MicroRNA-mediated downregulation of K + channels in pulmonary arterial hypertension
Item Type Article
Authors Babicheva, Aleksandra; Ayon, Ramon J; Zhao, Tengteng; Ek Vitorin, Jose F; Pohl, Nicole M; Yamamura, Aya; Yamamura, Hisao; Quinton, Brooke A; Ba, Manqing; Wu, Linda; Ravellette, Keeley S; Rahimi, Shamin; Balistrieri, Francesca; Harrington, Angela; Vanderpool, Rebecca R; Thistlethwaite, Patricia A; Makino, Ayako; Yuan, Jason X-J
Citation Babicheva, A., Ayon, R. J., Zhao, T., Vitorin, J. F. E., Pohl, N. M., Yamamura, A., ... & Ravellette, K. S. (2019). MicroRNA- mediated downregulation of K+ channels in pulmonary arterial hypertension. American Journal of Physiology-Lung Cellular and Molecular Physiology.
DOI 10.1152/ajplung.00010.2019
Publisher AMER PHYSIOLOGICAL SOC
Journal AMERICAN JOURNAL OF PHYSIOLOGY-LUNG CELLULAR AND MOLECULAR PHYSIOLOGY
Rights Copyright © 2020 the American Physiological Society.
Download date 28/09/2021 04:07:06
Item License http://rightsstatements.org/vocab/InC/1.0/
Version Final accepted manuscript
Link to Item http://hdl.handle.net/10150/637047 1
1 MicroRNA-mediated Downregulation of K+ Channels in Pulmonary Arterial Hypertension
2
3 Aleksandra Babicheva1,4, Ramon J. Ayon4, Tengteng Zhao1,4, Jose F. Ek Vitorin4, Nicole M.
4 Pohl5, Aya Yamamura6, Hisao Yamamura7, Brooke A. Quinton4, Manqing Ba4, Linda Wu4,
5 Keeley S. Ravellette4, Shamin Rahimi1, Francesca Balistrieri1, Angela Harington1, Rebecca R.
6 Vanderpool4, Patricia A. Thistlethwaite3, Ayako Makino2,4, and Jason X-J. Yuan1,4,5*
7
8 1Section of Physiology, Division of Pulmonary, Critical Care and Sleep Medicine, and 2Division
9 of Endocrinology and Metabolism, Department of Medicine; 3Department of Surgery, University
10 of California, San Diego, La Jolla, CA 92093; 4Departments of Medicine and Physiology, The
11 University of Arizona, Tucson, AZ 85721; 5Department of Medicine, University of Illinois at
12 Chicago, Chicago, IL 60612; 6Kinjo Gakuin University School of Pharmacy, Nagoya, Japan; and
13 7Nagoya City University Graduate School of Pharmaceutical Sciences, Nagoya, Japan
14
15 Running title: miRNA-mediated regulation of K+ channels
16 *Address correspondence to:
17 Jason X.-J. Yuan, M.D., Ph.D. 18 Professor of Medicine 19 Division of Pulmonary, Critical Care and Sleep Medicine 20 Department of Medicine, MC 0856 21 University of California, San Diego 22 9500 Gilman Drive 23 La Jolla, CA 92093-0856 24 Tel: (858)246-5797 25 Fax: (858)534-4812 26 Email: [email protected] 27
28
I 2
29 Abstract
30 Downregulated expression of K+ channels and decreased K+ currents in pulmonary artery smooth
31 muscle cells (PASMC) have been implicated in the development of sustained pulmonary
32 vasoconstriction and vascular remodeling in patients with idiopathic pulmonary arterial
33 hypertension (IPAH). However, it is unclear exactly how K+ channels are downregulated in
34 IPAH-PASMC. MicroRNAs (miRNAs) are small noncoding RNAs that are capable of
35 posttranscriptionally regulating gene expression by binding to the 3’-untranslated regions (3’-
36 UTR) of their targeted mRNAs. Here we report that specific miRNAs are responsible for the
37 decreased K+ channel expression and function in IPAH-PASMC. We identified 3 miRNAs (miR-
38 29b, miR-138 and miR-222) that were highly expressed in IPAH-PASMC in comparison to
39 normal PASMC (>2.5-fold difference). Selectively upregulated miRNAs are correlated with the
40 decreased expression and attenuated activity of K+ channels. Overexpression of miR-29b, miR-
41 138 or miR-222 in normal PASMC significantly decreased whole-cell K+ currents and
+ 42 downregulated voltage-gated K channel 1.5 (KV1.5/KCNA5) in normal PASMC. Inhibition of
+ 43 miR-29b in IPAH-PASMC completely recovered K channel function and KV1.5 expression,
44 while miR-138 and miR-222 had a partial or no effect. Luciferase assays further revealed that
45 KV1.5 is a direct target of miR-29b. Additionally, overexpression of miR-29b in normal PASMC
2+ + 46 decreased large-conductance Ca -activated K (BKCa) channel currents and downregulated
47 BKCa channel β1 subunit (BKCaβ1 or KCNMB1) expression, while inhibition of miR-29b in
48 IPAH-PASMC increased BKCa channel activity and BKCaβ1 level. These data indicate
49 upregulated miR-29b contributes, at least partially, to the attenuated function and expression of
50 KV and BKCa channels in PASMC from patients with IPAH.
51 Key words: posttranscriptional regulation; potassium channels; microRNA; KCNA5; KCNMB1.
52 I 3
53 Introduction
54 Sustained pulmonary vasoconstriction is an important early cause for elevated pulmonary
55 vascular resistance in patients with idiopathic pulmonary arterial hypertension (IPAH) (25, 61).
56 Pulmonary arterial tone and vasoconstriction are controlled by the resting membrane potential
57 (Em) in pulmonary artery smooth muscle cells (PASMC) (30, 49, 73). A change in Em plays a
58 key role in excitation-contraction coupling in PASMC by regulating the cytosolic free Ca2+
2+ 2+ 59 concentration ([Ca ]cyt). Membrane depolarization leads to an increase in [Ca ]cyt by opening
2+ 2+ 60 voltage-dependent Ca channels (VDCC) in PASMC (31, 32, 69). Increased [Ca ]cyt not only
61 causes PASMC contraction and pulmonary vasoconstriction, but also stimulates PASMC
62 proliferation and migration, which are the major contributors to concentric pulmonary arterial
63 wall remodeling (10, 15).
+ 64 K channel activity in PASMC contributes significantly to Em regulation (2, 41).
65 Decreased K+ currents by downregulating channel expression (leading to decreased number of
66 K+ channels in the plasma membrane) and/or inhibiting channel activity would depolarize
67 PASMC, open VDCC and increase Ca2+ influx. Downregulated expression of K+ channels and
68 decreased K+ currents in PASMC have been implicated in the development and progression of
69 pulmonary hypertension, however, the underlying mechanisms are still unknown.
70 To date, more than eight different K+ channel families have been identified in the
2+ + 71 pulmonary vasculature; voltage-gated (KV) and Ca -activated (KCa) K channels appear to
72 participate in the regulation of Em in PASMC. Each KV channel comprises four pore-forming α
73 subunits and four regulatory cytoplasmic β subunits that modulate channel activity via
74 inactivating α subunits (47). The diversity of mammalian KV channels is derived from genetic
75 diversity, with over 40 genes encoding KV channel α subunits from 12 subtypes (KV1-12)(18, 42,
I 4
2+ + 76 74). There are five families of Ca -activated K channels (KCa1-KCa5) including the large-
77 conductance KCa channels (MaxiK or BKCa) (60). The BKCa channel consists of four α subunits
78 (BKCaα) that create a pore in the membrane associated with four ancillary β (BKCaβ1-4) subunits.
79 BKCaβ2 (KCNMB2), BKCaβ3 (KCNMB3), and BKCaβ4 (KCNMB4) subunits are predominantly
80 expressed in endocrine tissue, testis, and brain tissue respectively, however, BKCaβ1 (KCNMB1)
81 appears to be solely expressed in smooth muscle tissue (5, 12). The function of BKCa channels in
82 PASMC is finely tuned by its regulatory β-subunits via enhancing α subunit sensitivity to
2+ 83 intracellular Ca and voltage (13). The presence of BKCa channels has been established in
84 human and animal PASMC (3, 9, 20, 26). Downregulated KV channel expression (e.g.,
85 KV1.5/KCNA5) and decreased whole-cell KV currents in PASMC have been established in PH
86 including IPAH (8, 63, 75) while the role of BKCa channels in PH is not well established (1, 4,
87 19, 45).
88 MicroRNAs (miRNAs) are small non-coding regulatory RNAs that posttranscriptionally
89 regulate gene expression by binding to the 3’-untranslated region (UTR) of their targeted mRNA,
90 thereby preventing translation and/or decreasing stability of target mRNAs. miRNAs have been
91 implicated in the development and progression of pulmonary hypertension by using lung
92 specimen and isolated PASMC from patients with IPAH as well as genetically engineered mice
93 including miR-204, miR-21, miR-130/301 and the miR-17/92 cluster (11, 28, 46, 56, 76). It has
+ 94 been found that certain miRNAs target multiple K channels including KV7.5/KCNQ5 (34),
95 KV4.2/KCND2 (38), KCa2.3/KCNN3 (36) and KIR2.1/KCNJ2 (40) channels in vascular smooth
96 muscle cells and cardiac myocytes. The aim of this study is to investigate the role of miRNAs in
97 the regulation of KV channels and BKCa channels in PASMC from patients with IPAH.
98
I 5
99 Materials and Methods
100 Cell Culture: The approval for using human cells was granted by the University Institutional
101 Review Board. PASMC from 6 healthy (normal) subjects without pulmonary hypertension and 6
102 IPAH patients were provided by the Pulmonary Hypertension Breakthrough Initiative (PHBI).
103 Normal and IPAH PASMC were cultured in 5% fetal bovine serum (FBS) smooth muscle
104 growth media (LifeLine) and incubated in a humidified 5% CO2 atmosphere at 37°C. Pulmonary
105 arterial endothelial cells (PAEC) isolated from 4 normal subjects and 4 IPAH patients (PHBI)
106 were cultured in 2% FBS growth media (LifeLine) and incubated in a humidified 5% CO2
107 atmosphere at 37°C. Human PASMC and PAEC were isolated at PHBI facility as previously
108 described (27, 67). PASMC authentication was carried out with fluorescence-activated cell
109 sorting (FACS) and immunocytochemistry (ICC) with smooth muscle actin-α (SMA), smooth
110 muscle 22-α (SM22α) and smooth muscle myosin heavy chain (SMMHC). The percentage of
111 positive cells that exhibit SMA, SM22α, and SMMHC signal was over 95%. PAEC
112 authentication was carried out with FACS and ICC using CD31 (FACS), von Willebrand factor
113 (vWF), and vascular endothelial cadherin (VE-cadherin) (ICC). The percentage of positive cells
114 that exhibit CD31, vWF, and VE-cadherin signal was over 93% in cultures. The cells were
115 acquired at passages 2-3. Passages 4-6 were used for the experiments. The demographic
116 information of human PASMC and PAEC is listed in Table 1.
117
118 miRNA PCR-Array: To determine the miRNA expression profile in PASMC, RNA was isolated
119 from normal and IPAH PASMC and miRNA expression was explored using the Human Cancer
120 Pathway Finder miRNA PCR Array from SABiosciences. The lung vasculopathy in IPAH
121 patients was recently demonstrated to be similar to pathological chances in cancer, and miRNA
I 6
122 dysregulation in affected lung vascular tissues from IPAH patients shares similarities with
123 miRNA profile in cancer tissues (17, 52). The miRNA PCR array consisted of a 96 well plate
124 which contained distinct primers for a total of 89 specific miRNAs plus 4 housekeeping small
125 nuclear RNAs for normalization. The miRNAs were reverse transcribed to generate cDNA using
126 miScript Reverse Transcription Kit (Qiagen), and then added to each well of the miRNA PCR
127 array containing distinct miRNA primers. miRNA expression levels were determined by using
128 the CFX96 real-time PCR machine (Bio-Rad Laboratories). The results were analyzed via the
129 ΔΔCt method and miRNA expression was normalized to the four small housekeeping RNAs U6,
130 SNORD44, SNORD47 and SNORD48 (Qiagen). Small housekeeping RNA U6 displayed the
131 least variability between samples making it a strong candidate as control. miRNAs expression
132 normalized to U6 in normal PASMC was defined as 1 fold and miRNAs with a fold change of
133 equal to or greater than 2.0 in IPAH-PASMC are shown in the heatmap.
134
135 In silico Analysis: We performed in silico analysis using the standard online software
136 TargetScanHuman v7.2 (Targetscan.org) to predict the potential target mRNAs encoding KV and
137 BKCa channels for the specific miRNAs. The assigned context score to each 3’-UTR mRNA was
138 used as a tool to select targets. The context score is the sum of the contributions of site-type, 3′
139 pairing, local AU, and position criteria. For each of these criteria, a more negative score indicates
140 a more favorable site.
141
142 miRNA RT-PCR Analysis: The total RNAs were isolated from normal and IPAH PASMC using
143 a phenol/guanidine-based QIAzol reagent (Qiagen). To generate cDNA for sensitive and specific
144 miRNA detection, the miScript II RT Kit (Qiagen) was used according to the manufacturer’s
I 7
145 protocol. Real-time PCR was then performed by using the miScript SYBR® Green PCR kit
146 (Qiagen) on the CFX384 real-time PCR machine (Bio-Rad Laboratories). miRNA specific
147 primers (Qiagen) for human miR-29b, miR-138 and miR-222 were used to amplify miRNAs.
