DOCSLIB.ORG

A Neuronal Subunit (KCNMB4) Makes the Large Conductance, Voltage

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Neuronal Subunit (KCNMB4) Makes the Large Conductance, Voltage A neuronal ␤ subunit (KCNMB4) makes the large conductance, voltage- and Ca2؉-activated K؉ channel resistant to charybdotoxin and iberiotoxin Pratap Meera*†, Martin Wallner*†, and Ligia Toro*‡§ Departments of *Anesthesiology and ‡Molecular and Medical Pharmacology and the Brain Research Institute, University of California, Los Angeles, CA 90095-7115 Communicated by Ramon Latorre, Center for Scientific Studies of Santiago, Valdivia, Chile, March 15, 2000 (received for review February 4, 2000) Large conductance voltage and Ca2؉-activated K؉ (MaxiK) chan- magnocellular neurons a CTx-sensitive isoform is localized on nels couple intracellular Ca2؉ with cellular excitability. They are the cell body (22), whereas a CTx-insensitive isoform is present composed of a pore-forming ␣ subunit and modulatory ␤ subunits. at the nerve endings (23). In addition, MaxiK currents in other The pore blockers charybdotoxin (CTx) and iberiotoxin (IbTx), at neuronal preparations are only partially blocked by CTx and nanomolar concentrations, have been invaluable in unraveling IbTx (15, 24). MaxiK channel physiological role in vertebrates. However in mam- Herein, we report that coexpression of a neuronal MaxiK malian brain, CTx-insensitive MaxiK channels have been described channel ␤ subunit (␤4) leads to a MaxiK channel phenotype that [Reinhart, P. H., Chung, S. & Levitan, I. B. (1989) Neuron 2, 1031– displays a low apparent IbTx and CTx sensitivity due to dramat- 1041], but their molecular basis is unknown. Here we report a ically decreased toxin association rates, by Ϸ250–1,000 fold. human MaxiK channel ␤-subunit (␤4), highly expressed in brain, Exchange of the extracellular loop between the smooth muscle which renders the MaxiK channel ␣-subunit resistant to nanomolar ␤1 and neuronal ␤4 subunits shows that this domain is respon- concentrations of CTx and IbTx. The resistance of MaxiK channel to sible for toxin resistance. We propose that the assembly of the toxin block, a phenotype conferred by the ␤4 extracellular loop, neuronal MaxiK channel ␤4 subunit with its pore forming ␣ results from a dramatic (Ϸ1,000 fold) slowdown of the toxin subunit in the brain forms the molecular basis for toxin- association. However once bound, the toxin block is apparently insensitive MaxiK channels found in neurons. irreversible. Thus, unusually high toxin concentrations and long exposure times are necessary to determine the role of ‘‘CTx͞IbTx- Experimental Procedures insensitive’’ MaxiK channels formed by ␣ ؉ ␤4 subunits. Cloning and Expression. The MaxiK ␤3 and ␤4 subunits were identified in the expressed sequence tag (EST) database. ␤3 axiK (large conductance, voltage- and Ca2ϩ-activated Kϩ) (accession no. AF160968) and ␤4 (accession no. AF160967) Mchannels are composed of a pore-forming ␣ subunit (1) cDNA clones were isolated from an arrayed, normalized human and modulatory transmembrane ␤ subunits (2–4). Association cDNA library (␤3, L12-D12; ␤4, F23F16; HUCL-Array library, with tissue-specific modulatory ␤ subunits may account for much Stratagene). The ␤3 clone contains several in-frame upstream of the phenotypic MaxiK channel variability observed in native stop codons before the start methionine. The sequence upstream tissues (5). ␤ subunits increase the apparent Ca2ϩ͞voltage of the Kozak consensus sequence (25) of ␤4 clone F23F16 is sensitivity of the ␣ subunit (3, 6, 7), modify channel kinetics unusually GC-rich (82.5% G ϩ C in 337 bases), a feature (8–10), and alter its pharmacological properties (3, 11). MaxiK frequently found in 5Ј-untranslated regions, and lacks an up- channel ␤1 and ␤2 subunits can alter the charybdotoxin (CTx) stream in-frame stop codon. For functional expression and in and iberiotoxin (IbTx) interaction in electrophysiological (9–11) vitro translation experiments, the untranslated (UT) regions and biochemical (12) studies; however, none of the reported ␤ were removed and replaced with 