AmericanMineralogist, Volume 83,pages 1510-1515,1998

Primary structure of a solublematrix protein of scallop shell: Implications for calcium carbonatebiomineralization

I. SlnasurNA ANDK. ENoox

GeologicalInstitute, University of Tokyo, Tokyo I l3-0033, Japan

Ansrnacr Soluble proteins in the scallop (Patinopectenyessoensis) foliated calcite shell layer were characterizedusing biochemical and molecular biological techniques.SDS PAGE of these molecules revealed three major protein bands, 97 kD, 12 kD, and 49 kD in molecular weight, when stained with Coomassie Brilliant Blue. Periodic Acid Schiff staining and Stains-All staining indicated that these proteins are slightly glycosylated and may have cation-binding potential. N-terminal sequencingof the three proteins revealedthat all three sharethe same amino acid sequenceat least for the first 20 residues.A partial amino acid sequenceof 436 amino acids of one of these proteins (MSP-l) was deduced by charac- terization of the complementary DNA encoding the protein. The deduced sequenceis composed of a high proporton of Ser (3l%o), Gly (25Vo),and Asp (20Vo),typifying an acidic glycoprotein of mineralized tissues. The protein has a basic domain near the N- terminus and two highly conserved Asp-rich domains interspersedin three Ser and Gly- rich regions. In contrast with prevalent expectations,(Asp-Gly)n-, (Asp-Ser)n-, and (Asp- Gly-X-Gly-X-Gly)ntype sequencemotifs do not exist in the Asp-rich domains,demanding revision of previous theories of protein-mineral interactions.