148 The results were analyzed via the ΔΔCt method and miRNA expression was normalized to the
149 small housekeeping RNA U6 since U6 displayed the least variability between samples. U6 is
150 thus a good normalizing control compared to SNORD44, SNORD47 and SNORD48. In order to
151 implement the ΔΔCt method, we compared our results to an average of the “healthy” cells.
152 miRNA level was first normalized to U6 level in all healthy subjects and calculated the mean,
153 then the ratio of miRNA to U6 from each IPAH patient was normalized to the mean ratio from
154 normal subjects. The mean ratio of miRNA expression level to U6 in normal PASMC was
155 defined as 1-fold.
156
157 Patch-clamp Experiments: Whole-cell and single-channel K+ currents were recorded with patch
158 clamp technique using an Axopatch-1D amplifier and a DigiData 1322 interface (Molecular
159 Devices). The borosilicate patch pipettes (2–3 MΩ) were fabricated on a P-97 electrode puller
160 (Sutter Instrument, Novato, CA) and polished with a Narashige MF-63 microforge for the
161 current recording. The command voltage pulse protocols and the data acquisition were
162 performed with pCLAMP 8.1 software. The currents, filtered at 1-2 kHz and digitized at 2-4
163 kHz, were elicited by depolarizing the cells from a holding potential of -80 mV to a series of test
164 potentials (ranging from -100 to +100 mV, for 500 ms) in increment of 20 mV (every 15 s). The
165 extracellular (bath) solution for recording KV currents (IK(V)) had an ionic composition of 140
166 mM NaCl, 4.7 mM KCl, 3 mM MgCl2, 10 mM glucose, 10 mM HEPES, and 1 mM EGTA (at
167 pH 7.4); while the intracellular (pipette) solution contained 140 mM KCl, 4 mM MgCl2, 10 mM
I 8
168 HEPES, 10 mM EGTA, and 5 mM Na2ATP (at pH 7.2). To record whole-cell KCa currents
169 (IK(Ca)), the bath (extracellular) solution contained 140 mM NaCl, 4.7 mM KCl, 1.8 mM CaCl2,
170 1.2 mM MgCl2, 10 mM glucose and 10 mM HEPES (pH was adjusted to 7.4 by NaOH). The
171 pipette (intracellular) solution contained 140 mM KCl, 4.4 mM CaCl2, 4 mM MgCl2, 5 mM
172 Na2ATP, 10 mM HEPES and 5 mM EGTA (pH was adjusted to 7.2 by KOH); the pCa of the
173 pipette solution under this condition was calculated to be approximately 6.0. The digital
174 subtraction of the currents recorded in PASMC during application of iberiotoxin (IbTX, 100 nM)
175 or Penitrem A (100 nM) from the currents recorded in PASMC before the application of blocker
176 were defined as IbTX-sensitive or Penitrem A-sensitive BKCa currents. The single-channel BKCa
177 currents [iK(Ca)] in the cell-attached membrane patch were measured as we previously reported
178 (50). We held the attached membrane patches at −70 mV before applying various test potentials.
179 Open probability (Popen) and amplitude of the currents were measured with Fetchan and PStat
180 software (Axon Instruments). High-K+ pipette (extracellular) solution was used in recording
+ 181 iK(Ca) so that the K equilibrium potential (EK) for the attached membrane was close to 0 mV (i.e.,
182 the [K+] in the pipette is close to the [K+] in the cytosol). The bath (extracellular) solution for
183 measuring iK(Ca) in the cell-attached membrane included 141 mM NaCl, 1.8 mM CaCl2, 4.7 mM
184 KCl, 1.2 mM MgCl2, 10 mM glucose and 10 mM HEPES (pH = 7.4). The pipette (extracellular)
185 solution included 125 mM KCl, 10 mM NaCl, 4 mM MgCl2, 5 mM ATP and 10 mM HEPES
186 (pH = 7.2). Results are presented as a function of the command potential (Ecomm), which is the
187 inverse of the applied (holding or test) potential. Due to a negative resting Em (approximately -40
188 mV in cultured human PASMC), the actual transmembrane potential across the patched
189 membrane is equal to the difference between the Ecomm and resting Em.
190
I 9
191 Gene (mRNA) Expression RT-PCR Analysis: The total RNAs were isolated from human cells
192 using QIAzol reagent (Qiagen). Real-time RT-PCR was performed as previously described (59).
193 Human oligonucleotide primers (Integrated DNA Technologies) that were used in this study are
194 listed below: KCNA1, CCCAGCAAGACGGACTTCTTCAAA (forward)/
195 TCTGGTTTCCTTCCTGCTCAGCTA (reverse); KCNA2, GAACCGCCCTAGCTTTGATG
196 (forward)/TCTCCCAGCTCATAAAACCGA (reverse); KCNA5,
197 TTCTACCACCGGGAAACGGA (forward)/CTTCGGGCACTGTCTGCATT (reverse);
198 KCNMB1, CTGTACCACACGGAGGACACT (forward)/GTAGAGGCGCTGGAATAGGAC
199 (reverse); GAPDH, GCACCGTCAAGGCTGAGAAC (forward)/
200 ATGGTGGTGAAGACGCCAGT (reverse). GAPDH, a housekeeping gene, was used to
201 normalize the expression of gene or transcript of interest.
202
203 Western Blot Analysis: Cells were washed with PBS and re-suspended into 1× RIPA buffer
204 (Millipore), which contained protease inhibitor cocktail tablets (Roche). Cells were incubated for
205 20 min on ice, followed by a 15-min centrifugation at 12,000 rpm. The supernatant was collected
206 and protein concentration was determined using a Nano-Drop spectrophotometer (Thermo
207 Scientific). Samples were applied on 10% SDS-PAGE, and proteins were transferred onto
208 nitrocellulose membranes. The membranes were blocked in 5% nonfat milk and incubated
209 overnight at 4°C with primary antibodies for KCNA1 (Cat# sc-11184), KCNA2 (Cat# sc-
210 292447), KCNA5 (Cat# sc-25681) and KCNMB1 (Cat# sc-377023) followed by 1-hr incubation
211 with secondary antibodies (either anti-rabbit, Cell Signaling, Cat#7074S or anti-mouse, Cell
212 Signaling, Cat#7076S). All samples were re-probed for β-actin (Cat# sc-47778) as a loading
213 control. Blots were developed using the SuperSignal West Pico Chemiluminescent Substrate
I 10
214 (Pierce Biotechnology). To compare the levels of target proteins in PASMC between normal
215 subjects and IPAH patients, we first normalized the level of target protein to β-actin level in each
216 normal subject and calculated the mean ratio from all normal subjects as control. Then, the ratio
217 of target protein to β-actin from each IPAH patient was normalized to the mean ratio from
218 normal subjects. The mean ratio of target protein level to β-actin level in normal PASMC was
219 defined as 1 fold.
220
221 Transfection Experiments: For the miRNA transfection, normal PASMC were transfected with
222 10 nM of human miScript miRNA mimics for miR-29b, miR138 and miR-222 (Qiagen) while
223 IPAH cells were transfected with 100 nM of miR-29b, miR138 and miR-222 inhibitors (Qiagen)
224 using LipofectamineTM RNAiMAX Transfection Reagent (Invitrogen) according to the
225 manufacturer’s protocol. AllStars Control siRNA (Qiagen, Cat# 1027280) and miScript Inhibitor
226 Negative Control (Qiagen, Cat# 1027271) were utilized as a negative control (NC) for miRNA
227 mimic and miRNA inhibitor transfection experiments, respectively (35, 39, 53, 65). The
228 transfection was performed in Opti-MEM Reduced Serum Medium (Gibco) for 4-6 hrs. Then,
229 the Opti-MEM was replaced with 5% FBS medium. 48-72 hrs later, the cells were collected for
230 RNA or protein isolation and were used for electrophysiological recordings. The transfection
231 efficiency was confirmed by real-time RT-PCR. For the gene transfection, HEK293 cells were
232 transiently transfected with 2µg of KCNA5 (OriGene, plasmid #RG219793) using X-
233 tremeGENE 9 DNA Transfection Reagent (Roche) according to the manufacturer’s instructions.
234 Experiments were performed 24-48 hours after transfection.
235
I 11
236 Antibody Validation. All antibodies used in this study have undergone validation in the course of
237 this study. Representative full-length blots and details of antibody validation are presented in
238 Suppl. Fig. 1 (private sharing link for Figshare data:
239 https://figshare.com/s/1f417014a1aba70f3ed2).
240
241 Luciferase Assays: gBlocks® gene fragments containing the 3′-untranslated region (3′-UTR) of
242 the human KCNA5, including the putative miR-29b binding site, as well as enzyme restriction
243 sites for PmeI and XbaI were purchased from Integrated DNA Technologies. Cloning was
244 performed according to the manufacturer’s protocol. The gBlocks, and the pmirGLO Dual-
245 Luciferase miRNA Target Expression Vector (Promega), were digested with PmeI and XbaI,
246 followed by ligation and transformation. To mutate the miR-29b seed region, a site-directed
247 mutagenesis kit (Invitrogen) with specific primers (Integrated DNA Technologies) was used
248 according to the manufacturer’s protocol. Vector constructs (wildtype, mutant1 and mutant2)
249 were confirmed by DNA sequencing. Wildtype, mutant1 and mutant2 3’UTR-vectors, as well as
250 an empty vector for a control, were used in luciferase assays. To prepare for the luciferase assay,
251 HEK293 cells were transfected in 6-well plates with 10 nM miR-29b mimic (Qiagen), 2 µg
252 luciferase vector and 40 ng Renilla luciferase vector (pRL-TK) using Lipofectamine RNAiMAX
253 (Invitrogen). Forty-eight hours after transfection, luciferase assays were performed using the
254 Dual-Luciferase® Reporter Assay System (Promega), according to the manufacturer’s protocol.
255 Cells were lysed using the passive lysis buffer. 20 µl of the resulting cell lysate was added to a
256 white 96 well plate, which was then placed in a GloMax® 96 Microplate Luminometer w/Dual
257 Injectors (Promega). The firefly luminescence from each experimental condition was normalized
258 to the luminescence from empty control vectors.
I 12
259
260 Statistical Analysis. The data are expressed as mean ± standard error (SEM). The differences
261 between groups were analyzed for statistical significance with Student’s t-test (paired or
262 unpaired as applicable) or ANOVA and post hoc tests (Student-Newman-Keuls) where
263 appropriate. The differences were considered to be statistically significant when a P-value was
264 less than 0.05 (P<0.05).
265
I 13
266 Results
267 To discover novel miRNAs that might be involved in the development and progression of
268 pulmonary hypertension, we first conducted an miRNA PCR array experiment to determine and
269 compare miRNA expression levels in PASMC between normal subjects and IPAH patients. To
270 determine which miRNAs are potentially involved in downregulating K+ channel expression and
271 decreasing whole-cell K+ currents in PASMC, we focused on the miRNAs that were selectively
272 upregulated in IPAH-PASMC compared to normal cells. Then, we performed a series of
273 experiments to determine whether the upregulated miRNAs affected expression and activity of
274 various K+ channels in PASMC from IPAH patients.
275
276 Decreased Activity of KV Channels is Associated with Selectively Upregulated miRNAs in
277 IPAH-PASMC. We first compared whole-cell KV currents in PASMC isolated from healthy
278 control subjects and patients with IPAH. The amplitude (Fig. 1Aa and Ab) and current-density
279 (Fig. 1Ac) of whole-cell KV currents, elicited by depolarizing the cells from a holding potential
280 of -70 mV to series of test potentials ranging from -90 mV to +90 mV, were significantly
281 (P<0.01) lower in IPAH-PASMC than in normal (Nor) cells. To determine whether the
+ 282 dysfunction of K channels or the decreased current density of KV channels in IPAH-PASMC
283 was due to miRNA-mediated post-transcriptional regulation, we then performed a miRNA PCR
284 microarray experiment to investigate the human miRNA expression profile in normal PASMC
285 and IPAH-PASMC. Among 89 miRNAs screened, 5 miRNAs were significantly (2-fold or
286 greater) downregulated (blue) and 6 miRNAs were significantly (2-fold or greater) upregulated
287 (red) in IPAH-PASMC compared to normal PASMC (Fig. 1B). The real-time PCR experiments
288 confirmed 3.3-fold, 3.3-fold and 2.9-fold upregulation for miR-29b, miR-138 and miR-222,
I 14
289 respectively, in IPAH-PASMC (Fig. 1C). We were unable to detect any significant differences in
290 miR-15a, miR-29a, and miR-let-7e levels between normal and IPAH cells using the real-time
291 PCR method. In addition to the upregulated miRNAs, miRNA PCR microarray showed there are
292 five miRNAs (miR-18a, miR-183, miR-181b, miR-378, and miR-126) that are downregulated in
293 IPAH-PASMC compared to normal PASMC. Therefore, miR-29b, miR-138 and miR-222 were
294 selected for the downstream experiments to investigate whether they were involved in (or
+ 295 required for) the regulation of activity and/or expression of K channels in PASMC isolated from
296 patients with IPAH.