182 bp 5Ј-UT region from the subunits can account for the toxin-insensitive MaxiK channels Shaker potassium channel. The ␤45Ј-GC-rich region was con- found in brain (13). firmed by genomic sequencing (P1 clone, Genome Systems, St. MaxiK channels are important regulators of neuronal func- Louis). The genomic sequence is identical with the ␤4 cDNA tion. In presynaptic terminals, MaxiK channels are found colo- sequence from position 1 to 673 (ends at CCAAG). After calized with voltage-dependent Ca2ϩ channels and, therefore, position 673 of the cDNA sequence, the genomic clone contains are thought to play a critical role in the regulation of neuro- an intron. transmitter release (14–17). However, because of the lack of The ␤3⌬N38-ball construct contained the N-terminal 19-aa IbTx effects in striatal brain slices (18, 19), the general involve- ‘‘ball’’ from the ␤2 subunit (9), a 7-aa linker (AMGRHEG) ment of MaxiK channels in neurotransmitter release remains followed by ␤3 (from amino acid 39). Chimeric ‘‘␤1–␤4 loop uncertain. IbTx is considered to be a specific MaxiK channel blocker, 2ϩ ϩ whereas CTx also blocks other potassium channels (20). Because Abbreviations: MaxiK channel, large conductance, voltage- and Ca -activated K chan- nel; CTx, charybdotoxin; IbTx, iberiotoxin. of its specificity, IbTx is used as a pharmacological agent to Data deposition: The sequences reported in the paper have been deposited in the GenBank dissect the role of MaxiK channels in physiological processes, database [accession nos. AF160968 (KCNMB3) and AF160967 (KCNMB4)]. and generally it is used at a concentration of 100 nM. In contrast †P.M. and M.W. contributed equally to this work. to smooth and skeletal muscles, where MaxiK channels are §To whom reprint requests should be addressed. E-mail: [email protected]. normally blocked by 100 nM IbTx or CTx, in neurons both The publication costs of this article were defrayed in part by page charge payment. This CTx-sensitive and -insensitive MaxiK channels are found. CTx- article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. insensitive MaxiK channels were first described in rat brain §1734 solely to indicate this fact. membrane preparations (13) and later in embryonic telence- Article published online before print: Proc. Natl. Acad. Sci. USA, 10.1073͞pnas.100118597. phalic neuroepithelium (21). Interestingly, in rat supraoptic Article and publication date are at www.pnas.org͞cgi͞doi͞10.1073͞pnas.100118597 5562–5567 ͉ PNAS ͉ May 9, 2000 ͉ vol. 97 ͉ no. 10 Downloaded by guest on September 29, 2021 exchange’’ constructs ␤1L␤4 and ␤4L␤1 were made using the ball) yielded inactivating currents suggesting that it interacts with overlap extension method (26). The predicted protein sequence the ␣ subunit (not shown). can be deduced from the sequence alignments (Fig. 1) by The similarity of the ␤4 and ␤3 proteins with the other swapping the sequence between transmembrane regions TM1 members of the MaxiK channel ␤ subunit family suggests a and TM2 between ␤1 and ␤4. DNA was sequenced on both common structure with two membrane spanning regions (TM1 strands. Northern and Dot blots (CLONTECH) were hybridized and TM2) separated by a large extracellular loop (Fig. 1a and at high stringency (9). Internal standards were ␤1, ␤2, and ␤4 Fig. 3b, Inset). The ␤4 protein has a consensus sequence for cRNA transcripts (in 200 ng of human placenta total RNA as protein kinase A (PKA) phosphorylation at the C terminus; carrier) spotted on Nytran Plus (Schleicher & Schuell) mem- whereas ␤1, ␤2, and ␤3 carry PKA sites at the N terminus. The branes. The internal standards were processed together with ␤4 and ␤3 extracellular loops contain two consensus sequences the dot blot membranes, and signals were quantified with a for N-linked glycosylation, one of these sites is conserved in all phosphorimager. four human ␤ subunit homologs, and the other is unique (Fig. 1a). Remarkable is the conservation of four cysteine residues Chromosomal Localization. The bacteriophage P1 clone carrying among the ␤ subunit family (12). A dendrogram illustrating the the human genomic ␤4 