INrnooucrroN (l) induction of oriented nucleation (Weiner 1975;Weiner Minerals produced by organisms often have crystal and Addadi l99l); (2) inhibition of crystal growth shapesclearly different from those formed inorganically. (Wheeler et al. 1981; Wheeler 1992); (3) control of ara- Most such biominerals are a compositeof inorganic crys- gonite-calcite polymorphism (Falini et al. 1996; Belcher tals and organic molecules such as lipids, polysaccha- et al. 1996); and (4) enhancementof mechanical prop- rides, and proteins, collectively known as the organic ma- erties of the crystals (Berman et al. 1988; Berman et al. trix. It is generally postulated that the elaborate 1990). Most of the evidence to support these hypotheses fabrication of biominerals arisesfrom specific molecular has been obtained through in vitro experiments. The interactions at inorganic-organic interfaces (Mann et al. weaknessof these studies is that unpurified proteins or 1993), and that the organic matrix representsmany of the protein fractions of dubious homogeneity have been ap- important molecules involved in the interactionscontrol- plied in the biochemical analysesand in the in vitro min- ling crystal growth (e.g., Watabeand Wilbur 1960; Low- eralization experiments, and that the stereochemicalre- enstam 1981; Weiner 1984; Lowenstam and Weiner lationships between the organic and inorganic phases 1989). have been presumed without precise information of the Calcium carbonate is one of the most common bio- fine structuresof the proteins. minerals, and its matrix molecules, especially of mollus- To understandthe underlying mechanismsof the pro- can shells, have been studied to a considerableextent to tein-mineral interactions,it seemsessential first of all to unveil their roles in the mineralizationprocesses. The ma- know the primary structure of the proteins involved. ffix molecules have been classif,ed conventionally into However, only a limited number of amino acid sequences two types based on their solubility in aqueoussolutions: have been determined so far for the calcium carbonate the insoluble matrix is thought to be largely intercrystal- matrix proteins. The available sequencescomprise those line (Krampitz 1982) and provides a framework where from spicules of sea urchin emryo (Sucov et al. 1987; mineralization is to occur, whereas the soluble matrix is Katoh-Fukui etal. l99l; Katoh-Fukui etal.1992; Benson known as intracrystalline or located on the intercrystal- and Wilt 1992), from pearl oyster shell layers (Miyamoto line matrix surfaces,but its functions are still poorly un- et al. 1996; Sudo et al. 1997\, and from the nacre of a derstood (Addadi and Weiner 1997). gastropod shell (Shen et al. 7997), in addition to partial Advocated functions of the mainly proteinaceous,sol- sequencesfrom brachiopod shells (Cusack et al. 1992), uble matrix of the molluscan shell in particular, include: an oyster shell (Wheeler 1992), and gastrolith of a cray- fish (Ishii et al. 1996, Ishii et al. 1998). Here we present * E-mail: endo @geol.s.u-tokyo.ac jp a partial amino acid sequenceof the molluscan shell pro- 0003-004x/98/1112-15 l0$05.00 1510 SARASHINA AND ENDO: MATRIX PROTEIN OF BIO-CALCITE l5l I tein MSP-I, a major soluble matrix protein of the scallop quired to design unique primers to facilitate subsequent foliated calcite shell layer, and discussits bearing on the amplification of the DNA sequenceencoding the entire functions of matrix proteins in calcium carbonate proteln. biomineralization. We extracted the total RNA from the mantle tissue of a single specimenof P. yessoensis,using ISOGEN (Nip- MlrBnrlr,s AND METHoDS pon Gene) and the single-stepmethod for RNA isolation Isolation of MSP-I (Chomzynski 1993). The RNA (5 pg) was applied as a Specimens of the commercial scallop Patinopecten template for reversetranscription to preparecomplemen- yessoensiswere purchasedlocally. A single shell valve tary DNA (cDNA) in a 20-p,L reaction, primed with a was thoroughly cleaned mechanically and incubated for "hybrid" primer, TCGAATTCGGATCC-GAGCTC(T ),,, 48 h at room temperaturein a l0 volVosolution of sodium using the SuperScriptpreamplification system(Life Tech- hypochlorite to desffoy surface contaminants.After thor- nologies). The target cDNA sequence,encoding the N- ough washing with ultrapure water, the marginal portion terminal sequenceof 20 amino acid residuesdetermined of the shell, consisting only of the outer shell layer of for the purified MSP-I, was amplified by a method foliated calcite, was crushedto fine fragments.The matrix known as reverseffanscription-polymerase chain reaction proteins were extractedby dissolution of the shell flakes (RT-PCR).The senseprimer and the antisenseprimer cor- (100 g) in 3 liters of 0.5 M EDTA (ethylenediaminete- responded to the sequence encoding LDTDKD and traacetate),pH 8. The extraction was performed at 4 'C NAAED (for one-letter abbrevation of amino acids, see with continuous stirring for 12 h. The preparation was the caption for Fig. 1), respectively, each being degen- then filtered through cheeseclothto remove viscous in- erate, containing oligonucleotides of all the possible se- soluble materials and desaltedby ultrafiltration using the quencesfor each amino acid sequence.The reaction mix- Minitan tangential flow system (Millipore). In this pro- ture (50 pL) contained2 pL cDNA, 2 p.M of eachprimer, cedure, the amount of EDTA was reduced to less than 1 x Taq DNA polymerasebuffer (Life Technologies),3 l0 6 mol, at which point the sample was concentratedto mM MgC,,,100 p,M dNTB and I unit of Taq DNA poly- about 50 mL, then lyophilized. merase(TOYOBO). A Cetus DNA Thermal Cycler (Per- kin Elmer) was employed with an initial step of 94 "C SDS PAGE analyses for 3 min, then 30 cycles at 94 "C for 30 s, 52 "C for 30 The extracted macromolecules (1 mg per each well) s,72'C for I min, followed by a final extensionstep of '72 were separatedby SDS PAGE (Laemmli 1970), using "C for 5 min. The resulting PCR products of 60 base slab gels (15 x 15 cm) of 2 mm thickness containing pairs (bp) in length (correspondingto 20 amino acids), l27o polyacrylamide. After elecffophoresis, gels were were sequenceddirectly by the chain termination method stained by Coomassie Brilliant Blue R or silver (Silver using the BigDye Terminator Cycle SequencingKit and Stain kit; Bio-Rad) to visualize proteins, by Stains-All to an automated DNA sequencer (Perkin-Elmer Applied visualize cation-binding proteins (Campbell et al. 1983), Biosystems). and by periodic acid and Schiff's reagentto visualize car- bohydrates(Holden et al. l97I). Amplffication and sequencingof cDNA 3'-end Threegene-specific sense primers,Pl,P2, and P3 (Fig. 1), designed based on the sequencedetermined by the N-terminal sequencedetermination above method, and the antisense"adaptor" primer (PA), Following separationby SDS PAGE, the proteins were TCGAATTCGGATCCGAGCTC, were synthesized for electroblotted onto polyvinylidene difluoride membrane the PCR amplification of the region between the point (ProBlott; ABI) in Caps buffer (10 mM, pH l l) contain- correspondingto the N-terminal end of the mature protein ing methanol (10 volTo solution), prior to staining with (MSP-l) and the 3'-end of the transcript(3' RACE: rapid Coomassie Brilliant Blue R. N-terminal amino acid se- amplification of cDNA ends protocol; Frohman 1990). quence analysis of the immobilized protein sampleswas The reactions using the primer pair of PI-PA were per- by Edman degradation using an automated protein se- formed first, under conditions similar to those described quencer (Perkin-Elmer Applied Biosystems). Sequences above,except that the reactionswere catalyzedby Ex Taq were determined at least twice for each protein band re- (TAKARA) in this case. A second and a third round of produced by different SDS PAGE gels. PCR reactions were performed with the P2-PA and P3- PA primer pairs, respectively,using the PCR products of RNA purification and RT-PCR the previous round of reactions as a template to verify A nucleotide sequencein mRNA (messengerribonu- specific amplification of the target cDNA fragment. PCR cleic acids) codes for the terminal amino acid sequence reactionswith only one primer (Pl,P2, P3, or PA) were found (as determined above) in P. yessoensisshell pro- included as negative controls. Unique PCR products were teins. The nucleotide sequenceis not uniquely determined digested with the restriction enzyme BamHI and sub- by the amino acid sequence,as up to six three-base cloned into the pUC 19 plasmid vector. The inserts en- groups (codons) may code for the same amino acid. The compassingthe first 765 bp segmentof the PCR products actual sequenceencoding the terminal amino acids is re- were sequencedfor both sffands using the Ml3 forward t512 SARASHINA AND ENDO: MATRIX PROTEIN OF BIO.CALCITE