297
298 Downregulation of specific K+ channels in PASMC from IPAH patients. In silico analysis
299 revealed that miR-29b, miR-138 and miR-222 could target several KV (i.e., KV1.1/KCNA1,
300 KV1.2/KCNA2, KV1.3/KCNA3, KV1.5/KCNA5, KV1.6/KCNA6, KV1.7/KCNA7,
301 KVβ1.1/KCNAB1, KVβ1.3/KCNAB3) and BKCa (BKCaβ1/KCNMB1, BKCaβ3/KCNMB3,
302 BKCaβ4/KCNMB4) channels. It has been established that KV1.1/KCNA1, KV1.2/KCNA2,
303 KV1.5/KCNA5, and BKCaβ1/KCNMB1 are involved in the development of pulmonary
304 hypertension (4, 9, 75). In this study, we aimed to determine whether miR-29b, miR-138, and
305 miR-222 are responsible for the regulation of these channels in PASMC isolated from patients
306 with IPAH. To test this possibility, we first compared the expression level of certain K+ channels
307 (Kv1.1, Kv1.2, Kv1.5, and BKCaβ1) in PASMC from normal subjects and patients with IPAH.
308 Real-time RT-PCR experiments showed that the mRNA levels of KV1.2 (KCNA2), KV1.5
309 (KCNA5), and BKCaβ1 (KCNMB1) were downregulated in PASMC isolated from IPAH patients
310 (Fig. 2A). However, there were no significant differences in KV1.1 (KCNA1) mRNA expression
311 between normal and IPAH PASMC. Utilizing Western blot technique, we confirmed these
I 15
312 results. The protein levels of KCNA2 (KV1.2), KCNA5 (KV1.5), and KCNMB1 (BKCaβ1) were
313 significantly reduced in IPAH-PASMC compared to control cells, while the protein level of
314 KCNA1 did not change (Fig. 2B and C). These data indicate that mRNA expression of certain
315 K+ channels is significantly downregulated in PASMC from IPAH patients. Downregulated K+
316 channel expression is potentially responsible for the decreased amplitude and current-density of
317 whole-cell K+ currents due to changes in K+ channel pore-forming subunits (i.e., KCNA2 and
318 KCNA5) or from changes in K+ channel regulatory subunits (i.e., KCNMB1) in IPAH patients.
319 Moreover, we compared levels of K+ channels in pulmonary arterial endothelial cells
320 (PAEC) between healthy subjects and IPAH patients to identify whether KCNA2, KCNA5 and
321 KCNMB1 were decreased in endothelial cells. As shown on Figure 2D (panel a), we were able to
322 detect KCNA2, KCNA5, and KCNMB1 channels in human PAEC, but did not reveal significant
323 changes in protein expression of KCNA2 and KCNA5 between normal and IPAH PAEC.
324 KCNMB1 level was slightly increased in IPAH cells compared to controls (Fig. 2D, panel b).
325 We did not measure KCNA1 protein level in normal and IPAH PAEC since there were no
326 differences in KCNA1 expression between normal and IPAH PASMC. These results
327 demonstrate that the downregulation of KCNA2, KCNA5 and KCNMB1 are unique to PASMC
328 in IPAH patients.
329 To further demonstrate that miR-29b, miR-138 and miR-222 specifically regulate K+
330 channels in PASMC, we also quantified the miRNAs in normal and IPAH PAEC. Real-time
331 PCR experiments showed that miR-138 level was significantly decreased, whereas miR-222
332 level was markedly increased in PAEC isolated from IPAH patients compared to controls (Fig.
333 2E). We did not reveal any changes in miR-29b expression between normal and IPAH cells.
I 16
334 These findings led us to speculate that unchanged K+ channel expression is related to miR-29b
335 but not miR138 and miR-222 levels in IPAH PAEC.
336
337 The miR-29b, miR-138, and miR-222 mimics decrease the activity and downregulates the
338 expression of KV channels in normal human PASMC. This set of experiments was designed to
339 investigate whether miR-29b, miR-138, and miR-222 regulate the expression and/or activity of
340 K+ channels in human PASMC. As shown in Suppl. Table 1, in silico analysis revealed that miR-
341 29b, miR-138 and miR-222 target KCNA2, KCNA5 and KCNMB1 in human PASMC (private
342 sharing link for Figshare data: https://figshare.com/s/1f417014a1aba70f3ed2). First, we aimed to
343 determine whether the overexpression of miR-29b, miR-138, or miR-222 (which were detected
344 at higher level in IPAH-PASMC) in normal PASMC decreased K+ channels expression and/or
345 activity. Normal PASMC transfected with miR-29b, miR-138, miR-222 mimics had a dramatic
346 increase of miR-29b, miR-138, and miR-222 compared to non-transfected (Mock) cells and cells
347 transfected with AllStars Control siRNA (NC mimic) (Fig. 3A). There was no significant
348 difference between mock and NC mimic groups. It is important to note that we should measure
349 the level of functional (RISC-associated) miRNA in a manner that we could avoid detecting
350 miRNA mimic trapped in the non-functional locations. Due to the limitations of real-time RT-
351 PCR technique, however, we were only able to detect the total, but not the functional, miRNA
352 level (Fig. 3A). Then, we compared KV channel activity in normal PASMC transfected with NC
353 mimic or miRNA mimics (miR-29b/miR-138/miR-222). The amplitude and current-density of
354 whole-cell KV currents were significantly decreased by miR-29b (P<0.001), miR-138 (P<0.001)
355 or miR-222 (P<0.001) mimics (Fig. 3B); the miR-29b-induced inhibition (approximately 80%)
356 seemed to be greater than the miR-138/miR-222-mediated inhibition (at 60-70% compared to
I 17
357 NC mimic-transfected cells) (Fig. 3Bb). We then aimed to investigate which KV channels were
358 responsible for the miRNA-mediated decrease in KV currents in normal PASMC. As shown
359 earlier in this study (see Fig. 2), we found that both mRNA and protein expression levels of
360 KCNA2 and KCNA5 were significantly downregulated in IPAH-PASMC compared to cells
361 from healthy subjects. In the next set of experiments, we examined whether expression of
362 KCNA2 and KCNA5 channels were regulated by miR-29b, miR-138 and miR-222 in normal
363 PASMC. As shown in Figure 3C, all three miRNAs (miR-29b/miR-138/miR-222) remarkably
364 decreased the mRNA expression level of KCNA5 but not the mRNA expression of KCNA2 in
365 normal PASMC. We were able to confirm the real-time PCR results in the Western blot
366 experiments. However, we could not detect any changes in KCNA2 protein expression between
367 the NC mimic-transfected cells and the miRNA-transfected cells, while KCNA5 level was
368 dramatically reduced in PASMC overexpressed miR-29b, miR-138 or miR-222 (Fig. 3D). These
369 results indicate that the upregulation of miR-29b, miR-138, or miR-222 (observed in IPAH-
370 PASMC) reduces whole-cell KV currents by, at least partially, downregulating KCNA5 channels
371 in normal PASMC.
372
373 Inhibition of miR-29b rescues the activity and expression of KV channels in PASMC that were
374 isolated from IPAH patients. In order to investigate whether the inhibition of selected miRNAs
375 (miR-29b, miR-138 or miR-222) in IPAH-PASMC results in recovering of KV channel activity
376 and/or expression, we transfected IPAH-PASMC with the miRNA inhibitors (or antagomiRs).
377 As expected, transfection of the specific miRNA inhibitors, antagomiR-29b, antagomiR-138 or
378 antagomiR-222 in IPAH-PASMC significantly decreased the levels of miR-29b, miR-138 and
379 miR-222, respectively (Fig. 4A), whereas transfection of the miScript Inhibitor Negative Control
I 18
380 (NC Inhibitor) had no effect on the miRNA levels (Fig. 4A) in comparison to the non-transfected
381 cells (Mock). We then compared KV channel activity in IPAH-PASMC transfected with the NC
382 inhibitor or the miRNA inhibitors. As shown in Figure 4B (panel a), antagomiR-29b completely
383 rescued whole-cell KV currents in IPAH-PASMC to the normal level while antagomiR-138
384 partially restored whole-cell KV currents. The amplitude of the whole-cell KV currents was
385 significantly (P<0.01) higher in IPAH-PASMC transfected with antagomiR-29b or antagomiR-
386 138 than in NC inhibitor-transfected IPAH-PASMC (Fig. 4Bb). Interestingly, inhibition of miR-
387 222 with antagomiR-222 had no effect on whole-cell KV currents in IPAH-PASMC (Fig. 4B).
388 Next, we investigated whether inhibition of miR-29b, miR-138, or miR-222 resulted in
389 increased KCNA5 expression in IPAH-PASMC. Out of the three miRNA inhibitors, only
390 antagomiR-29b was able to significantly upregulate both mRNA and protein level of KCNA5
391 channels (Fig. 4C and D). Inhibition of miR-138 or miR-222 by transfecting antagomiR-138 or
392 antagomiR-222 had no effect on KCNA5 protein expression levels in IPAH-PASMC (Fig. 4C
393 and D). We did not quantify KCNA2 protein levels since KCNA2 mRNA was not changed in
394 miRNA-transfected cells (see Fig. 3C and D). These data demonstrate that only miR-29b
395 inhibition is sufficient to recover or restore the whole-cell KV currents by increasing KCNA5
396 protein expression in PASMC isolated from patients with IPAH.
397 To further characterize the recovered or restored currents in antagomiR-29b-transfected
398 IPAH-PASMC, we conducted pharmacological experiments using diphenyl phosphine oxide-1
399 (DPO-1), a specific Kv1.5/KCNA5 channel blocker (21, 23). In order to confirm that DPO-1
400 specifically blocks Kv1.5/KCNA5 currents, we used HEK-293 cells transiently transfected with
401 the KCNA5 gene (Fig. 5A) to determine whether DPO-1 decreases whole-cell KCNA5 currents.
402 Extracellular application of DPO-1 (0.3 µM) to the KCNA5-transfected cells significantly and
I 19
403 reversibly decreased the amplitude and current-density of whole-cell KCNA5 currents (Fig. 5B).
404 These results indicate that DPO-1 is a potent inhibitor of KCNA5 channels. Then, we examined
405 the effect of DPO-1 on the recovered K+ currents in IPAH-PASMC transfected with antagomiR-
406 29b. As shown in Figure 5C, antagomiR-29b transfection resulted in an increase in KCNA5
407 protein expression level in IPAH-PASMC (also see Fig. 4C and D). Extracellular application of
408 0.3 μM DPO-1 significantly and reversibly decreased the whole-cell KV currents in IPAH-
409 PASMC transfected with antagomiR-29b (Fig. 5D). The amplitude and current-density of KV
410 currents, elicited by a test potential of +80 mV from a holding potential of -70 mV, in
411 antagomiR-29b-transfected IPAH-PASMC were reduced from 343.1±49.8 pA and 22.9±3.3
412 pA/pF to 128.6±36.4 pA and 6.4±1.8 pA/pF (P<0.001) before (Control) and during (DPO-1)
413 extracellular application of 0.3 μM DPO-1 (Fig. 5Db and Dc). The DPO-1-mediated inhibitory
414 effect on whole-cell KV currents was also reversible in some cells. These data led us to conclude
415 that increased miR-29b and miR-29b-mediated KCNA5 downregulation are involved in
416 decreasing whole-cell KV currents in IPAH-PASMC.
417
418 miR-29b directly targets 3’-UTR of human KCNA5. There is a potential complimentary binding
419 site for miR-29b in the 3’-UTR of human KCNA5 mRNA (Fig. 6A). To determine if miR-29b
420 directly binds KCNA5, we performed luciferase assays in which wildtype 3’-UTR of KCNA5
421 was cloned into a pmiR-Glo vector. To further confirm direct binding of miR-29b to the putative
422 seed sequence in the 3’-UTR of KCNA5, we additionally designed two different luciferase
423 constructs containing specific point mutations within the seed sequence (Fig. 6B). The firefly
424 luminescence was significantly decreased in HEK 293 cells transfected with wildtype KCNA5
425 3’-UTR vector and miR-29b mimic compared to cells transfected with wildtype KCNA5 3’-UTR
I 20
426 vector and NC mimic (Fig. 6C). This decrease indicates that miR-29b binds to the 3’-UTR of
427 KCNA5. As expected, the transfections with mutated plasmids (Mutant-1 and Mutant-2) did not
428 significantly alter the luciferase activity between the NC inhibitor-transfected cells and the miR-
429 29b-transfected cells (Fig. 6C). These results demonstrate that miR-29b directly binds to the 3’-
430 UTR of KCNA5. Therefore, a selective miR-29b inhibitor would be an ideal therapeutic agent
431 that may be able to rescue the attenuated K+ channel function and the decreased KCNA5
432 expression in PASMC from patients with IPAH.
433
434 Activity of BKCa channels is attenuated in PASMC isolated from IPAH patients. Earlier in this
435 study we showed that KCNMB1 mRNA and protein level is lower in IPAH-PASMC than normal
436 cells (see Fig. 2Bb and C). In silico analysis revealed that miR-29b, miR-138, and miR-222
437 could also target BKCaβ1 channel encoded by the KCNMB1 gene. Therefore, we aimed to
438 measure the activity of BKCa channels in normal and IPAH PASMC. In these experiments,
2+ 439 whole-cell BKCa currents were measured under conditions in which the intracellular [Ca ] (in
440 the pipette solution) was maintained at a high level (1 µM by using appropriate concentrations of
2+ 441 EGTA and CaCl2) and extracellular [Ca ] (in the bath solution) was kept at 1.8 mM.
442 Extracellular application of 100 nM iberiotoxin (IbTX), a selective blocker of BKCa channels,
443 significantly reduced the whole-cell BKCa currents in both normal and IPAH PASMC (Fig. 7Aa).
444 The subtraction of the currents recorded during the application of IbTX from the currents
445 recorded before application of IbTX revealed IbTX-sensitive BKCa currents (Fig. 7Ab).