gene hybridized to the long arm of sequence similarities among ␤-subunit proteins shows that ␤4is chromosome 12 using fluorescent in situ hybridization (Genome closer to the ␤3 subunit than to the ␤1 and ␤2 subunits (Fig. 1b). Systems). This localization was confirmed by cohybridization of To confirm the proposed structural features of the ␤4 and ␤3 the digoxigenin-labeled ␤4 genomic clone with a biotin-labeled subunits, we performed in vitro translation in the presence of probe specific for the centromere of chromosome 12. Hybrid- microsomes and deglycosylation with N-glycosidase F. Electro- ization was visualized with a fluoresceinated antidigoxigenin phoretic size separation of in vitro translated ␤-subunit proteins antibody (␤4-probe) and Texas red avidin for the chromosome leads to bands of the expected molecular mass (Fig. 1c). Treat- 12 centromere-specific probe. ment with N-glycosidase (Fig. 1c, ϩ) reduces the apparent molecular weight by Ϸ8 kDa (␤1, ␤3, and ␤4) and Ϸ12 kDa (␤2), Electrophysiology. Xenopus laevis oocytes were injected with 2 ng consistent with the number of consensus sequences for N-linked of human MaxiK ␣ subunit (hslo; GenBank accession no. glycosylation. Therefore, it is likely that all N-linked glycosyla- U11058) and 4 ng of ␤ subunit cRNAs, which corresponded to tion sites in these MaxiK ␤ subunits are available for N- a Ϸ6 fold molar excess of ␤ cRNA. Based on our previous studies glycosylation in the native protein. with other ␤ subunits, it is likely that ␤3 and ␤4 subunits are at saturating concentrations. HEK293T cells were transfected with The MaxiK Channel ␤4 Subunit mRNA Is Abundant in Brain. Dot blot ␤4 in pcDNA3. Pipette and bath solutions (mM): 110 Kϩ- and Northern blot analysis show strong ␤4 signals in all brain methanesulfonate, 5 KCl, 10 Hepes, 5 N-(2-hydroxyethyl)ethyl- regions (Fig. 2a, lanes A and B, G1) with lower signals in many enediamine triacetic acid, pH 7.0; patch pipettes had resistances other tissues. Dot blot quantification (Fig. 2b) using an internal of 1–2 M⍀. Free Ca2ϩ concentrations were calculated with standard with known amounts of ␤-subunit transcripts (Fig.
Load more

Recommended publications
  • The Mineralocorticoid Receptor Leads to Increased Expression of EGFR
    www.nature.com/scientificreports OPEN The mineralocorticoid receptor leads to increased expression of EGFR and T‑type calcium channels that support HL‑1 cell hypertrophy Katharina Stroedecke1,2, Sandra Meinel1,2, Fritz Markwardt1, Udo Kloeckner1, Nicole Straetz1, Katja Quarch1, Barbara Schreier1, Michael Kopf1, Michael Gekle1 & Claudia Grossmann1* The EGF receptor (EGFR) has been extensively studied in tumor biology and recently a role in cardiovascular pathophysiology was suggested. The mineralocorticoid receptor (MR) is an important efector of the renin–angiotensin–aldosterone‑system and elicits pathophysiological efects in the cardiovascular system; however, the underlying molecular mechanisms are unclear. Our aim was to investigate the importance of EGFR for MR‑mediated cardiovascular pathophysiology because MR is known to induce EGFR expression. We identifed a SNP within the EGFR promoter that modulates MR‑induced EGFR expression. In RNA‑sequencing and qPCR experiments in heart tissue of EGFR KO and WT mice, changes in EGFR abundance led to diferential expression of cardiac ion channels, especially of the T‑type calcium channel CACNA1H. Accordingly, CACNA1H expression was increased in WT mice after in vivo MR activation by aldosterone but not in respective EGFR KO mice. Aldosterone‑ and EGF‑responsiveness of CACNA1H expression was confrmed in HL‑1 cells by Western blot and by measuring peak current density of T‑type calcium channels. Aldosterone‑induced CACNA1H protein expression could be abrogated by the EGFR inhibitor AG1478. Furthermore, inhibition of T‑type calcium channels with mibefradil or ML218 reduced diameter, volume and BNP levels in HL‑1 cells. In conclusion the MR regulates EGFR and CACNA1H expression, which has an efect on HL‑1 cell diameter, and the extent of this regulation seems to depend on the SNP‑216 (G/T) genotype.