D1 f, TTGATACTCATMCCMtr fACMTTTCATCTAGA]IqGEIIAEIASAIGgACC'CMCA I 6 O TaeLe 1. Amino acid compositionsof MSP-1 (partial LDTDKDLEFHLDSLLNAAED sequence),soluble matrix (bulk) of Patinopecten r20 GGGGDAAGAEEAAPAADLSG yessoensis(Kasai and Ohta 1981),and an hplc fraction of soluble matrix of the oyster Crassostrea GGTAGCMGGAGGMGCMGGMGTAGCACMGMGTAGTMGGGAGGTAGTMGGGA 180 GSKGGSKGSSTRSSKGGSKG virginica(Wheeler 1992) GGTAGTMGGGAGGCMTGGTGGTGGAGATGCTGATGATTCMGTAGCTCMGCGGTTCT 240 GSKGGNGGGDADDSSSSSGS Solublefraction MSP-1 GATTCGGGMGTTCTGGMGTGACGMGMTCAGATGATTCCAGCTCTAGTTCCAGTTCT 300 DSGSSGSDEESDDSSSSSSS Aminoacid Scallop Scallop Oyster

GGTTCTGGTTCCGGCTCTGGCTCAGGTTCTGGCTCCGGCTCMGCTCCAGCTCTGGCTCA 360 el F CSGSCSGSGSGSGSSSSSCS Asp 195 25.2 Thr 0.9 to 0.5 TCCAGCGATMATCTGATGA TGCTGAT 424 SSDGSDDGSDDGSDSGDDAD Ser 31.0 224 24.3 Glu 3.0 60 4.2 TCCGCTMTGCTGATGACCTTGATTCCMTGATTCCGATGATTCCGATMCTCCGGTTCC 480 SANADDLDSNDSDDSDNSGS Pro 14 2.4 0.9 250 zoJ 30.0 MTGGCGAGTCTGACTCTGA Glv NGESDSDNSSSDDGDGSDSG Ala 46 65 0.9 cys 0.0 14 ND TGACTCC 6OO 'I SDSGNDSOSDDASNNDSDDS Val .1 0.2 cATGAcrcGGATGATTcrrcrMrcArcrHrcurcu,@Nr eso Met 00 00 ND D D S D D S S N n r|=N S D E S G P lle 0.0 o7 0.1 120 Leu 18 1.6 0.1 GGYGGNGPAGNGGKGRKGGN Tyr 05 00 1.7 _-BaEEI GGAGGAGGCMTGMGGCMTGGAGGCMTGGAGGTGAIEGAISIAGTTCTAGTTCGAGC'7 80 Phe 02 0.6 01 GGGNEGNGGNGGDGSSSSSS Lys z.o 3.4 0.6 840 Arg 0.9 09 0.3 SGSGSGSGSGSGSSSGSGSG His 0.2 o7 ND CAGGTTCTGGGTCCGGCTCMGCTCTAGCTCTAGCTCATCCGGCGATGGATCTGATGAT9OO Trp 0.0 ND ND SGSGSGSSSSSSSSGDGSDD Asn 8.0 ND ND 950 Gln 0.5 ND ND GSDDGSDDGDDANSANADDL

GATTCCMTGATCCCGATGATTCCGATMCTCCGGTTCCMTGGCGAGTCTGACTCTGAT1020 Nofe-'ND : no data DSNDPDDSDNSGSNGESDSD

MCTCTTCCTCCGACGATGGCGATGGTTCCGATTCCGG?TCCGATTCCGGCAGAGATAGT1080 NSSSDDGDGSDSGSDSGRDS

CAGTCCGATGACGCTTCTMTMTGATTCTGATGACTCCGATGACTCTGATMTTCGTCT 1-1-40 OSDDASNNDSDDSDDSDNSS 97,72, and,49kDa in apparentmolecular weight, as well ACTGGTACTGGCGMTCCGATTCCGArcAGTCTGGGCCTGGAGGATATGGAGGCMTGGA12OO TGTGESDSDESGPGGYGGNG as three minor bands of smaller sizes, when stained with

