DOCSLIB.ORG

Primary Structure of a Soluble Matrix Protein of Scallop Shell

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Primary Structure of a Soluble Matrix Protein of Scallop Shell AmericanMineralogist, Volume 83,pages 1510-1515,1998 Primary structure of a solublematrix protein of scallop shell: Implications for calcium carbonatebiomineralization I. SlnasurNA ANDK. ENoox GeologicalInstitute, University of Tokyo, Tokyo I l3-0033, Japan Ansrnacr Soluble proteins in the scallop (Patinopectenyessoensis) foliated calcite shell layer were characterizedusing biochemical and molecular biological techniques.SDS PAGE of these molecules revealed three major protein bands, 97 kD, 12 kD, and 49 kD in molecular weight, when stained with Coomassie Brilliant Blue. Periodic Acid Schiff staining and Stains-All staining indicated that these proteins are slightly glycosylated and may have cation-binding potential. N-terminal sequencingof the three proteins revealedthat all three sharethe same amino acid sequenceat least for the first 20 residues.A partial amino acid sequenceof 436 amino acids of one of these proteins (MSP-l) was deduced by charac- terization of the complementary DNA encoding the protein. The deduced sequenceis composed of a high proporton of Ser (3l%o), Gly (25Vo),and Asp (20Vo),typifying an acidic glycoprotein of mineralized tissues. The protein has a basic domain near the N- terminus and two highly conserved Asp-rich domains interspersedin three Ser and Gly- rich regions. In contrast with prevalent expectations,(Asp-Gly)n-, (Asp-Ser)n-, and (Asp- Gly-X-Gly-X-Gly)ntype sequencemotifs do not exist in the Asp-rich domains,demanding revision of previous theories of protein-mineral interactions. INrnooucrroN (l) induction of oriented nucleation (Weiner 1975;Weiner Minerals produced by organisms often have crystal and Addadi l99l); (2) inhibition of crystal growth shapesclearly different from those formed inorganically. (Wheeler et al. 1981; Wheeler 1992); (3) control of ara- Most such biominerals are a compositeof inorganic crys- gonite-calcite polymorphism (Falini et al. 1996; Belcher tals and organic molecules such as lipids, polysaccha- et al. 1996); and (4) enhancementof mechanical prop- rides, and proteins, collectively known as the organic ma- erties of the crystals (Berman et al. 1988; Berman et al. trix. It is generally postulated that the elaborate 1990). Most of the evidence to support these hypotheses fabrication of biominerals arisesfrom specific molecular has been obtained through in vitro experiments. The interactions at inorganic-organic interfaces (Mann et al. weaknessof these studies is that unpurified proteins or 1993), and that the organic matrix representsmany of the protein fractions of dubious homogeneity have been ap- important molecules involved in the interactionscontrol- plied in the biochemical analysesand in the in vitro min- ling crystal growth (e.g., Watabeand Wilbur 1960; Low- eralization experiments, and that the stereochemicalre- enstam 1981; Weiner 1984; Lowenstam and Weiner lationships between the organic and inorganic phases 1989). have been presumed without precise information of the Calcium carbonate is one of the most common bio- fine structuresof the proteins. minerals, and its matrix molecules, especially of mollus- To understandthe underlying mechanismsof the pro- can shells, have been studied to a considerableextent to tein-mineral interactions,it seemsessential first of all to unveil their roles in the mineralizationprocesses. The ma- know the primary structure of the proteins involved. ffix molecules have been classif,ed conventionally into However, only a limited number of amino acid sequences two types based on their solubility in aqueoussolutions: have been determined so far for the calcium carbonate the insoluble matrix is thought to be largely intercrystal- matrix proteins. The available sequencescomprise those line (Krampitz 1982) and provides a framework where from spicules of sea urchin emryo (Sucov et al. 1987; mineralization is to occur, whereas the soluble matrix is Katoh-Fukui etal. l99l; Katoh-Fukui etal.1992; Benson known as intracrystalline or located on the intercrystal- and Wilt 1992), from pearl oyster shell layers (Miyamoto line matrix surfaces,but its functions are still poorly un- et al. 1996; Sudo et al. 1997\, and from the nacre of a derstood (Addadi and Weiner 1997). gastropod shell (Shen et al. 7997), in addition to partial Advocated functions of the mainly proteinaceous,sol- sequencesfrom brachiopod shells (Cusack et al. 1992), uble matrix of the molluscan shell in particular, include: an oyster shell (Wheeler 1992), and gastrolith of a cray- fish (Ishii et al. 1996, Ishii et al. 1998). Here we present * E-mail: endo @geol.s.u-tokyo.ac jp a partial amino acid sequenceof the molluscan shell pro- 0003-004x/98/1112-15 l0$05.00 1510 SARASHINA AND ENDO: MATRIX PROTEIN OF BIO-CALCITE l5l I tein MSP-I, a major soluble matrix protein of the scallop quired