    [Show full text]
  • Calcium-Induced Calcium Release in Noradrenergic Neurons of the Locus Coeruleus
    bioRxiv preprint doi: https://doi.org/10.1101/853283; this version posted November 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Calcium-induced calcium release in noradrenergic neurons of the locus coeruleus Hiroyuki Kawano1, Sara B. Mitchell1, Jin-Young Koh1,2,3, Kirsty M. Goodman1,4, and N. Charles Harata1,* 1 Department of Molecular Physiology and Biophysics, University of Iowa Carver College of Medicine, Iowa City, IA, USA 2 Molecular Otolaryngology and Renal Research Laboratories, Department of Otolaryngology-Head and Neck Surgery, University of Iowa Carver College of Medicine, Iowa City, IA, USA 3 Department of Biomedical Engineering, University of Iowa College of Engineering, Iowa City, IA, USA 4 Department of Biology & Biochemistry, University of Bath, Bath, UK * Correspondence to: N. Charles Harata, MD, PhD Department of Molecular Physiology & Biophysics University of Iowa Carver College of Medicine 51 Newton Road, Iowa City, IA 52242, USA Phone: 1-319-335-7820 Fax: 1-319-335-7330 E-mail: [email protected] Number of words: 8620; Number of figures: 12. 1 bioRxiv preprint doi: https://doi.org/10.1101/853283; this version posted November 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • KCNMB3 (NM 171830) Human Untagged Clone – SC306700
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC306700 KCNMB3 (NM_171830) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: KCNMB3 (NM_171830) Human Untagged Clone Tag: Tag Free Symbol: KCNMB3 Synonyms: BKBETA3; HBETA3; K(VCA)BETA-3; KCNMB2; KCNMBL; SLO-BETA-3; SLOBETA3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_171830, the custom clone sequence may differ by one or more nucleotides ATGTTCCCCCTTCTTTATGAGCTCACTGCAGTATCTCCTTCTCCCTTTCCCCAAAGGACAGCCTTTCCTG CCTCAGGGAAGAAGAGAGAGACAGACTACAGTGATGGAGACCCACTAGATGTGCACAAGAGGCTGCCATC CAGTGCTGGAGAGGACCGAGCCGTGATGCTGGGGTTTGCCATGATGGGCTTCTCAGTCCTAATGTTCTTC TTGCTCGGAACAACCATTCTAAAGCCTTTTATGCTCAGCATTCAGAGAGAAGAATCGACCTGCACTGCCA TCCACACAGATATCATGGACGACTGGCTGGACTGTGCCTTCACCTGTGGTGTGCACTGCCACGGTCAGGG GAAGTACCCGTGTCTTCAGGTGTTTGTGAACCTCAGCCATCCAGGTCAGAAAGCTCTCCTACATTATAAT GAAGAGGCTGTCCAGATAAATCCCAAGTGCTTTTACACACCTAAGTGCCACCAAGATAGAAATGATTTGC TCAACAGTGCTCTGGACATAAAAGAATTCTTCGATCACAAAAATGGAACCCCCTTTTCATGCTTCTACAG TCCAGCCAGCCAATCTGAAGATGTCATTCTTATAAAAAAGTATGACCAAATGGCTATCTTCCACTGTTTA TTTTGGCCTTCACTGACTCTGCTAGGTGGTGCCCTGATTGTTGGCATGGTGAGATTAACACAACACCTGT CCTTACTGTGTGAAAAATATAGCACTGTAGTCAGAGATGAGGTAGGTGGAAAAGTACCTTATATAGAACA GCATCAGTTCAAACTGTGCATTATGAGGAGGAGCAAAGGAAGAGCAGAGAAATCTTAA Restriction Sites: SgfI-MluI ACCN: NM_171830
    [Show full text]
  • Ion Channels 3 1
    r r r Cell Signalling Biology Michael J. Berridge Module 3 Ion Channels 3 1 Module 3 Ion Channels Synopsis Ion channels have two main signalling functions: either they can generate second messengers or they can function as effectors by responding to such messengers. Their role in signal generation is mainly centred on the Ca2 + signalling pathway, which has a large number of Ca2+ entry channels and internal Ca2+ release channels, both of which contribute to the generation of Ca2 + signals. Ion channels are also important effectors in that they mediate the action of different