446 In normal PASMC, the outward K+ currents elicited by depolarizing the cells from a
447 holding potential of -80 mV to a series of test potentials ranging from -90 to +100 mV were
448 mostly inhibited by 100 nM IbTX. On the other hand, the amplitude of whole-cell outward K+
I 21
449 currents (including KV and BKCa currents) in IPAH-PASMC was smaller than that in normal
450 PASMC (Fig. 7A) and the sensitive of the whole-cell outward K+ currents to IbTX was also
451 much less in IPAH-PASMC than in normal PASMC (Fig. 7A). It is important to note that the
+ 452 IbTX-insensitive currents, which are mainly generated by K efflux through KV channels (IK(V)),
2+ 453 are very low in normal PASMC indicating that high intracellular [Ca ] reduces IK(V) (55). There
454 was no significant difference in cell capacitance between normal and IPAH PASMC (Fig. 7B).
455 The amplitude and current-density of the IbTX-sensitive BKCa currents in IPAH-PASMC were
456 significantly (P<0.05) lower than in normal PASMC (Fig. 7C). These results indicate that the
457 activity of BKCa channels is dramatically reduced in PASMC isolated from IPAH patients.
458
459 miR-29b regulates BKCa channel activity and KCNMB1 expression. This set of experiments
460 was designed to test whether the selected upregulated miRNAs (miR-29b/miR-138/miR-222)
461 contributed to the attenuated BKCa channel activity and/or expression in PASMC from IPAH
462 patients. At first, we compared KCNMB1 expression in normal PASMC transfected with miR-
463 29b, miR-138 or miR-222 mimics. Western blot experiments showed that the protein level of
464 KCNMB1 was decreased by miR-29b, miR-138 and miR-222 in normal PASMC (Fig. 8A). We
465 were also able to confirm our results on channel activities in the single-channel cell-attached
466 mode of patch-clamp experiments. The amplitude of single-channel current at holding potential
467 of +40 mV indicates that this is the large-conductance BKCa channel current (Fig. 8Ba). The
468 open probability (Popen) of the channels was significantly decreased in cells transfected with
469 miR-29b mimic compared with NC mimic-transfected cells (Fig. 8Ba and Bb). Overexpression
470 of miR-138 also had an inhibitory effect on BKCa channel activity in normal PASMC but the
471 Popen in miR-138-transfected cells was only partially decreased in comparison to cells transfected
I 22
472 with NC mimic (Fig. 8C). We did not measure BKCa channel activity in miR-222-transfected
473 cells because we showed earlier that miR-222 had no effect on the whole-cell K+ currents in
474 IPAH-PASMC (see Fig. 4B).
475 Then, we aimed to determine whether antagomiR-29b, antagomiR-138, antagomiR-222
476 recovered the expression of BKCa channels in PASMC isolated from patients with IPAH. As
477 shown in Figure 9A, only antagomiR-29b significantly restored KCNMB1 protein expression in
478 IPAH-PASMC, whereas antagomiR-138 and antagomiR-222 had little effects on the protein
479 level of KCNMB1 in IPAH PASMC. These data suggest that miR-29b had the greatest ability to
480 regulate BKCa channel expression and KCa currents in human PASMC; therefore, we excluded
481 miR-138 and miR-222 from subsequent experiments. To further confirm miR-29b-mediated
+ 482 regulation of BKCa channels, we recorded the whole-cell K current in the presence of a specific
483 blocker of KCa channels. Extracellular application of Penitrem A (100 nM), a selective blocker of
+ 484 BKCa channels, was able to reduce the whole-cell K currents in normal PASMC transfected with
485 NC mimic but not in cells transfected with miR-29b mimic (Fig. 9Ba). In NC mimic-transfected
+ 486 cells, the outward K currents were significantly reduced by the BKCa channel blocker, Penitrem
487 A. On the other hand, the whole-cell outward K+ currents in miR-29b-transfected cells were
488 smaller than that in NC mimic-transfected PASMC and insensitive to Penitrem A. The
489 subtraction of the currents recorded during the application of Penitrem A from the currents
490 recorded before application of the blocker revealed Penitrem A-sensitive BKCa currents (Fig.
491 9Bb). The amplitude of the Penitrem A-sensitive BKCa currents in PASMC transfected with
492 miR-29b was significantly (P<0.05) lower than that in NC mimic-transfected cells (Fig. 9Bc).
493 These data indicate that miR-29b, in addition to its inhibitory effect on KV channels, also
I 23
494 decreases BKCa channel activity by, at least in part, reducing KCNMB1 mRNA and protein level
495 in PASMC.
496 To further characterize the outward K+ currents recovered by transfecting miR-29b
497 inhibitor, we measured whole-cell BKCa currents before, during and after application Penitrem A
498 in IPAH-PASMC transfected with antagomiR-29b (Fig. 9C). The extracellular application of 100
499 nM Penitrem A significantly and reversibly reduced the whole-cell outward K+ currents in
500 antagomiR-29b-transfected IPAH-PASMC (Fig. 9C). The sensitivity of antagomiR-29b-
+ 501 recovered or restored whole-cell K currents to Penitrem A indicates that BKCa currents are part
502 of the K+ currents in IPAH PASMC restored by antagomir-29b (Fig. 9C). These data also imply
503 that increased miR-29b in IPAH-PASMC is involved in decreasing whole-cell K+ currents by
504 downregulating KV channels (see Fig. 5D) and BKCa channels (see Fig. 9C) in PASMC.
505 Next, we performed single-channel patch-clamp experiments to further confirm that
506 antagomiR-29b elevated BKCa currents in IPAH-PASMC. miR-29b inhibitor or antagomir-29b
507 significantly increased the channel activity and Popen in IPAH-PASMC (Fig. 9D). The amplitude
508 (~10 pA) of single-channel current at a holding potential of +40 mV for the cell-attached
509 membrane patch indicates that the antagomiR-29b-recovered K+ currents in IPAH-PASMC (Fig.
510 9D) are likely the large-conductance (~200 pS) BKCa channel currents. Based on these results,
511 we conclude that miR-29b inhibition is sufficient to restore BKCa channel activity in PASMC
512 isolated from patients with IPAH.
513
I 24
514 Discussion
515 In this study, we demonstrate that miR-29b is specifically upregulated and negatively exerts
+ 516 posttranscriptional regulation onto K (KV and BKCa) channels in PASMC isolated from IPAH
517 patients in comparison to PASMC isolated from normal subjects. Additionally, we showed that
518 inhibitors or antagomiRs specifically targeting miR-29b could be novel potential therapeutic
519 agents for patients with IPAH. Our results indicate that: a) upregulated miR-29b, miR-138 and
+ 520 miR-222 are associated with reduced K channel activity and downregulated KV1.2 (KCNA2),
521 KV1.5 (KCNA5), and BKCaβ1 (KCNMB1) channel subunits in PASMC from IPAH patients; b)
522 miR-29b decreases KV channel activity in IPAH-PASMC by directly targeting KCNA5; and c)
523 miR-29b also contributes to attenuated BKCa channel activity and BKCaβ1 expression in IPAH-
524 PASMC. The miR-29b-mediated posttranscriptional suppression of the KV channel pore-forming
525 α subunit, KV1.5/KCNA5 and the large-conductance KCa channel regulatory β subunit,
526 BKCaβ1/KCNMB1, in PASMC is thus one of the important mechanisms responsible for
527 attenuated whole-cell K+ currents in PASMC from patients and animals with pulmonary
528 hypertension. The decreased function and expression of KV (e.g., KV1.5/KCNA5) and BKCa
529 (e.g., BKCaβ1/KCNMB1) channel subunits by miR-29b in PASMC would contribute to causing
2+ 530 pulmonary vasoconstriction (by membrane depolarization-mediated increase in [Ca ]cyt) and
531 pulmonary vascular remodeling (by enhancing PASMC proliferation and inhibiting apoptosis).
532 We previously identified the expression of many different K+ channels in normal human
533 PASMC (26). We and other investigators showed that mRNA and protein expression of KV
534 channels (e.g., KV1.2/KCNA2, KV1.5/KCNA5) was downregulated, and amplitude and current
535 density of KV currents were reduced in PASMC isolated from patients with IPAH compared to
536 PASMC isolated from normal subjects (or patients without pulmonary hypertension) and in
I 25
537 PASMC isolated from animals with experimental pulmonary hypertension (e.g., hypoxia-
538 induced pulmonary hypertension) compared to the normoxic controls (8, 22, 24, 44, 63, 64, 75).
539 Our current findings are consistent with the previous results: the whole-cell KV currents are
540 reduced and KV1.2/KCNA2 and KV1.5/KCNA5 channels are downregulated in IPAH-PASMC in
541 comparison to normal cells. However, we could not detect any significant changes in KV1.1
542 (KCNA1) mRNA and protein levels between normal and IPAH PASMC. Given that
+ 543 KV1.5/KCNA5 channel is an important K channel involved in regulating the membrane
544 potential and inducing membrane repolarization and hyperpolarization in PASMC (48), the
545 downregulated KV1.5/KCNA5 expression is responsible, at least partially, for the decreased
546 amplitude and current density of whole-cell IK(V) and the membrane depolarization associated
2+ 547 increases in [Ca ]cyt in PASMC from IPAH patients under normoxia.
2+ 548 When we used intracellular pipette solution containing high [Ca ]cyt to record BKCa
549 currents in human PASMC, we found that the IbTX-insensitive currents or the remaining IbTX-
550 insensitive KV currents in PASMC superfused with high concentration of IbTX (100 nM), were
551 very small in normal PASMC (see Fig. 7A). These results are consistent with early studies
552 showing that intracellular Ca2+ may inhibit Kv channels in PASMC (51, 55). Post et al. first
2+ 553 reported in 1992 that acute hypoxia inhibited Kv channels in PASMC by an increase in [Ca ]cyt
2+ 2+ 554 (51); the initial increase in [Ca ]cyt was due likely to hypoxia-mediated Ca release (55) from
2+ 2+ 555 IP3-sensitive intracellular Ca stores and/or Ca influx through voltage-independent cation
2+ 556 channels (57, 66). The resulting membrane depolarization induced by Ca -mediated KV channel
557 inhibition further result in Ca2+ influx through voltage-dependent Ca2+ channels causing
558 pulmonary vasoconstriction.
I 26
559 Unlike KV channels, the expression and function of BKCa channels are not well
560 understood in pulmonary hypertension (1, 4, 19, 45). In this study, we revealed that BKCa
561 channel activity is attenuated and KCNMB1 expression is reduced in PASMC from IPAH
562 patients in comparison to cells from healthy subjects. Our findings are consistent with the
563 observations in animal models of pulmonary hypertension (7, 71, 77). BKCa channel activator
564 NS1619 was able to reduce right ventricular systolic pressure, a surrogate of pulmonary arterial
565 systolic pressure, in rats with monocrotaline-induced pulmonary hypertension (54). KCNMB1 is
566 a regulatory subunit that modulates the electrophysiological property of the pore-forming subunit
567 (e.g., KCNMA1) of the large-conductance Ca2+-activated and voltage-dependent K+ channels
568 (BKCa channels) (13). Co-assembly of the β subunit (KCNMB1) with the pore-forming α
569 subunit (KCNMA1) significantly affects the biophysical (e.g., voltage- and Ca2+-sensitivity) and
570 pharmacological (e.g., toxin selectivity and efficacy) properties of the BKCa channel (42). The
571 modifications of Ca2+ sensitivity (which is regulated by β subunit/KCNMB1) are mainly
572 responsible for the decreased activity of BKCa channels in PASMC isolated from rats with
573 hypoxia-induced pulmonary hypertension (9) while kcnmb1−/− mice develop worse pulmonary
574 hypertension under hypoxic conditions (4). Interestingly, kcnmb1−/− mice are also hypertensive
2+ 575 due to the inability of BKCa channels to be activated by Ca sparks and the compensated
2+ 576 pressure-induced vasoconstriction (13). Additionally, whole-cell BKCa current density and Ca
577 sensitivity were also lower in vascular smooth muscle cells from patients with systemic
578 hypertension due to KCNMB1 downregulation (72). The striking parallels to systemic
579 hypertension suggest that impaired BKCa channel function may be an important contributor to
580 sustained vasoconstriction in pulmonary hypertension.
I 27
581 In contrast to our results, another group revealed the upregulation of KCNMB1 mRNA
582 and protein in lung tissue from donors and IPAH patients (45). Although KCNMB1 appeared to
583 be restricted mainly to smooth muscle tissue, we at first detected its expression in human
584 pulmonary arterial endothelial cells (PAEC). Using Western blot experiments, we demonstrated
585 that KCNMB1 is decreased in PASMC but increased in PAEC from IPAH patients. We
586 previously reported that the whole-lung tissue is mainly composed of lung vascular endothelial
587 cells (62), therefore, the divergent changes in KCNMB1 expression in PASMC and PAEC could
588 explain, at least partially, the different data on KCNMB1 level in PASMC and lung tissue
589 isolated patients with IPAH or animals with experimental pulmonary hypertension.