CCAGCAGGCMTGGAGGTMGGGACGCMGGGAGGCMTGGAGGAGGCMTGGAGGCMT1260 CoomassieBrilliant Blue or silver. This pattern was rep- P AGNGGKGRKGGNGGGNGGN licated several times using different shell exffact prepa- GGC 1308 rations. PAS and Stains-All stainedeach protein band red ""*"*"'. compo- ;";"i;;:j;.: r *r' andthe de- and blue, respectively, indicating that all these nents are glycosylated and may have cation-binding po- duced amino acid sequence.Numbers on the right indicate po- sitions of the nucleotides in the MSP-I cDNA sequence.The tential. PAGE under non-denaturingconditions revealed residuesdetermined by Edman degradationare in bold. Sequenc- a similar gel pattern as in SDS PAGE, confirming that es that correspond to the oligonucleotide primers (P1, P2, P3, these proteins are highly acidic. and P4) are boxed. Cloning site is also boxed (BamHI). Potential N-terminal sequencingof the three major components N-glycosylation sites are underlined. One-letter abbreviation of revealed that all three share the same amino acid se- amino acid residues(threeJetter abbreviationin parenthesis):G quence at least for the first twenty residues (LDTDK : glycine (Gly); A : alanine (Ala); V : valine (Val); L = DLEFH LDSLL NAAED, in one-letter abbrevation of p : p : : leucine (Leu); phenylalanine(Phe); proline (Pro); S amino acids). These componentsmay have derived from (Ser); : (Thr); : : serine T threonine N asparagine(Asn); Q the same transcript, but were subjected to different de- glutamine (Gln); Y : tyrosine (Tyr); D : aspartate(Asp); E : grees of post-transcriptional processing or post-transla- glutamate(Glu); H : histidine (His); K : lysine (Lys); R = arginine (Arg). tional processing(such as glycosylation,phosphorylation, and C-terminal cleavage), or they may be encoded by different genes. At the moment, evidence is lacking to and reverse primers. PCR products were also sequenced support any of these possibilities, and MSP-I cannot be directly using an internal primer (P4: Fig. 1). Resulting specified to a particular band in the SDS PAGE gel. sequence data were analyzed with the software GENE- TYX-MAC ver. 9 (Software Development). The DDBJ Amino acid sequenceof MSP-1 data bank (National Institute of Genetics, Mishima, Ja- Figure I shows the nucleotide sequencefor the part of pan) was searched to find similar sequences. the cDNA encoding the first 436 amino acid sequenceof Rnsurrs MSP-I. The deducedsequence contains a high proportion of serine, glycine, and aspartateresidues (Table 1), in Biochemicalcharacterization of MSP-I agreementwith the bulk composition of the soluble ma- The exffaction procedureyielded about I mg of soluble trix of the same species(Kasai and Ohta l98l), support- total organic moleculesper 3 g of shell flakes. SDS PAGE ing the fact that MSP-I representsthe major component of these molecules revealed three major protein bands of of the soluble matrix. The amino acid composition is also SARASHINA AND ENDO: MATRIX PROTEIN OF BIO-CALCITE t5l3