intracellular signalling pathways. There are a large number of K+ channels and many of these function in different + aspects of cell signalling. The voltage-dependent K (KV) channels regulate membrane potential and + excitability. The inward rectifier K (Kir) channel family has a number of important groups of channels + + such as the G protein-gated inward rectifier K (GIRK) channels and the ATP-sensitive K (KATP) + + channels. The two-pore domain K (K2P) channels are responsible for the large background K current. Some of the actions of Ca2 + are carried out by Ca2+-sensitive K+ channels and Ca2+-sensitive Cl − channels. The latter are members of a large group of chloride channels and transporters with multiple functions. There is a large family of ATP-binding cassette (ABC) transporters some of which have a signalling role in that they extrude signalling components from the cell. One of the ABC transporters is the cystic − − fibrosis transmembrane conductance regulator (CFTR) that conducts anions (Cl and HCO3 )and contributes to the osmotic gradient for the parallel flow of water in various transporting epithelia.
    [Show full text]
  • Stem Cells and Ion Channels
    Stem Cells International Stem Cells and Ion Channels Guest Editors: Stefan Liebau, Alexander Kleger, Michael Levin, and Shan Ping Yu Stem Cells and Ion Channels Stem Cells International Stem Cells and Ion Channels Guest Editors: Stefan Liebau, Alexander Kleger, Michael Levin, and Shan Ping Yu Copyright © 2013 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “Stem Cells International.” All articles are open access articles distributed under the Creative Com- mons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Editorial Board Nadire N. Ali, UK Joseph Itskovitz-Eldor, Israel Pranela Rameshwar, USA Anthony Atala, USA Pavla Jendelova, Czech Republic Hannele T. Ruohola-Baker, USA Nissim Benvenisty, Israel Arne Jensen, Germany D. S. Sakaguchi, USA Kenneth Boheler, USA Sue Kimber, UK Paul R. Sanberg, USA Dominique Bonnet, UK Mark D. Kirk, USA Paul T. Sharpe, UK B. Bunnell, USA Gary E. Lyons, USA Ashok Shetty, USA Kevin D. Bunting, USA Athanasios Mantalaris, UK Igor Slukvin, USA Richard K. Burt, USA Pilar Martin-Duque, Spain Ann Steele, USA Gerald A. Colvin, USA EvaMezey,USA Alexander Storch, Germany Stephen Dalton, USA Karim Nayernia, UK Marc Turner, UK Leonard M. Eisenberg, USA K. Sue O’Shea, USA Su-Chun Zhang, USA Marina Emborg, USA J. Parent, USA Weian Zhao, USA Josef Fulka, Czech Republic Bruno Peault, USA Joel C. Glover, Norway Stefan Przyborski, UK Contents Stem Cells and Ion Channels, Stefan Liebau,
    [Show full text]
  • The Β4-Subunit of the Large-Conductance Potassium Ion Channel Kca1.1 Regulates Outflow Facility in Mice
    Glaucoma The β4-Subunit of the Large-Conductance Potassium Ion Channel KCa1.1 Regulates Outflow Facility in Mice Jacques A. Bertrand,1 Martin Schicht,2 W. Daniel Stamer,3 David Baker,4 Joseph M. Sherwood,1 Elke Lütjen-Drecoll,2 David L. Selwood,5 and Darryl R. Overby1 1Department of Bioengineering, Imperial College London, London, United Kingdom 2Department of Anatomy II, University of Erlangen-Nürnberg, Erlangen, Germany 3Department of Ophthalmology, Duke University, Durham, North Carolina, United States 4Department of