590 Various miRNAs have been implicated in the development and progression of pulmonary
591 hypertension (11, 28, 46, 56, 76), however, miRNA-mediated regulation of KV and BKCa
592 channels is not well understood. Recently, Mondejar-Parreño et al. revealed that KCNA5 is
593 inhibited by the upregulated miR-1 in hypoxia/SU5416-induced pulmonary hypertension model
594 in rats (43). In contrast, Machado’s group reported that hypoxia attenuated miR-1 in vitro and in
595 vivo experiments (58). Additional studies are needed to further investigate these differing
596 findings. Interestingly, it is reported that miR-1 is downregulated in PASMC isolated from IPAH
597 patients (58) suggesting that downregulation of KCNA5 is not directly due to miR-1 in IPAH-
598 PASMC. Our data showed for the first time that miR-29b directly inhibits KCNA5 and decreases
599 KCNMB1 resulting in reduced whole-cell K+ currents in IPAH-PASMC. The upregulation of
600 miR-138 and miR-222 were also previously established in pulmonary hypertension (6, 29, 33,
601 37, 68), but in this study we demonstrated that miR-29b has the most potential to regulate K+
602 channel function and expression in PASMC from patients with IPAH. Although miR-138 and
603 miR-222 attenuate K+ channel activity and downregulate KCNA5 and KCNMB1, inhibition of
I 28
604 miR-138 and miR-222 are not sufficient to restore K+ channel activity and expression in IPAH-
605 PASMC. It is reasonable to speculate that miR-29b could be a potential interesting target in
606 developing novel therapeutic approach for different forms of pulmonary hypertension.
607 In human cancer, miR-29b is known to be a tumor suppressor, however it may also act as
608 a tumor promoter under certain conditions (70). Data about miR-29b in pulmonary hypertension
609 is limited but suggest that miR-29b is involved in the development and progression of disease. In
610 contrast, a recent study found that hypoxia decreases miR-29b in vivo and in vitro (16). Chen et
611 al. showed that miR-29b suppresses proliferation and promotes apoptosis by targeting CCND2
612 and Mcl-1. Similar to cancer research miR-29b could have a different effect in hypoxia-induced
613 pulmonary hypertension and idiopathic PAH. It is also unclear whether and how miR-29b affects
614 PASMC contraction, proliferation, migration and/or apoptosis in normal subjects and IPAH
615 patients; but we will pursue this line of investigation in the future.
616 In conclusion, we identified three miRNAs (miR-29b, miR-138, miR-222) in this study
617 that are upregulated in IPAH-PASMC comparing to normal PASMC in addition to many
618 miRNAs that have been implicated in the development and progression of pulmonary
619 hypertension. Our results from this study indicate that downregulated KCNA5, a pore-forming α
620 subunit for forming KV channels, and KCNMB1, a regulatory β subunit for BKCa channels, and
621 the reduced whole-cell KV and BKCa currents in IPAH-PASMC may be due partially to the
622 upregulation of selected miRNAs (e.g., miR-29b, miR-138, miR-222). Overexpression of these
623 miRNAs in normal PASMC makes normal cells phenotypically resemble IPAH-PASMC (e.g.,
624 with reduced whole-cell K+ currents and downregulated KCNA5/KCNMB1), while inhibition of
625 miR-29b only in IPAH-PASMC is sufficient to rescue the decreased K+ currents and
626 KCNA5/KCNMB1 expression. AntagomiR-29b-recovered whole-cell K+ currents in IPAH-
I 29
627 PASMC contain both Penitrem A-insensitive KV currents and Penitrem A-sensitive BKCa
628 currents. These observations indicate that upregulated miR-29b in IPAH-PASMC is sufficient to
629 decrease both KV currents (by downregulating KCNA5) and BKCa currents (by downregulating
630 KCNMB1). Significantly reduced whole-cell K+ currents (e.g., by miR-29b, miR-138, miR-222)
631 would subsequently cause membrane depolarization, enhance Ca2+ influx through VDCC,
2+ 632 increase [Ca ]cyt and eventually cause pulmonary vasoconstriction and induce pulmonary
633 vascular medial hypertrophy (by stimulating PASMC proliferation and migration). Furthermore,
+ + 634 decreased K currents or K efflux through KV and BKCa channels in IPAH-PASMC would also
635 inhibit PASMC apoptosis by attenuating apoptotic volume decrease and inhibiting cytoplasmic
636 caspase activity, and further contribute to pulmonary vascular wall thickening (14). The impaired
2+ 637 BKCa channel function or inhibited Ca - and voltage-mediated BKCa channel activation would
638 also contribute to increasing myogenic vascular tone and further enhance sustained pulmonary
639 vasoconstriction. These data imply that specific inhibition of miR-29b in PASMC (by the use of
640 chemically modified oligonucleotide antisense inhibitors or antagomirs) may be an important
641 strategy to develop novel and therapeutically effective approaches to treat patients with IPAH.
642
643
I 30
644 Acknowledgments
645 This work was supported, in part, by grants from the National Heart, Lung, and Blood Institute
646 of the National Institutes of Health (HL125208, HL135807, and HL126609).
647
I 31
648 REFERENCES 649 650 1. Ahn YT, Kim YM, Adams E, Lyu SC, Alvira CM, and Cornfield DN. Hypoxia- 651 inducible factor-1a regulates KCNMB1 expression in human pulmonary artery smooth muscle 652 cells. Am J Physiol Lung Cell Mol Physiol 302: L352-359, 2012. 653 2. Archer SL, Souil E, Dinh-Xuan AT, Schremmer B, Mercier JC, El Yaagoubi A, 654 Nguyen-Huu L, Reeve HL, and Hampl V. Molecular identification of the role of voltage-gated + 655 K channels, Kv1.5 and Kv2.1, in hypoxic pulmonary vasoconstriction and control of resting 656 membrane potential in rat pulmonary artery myocytes. J Clin Invest 101: 2319-2330, 1998. 657 3. Barman SA, Zhu S, and White RE. Hypoxia modulates cyclic AMP activation of BKCa 658 channels in rat pulmonary arterial smooth muscle. Lung 183: 353-361, 2005. 659 4. Barnes EA, Lee L, Barnes SL, Brenner R, Alvira CM, and Cornfield DN. b1-Subunit 660 of the calcium-sensitive potassium channel modulates the pulmonary vascular smooth muscle 661 cell response to hypoxia. Am J Physiol Lung Cell Mol Physiol 315: L265-L275, 2018. 662 5. Behrens R, Nolting A, Reimann F, Schwarz M, Waldschutz R, and Pongs O. 663 hKCNMB3 and hKCNMB4, cloning and characterization of two members of the large- 664 conductance calcium-activated potassium channel beta subunit family. FEBS Lett 474: 99-106, 665 2000. 666 6. Bienertova-Vasku J, Novak J, and Vasku A. MicroRNAs in pulmonary arterial 667 hypertension: pathogenesis, diagnosis and treatment. J Am Soc Hypertens 9: 221-234, 2015. 668 7. Bonnet S, Dumas-de-La-Roque E, Begueret H, Marthan R, Fayon M, Dos Santos P, 669 Savineau JP, and Baulieu EE. Dehydroepiandrosterone (DHEA) prevents and reverses chronic 670 hypoxic pulmonary hypertension. Proc Natl Acad Sci U S A 100: 9488-9493, 2003. 671 8. Bonnet S, Michelakis ED, Porter CJ, Andrade-Navarro MA, Thebaud B, Bonnet S, 672 Haromy A, Harry G, Moudgil R, McMurtry MS, Weir EK, and Archer SL. An abnormal 673 mitochondrial-hypoxia inducible factor-1a-Kv channel pathway disrupts oxygen sensing and 674 triggers pulmonary arterial hypertension in fawn hooded rats: similarities to human pulmonary 675 arterial hypertension. Circulation 113: 2630-2641, 2006. 676 9. Bonnet S, Savineau JP, Barillot W, Dubuis E, Vandier C, and Bonnet P. Role of 677 Ca2+-sensitive K+ channels in the remission phase of pulmonary hypertension in chronic 678 obstructive pulmonary diseases. Cardiovasc Res 60: 326-336, 2003. 679 10. Boucherat O, Chabot S, Antigny F, Perros F, Provencher S, and Bonnet S. 680 Potassium channels in pulmonary arterial hypertension. Eur Respir J 46: 1167-1177, 2015. 681 11. Boucherat O, Potus F, and Bonnet S. microRNA and pulmonary hypertension. Adv Exp 682 Med Biol 888: 237-252, 2015. 683 12. Brenner R, Jegla TJ, Wickenden A, Liu Y, and Aldrich RW. Cloning and functional 684 characterization of novel large conductance calcium-activated potassium channel beta subunits, 685 hKCNMB3 and hKCNMB4. J Biol Chem 275: 6453-6461, 2000. 686 13. Brenner R, Perez GJ, Bonev AD, Eckman DM, Kosek JC, Wiler SW, Patterson AJ, 687 Nelson MT, and Aldrich RW. Vasoregulation by the b1 subunit of the calcium-activated 688 potassium channel. Nature 407: 870-876, 2000. 689 14. Brevnova EE, Platoshyn O, Zhang S, and Yuan JX. Overexpression of human 690 KCNA5 increases IKV and enhances apoptosis. Am J Physiol Cell Physiol 287: C715-722, 2004. 691 15. Burg ED, Remillard CV, and Yuan JX. Potassium channels in the regulation of 692 pulmonary artery smooth muscle cell proliferation and apoptosis: pharmacotherapeutic 693 implications. Br J Pharmacol 153 Suppl 1: S99-S111, 2008.
I 32
694 16. Chen J, Li Y, Li Y, Xie L, Wang J, Zhang Y, and Xiao T. Effect of miR-29b on the 695 proliferation and apoptosis of pulmonary artery smooth muscle cells by targeting Mcl-1 and 696 CCND2. Biomed Res Int 2018: 6051407, 2018. 697 17. Courboulin A, Ranchoux B, Cohen-Kaminsky S, Perros F, and Bonnet S. MicroRNA 698 networks in pulmonary arterial hypertension: share mechanisms with cancer? Curr Opin Oncol 699 28: 72-82, 2016. 700 18. Cox RH. Molecular determinants of voltage-gated potassium currents in vascular smooth 701 muscle. Cell Biochem Biophys 42: 167-195, 2005. 702 19. Detweiler ND, Song L, McClenahan SJ, Versluis RJ, Kharade SV, Kurten RC, Rhee 703 SW, and Rusch NJ. BK channels in rat and human pulmonary smooth muscle cells are BKa-β1 704 functional complexes lacking the oxygen-sensitive stress axis regulated exon insert. Pulm Circ 6: 705 563-575, 2016. 706 20. Dopico AM, Bukiya AN, and Jaggar JH. Calcium- and voltage-gated BK channels in 707 vascular smooth muscle. Pflugers Arch 2018. 708 21. Du YM, Zhang XX, Tu DN, Zhao N, Liu YJ, Xiao H, Sanguinetti MC, Zou A, and 709 Liao YH. Molecular determinants of Kv1.5 channel block by diphenyl phosphine oxide-1. J Mol 710 Cell Cardiol 48: 1111-1120, 2010. 711 22. Fan Z, Liu B, Zhang S, Liu H, Li Y, Wang D, Liu Y, Li J, Wang N, Liu Y, and 712 Zhang B. YM155, a selective survivin inhibitor, reverses chronic hypoxic pulmonary 713 hypertension in rats via upregulating voltage-gated potassium channels. Clin Exp Hypertens 37: 714 381-387, 2015. 715 23. Fancher IS, Butcher JT, Brooks SD, Rottgen TS, Skaff PR, Frisbee JC, and Dick 716 GM. Diphenyl phosphine oxide-1-sensitive K+ channels contribute to the vascular tone and 717 reactivity of resistance arteries from brain and skeletal muscle. Microcirculation 22: 315-325, 718 2015. 719 24. Fike CD, Kaplowitz MR, Zhang Y, and Madden JA. Voltage-gated K+ channels at an 720 early stage of chronic hypoxia-induced pulmonary hypertension in newborn piglets. Am J 721 Physiol Lung Cell Mol Physiol 291: L1169-1176, 2006. 722 25. Firth AL, Mandel J, and Yuan JX. Idiopathic pulmonary arterial hypertension. Dis 723 Model Mech 3: 268-273, 2010. 724 26. Firth AL, Remillard CV, Platoshyn O, Fantozzi I, Ko EA, and Yuan JX. Functional 725 ion channels in human pulmonary artery smooth muscle cells: Voltage-dependent cation 726 channels. Pulm Circ 1: 48-71, 2011. 727 27. Goncharov DA, Kudryashova TV, Ziai H, Ihida-Stansbury K, DeLisser H, 728 Krymskaya VP, Tuder RM, Kawut SM, and Goncharova EA. Mammalian target of 729 rapamycin complex 2 (mTORC2) coordinates pulmonary artery smooth muscle cell metabolism, 730 proliferation, and survival in pulmonary arterial hypertension. Circulation 129: 864-874, 2014. 731 28. Gupta S, and Li L. Modulation of miRNAs in pulmonary hypertension. Int J Hypertens 732 2015: 169069, 2015. 733 29. Hong Z, Chen KH, DasGupta A, Potus F, Dunham-Snary K, Bonnet S, Tian L, Fu J, 734 Breuils-Bonnet S, Provencher S, Wu D, Mewburn J, Ormiston ML, and Archer SL. 735 MicroRNA-138 and microRNA-25 down-regulate mitochondrial calcium uniporter, causing the 736 pulmonary arterial hypertension cancer phenotype. Am J Respir Crit Care Med 195: 515-529, 737 2017. 738 30. Huang JB, Liu YL, Sun PW, Lv XD, Bo K, and Fan XM. Novel strategy for treatment 739 of pulmonary arterial hypertension: enhancement of apoptosis. Lung 188: 179-189, 2010.