to design unique primers to facilitate subsequent foliated calcite shell layer, and discussits bearing on the amplification of the DNA sequenceencoding the entire functions of matrix proteins in calcium carbonate proteln. biomineralization. We extracted the total RNA from the mantle tissue of a single specimenof P. yessoensis,using ISOGEN (Nip- MlrBnrlr,s AND METHoDS pon Gene) and the single-stepmethod for RNA isolation Isolation of MSP-I (Chomzynski 1993). The RNA (5 pg) was applied as a Specimens of the commercial scallop Patinopecten template for reversetranscription to preparecomplemen- yessoensiswere purchasedlocally. A single shell valve tary DNA (cDNA) in a 20-p,L reaction, primed with a was thoroughly cleaned mechanically and incubated for "hybrid" primer, TCGAATTCGGATCC-GAGCTC(T ),,, 48 h at room temperaturein a l0 volVosolution of sodium using the SuperScriptpreamplification system(Life Tech- hypochlorite to desffoy surface contaminants.After thor- nologies). The target cDNA sequence,encoding the N- ough washing with ultrapure water, the marginal portion terminal sequenceof 20 amino acid residuesdetermined of the shell, consisting only of the outer shell layer of for the purified MSP-I, was amplified by a method foliated calcite, was crushedto fine fragments.The matrix known as reverseffanscription-polymerase chain reaction proteins were extractedby dissolution of the shell flakes (RT-PCR).The senseprimer and the antisenseprimer cor- (100 g) in 3 liters of 0.5 M EDTA (ethylenediaminete- responded to the sequence encoding LDTDKD and traacetate),pH 8. The extraction was performed at 4 'C NAAED (for one-letter abbrevation of amino acids, see with continuous stirring for 12 h. The preparation was the caption for Fig. 1), respectively, each being degen- then filtered through cheeseclothto remove viscous in- erate, containing oligonucleotides of all the possible se- soluble materials and desaltedby ultrafiltration using the quencesfor each amino acid sequence.The reaction mix- Minitan tangential flow system (Millipore). In this pro- ture (50 pL) contained2 pL cDNA, 2 p.M of eachprimer, cedure, the amount of EDTA was reduced to less than 1 x Taq DNA polymerasebuffer (Life Technologies),3 l0 6 mol, at which point the sample was concentratedto mM MgC,,,100 p,M dNTB and I unit of Taq DNA poly- about 50 mL, then lyophilized. merase(TOYOBO). A Cetus DNA Thermal Cycler (Per- kin Elmer) was employed with an initial step of 94 "C SDS PAGE analyses for 3 min, then 30 cycles at 94 "C for 30 s, 52 "C for 30 The extracted macromolecules (1 mg per each well) s,72'C for I min, followed by a final extensionstep of '72 were separatedby SDS PAGE (Laemmli 1970), using "C for 5 min. The resulting PCR products of 60 base slab gels (15 x 15 cm) of 2 mm thickness containing pairs (bp) in length (correspondingto 20 amino acids), l27o polyacrylamide. After elecffophoresis, gels were were sequenceddirectly by the chain termination method stained by Coomassie Brilliant Blue R or silver (Silver using the BigDye Terminator Cycle SequencingKit and Stain kit; Bio-Rad) to visualize proteins, by Stains-All to an automated DNA sequencer (Perkin-Elmer Applied visualize cation-binding proteins (Campbell et al. 1983), Biosystems). and by periodic acid and Schiff's reagentto visualize car- bohydrates(Holden et al. l97I). Amplffication and sequencingof cDNA 3'-end Threegene-specific sense primers,Pl,P2, and P3 (Fig. 1), designed based on the sequencedetermined by the N-terminal sequencedetermination above method, and the antisense"adaptor" primer (PA), Following separationby SDS PAGE, the proteins were TCGAATTCGGATCCGAGCTC, were synthesized for electroblotted onto polyvinylidene difluoride membrane the PCR amplification of the region between the point (ProBlott; ABI) in Caps buffer (10 mM, pH l l) contain- correspondingto the N-terminal end of the mature protein ing methanol (10 volTo solution), prior to staining with (MSP-l) and the 3'-end of the transcript(3' RACE: rapid Coomassie Brilliant Blue R. N-terminal amino acid se- amplification of cDNA ends protocol; Frohman 1990). quence analysis of the immobilized protein sampleswas The reactions using the primer pair of PI-PA were per- by Edman degradation using an automated protein se- formed first, under conditions similar to those described quencer (Perkin-Elmer Applied Biosystems). Sequences above,except that the reactionswere catalyzedby Ex Taq were determined at least twice for each protein band re- (TAKARA) in this case. A second and a third round of produced by different SDS PAGE gels. PCR reactions were performed with the P2-PA and P3- PA primer pairs, respectively,using the PCR products of RNA purification and RT-PCR the previous round of reactions as a template to
Load more

Recommended publications
  • Biomineralization and Global Biogeochemical Cycles Philippe Van Cappellen Faculty of Geosciences, Utrecht University P.O