Neuroinflammation, University College London Institute of Neurology, University College London, London, United Kingdom 5Department of Medicinal Chemistry, Wolfson Institute for Biomedical Research, University College London, London, United Kingdom Correspondence: Darryl R. Overby, PURPOSE. The large-conductance calcium-activated potassium channel KCa1.1 (BKCa,maxi- Department of Bioengineering, K) influences aqueous humor outflow facility, but the contribution of auxiliary β-subunits Imperial College London, London to KCa1.1 activity in the outflow pathway is unknown. SW7 2AZ, United Kingdom; [email protected]. METHODS. Using quantitative polymerase chain reaction, we measured expression of β-subunit genes in anterior segments of C57BL/6J mice (Kcnmb1-4) and in cultured Received: August 20, 2019 human trabecular meshwork (TM) and Schlemm’s canal (SC) cells (KCNMB1-4). We also Accepted: January 9, 2020 α Published: March 23, 2020 measured expression of Kcnma1/KCNMA1 that encodes the pore-forming -subunit. Using confocal immunofluorescence, we visualized the distribution of β4 in the conven- Citation: Bertrand JA, Schicht M, tional outflow pathway of mice. Using iPerfusion, we measured outflow facility in enucle- β Stamer WD, et al.
    [Show full text]
  • Dimethylation of Histone 3 Lysine 9 Is Sensitive to the Epileptic Activity
    1368 MOLECULAR MEDICINE REPORTS 17: 1368-1374, 2018 Dimethylation of Histone 3 Lysine 9 is sensitive to the epileptic activity, and affects the transcriptional regulation of the potassium channel Kcnj10 gene in epileptic rats SHAO-PING ZHANG1,2*, MAN ZHANG1*, HONG TAO1, YAN LUO1, TAO HE3, CHUN-HUI WANG3, XIAO-CHENG LI3, LING CHEN1,3, LIN-NA ZHANG1, TAO SUN2 and QI-KUAN HU1-3 1Department of Physiology; 2Ningxia Key Laboratory of Cerebrocranial Diseases, Incubation Base of National Key Laboratory, Ningxia Medical University; 3General Hospital of Ningxia Medical University, Yinchuan, Ningxia 750004, P.R. China Received February 18, 2017; Accepted September 13, 2017 DOI: 10.3892/mmr.2017.7942 Abstract. Potassium channels can be affected by epileptic G9a by 2-(Hexahydro-4-methyl-1H-1,4-diazepin-1-yl)-6,7-di- seizures and serve a crucial role in the pathophysiology of methoxy-N-(1-(phenyl-methyl)-4-piperidinyl)-4-quinazolinamine epilepsy. Dimethylation of histone 3 lysine 9 (H3K9me2) and tri-hydrochloride hydrate (bix01294) resulted in upregulation its enzyme euchromatic histone-lysine N-methyltransferase 2 of the expression of Kir4.1 proteins. The present study demon- (G9a) are the major epigenetic modulators and are associated strated that H3K9me2 and G9a are sensitive to epileptic seizure with gene silencing. Insight into whether H3K9me2 and G9a activity during the acute phase of epilepsy and can affect the can respond to epileptic seizures and regulate expression of transcriptional regulation of the Kcnj10 channel. genes encoding potassium channels is the main purpose of the present study. A total of 16 subtypes of potassium channel Introduction genes in pilocarpine-modelled epileptic rats were screened by reverse transcription-quantitative polymerase chain reac- Epilepsies are disorders of neuronal excitability, characterized tion, and it was determined that the expression ATP-sensitive by spontaneous and recurrent seizures.