I 33
740 31. Jernigan NL, and Resta TC. Calcium homeostasis and sensitization in pulmonary 741 arterial smooth muscle. Microcirculation 21: 259-271, 2014. 742 32. Kuhr FK, Smith KA, Song MY, Levitan I, and Yuan JX. New mechanisms of 743 pulmonary arterial hypertension: role of Ca2+ signaling. Am J Physiol Heart Circ Physiol 302: 744 H1546-1562, 2012. 745 33. Li S, Ran Y, Zhang D, Chen J, Li S, and Zhu D. MicroRNA-138 plays a role in 746 hypoxic pulmonary vascular remodelling by targeting Mst1. Biochem J 452: 281-291, 2013. 747 34. Li SS, Ran YJ, Zhang DD, Li SZ, and Zhu D. MicroRNA-190 regulates hypoxic 748 pulmonary vasoconstriction by targeting a voltage-gated K+ channel in arterial smooth muscle 749 cells. J Cell Biochem 115: 1196-1205, 2014. 750 35. Ling L, Kokoza VA, Zhang C, Aksoy E, and Raikhel AS. MicroRNA-277 targets 751 insulin-like peptides 7 and 8 to control lipid metabolism and reproduction in Aedes aegypti 752 mosquitoes. Proc Natl Acad Sci U S A 114: E8017-E8024, 2017. 753 36. Ling TY, Wang XL, Chai Q, Lu T, Stulak JM, Joyce LD, Daly RC, Greason KL, 754 Wu LQ, Shen WK, Cha YM, and Lee HC. Regulation of cardiac CACNB2 by microRNA- 755 499: Potential role in atrial fibrillation. BBA Clin 7: 78-84, 2017. 756 37. Liu JJ, Zhang H, Xing F, Tang B, Wu SL, Xuan L, Kang PF, Xu Q, Wang HJ, 757 Zhang NR, and Wang XJ. MicroRNA138 promotes proliferation and suppresses mitochondrial 758 depolarization in human pulmonary artery smooth muscle cells through targeting TASK1. Mol 759 Med Rep 17: 3021-3027, 2018. 760 38. Liu X, Zhang Y, Du W, Liang H, He H, Zhang L, Pan Z, Li X, Xu C, Zhou Y, Wang 761 L, Qian M, Liu T, Yin H, Lu Y, Yang B, and Shan H. MiR-223-3p as a novel microRNA + 762 regulator of expression of voltage-gated K channel Kv4.2 in acute myocardial infarction. Cell 763 Physiol Biochem 39: 102-114, 2016. 764 39. Liu XS, Fan BY, Pan WL, Li C, Levin AM, Wang X, Zhang RL, Zervos TM, Hu J, 765 Zhang XM, Chopp M, and Zhang ZG. Identification of miRNomes associated with adult 766 neurogenesis after stroke using Argonaute 2-based RNA sequencing. RNA Biol 14: 488-499, 767 2017. 768 40. Luo X, Pan Z, Shan H, Xiao J, Sun X, Wang N, Lin H, Xiao L, Maguy A, Qi XY, Li 769 Y, Gao X, Dong D, Zhang Y, Bai Y, Ai J, Sun L, Lu H, Luo XY, Wang Z, Lu Y, Yang B, 770 and Nattel S. MicroRNA-26 governs profibrillatory inward-rectifier potassium current changes 771 in atrial fibrillation. J Clin Invest 123: 1939-1951, 2013. 772 41. Makino A, Firth AL, and Yuan JX. Endothelial and smooth muscle cell ion channels in 773 pulmonary vasoconstriction and vascular remodeling. Compr Physiol 1: 1555-1602, 2011. 774 42. Michelakis ED, Reeve HL, Huang JM, Tolarova S, Nelson DP, Weir EK, and 775 Archer SL. Potassium channel diversity in vascular smooth muscle cells. Can J Physiol 776 Pharmacol 75: 889-897, 1997. 777 43. Mondejar-Parreno G, Callejo M, Barreira B, Morales-Cano D, Esquivel-Ruiz S, 778 Moreno L, Cogolludo A, and Perez-Vizcaino F. miR-1 is increased in pulmonary hypertension 779 and downregulates Kv1.5 channels in rat pulmonary arteries. J Physiol 2018. 780 44. Moudgil R, Michelakis ED, and Archer SL. The role of K+ channels in determining 781 pulmonary vascular tone, oxygen sensing, cell proliferation, and apoptosis: implications in 782 hypoxic pulmonary vasoconstriction and pulmonary arterial hypertension. Microcirculation 13: 783 615-632, 2006. 784 45. Nagaraj C, Tang B, Nagy BM, Papp R, Jain PP, Marsh LM, Meredith AL, Ghanim 785 B, Klepetko W, Kwapiszewska G, Weir EK, Olschewski H, and Olschewski A.
I 34
786 Docosahexaenoic acid causes rapid pulmonary arterial relaxation via KCa channel-mediated 787 hyperpolarisation in pulmonary hypertension. Eur Respir J 48: 1127-1136, 2016. 788 46. Negi V, and Chan SY. Discerning functional hierarchies of microRNAs in pulmonary 789 hypertension. JCI Insight 2: e91327, 2017. 790 47. Nieves-Cintron M, Syed AU, Nystoriak MA, and Navedo MF. Regulation of voltage- 791 gated potassium channels in vascular smooth muscle during hypertension and metabolic 792 disorders. Microcirculation 25: 2018. 793 48. Park WS, Firth AL, Han J, and Ko EA. Patho-, physiological roles of voltage- 794 dependent K+ channels in pulmonary arterial smooth muscle cells. J Smooth Muscle Res 46: 89- 795 105, 2010. 796 49. Platoshyn O, Golovina VA, Bailey CL, Limsuwan A, Krick S, Juhaszova M, Seiden 797 JE, Rubin LJ, and Yuan JX. Sustained membrane depolarization and pulmonary artery smooth 798 muscle cell proliferation. Am J Physiol Cell Physiol 279: C1540-1549, 2000. 799 50. Platoshyn O, Remillard CV, Fantozzi I, Mandegar M, Sison TT, Zhang S, Burg E, 800 and Yuan JX. Diversity of voltage-dependent K+ channels in human pulmonary artery smooth 801 muscle cells. Am J Physiol Lung Cell Mol Physiol 287: L226-238, 2004. 802 51. Post JM, Hume JR, Archer SL, and Weir EK. Direct role for potassium channel 803 inhibition in hypoxic pulmonary vasoconstriction. Am J Physiol 262: C882-890, 1992. 804 52. Pullamsetti SS, Savai R, Seeger W, and Goncharova EA. Translational Advances in 805 the Field of Pulmonary Hypertension. From Cancer Biology to New Pulmonary Arterial 806 Hypertension Therapeutics. Targeting Cell Growth and Proliferation Signaling Hubs. Am J 807 Respir Crit Care Med 195: 425-437, 2017. 808 53. Qian H, Yang C, and Yang Y. MicroRNA-26a inhibits the growth and invasiveness of 809 malignant melanoma and directly targets on MITF gene. Cell Death Discov 3: 17028, 2017. 810 54. Revermann M, Neofitidou S, Kirschning T, Schloss M, Brandes RP, and Hofstetter 811 C. Inhalation of the BKCa-opener NS1619 attenuates right ventricular pressure and improves 812 oxygenation in the rat monocrotaline model of pulmonary hypertension. PLoS One 9: e86636, 813 2014. 814 55. Salvaterra CG, and Goldman WF. Acute hypoxia increases cytosolic calcium in 815 cultured pulmonary arterial myocytes. Am J Physiol 264: L323-328, 1993. 816 56. Sessa R, and Hata A. Role of microRNAs in lung development and pulmonary diseases. 817 Pulm Circ 3: 315-328, 2013. 818 57. Smith KA, Voiriot G, Tang H, Fraidenburg DR, Song S, Yamamura H, Yamamura 819 A, Guo Q, Wan J, Pohl NM, Tauseef M, Bodmer R, Ocorr K, Thistlethwaite PA, Haddad 820 GG, Powell FL, Makino A, Mehta D, and Yuan JX. Notch Activation of Ca(2+) Signaling in 821 the Development of Hypoxic Pulmonary Vasoconstriction and Pulmonary Hypertension. Am J 822 Respir Cell Mol Biol 53: 355-367, 2015. 823 58. Sysol JR, Chen J, Singla S, Zhao S, Comhair S, Natarajan V, and Machado RF. 824 Micro-RNA-1 is decreased by hypoxia and contributes to the development of pulmonary 825 vascular remodeling via regulation of sphingosine kinase 1. Am J Physiol Lung Cell Mol Physiol 826 314: L461-L472, 2018. 827 59. Tang H, Babicheva A, McDermott KM, Gu Y, Ayon RJ, Song S, Wang Z, Gupta A, 828 Zhou T, Sun X, Dash S, Wang Z, Balistrieri A, Zheng Q, Cordery AG, Desai AA, Rischard 829 F, Khalpey Z, Wang J, Black SM, Garcia JGN, Makino A, and Yuan JX. Endothelial HIF- 830 2a contributes to severe pulmonary hypertension due to endothelial-to-mesenchymal transition. 831 Am J Physiol Lung Cell Mol Physiol 314: L256-L275, 2018.
I 35
832 60. Toro L, Wallner M, Meera P, and Tanaka Y. Maxi-K(Ca), a Unique Member of the 833 Voltage-Gated K Channel Superfamily. News Physiol Sci 13: 112-117, 1998. 834 61. Tuder RM. Pulmonary vascular remodeling in pulmonary hypertension. Cell Tissue Res 835 367: 643-649, 2017. 836 62. Wang Z, Yang K, Zheng Q, Zhang C, Tang H, Babicheva A, Jiang Q, Li M, Chen Y, 837 Carr SG, Wu K, Zhang Q, Balistrieri A, Wang C, Song S, Ayon RJ, Desai AA, Black SM, 838 Garcia JGN, Makino A, Yuan JX, Lu W, and Wang J. Divergent changes of p53 in 839 pulmonary arterial endothelial and smooth muscle cells involved in the development of 840 pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 2018. 841 63. Weir EK, Obreztchikova M, Vargese A, Cabrera JA, Peterson DA, and Hong Z. 842 Mechanisms of oxygen sensing: a key to therapy of pulmonary hypertension and patent ductus 843 arteriosus. Br J Pharmacol 155: 300-307, 2008. 844 64. Whitman EM, Pisarcik S, Luke T, Fallon M, Wang J, Sylvester JT, Semenza GL, 845 and Shimoda LA. Endothelin-1 mediates hypoxia-induced inhibition of voltage-gated K+ 846 channel expression in pulmonary arterial myocytes. Am J Physiol Lung Cell Mol Physiol 294: 847 L309-318, 2008. 848 65. Xin H, Li Y, Buller B, Katakowski M, Zhang Y, Wang X, Shang X, Zhang ZG, and 849 Chopp M. Exosome-mediated transfer of miR-133b from multipotent mesenchymal stromal 850 cells to neural cells contributes to neurite outgrowth. Stem Cells 30: 1556-1564, 2012. 851 66. Xu L, Chen Y, Yang K, Wang Y, Tian L, Zhang J, Wang EW, Sun D, Lu W, and 852 Wang J. Chronic hypoxia increases TRPC6 expression and basal intracellular Ca2+ 853 concentration in rat distal pulmonary venous smooth muscle. PLoS One 9: e112007, 2014. 854 67. Xu W, Koeck T, Lara AR, Neumann D, DiFilippo FP, Koo M, Janocha AJ, Masri 855 FA, Arroliga AC, Jennings C, Dweik RA, Tuder RM, Stuehr DJ, and Erzurum SC. 856 Alterations of cellular bioenergetics in pulmonary artery endothelial cells. Proc Natl Acad Sci U 857 S A 104: 1342-1347, 2007. 858 68. Xu Y, Bei Y, Shen S, Zhang J, Lu Y, Xiao J, and Li X. MicroRNA-222 promotes the 859 proliferation of pulmonary arterial smooth muscle cells by targeting P27 and TIMP3. Cell 860 Physiol Biochem 43: 282-292, 2017. 861 69. Yamamura A, Ohara N, and Tsukamoto K. Inhibition of excessive cell proliferation 862 by calcilytics in idiopathic pulmonary arterial hypertension. PLoS One 10: e0138384, 2015. 863 70. Yan B, Guo Q, Fu FJ, Wang Z, Yin Z, Wei YB, and Yang JR. The role of miR-29b in 864 cancer: regulation, function, and signaling. Onco Targets Ther 8: 539-548, 2015. 865 71. Yan J, Chen R, Liu P, and Gu Y. Docosahexaenoic acid attenuates hypoxic pulmonary 866 vasoconstriction by activating the large conductance Ca2+-activated K+ currents in pulmonary 867 artery smooth muscle cells. Pulm Pharmacol Ther 28: 9-16, 2014. 868 72. Yang Y, Li PY, Cheng J, Mao L, Wen J, Tan XQ, Liu ZF, and Zeng XR. Function of 869 BKCa channels is reduced in human vascular smooth muscle cells from Han Chinese patients 870 with hypertension. Hypertension 61: 519-525, 2013. 871 73. Yeligar SM, Kang BY, Bijli KM, Kleinhenz JM, Murphy TC, Torres G, San Martin 872 A, Sutliff RL, and Hart CM. PPARg regulates mitochondrial structure and function and human 873 pulmonary artery smooth muscle cell proliferation. Am J Respir Cell Mol Biol 58: 648-657, 874 2018. 875 74. Yu FH, and Catterall WA. The VGL-chanome: a protein superfamily specialized for 876 electrical signaling and ionic homeostasis. Sci STKE 2004: re15, 2004.
I 36
877 75. Yuan JX, Aldinger AM, Juhaszova M, Wang J, Conte JV, Jr., Gaine SP, Orens JB, 878 and Rubin LJ. Dysfunctional voltage-gated K+ channels in pulmonary artery smooth muscle 879 cells of patients with primary pulmonary hypertension. Circulation 98: 1400-1406, 1998. 880 76. Zhou G, Chen T, and Raj JU. MicroRNAs in pulmonary arterial hypertension. Am J 881 Respir Cell Mol Biol 52: 139-151, 2015. 882 77. Zhu S, White RE, and Barman SA. Role of phosphodiesterases in modulation of BKCa 883 channels in hypertensive pulmonary arterial smooth muscle. Ther Adv Respir Dis 2: 119-127, 884 2008.