N-teminua D-1 DGSDDGSDDGSDSGDDADSANADDLDSNDSDD ]-54

Basic KGGSKGSSTRSSKGGSKGGSKGGN 66 D-2 321 SGD GGGDADDSSSSSCSDSGSSGSDEESDD 93

sG-1 722 D-1 SDNSGSNGESDSDNSSSDDGDGSDSGSDSGND 186

D-1 DGSDDGSDESDSGDDADSANADDLDSNDSDDSDNSGSNGESDSDNSS D-2 SDNSGSNGESDSDNSSSDDGDGSDSGSDSGRD 359

254 D-L SQSDDASNNDSDDSDDSDDS SNDIVNESNSDE 2L7 295 ******************** ** ***

DGSDDGSDIESDDGDDANSANADDLDSMPDDS D-2 SQSDDASNNDSDDSDDSDNS STGTGE SDSDE 390 SDDGDGSDSGSDSGRDSQSDmS 389 Frcunn3. Sequencealignment of aspartate-richdomains (D- 429 I andD-2) of MSP-I. Identicalamino acids are indicated by as- sG-3 sssssss 436 terisks.Numbers on theright indicatepositions of theamino acid residuesin theMSP-1 sequence Acidic residues are in bold.For FIcunn 2. Modularstructure of MSP-I. The aspartate-rich one-letterabbreviation of arninoacids. see caDtion of Fisure1. domainsare boxed.Acidic residuesare in bold. PotentialN- glycosylationsites are underlined. For one-letterabbreviation of aminoacids, see caption ofFigure 1. mains of MSP-I. The two D domains comprise 95 amino acids, containing 33-35 aspartateresidues, and share a comparablewith that of a purified soluble fraction of oys- high degree of sequencesimilarity with each other (Fig. ter shell (Wheeler 1992; Table l), and is in fact typical 3). This sequence conservation suggests its functional for a mollusc soluble matrix fraction (Lowenstam and significance, which is most naturally thought to be that Weiner 1989). of calcium binding, with the calcium either in the solution The predicted sequencerevealed a modular structure or in the crystal, or both. A glycine-rich domain ("G" with a basic domain near the N-terminus and two aspar- domain) follows the D domain. As the two G domains tate-rich domains ("D" domains) interspersed among also exhibit a high degree of sequencesimilarity, they three serine- and glycine-rich regions (Fig. 2), and eight also may be important functionally. possible N-glycosylation sites localized in the aspartate- Soluble proteins in foliated calcite of mollusc shells are rich domains (Figs. I and 2). Preliminary results indicare phosphorylated(Borbas et al. 1991). Thus it is likely that that the rest of the amplified cDNA coding region codes MSP-I is also phosphorylated becauseit has been ex- for repetition of similar sequencemotifs. ffacted from the foliate calcite layer of P. yessoensis.The The N-terminal domain of MSP-I is 42 residueslong, deduced partial sequenceof MSP-I contains a total of and an a-helix was predicted for this domain by the anal- 137 serine,four threonine,and two tyrosine residues(Fig. yses of secondary sffucture using the method of Chou 1), and any of thesecan be consideredas a putative phos- and Fasman (1978). The N-terminal domain is followed phorylation site. : by a basic domain, containing f,ve Lys-Gly-X-Y (X DrscussroN Gly or Ser, y : Ser or Asn) segmentsin tandem, inter- calatedby a Thr-Arg-Ser-Sersegment in the middle. Fol- Aspartate-rich domain and mineral-protein interactions lowing the basic domain is a 27 residue serine and gly- How do organismsproduce delicately textured and yet cine-richregion ("SGD" domain),which is acidic due to rock-solid biominerals under physiological conditions?A the presence of seven aspartate and two glutamate key may be biopolymers, especiallyproteins, that interact residues. with the ions in the media and the growing crystals. A The SG domains are solely composed of serine and considerablenumber of in vitro studieshave demonstrat- glycine, dominated by (Ser-Gly), and (Ser)" repeats. ed that such interactions between calcium carbonateand Among the sequencesin the DDBJ data bank, this do- soluble matrix proteins are indeed possible. main showed the highest sequencesimilarity with the Examples of such observations include inhibition of "GS" domain of Lustrin A, a matrix protein of gastropod crystal growth by proteins (Wheeler et al. 1981), adsorp- nacre (Shen et al. 1997), suggestingthat they are evolu- tion of proteins to specific crystal faces (Addadi and Wei- tionarily and/or functionally related. The "GS" domain ner 1985;Berman et al. 1988;Berman et al. 1990;Albeck of Lustrin A is suggestedto have an elastic property mak- et al. 1993;Wierzbicki et al. 1994; Aizenberg et al. 1994; ing the protein an extensor molecule (Shen et al. 1997). Aizenberg et al. 1995), and control of aragonite-calcite It seemspossible that the SG domains of MSP-I have a polymorphism by proteins (Belcher et al. 1996; Falini et similar function. However, becausethe SG domains of al. 1996). But how do these proteins interact with the MSP-I lack the aromatic residues of tryptophan and calcium carbonateto control crystal growth? phenylalanine,which are consideredimportant in Lustrin It is reasonableto assumethat the negatively charged A, their functions could well be different. acidic amino acid residuesand the positively chargedba- Each SG domain is followed by the D domain, the sic residues in the matrix proteins interact with the cal- largest and seemingly most important of the revealeddo- cium ions and carbonateions, respectively,somehow pro- t5l4 SARASHINA AND ENDO: MATRIX PROTEIN OF BIO.CALCITE viding specific templatesfor the nucleation of biominerals ner 1989). Suggestedexplanations include: (1) presence (Hare 1963), although no evidencehas been reported for of foreign ions, especially Mg'* (Simkiss et al 1982); (2) involvement of positively charged amino acids in these structure of organic maffix; (3) influence of carbonic an- processes.In addition, the charged amino acids in these hydrase; and (4) temperature(Wilbur 1960). proteins can also interact with crystal planes and thus Watabe and Wilbur (1960) repoted that insoluble or- conffol growth. ganic maffix