N. (1990). Systemic movement

and symptom production following agroinoculation with a single DNA of

tomato yellow leaf curl geminivirus (Thailand). Virology 178, 520-526.

Rodoni, B. C., Dale, J. L., and Harding, R. M. (1999). Characterisation and

expression of the coat protein-coding region of banana bract mosaic

potyvirus, development of diagnostic assays and detection of the virus in

banana plants from five countries in southeast Asia. Archives of Virology 144,

1725-1737.

Rojas, M. R., Hagen, C., Lucas, W. J., and Gilbertson, R. L. (2005). Exploiting

chinks in the plant's armor: Evolution and emergence of geminiviruses.

Annual Review of Phytopathology 43, 361-394.

Roye, Wernecke, McLaughlin, Nakhla, and Maxwell (1999). Tomato dwarf leaf curl

virus, a new bipartite geminivirus associated with tomatoes and peppers in

263

Jamaica and mixed infection with tomato yellow leaf curl virus. Plant

Pathology 48, 370-378.

Rybicki, E. P. (1994). A phylogenetic and evolutionary justification for 3 genera of

geminiviridae. Archives of Virology 139, 49-77.

Saunders, K., Salim, N., Mali, V. R., Malathi, V. G., Briddon, R., Markham, P. G.,

and Stanley, J. (2002). Characterisation of Sri Lankan cassava mosaic virus

and Indian cassava mosaic virus: Evidence for acquisition of a DNA B

component by a monopartite begomovirus. Virology 293, 63-74.

Sharma, P., Rishi, N., and Malathi, V. G. (2005). Molecular cloning of coat protein

gene of an Indian cotton leaf curl virus (CLCuV-HS2) isolate and its

phylogenetic relationship with others members of geminiviridae. Virus Genes

30, 85-91.

Shukla, D. D., and Ward, C. W. (1989). Identification and classification of

potyviruses on the basis of coat protein sequence data and serology. Brief

review. Archives of Virology 106, 171-200.

Stonor, J., Hart, P., Gunther, M., DeBarro, P., and Rezaian, M. A. (2003). Tomato

leaf curl geminivirus in Australia: occurrence, detection, sequence diversity

and host range. Plant Pathology 52, 379-388.

Unseld, S., Hohnle, M., Ringel, M., and Frischmuth, T. (2001). Subcellular targeting

of the coat protein of African cassava mosaic geminivirus. Virology 286, 373-

383.

Vetten, H. J., Green, S. K., and Lesemann, D. E. (1992). Characterisation of peanut

stripe virus isolates from soybean in Taiwan. Journal of Phytopathology 135,

107-124.

264

Vu, M. T. (1984). Study of the viruses infecting poatato in North Vietnam. PhD

thesis (in Vietnamese). Hanoi Agricultural University. Hanoi - Vietnam.

Ward, C. W., McKern, N. M., Frenkel, M. J., and Shukla, D. D. (1992). Sequence

data as the major criterion for potyvirus classification. Archives of Virology

(Suppl.) 5, 283-297.

Ward, C. W., and Shukla, D. D. (1991). Taxonomy of potyviruses: current problems

and some solutions. Intervirology 32, 269-296.

265