885 886
I 37
887 Figure Legends
888 Figure 1. Upregulated miRNAs correlate with reduced KV currents in PASMC from
889 patients with IPAH. A: Representative records (a) showing whole-cell KV currents elicited by
890 depolarization from a holding potential of -70 mV to a series of test potentials ranging from -80
891 to + 80 mV (in 20-mV increments) in PASMC isolated from normal subjects (Nor) and IPAH
892 patients (IPAH). Summarized data (mean±SE) showing the averaged current amplitude at + 80
893 mV in Nor and IPAH PASMC (b). The the current density-voltage (I-V) relationship curves (c)
894 of whole-cell KV currents measured from normal (n=25 cells from 4-5 different cell lines) and
895 IPAH (n=25 cells from 4-5 different cell lines) PASMC. I-V curves of normal and IPAH
896 PASMC are significantly different (P<0.01). B: A heatmap showing miRNAs that are
897 upregulated (red) and downregulated (blue) in normal (n=2 different cell lines) and IPAH (n=2
898 different cell lines) PASMC. Six miRNAs (with greater than 2-fold upregulation) highlighted in
899 red were further investigated by using real-time RT-PCR analysis. C: Real-time RT-PCR
900 analysis of miR-29b, miR-138 and miR-222 expression (normalized to U6) in PASMC from
901 normal subjects (Nor, n=6 different cell lines) and IPAH patients (IPAH, n=6 different cell
902 lines). The expression of miR-15a, miR-29a and miR-let-7e in normal and IPAH PASMC is not
903 significantly different (data not shown). Data are expressed as median (solid line)/mean (dashed
904 line) ± CI or mean±SE from 3-5 independent experiments. **P<0.01, ***P<0.001 vs. Nor.
905 Statistical analysis was performed using unpaired Student’s t-test.
906
907 Figure 2. Downregulation of selective K+ channels in PASMC isolated from patients with
908 IPAH. A: Real-time RT-PCR analysis of KCNA1, KCNA2, KCNA5, KCNMB1 (normalized to
909 GAPDH) in PASMC isolated from normal subjects (Nor, n=6 different cell lines) and IPAH
I 38
910 patients (IPAH, n=6 different cell lines). *P<0.05, ***P<0.001 vs. Nor. B: Representative
911 Western blot images showing the protein expression level of KCNA1, KCNA2 and KCNA5, β-
912 actin (a) as well as KCNMB1 and β-actin (b) in normal and IPAH PASMC. C: Summarized data
913 showing protein level of KCNA1, KCNA2, KCNA5, KCNMB1 (normalized to β-actin) in
914 normal subjects (Nor, n=6 different cell lines) and IPAH patients (IPAH, n=6 different cell
915 lines). *P<0.05, **P<0.01 vs. Nor. D: Representative Western blot images (a) showing the
916 protein expression level of KCNA2, KCNA5, KCNMB1, and β-actin and summarized data (b) in
917 pulmonary arterial endothelial cells (PAEC) isolated from normal subjects (Nor, n=4 different
918 cell lines) and IPAH patients (IPAH, n=4 different cell lines). *P<0.05 vs. Nor. E: Real-time RT-
919 PCR analysis of miR-29b, miR-138 and miR-222 expression (normalized to U6) in PAEC from
920 normal subjects (Nor, n=4 different cell lines) and IPAH patients (IPAH, n=4 different cell
921 lines). Data are expressed as median/mean±CI from 3-5 independent experiments. **P<0.01,
922 ***P<0.001 vs. Nor. Statistical analysis was performed using unpaired Student’s t-test.
923
924 Figure 3. miR-29b, miR-138 and miR-222 reduce KV currents and downregulate KCNA5
925 expression in normal human PASMC. A: Real-time RT-PCR analysis of miR-29b, miR-138
926 and miR-222 expression (normalized to U6) in non-transfected PASMC (mock) and PASMC
927 transfected with AllStars Control siRNA (NC mimic), miR-29b, miR-138, or miR-222 mimic
928 (n=3 different cell lines). Data are expressed as mean±SE from 3-4 independent experiments.
### 929 **P<0.01, ***P<0.001 vs. Mock; P<0.001 vs NC mimic. B: Representative whole-cell KV
930 currents (a) elicited by depolarizing the cells from a holding potential of -70 mV to a series of
931 test potentials ranging from -80 to + 80 mV (in 20-mV increments) and summarized current-
932 voltage (IV) relationship curves (b) in normal human PASMC transfected with NC, miR-29b,
I 39
933 miR-138, or miR-222 mimic. Summarized data showing that the current density of K+ currents
934 induced by the test potentials of +40 mV to + 80 mV in PASMC transfected with miR-29b, miR-
935 138 or miR-222 mimic (n=25 cells from 4-5 different cell lines) is significantly different from
936 the NC mimic group (P<0.001). C: Real-time RT-PCR analysis (mean±SE) of KCNA2 and
937 KCNA5 (normalized to GAPDH) in normal PASMC transfected with NC, miR-29b, miR-138, or
938 miR-222 mimic (n=5 different cell lines). **P<0.01, ***P<0.001 vs. NC mimic. D:
939 Representative Western blot images (panel a) and summarized data (b) showing the protein
940 expression level of KCNA2, KCNA5, and β-actin in normal PASMC transfected with NC, miR-
941 29b, miR-138, or miR-222 mimic (n=5 different cell lines). Data are expressed as mean±SE or
942 mean/median±CI in panel b from at least 3 independent experiments. *P<0.05, **P<0.01 vs. NC
943 mimic. Statistical analysis was performed using one-way ANOVA and post hoc test (Student-
944 Newman-Keuls).
945
946 Figure 4. Inhibition of miR-29b restores KV channel activity and KCNA5 expression in
947 IPAH-PASMC. A: Real-time RT-PCR analysis (means±SE) of miR-29b, miR-138 and miR-222
948 expression levels (normalized to U6) in non-transfected IPAH-PASMC (mock) and IPAH-
949 PASMC transfected with miScript Inhibitor Negative Control (NC inhibitor), antagomiR-29b,
950 antagomiR-138, or antagomiR-222 (n=3 different cell lines). Data are expressed as mean±SE
951 from 3-4 independent experiments. *P<0.05, **P<0.01 vs. Mock; #P<0.05, ##P<0.01 vs NC
952 inhibitor. B: Representative whole-cell KV currents (a), elicited by depolarizing the cells from a
953 holding potential of -70 mV to a series of test potentials ranging from -60 mV to + 80 mV (in 20-
954 mV increments), and summarized data (means±SE) showing current-voltage (IV) relationship
955 curves (b) of the KV currents in IPAH-PASMC transfected with NC inhibitor, antagomiR-29b,
I 40
956 antagomiR-138, or antagomiR-222. Summarized data (b) showing that the current density of K+
957 currents induced by the test potentials of +40 mV to + 80 mV in IPAH-PASMC transfected with
958 antagomiR-29b and antagomiR-138 (n=25 cells from 4-5 different cell lines) is significantly
959 different from the NC inhibitor group (P<0.01). C: Real-time RT-PCR analysis of KCNA5
960 (normalized to GAPDH) in IPAH-PASMC transfected with NC inhibitor, antagomiR-29b,
961 antagomiR-138, or antagomiR-222 (n=5 different cell lines). D: Representative Western blot
962 images (a) and summarized data (b) showing the protein expression level of KCNA5 and β-actin
963 in IPAH-PASMC transfected with NC inhibitor, antagomiR-29b, antagomiR-138, or antagomiR-
964 222 (n=5 different cell lines). Data are expressed as mean±SE or mean/median±CI in panel b
965 from at least 3 independent experiments. ***P<0.001 vs. NC inhibitor. Statistical analysis was
966 performed using one-way ANOVA and post hoc test (Student-Newman-Keuls).
967
968 Figure 5. Whole-cell K+ currents in IPAH-PASMC transfected with miR-29b inhibitor are
969 sensitive to the specific Kv1.5 channel blocker, DPO-1. A: Western blot analysis of KCNA5
970 and β-actin in control HEK cells (Control) and cells transfected with empty vector (Vector) or
971 KCNA5. B: Representative whole-cell K+ currents (a), elicited by depolarization from a holding
972 potential of -70 mV to a series of test potentials ranging from -80 mV to +80 mV (in 20-mV
973 increments) in a KCNA5-transfected HEK cell before (Control), during (DPO-1) and after
974 (Washout) extracellular application of 0.3 µM DPO-1. Summarized data (means±SE) showing
975 the amplitude of the KCNA5 currents at +80 mV (b, n=10-15 cells from 3 different cell lines)
976 and the current-voltage (I-V) curves (c, n=10-15 cells from 3 different cell lines) in KCNA5-
977 transfected HEK cells before (Control), during (DPO-1) and after (Washout) extracellular
978 application of DPO-1. ***P<0.001 vs. Control and Washout. The I-V curve of the KCNA5
I 41
979 currents in KCNA5-transfected cells superfused with DPO-1 is significantly different (P<0.001)
980 from the curves in the cells before (Control) and after (Washout) DPO-1 application. C: Western
981 blot analysis of KCNA5 and β-actin in non-transfected control IPAH-PASMC (Mock) and
982 IPAH-PASMC transfected with NC inhibitor or antagomiR-29b. D: Representative currents (a),
983 elicited by depolarization from a holding potential of -70 mV to a series of test potentials ranging
984 from -80 mV to +80 mV (in 20-mV increments) in an antagomir-29b-transfected IPAH-PASMC
985 before (Control), during (DPO-1) and after (Washout) extracellular application of 0.3 µM DPO-
986 1. Summarized data (means±SE) showing the amplitude of the outward K+ currents at +80 mV
987 (b, n=10-15 cells from 3 different cell lines) and the current-voltage (I-V) curves (c, n=10-15
988 cells from 3 different cell lines) in antagomir-29b-transfected IPAH-PASMC before (Control),
989 during (DPO-1) and after (Washout) extracellular application of DPO-1. Data are expressed as
990 mean±SE from at least 3 independent experiments. ***P<0.001 vs. Control and Washout. The I-
991 V curve of the outward K+ currents in antagomir-29b-transfected IPAH-PASMC superfused with
992 DPO-1 is significantly different (P<0.001) from the curves in the cells before (Control) and after
993 (Washout) DPO-1 application. Statistical analysis was performed using one-way ANOVA and
994 post hoc test (Student-Newman-Keuls).
995
996 Figure 6. miR-29b directly binds to the 3’-untranslated region (UTR) of KCNA5. A: The
997 potential binding site of miR-29b on the 3’-UTR of human KCNA5. B: The sequences mutated
998 in miR-29b binding site within the 3’-UTR of KCNA5. C: The summarized data showing
999 luciferase activity in HEK293 cells co-transfected with NC or miR-29b mimic and pRL-TK
1000 vector containing the 3’-UTR region of KCNA5 (wildtype or mutant) and the luciferase gene
I 42
1001 (n=4). Data are expressed as mean±SE from at least 3 independent experiments*P<0.05 vs. NC
1002 mimic. Statistical analysis was performed using unpaired Student’s t-test.
1003
2+ + 1004 Figure 7. Large-conductance Ca -activated K (BKCa) channel currents are decreased in
1005 PASMC from patients with IPAH. A: Representative whole-cell K+ currents (a), elicited by
1006 depolarizing cells from a holding potential of -70 mV to a series of test potentials ranging from -
1007 100 mV to + 100 mV (in 20-mV increments, for 500 ms every 15 s), in PASMC from normal
1008 subjects (Nor) and PASMC from IPAH patients (IPAH) before (Control) and during (IbTX)
1009 extracellular application of 100 nM iberotoxin (IbTX). IbTx-sensitive component of the currents
1010 (b) were obtained by subtracting the currents recorded during application of IbTX from the
1011 currents recorded under control condition. B: Bar graphs summarizing the capacitance of
1012 PASMC isolated from normal subjects and IPAH patients (means±SE, n=6 cells, NS). C:
1013 Summarized data (means±SE) showing the current-voltage (I-V) relationship curves of the
1014 IbTX-sensitive K+ currents in normal PASMC and IPAH PASMC (n=25 cells from 4-5 different
1015 cell lines, P<0.05 vs Normal). Data are expressed as mean±SE from at least 3 independent
1016 experiments. Statistical analysis was performed using unpaired Student’s t-test.