extracted from mollusc shells can control Using the amino acid composition data on maffix pro- calcite-aragonitepolymorphism both in vitro and in vivo, teins hydrolyzed partially or completely, Weiner and co- but the evidencewas not conclusive.Recent findings have workers developed an hypothesis that predicts that the demonstratedmore definitively that soluble matrix pro- soluble matrix proteins adopt antiparallel p-sheet, con- teins, rather than insoluble ones, can conffol the poly- taining (Asp-Y)" domains, where Y representsserine or morphism in vitro (Belcher et al. 1996; Falini et al. 1996). glycine (Weiner 1975; Weiner 1983; Weiner and Tlaub The fact that soluble aragonitic proteins alone can switch 1984; Weiner and Addadi 199!). It was further hypoth- the polymorph of growing crystals (Belcher et al. 1996), esized that the spacing (6.95 A) between every second and that a carbonic anhydrasehas been isolated as a ma- residue of the negatively charged aspartateis approxi- jor soluble matrix componentof the aragonitic shell (Mi- mately similar to the distance(3.0-6.5 A) betweenthe yilmoto et al. 1996), suggestthat the carbonic anhydrase calcium ions in the unit cells of aragonite and calcite, activity to produce local accumulation of carbonateions enabling the proteins to function as a template for min- at the site of crystal growth could be important in the eralization(Weiner 1975). formation of aragonite.The absenceof a carbonic anhy- This model was further extended to explain the crys- drase domain in the major soluble proteins of the calcitic tallography of the three types of foliated calcite by a pre- shell in this study tends to support this hypothesis. cise stereochemicalfit between the amino acid residues of the matrix protein and the crystal lattices in the surface CoNcr-usroNs of a specific crystal face (Runnegar 1984). The spacing To understand the functions of matrix proteins, and of calcium ions along the length of the laths is 19.3 A in biomineralization processesin general, it is necessaryto one type of foliated calcite, a distancethat is matched by determine primary, secondary,and tertiary structures;to every sixth residue of a parallel B-sheet(I9.44 A). Taking localize the proteins precisely in the biominerals; and to account of the amino acid composition, the protein was perform refined in vitro experimentsusing pure proteins. predicted to have the repetitive sequenceof (Asp-Gly-X- The recombinant clones for the MSP-I gene provide a Gly-X-Gly),. The other two types of foliated calcire were basis for those experiments.Furthermore, to understand specified by the repetitive sequenceof (Asp-Y)" of either the functions of maffix proteins in vivo, it would be use- antiparallel or parallel B-sheet conformation (Runnegar ful to produce "transgenic shellfish" with a certain matrix 1984). protein gene disrupted. The kind of information obtained However, thesehypotheses of the primary and second- in this study is considered as a prerequisite for such a ary structures of the acidic matrix proteins have been ventrue. basedon indirect observations.The (Asp-Y)" domains are absent in a phosphoprotein of oyster shell (Wheeler Acxnowr,BDGMENTS 1992). The primary sequenceof Nacrein, a major soluble We thank Hiromichi Nagasawafor technical advice and the use of the protein of pearl nacre (Miyamoto et al. 1996), contains protein sequencer.Maggie Cusack, Lia Addadi, and A P Wheeler are an acidic domain, but is not of the (Asp-Y), thankedfor valuable commentson the manuscript Thanks are due to Jill type. Our Banfield for providing us with the opportunity to publish our results and results indicate that (Asp-Y), type and (Asp-Gly-X-Gly- for helpful suggestionsWe appreciatethe discussionwith KazushigeTan- X-Gly)" type domains do not exist at least in the se- abe and ThtsuoOji. This work was partly financedby grants from Mom- quencedpart of MSP-I. MSP-I has aspartate-richdo- busho (JapanMinistry of Education,no. 08740401and no 09304049)and mains, which contain some regular motifs such as ShimadzuFoundation to K.E. (Asp-Gly-Ser-Asp) and (Asp-Ser-Asp),but the overall ar- RrrnnBNcBScrrED rangementof the acidic residuesin the domains suggests (1985) Interactionsbetween proteins that two-dimensional simple models may be insufficient Addadi, L. and Weiner,S. acidic and crystals: stereochemicalrequirements in biomineralization.Proceedings to explain the interactive relationshipsat the protein-min- of the National Academy of Science,82, 4110-4114. eral interfaces. -(1997) A pavementof perl Natue, 389,912-915 Albeck, S., Aizenberg,J, Addadi,L, and Weiner,S (1993)Interactions Implications for the polymorph formation of various skeletal intracrystalline components with calcite crystals. Journal of American Chemical Society, 115, 1169l-11691 The calcium carbonateof mollusc shell occurs as cal- Aizenberg, J., Albeck, S., Weiner,S., and Addadi, L (1994) Crystal-pro- cite, aragonite, or vaterite (Wilbur 1960). Aragonite oc- tein interactionsstudied by overgrowth of calcite on biogenic skeletal curs in other animals as well as in plants, protists, and elements.Joumal of CrystalGrowth, 142, 156-164 bacteria (Lowenstam and Weiner 1989). The problem of Aizenberg, J , Hanson,J , Ilan, M , Leiserowitz, L., Koetzle, TF, Addadi, (1995) the formation of the much less stablearagonite instead L., and Weiner,S Morphogenesisof calcitic spongespicules: a of role for specializedproteins interactingwith growing crystals The FA- calcite ("the calcite-aragoniteproblem") is long standing SEB Journal. 9. 262-268. and still unresolved (Wilbur 1960; Lowenstam and Wei- Belcher,A M., Wu, X H, Christensen,R J, Hansma,PK, Stucky,G D, SARASHINA AND ENDO: MATRIX PROTEIN OF BIO-CALCITE 1515