    [Show full text]
  • Dual Separable Feedback Systems Govern Firing Rate Homeostasis Yelena Kulik1†, Ryan Jones1†, Armen J Moughamian2, Jenna Whippen1, Graeme W Davis1*
    RESEARCH ARTICLE Dual separable feedback systems govern firing rate homeostasis Yelena Kulik1†, Ryan Jones1†, Armen J Moughamian2, Jenna Whippen1, Graeme W Davis1* 1Department of Biochemistry and Biophysics, Kavli Institute for Fundamental Neuroscience, University of California, San Francisco, San Francisco, United States; 2Department of Neurology, University of California, San Francisco, San Francisco, United States Abstract Firing rate homeostasis (FRH) stabilizes neural activity. A pervasive and intuitive theory argues that a single variable, calcium, is detected and stabilized through regulatory feedback. A prediction is that ion channel gene mutations with equivalent effects on neuronal excitability should invoke the same homeostatic response. In agreement, we demonstrate robust FRH following either elimination of Kv4/Shal protein or elimination of the Kv4/Shal conductance. However, the underlying homeostatic signaling mechanisms are distinct. Eliminating Shal protein invokes Kru¨ppel-dependent rebalancing of ion channel gene expression including enhanced slo, Shab, and Shaker. By contrast, expression of these genes remains unchanged in animals harboring a CRISPR- engineered, Shal pore-blocking mutation where compensation is achieved by enhanced IKDR. These different homeostatic processes have distinct effects on homeostatic synaptic plasticity and animal behavior. We propose that FRH includes mechanisms of proteostatic feedback that act in parallel with activity-driven feedback, with implications for the pathophysiology of human channelopathies. DOI: https://doi.org/10.7554/eLife.45717.001 *For correspondence: [email protected] Introduction †These authors contributed Firing Rate Homeostasis (FRH) is a form of homeostatic control that stabilizes spike rate and informa- equally to this work tion coding when neurons are confronted by pharmacological, genetic or environmental perturba- tion (Davis, 2013; O’Leary et al., 2014).
    [Show full text]
  • Microrna-Mediated Downregulation of K+ Channels in Pulmonary Arterial Hypertension
    MicroRNA-mediated downregulation of K + channels in pulmonary arterial hypertension Item Type Article Authors Babicheva, Aleksandra; Ayon, Ramon J; Zhao, Tengteng; Ek Vitorin, Jose F; Pohl, Nicole M; Yamamura, Aya; Yamamura, Hisao; Quinton, Brooke A; Ba, Manqing; Wu, Linda; Ravellette, Keeley S; Rahimi, Shamin; Balistrieri, Francesca; Harrington, Angela; Vanderpool, Rebecca R; Thistlethwaite, Patricia A; Makino, Ayako; Yuan, Jason X-J Citation Babicheva, A., Ayon, R. J., Zhao, T., Vitorin, J. F. E., Pohl, N. M., Yamamura, A., ... & Ravellette, K. S. (2019). MicroRNA- mediated downregulation of K+ channels in pulmonary arterial hypertension. American Journal of Physiology-Lung Cellular and Molecular Physiology. DOI 10.1152/ajplung.00010.2019 Publisher AMER PHYSIOLOGICAL SOC Journal AMERICAN JOURNAL OF PHYSIOLOGY-LUNG CELLULAR AND MOLECULAR PHYSIOLOGY Rights Copyright © 2020 the American Physiological Society. Download date 28/09/2021 04:07:06 Item License http://rightsstatements.org/vocab/InC/1.0/ Version Final accepted manuscript Link to Item http://hdl.handle.net/10150/637047 1 1 MicroRNA-mediated Downregulation of K+ Channels in Pulmonary Arterial Hypertension 2 3 Aleksandra Babicheva1,4, Ramon J. Ayon4, Tengteng Zhao1,4, Jose F. Ek Vitorin4, Nicole M. 4 Pohl5, Aya Yamamura6, Hisao Yamamura7, Brooke A. Quinton4, Manqing Ba4, Linda Wu4, 5 Keeley S. Ravellette4, Shamin Rahimi1, Francesca Balistrieri1, Angela Harington1, Rebecca R. 6 Vanderpool4, Patricia A. Thistlethwaite3, Ayako Makino2,4, and Jason X-J. Yuan1,4,5* 7 8 1Section of Physiology,