1017
1018 Figure 8. miR-29b, miR-138 and miR-222 downregulate KCNMB1 and reduce BKCa
1019 currents in normal PASMC. A: Representative Western blot images (a) and summarized data
1020 (b, means±SE) showing the protein expression level of the BKCa channel β1-subunit (KCNMB1)
1021 and β-actin in normal PASMC transfected with AllStars Control siRNA (NC mimic), miR-29b,
1022 miR-138, or miR-222 mimic (n=5 different cell lines). Data are expressed as mean/median±CI
1023 from at least 3 independent experiments. *P<0.05 vs. NC. B: Representative large-conductance
I 43
1024 single-channel K+ currents in cell-attached membrane patches held at +40 mV (a) in normal
1025 PASMC transfected with NC mimic or miR-29b. C and horizontal broken lines denote the
1026 current level when the channel is closed. Summarized data (b, means±SE) showing the steady-
1027 state open probability (Popen) of the currents recorded in normal PASMC transfected with NC or
1028 miR-29b mimic. C: Representative single-channel BKCa current recordings in cell-attached
1029 membrane patches held at + 40 mV (a) in normal PASMC transfected with NC and miR138
1030 mimic. C and horizontal broken lines denote the current level when the channel is closed. Bar
1031 graph (b) summarizing the steady-state Popen of the single-channel currents in normal PASMC
1032 transfected with NC or miR-138 mimic. Statistical analysis was performed using one-way
1033 ANOVA and post hoc test (Student-Newman-Keuls) or unpaired Student’s t-test.
1034
1035 Figure 9. Inhibition of miR-29b restores KCNMB1 expression level and whole-cell BKCa
1036 currents in PASMC from IPAH patients. A: Representative Western blot images (a) and
1037 summarized data (b, mean±SE or mean/median±CI) showing the protein expression level of
1038 KCNMB1 and β-actin in IPAH-PASMC transfected with miScript Inhibitor Negative Control
1039 (NC inhibitor), antagomiR-29b, antagomiR-138, or antagomiR-222 (n=5 different cell lines).
1040 *P<0.05 vs. NC inhibitor. B: Representative whole-cell K+ currents, elicited by depolarization
1041 from a holding potential of -70 mV to a series of test potentials ranging from -80 mV to + 80 mV
1042 (in 20-mV increments), in normal PASMC transfected with AllStars Control siRNA (NC mimic)
1043 or miR-29b mimic before (Control) and during extracellular application of 100 nM penitrem A
1044 (Penitrem A). Penitrem A-sensitive component of the currents (b) was obtained by subtracting
1045 the currents recorded during application of Penitrem A from the currents recorded under control
1046 condition. Summarized data (c, means±SE) showing the I-V curves of the Penitrem A-sensitive
I 44
1047 K+ currents in NC mimic- and miR-29b-transfected PASMC (n=25 cells from 4-5 different cell
1048 lines, P<0.05 vs NC mimic). C: Representative whole-cell K+ currents, elicited by depolarizing
1049 an antagomir-29b-transfected IPAH PASMC from a holding potential of -70 mV to a series of
1050 test potentials ranging from -80 mV to + 80 mV (in 20-mV increments) before (Control), during
1051 (Penitrem A) and after (Washout) extracellular application of 100 nM penitrem A. Summarized
1052 data (b, means±SE) showing the amplitude of K+ currents at +80 mV and the I-V curves of the
1053 currents (c) in IPAH-PASMC transfected with antagomiR-29b before (Control), during
1054 (Penitrem A) and after (Washout) extracellular application of Penitrem A (n=10-15 cells from 3
1055 different cell lines, ***P<0.001 vs. Control). D: Representative single-channel current recorded
1056 in cell-attached membrane patches held at +40 mV (a) in IPAH-PASMC transfected with NC
1057 inhibitor (upper panel, in red) and antagomir-29b (lower panel in blue). Panel b shows the
1058 steady-state Popen in IPAH-PASMC transfected with NC inhibitor or antagomiR-29b. C and
1059 horizontal broken lines denote the current level when the channel is closed. Statistical analysis
1060 was performed using one-way ANOVA and post hoc test (Student-Newman-Keuls) or unpaired
1061 Student’s t-test.
1062
1063 Supplemental Material DOI: https://doi.org/10.6084/m9.figshare.9636893
1064
I A Human PASMC a Nor IPAH b c 500 120 Nor
375 80
250 * (pA/pF) I 40 IPAH 125 at +80 mV (pA) +80 at
Amplitude of Current 0
100 pA 100 0 100 ms Nor IPAH -80 -40 0 40 80 V (mV) BC miR-18a Nor IPAH miR-183 7 7 7 miR181b ** 6 *** 6 *** 6 miR-378 miR-126 5 5 5 miR-138 4 4 4 miR-29b 3 3 3 miR-15a 2 2 2 miR-222 (Normalized to Nor) to (Normalized 1 1 1 miR-29a miRNA Level Relative 0 0 0 miR-let-7e miR-29b miR-138 miR-222 Nor Nor IPAH IPAH
Figure 1 A Human PASMC 2.0 2.0 2.0 2.0 Nor IPAH 1.5 1.5 1.5 1.5
1.0 1.0 1.0 1.0
0.5 0.5 0.5 0.5 mRNA Level mRNA Level *** mRNA Level *** * (Normalized to Nor) (Normalized to Nor) Nor) to (Normalized (Normalized to Nor)
0.0 0.0 0.0 miRNA Level Relative 0.0 KCNA1 KCNA2KCNA5 KCNMB1 B abNor IPAH Nor IPAH 12341234 123 123 kDa 20 KCNA1 KCNMB1 50 kDa 75 KCNA2 β-actin 37
50 KCNA5
37 β-actin
C 2.0 2.0 2.0 2.0 Nor IPAH 1.5 1.5 1.5 1.5
1.0 1.0 1.0 1.0 * * 0.5 0.5 0.5 0.5 Protein Level Protein Level Protein Level ** Protein Level (Normalized to Normal) to (Normalized 0.0 0.0 Normal) to (Normalized 0.0 0.0 (Normalized to Normal) to (Normalized (Normalized to Normal) KCNA1 KCNA2 KCNA5 KCNMB1 D Human PAEC abNor IPAH Nor IPAH 3 3 3 kDa 12 341234 75 KCNA2 2 2 2 * KCNA5 50 20 KCNMB1 1 1 1 Protein Level
β-actin Nor) to (Normalized 37 0 0 0 KCNA2 KCNA5 KCNMB1 E 3 Nor 2.0 Nor 4 ** Nor IPAH IPAH IPAH 1.5 3 2 1.0 *** 2 1 0.5 1 (Normalized to Nor) to (Normalized Nor) to (Normalized Nor) to (Normalized Relative miRNA Level Relative 0 miRNA Level Relative 0.0 miRNA Level Relative 0 miR-29b miR-138 miR-222
Figure 2 mRNA Level C B miRNA-29b Level A
(Normalized to NC Mimic) a (Normalized to Mock) 0.0 0.5 1.0 1.5 2.0 Normal PASMC Normal 10 20 30 40 50 0
100 ms 200 pA NC Mimic KCNA2 ### ** 0.0 0.5 1.0 1.5 2.0 NC Mimic Mock miR-29b KCNA5 miR-29b *** miR-222 miR-138 miR-29b NC Mimic *** ** miRNA-138 Level (Normalized to Mock) 200 400 600 800 0 D kDa 37 50 37 75 a miR-138 Figure Figure 3 Normal PASMC Normal *** ### NC Mimic Mock miR-138 miR-222 β KCNA5 β KCNA2 -actin -actin miRNA-222 Level (Normalized to Mock) 100 150 200 250 300 50 8 4 080 40 0 -40 -80 b b Protein Level 0 (Normalized to NC Mimic) I (pA/pF) 100 120 0.0 0.3 0.6 0.9 1.2 20 40 60 80 V (mV) 0 KCNA5 *** ### ** * miR-138 NC Mimic miR-29b miR-222 miR-138 NC Mimic miR-222 NC Mimic Mock miR-222 ** miR-29b C B A
mRNA Level 100 ms 200 pA a miRNA-29b Level (Normalized to NC Inhibitor) PASMC IPAH NC Inhibitor NC 0 1 2 3 4 (Normalized to Mock) 0.0 0.2 0.4 0.6 0.8 1.0 1.2 KCNA5 *** ** # AntagomiR-29b NC Inhibitor NC Mock AntagomiR-222 AntagomiR-138 AntagomiR-29b AntagomiR-29b NC Inhibitor AntagomiR-138 kDa D
37 50 miRNA-138 Level
ab (Normalized to Mock) 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Figure Figure 4 IPAH-PASMC AntagomiR-222 ** ## AntagomiR-138 NC Inhibitor Mock KCNA5 β -actin
Protein Level 80 40 0 -40 -80 b (Normalized to NC Inhibitor) miRNA-222 Level 0 1 2 3 4
I (pA/pF)100 120 140 (Normalized to Mock) 0.0 0.2 0.4 0.6 0.8 1.0 1.2 20 40 60 80 V (mV) 0 KCNA5 *** * # AntagomiR-138 AntagomiR-29b NC Inhibitor AntagomiR-222 AntagomiR-138 AntagomiR-29b AntagomiR-222 NC Inhibitor AntagomiR-222 NC Inhibitor Mock ABHEK293 Cells Transfected with KCNA5 at +80 mV ab4000 c Control DPO-1 Washout 300 Control
(pA) 3000 K I Vector Control kDa KCNA5 200 Washout KCNA5 2000 50 (pA/pF) I 100 β-actin 1000 37 *** DPO-1
HEK293 cells of Amplitude 0 0 1000 pA 1000 50 ms +80 mV -80 -40 0 40 80 -70 mV ControlDPO-1 V (mV) -80 mV Washout CDIPAH-PASMC Transfected with AntagomiR-29b abat +80 mV c Control DPO-1 Washout 400 30
300 Control (pA) K I 20 Washout
kDa Mock NC inhibitor AntagomiR-29b 200 (pA/pF) 50 KCNA5 I *** 10 β-actin 100 37 DPO-1
IPAH PASMC Amplitude of 0 0 100 pA 100 50 ms +80 mV -80 -40 0 40 80 -70 mV ControlDPO-1 -80 mV Washout
Figure 5 C B A hsa- hsa- Mutant-1 Mutant-2 HEK293 cells HEK293 KCNA5 Relative Luciferase Units miR-29b miR-29b (Normalized to NC Mimic) 0.0 0.2 0.4 0.6 0.8 1.0 5’-…UCUGGGAUGUGGUAUUGGUGCUU…-3’ 5’-…UCUGGGAUGUGGUAUU 5’-…UCUGGGAUGUGGUAUU Wildtype 3’-UUGUGACUAAAGUUUACCACGAU-5’ 3’-UUGUGACUAAAGUUUACCACGAU-5’ * NC Mimic 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Figure Figure 6 Mutant-1 miR-29b 0.0 0.2 0.4 0.6 0.8 1.0 1.2 AGAGUA UUUACA Mutant-2 U…-3’ U…-3’ Human PASMC IbTX-sensitive I A abControl IbTX K Nor Subtraction 200 pA 200 200 ms IPAH 200 pA 200 200 ms +100 mV -80 mV
IbTX-sensitive Currents BC18 NS 200 15 Nor 12 150
9 100 (pA/pF) 6 I 50
Capacitance (pF) 3 IPAH 0 0 Nor IPAH -80 -40 0 40 80 V (mV)
Figure 7 kDa C B A 37 20 b a b a ab c c c c c Popen c c c c c Popen 0.0 0.1 0.2 0.3 0.4 0.0 0.1 0.2 0.3 0.4 Normal PASMC Normal 012345678 012345678 NC Mimic Time (s) NC Mimic Time (s) β KCNMB1 -actin Figure Figure 8 012345678 012345678 KCNMB1 Protein Level (Normalized to NC Mimic) 0.0 0.5 1.0 1.5 miR-29b miR138 Time (s) Time (s) * * miR-222 miR-138 miR-29b NC Mimic * 100 ms 100 ms 5 pA 5 pA A ab IPAH PASMC 3.0 NC inhibitor * AntagomiR-29b 2.5 AntagomiR-138 2.0 AntagomiR-222 kDa 1.5 20 KCNMB1 1.0 0.5 β-actin 37 Level Protein KCNMB1 0.0 (Normalized to NC inhibitor)(Normalized to
B abcNormal PASMC Control Penitrem A Penitrem A-sensitive IK Penitrem A-sensitive Currents 120
500 pA 500 100 NC Mimic 50 ms NC Mimic 80 +80 mV 60 -70 mV Subtraction 40 I (pA/pF)
-80 mV pA 200 50 ms 20 miR-29b miR-29b 0 -80 -40 0 40 80 V (mV) C IPAH PASMC Transfected with AntagomiR-29b a Control Penitrem A Washout b 400 c 20 300 Control 15 200 Washout *** 10 (pA/pF) Penitrem A I 100
at +80 mV (pA) +80 at 5 K I 0 100 pA 100 +80 mV 0 100 ms -80 -40 0 40 80 -70 mV V (mV) -80 mV Control Washout Penitrem A D a b 1.0 NC Inhibitor NC Inhibitor 5 pA
open 0.5 100 ms P C 0.0 AntagomiR-29b 1.0 AntagomiR-29b
open 0.5 P
C 0.0 0 5 10 15 20 Time (s)
Figure 9 Table 1. Demographic information of human subjects from whom PASMC and PAEC were isolated for molecular biological and electrophysiological experiments Subjects Gender Age Race Type of cells Healthy Subject-1 Female 36 White PASMC Healthy Subject -2 Female 33 White PASMC Healthy Subject -3 Male 34 White PASMC Healthy Subject -4 Female 34 Asian PASMC Healthy Subject -5 Male 46 Asian PASMC Healthy Subject -6 Female 56 White PASMC IPAH patient-1 Female 56 White PASMC IPAH patient-2 Female 41 White PASMC IPAH patient-3 Male 27 White PASMC IPAH patient-4 Male 56 White PASMC IPAH patient-5 Female 33 White PASMC IPAH patient-6 Male 51 White PASMC
Healthy Subject-1 Female 49 White PAEC Healthy Subject -2 Male 51 White PAEC Healthy Subject -3 Female 55 White PAEC Healthy Subject -4 Male 49 White PAEC IPAH patient-1 Male 51 White PAEC IPAH patient-2 Male 16 White PAEC IPAH patient-3 Female 16 White PAEC IPAH patient-4 Female 22 White PAEC