and Morse, D E. (1996) Control of crystal phaseswitching and orien- Laemmli, U K (1970) Cleavageof structuralproteins during the assembly tationby solublemollusc-shell proteins. Nature, 381, 56-58 of the head of bacteriophageT4. Nature, 227,680-685. Benson,S.C. and Wilt, EH (1992) Calcificationof spiculesin the sea Lowenstam,H.A. (1981) Minerals formed by organisms.Science, 211, urchin embryo. In E. Bonucci, Ed, Calcification in biological systems, 1126-1131. p 157-178 CRC Press,Cleveland, Ohio. Lowenstam, H.A and Weiner, S (1989) On Biomineralization Oxford Berman, A., Addadi, L., and Weiner, S (1988) Interactionsof sea-urchin University Press,New York skeleton macromoleculeswith growing calcite crystals-a study of in- Mann, S, Archibald,DD, Didymus,JM, Douglas,T., Heywood,B.R., tracrystallineproteins Nature, 331, 546-548. Meldrum, FC, and Reeves,NJ. (1993) Crystallizationat inorganic- Berman,A, Addadi,L., Kvick, A, Leiserowitz,L, Nelson,M., andWei- organic interfaces: biomineralsand biomimetic synthesis.Science, 26 1, ner, S (1990) Intercalationof sea urchin proteins in calcite: study of a 1286 1292 crystallinecomposite material Science,25O, 664-667 Miyamoto, H, Miyashita, T., Okushima, M , Nakano, S , Morita, T., and Borbas,J E , Wheeler,A P, and Sikes,C S. (1991)Molluscan shell matrix Matsushiro, A (1996) A carbonic anhydrasefrom the nacreouslayer phosphoproteins:Correlation of degreeof phosphorylationto shell min- in oyster pearls Proceedingsof the National Academy of Science,93, -9660 eral microstructure and to in vitro regulation of mineralization. The 9651 Journal of ExperimentalZoology,258, 1-13. Runnegar,B (1984) Crystallographyof the foliated calcite shell layers of -29O. Campbell,K P, Maclennan, D H, and Jorgensen,A O (1983)Staining bivalve molluscs Alcheringa, 8, 273 of the Ca'?*-bindingproteins, calsequestrin, calmodulin, troponin C, and Shen,X, Belcher,A M., Hansma,PK, Srucky,G.D , and Morse, D E (1997) S-100, with the cationic carbocyaninedye "Stains-all" The Journal of Molecular cloning and characterizationof Lustrin A, a matrix Biological Chemistry, 258, 11261-11273. protein from shell and pearl nacre of Haliotis rufescens.The Journalof Biological 272, 2-32481. Chomzynski,P (1993) A reagentfor the single-stepsimultaneous isolation Chemistry, 3247 Simkiss,K, Althofl J, Anderson,C., Bennema,P, Boyde,A Crenshaw, of RNA, DNA and proteins from cell and tissue samples.Biotech- , nlques,I), JJz-)JI M A , Fleisch,H., Hohling,H.-J., Howell, D.S., Kitano, Y., Nancollas, G H., Newesely,H., Nielsen,A.E., P, and Termine,J D. (1982) Chou, Ry. and Fasman,G D (1978) Prediction of the secondarysrucrure Quint, Mechanismsof mineralization (normal) group report In G H Nancol- of proteins from their amino acid sequence.Advances in Enzymology, p. 47. 45-148. las, Ed., Biological mineralization and demineralization, 351-363 Springer-Verlag,Berlin. Cusack,M, Cuny, G, Clegg,H., and Abbou, G (1992)An inrracrystal- Sucov,H.M, Benson,S, Robinson,J.J., Britten, RJ, Wilt, F, and Da- line chromoproteinfrom red brachiopodshells: implications for the pro- vidson, E.H. (1987) A lineage-specificgene encoding a major matrix cess of biomineralization ComparativeBiochemistry and physiology, protein of the sea urchin embryo spicule II Structureof the gene and 1028,93-95 derived sequenceof the protein. Developmental Biology, 120,507- Falini, G, Albeck, S, Weiner,S, and Addadi,L. (1996) Conrrolof ara- 519. gonite or calcite polymorphism by mollusk shell macromolecules Sci- Sudo,S, Fujikawa,T, Nagakura,T, Ohkubo,T, Sakaguchi,K., Tanaka, ence,2'71,6'7 -69. M , Nakashima,K, and Takahashi,T. (1997) Structuresofmollusc shell