    [Show full text]
  • The Β4-Subunit of the Large-Conductance Potassium Ion Channel Kca1.1 Regulates Outflow Facility in Mice
    Glaucoma The β4-Subunit of the Large-Conductance Potassium Ion Channel KCa1.1 Regulates Outflow Facility in Mice Jacques A. Bertrand,1 Martin Schicht,2 W. Daniel Stamer,3 David Baker,4 Joseph M. Sherwood,1 Elke Lütjen-Drecoll,2 David L. Selwood,5 and Darryl R. Overby1 1Department of Bioengineering, Imperial College London, London, United Kingdom 2Department of Anatomy II, University of Erlangen-Nürnberg, Erlangen, Germany 3Department of Ophthalmology, Duke University, Durham, North Carolina, United States 4Department of Neuroinflammation, University College London Institute of Neurology, University College London, London, United Kingdom 5Department of Medicinal Chemistry, Wolfson Institute for Biomedical Research, University College London, London, United Kingdom Correspondence: Darryl R. Overby, PURPOSE. The large-conductance calcium-activated potassium channel KCa1.1 (BKCa,maxi- Department of Bioengineering, K) influences aqueous humor outflow facility, but the contribution of auxiliary β-subunits Imperial College London, London to KCa1.1 activity in the outflow pathway is unknown. SW7 2AZ, United Kingdom; [email protected]. METHODS. Using quantitative polymerase chain reaction, we measured expression of β-subunit genes in anterior segments of C57BL/6J mice (Kcnmb1-4) and in cultured Received: August 20, 2019 human trabecular meshwork (TM) and Schlemm’s canal (SC) cells (KCNMB1-4). We also Accepted: January 9, 2020 α Published: March 23, 2020 measured expression of Kcnma1/KCNMA1 that encodes the pore-forming -subunit. Using confocal immunofluorescence, we visualized the distribution of β4 in the conven- Citation: Bertrand JA, Schicht M, tional outflow pathway of mice. Using iPerfusion, we measured outflow facility in enucle- β Stamer WD, et al.
    [Show full text]
  • De Novo BK Channel Mutation Causes Epilepsy by Regulating Voltage-Dependent, but Not Calcium-Dependent, Activation
    bioRxiv preprint doi: https://doi.org/10.1101/120543; this version posted March 25, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. De novo BK channel mutation causes epilepsy by regulating voltage-dependent, but not calcium-dependent, activation Xia Li,1,† Sibylle Poschmann,2,† Qiuyun Chen,3,† Nelly Jouayed Oundjian,4 Francesca M. Snoeijen-Schouwenaars,5 Erik-Jan Kamsteeg,6 Marjolein Willemsen,6,7,* Qing Kenneth Wang1,3,* 1The Key Laboratory of Molecular Biophysics of the Ministry of Education, College of Life Science and Technology, Center for Human Genome Research, Cardio-X Institute, Huazhong University of Science and Technology, Wuhan, 430074, Hubei Province, P. R. China; 2Children Hospital Dritter Orden, Menzinger Str. 44, 80638 München, Germany; 3Center for Cardiovascular Genetics, Department of Molecular Cardiology, Lerner Research Institute, Department of Cardiovascular Medicine, Cleveland Clinic; Department of Molecular Medicine, Department of Genetics and Genome Science, Case Western Reserve University, Cleveland, OH, 44195, USA; 4Department of Pediatrics, Columbia University Medical Center, New York, New York, USA 5Academic Centre for Epileptology Kempenhaeghe, Department of Residential Care, The Netherlands; 6Department of Human Genetics, Radboud University Medical Center and Maastricht University Medical Center, 6500 HB Nijmegen (836), The Netherlands; 7Department of Clinical Genetics, Maastricht University Medical Center, Maastricht, The Netherlands † These authors contributed equally to this article. *For correspondence: [email protected], [email protected] (Q.K.W.) *For correspondence: [email protected] (M.W.) 1 bioRxiv preprint doi: https://doi.org/10.1101/120543; this version posted March 25, 2017.
    [Show full text]