Frohman, M A (1990) RACE: Rapid amplification of cDNA ends. In framework proteins. Nature, 387, 563-564. M A Innis, D H Gelfand, pCR pro- J J Sninsky, and T.J White, Eds., Watabe,N and Wilbur, KM (1960) Influence of the organic matrix on tocols, p 28-38. Academic Press,San Diego, California crystaltype in molluscs Nature,188, 334 Hare, PE (1963) Amino acids in the proteins from aragoniteand calcite Weiner,S. (1975) Soluble protein of the organic matrix of mollusk shells: in the shells of Mytilus californianus. Science, 139, 216-217. a potential templatefor shell formation. Science, 190, 987-989 Holden,K.G, Yim, N.C.F, Griggs,LJ, and Weissbach,J.A. (1971)Gel -(1983) Mollusk shell formation: Isolation of two organic matrix electrophoresisof mucousglycoproteins I Effect of gel porosity Bio- proteins associatedwith calcite deposition in the bivalve Mytilus cali- chemistry, 10, 3105-3109 fornianus Biochemistry, 22, 4139-41 45 Ishii, K, Yanagisawa,T, and Nagasawa,H. (1996) Characterizationof a -(1984) Organizationof organic matrix componentsin mineralized matrix protein in the gastrolith of the crayfish Procambarus clarkii tissues American Zoologist, 24, 945-951. BioscienceBiotechnology Biochemistry, 60, 1479 - I48Z Weiner, S and Addadi, L (1991) Acidic macromoleculesof mineralized Ishii, K, Tsutsui, N , Watanabe,T, Yanagisawa,T., and Nagasawa,H tissues:the controllersof crystal formation. Trendsin Biochemical Sci- (1998) Solubilizationand Chemical characterizationof an insolublema- ence,16,252-256 trix protein in the gastroliths of a crayfish, Procambarus clarkii. Bjo- Weiner, S and Traub, W. (1984) Macromoleculesin mollusc shells and scienceBiotechnology Biochemisny, 62, 291-296. their functions in biomineralization.Philosophical Transactions of Roy- Kasai, H and Ohta, N (1981) Relationshipbetween organic matricesand al Society of London, 8304,425-434. shell structuresin recentbivalves In T. Habe and M Omori, Eds., Study Wheeler, AP. (1992) Phosphoproteinsof oyster (Crassostreavirginica) of molluscanpaleobiology, p 101-106 Kokusai Insatsu,Tokyo (in shell organic matrix. In S. Suga and N. Watabe,Eds , Hard tissuemin- Japanese). eralizationand demineralization,p. I 7 1- I 87 Springer-Verlag,Tokyo Katoh-Fukui, Y., Noce, T., Ueda, T,, Fujiwara, Y, Hashimoto,N, Higash- Wheeler,A.P, George,J.W., and Evans, C A (1981) Control of calcium inakagawa,T., Killian, C E, Livingston,B T., Wilt, FH, Benson,S.C., carbonate nucleation and crystal growth by soluble matrix of oyster -1398 Sucov,H M , and Davidson,E.H. (1991)The corected structureof the shell. Science.212. 1397 Wierzbicki,A, Sikes,CS, Madura, (1994) SM50 spicule matrix protein of Strongylocentrotuspurpuratus Devel- JD., and Drake,B. Atomic opmental Biology, 145, 2Ol-222 force microscopy and molecular modeling of protein md peptidebind- ing to calcite CalcifiedTissue International,54,133-141 Katoh-Fukui, Y, Noce, T., Ueda, T, Fujiwara, Y, Hashimoto,N, Tanaka, Wilbur, K.M. (1960) Shell structure and mineralization in molluscs. In S., and Higashinakagawa,T. (1992) Isolation and characterizationof RF Sognnaes,Ed, Calcificationin biological systems,p. 15-40 cDNA encoding a spicule matrix protein in Hemicentrotuspulcheni- American Association for the advancementof Science, Washington, mus InternationalJoumal of DevelopmentalBiology, 36,353- 361. DC. Krampiu, C P (1982) Structure of the organic matrix in mollusc shells and avian eggshells In G H Nancollas,Ed., Biological mineralization MeNuscptm RECETvEDMmcs 5. 1998 and demineralization,p 219-232 Springer-Verlag,Berlin, Heidelberg, M,q.NuscnrsrACcEprtsD Aucusr 13, 1998 New York Plpnn geNtlLgogv JrrreN E Banucru