    1122 Biomineralization and Global Biogeochemical Cycles Philippe Van Cappellen Faculty of Geosciences, Utrecht University P.O. Box 80021 3508 TA Utrecht, The Netherlands INTRODUCTION Biological activity is a dominant force shaping the chemical structure and evolution of the earth surface environment. The presence of an oxygenated atmosphere- hydrosphere surrounding an otherwise highly reducing solid earth is the most striking consequence of the rise of life on earth. Biological evolution and the functioning of ecosystems, in turn, are to a large degree conditioned by geophysical and geological processes. Understanding the interactions between organisms and their abiotic environment, and the resulting coupled evolution of the biosphere and geosphere is a central theme of research in biogeology. Biogeochemists contribute to this understanding by studying the transformations and transport of chemical substrates and products of biological activity in the environment. Biogeochemical cycles provide a general framework in which geochemists organize their knowledge and interpret their data. The cycle of a given element or substance maps out the rates of transformation in, and transport fluxes between, adjoining environmental reservoirs. The temporal and spatial scales of interest dictate the selection of reservoirs and processes included in the cycle. Typically, the need for a detailed representation of biological process rates and ecosystem structure decreases as the spatial and temporal time scales considered increase. Much progress has been made in the development of global-scale models of biogeochemical cycles. Although these models are based on fairly simple representations of the biosphere and hydrosphere, they account for the large-scale changes in the composition, redox state and biological productivity of the earth surface environment that have occurred over geological time.
    [Show full text]
  • A Perspective on Underlying Crystal Growth Mechanisms in Biomineralization: Solution Mediated Growth Versus Nanosphere Particle Accretion
    CrystEngComm A perspective on underlying crystal growth mechanisms in biomineralization: solution mediated growth versus nanosphere particle accretion Journal: CrystEngComm Manuscript ID: CE-HIG-07-2014-001474.R1 Article Type: Highlight Date Submitted by the Author: 01-Dec-2014 Complete List of Authors: Gal, Assaf; Weizmann Institute of Science, Structural Biology Weiner, Steve; Weizmann Institute of Science, Structural Biology Addadi, Lia; Weizmann Institute of Science, Structural Biology Page 1 of 23 CrystEngComm A perspective on underlying crystal growth mechanisms in biomineralization: solution mediated growth versus nanosphere particle accretion Assaf Gal, Steve Weiner, and Lia Addadi Department of Structural Biology, Weizmann Institute of Science, Rehovot, Israel 76100 Abstract Many organisms form crystals from transient amorphous precursor phases. In the cases where the precursor phases were imaged, they consist of nanosphere particles. Interestingly, some mature biogenic crystals also have nanosphere particle morphology, but some are characterized by crystallographic faces that are smooth at the nanometer level. There are also biogenic crystals that have both crystallographic faces and nanosphere particle morphology. This highlight presents a working hypothesis, stating that some biomineralization processes involve growth by nanosphere particle accretion, where amorphous nanoparticles are incorporated as such into growing crystals and preserve their morphology upon crystallization. This process produces biogenic crystals with a nanosphere particle morphology. Other biomineralization processes proceed by ion-by-ion growth, and some cases of biological crystal growth involve both processes. We also identify several biomineralization processes which do not seem to fit this working hypothesis. It is our hope that this highlight will inspire studies that will shed more light on the underlying crystallization mechanisms in biology.
    [Show full text]
  • Chitosan-Based Biomimetically Mineralized Composite Materials in Human Hard Tissue Repair
    molecules Review Chitosan-Based Biomimetically Mineralized Composite Materials in Human Hard Tissue Repair Die Hu 1,2 , Qian Ren 1,2, Zhongcheng Li 1,2 and Linglin Zhang 1,2,* 1 State Key Laboratory of Oral Diseases & National Clinical Research Centre for Oral Disease, Sichuan University, Chengdu 610000, China; [email protected] (D.H.); [email protected] (Q.R.); [email protected] (Z.L.) 2 Department of Cariology and Endodontics, West China Hospital of Stomatology, Sichuan University, Chengdu 610000, China * Correspondence: [email protected] or [email protected]; Tel.: +86-028-8550-3470 Academic Editors: Mohamed Samir Mohyeldin, Katarína Valachová and Tamer M Tamer Received: 16 September 2020; Accepted: 16 October 2020; Published: 19 October 2020 Abstract: Chitosan is a natural, biodegradable cationic polysaccharide, which has a similar chemical structure and similar biological behaviors to the components of the extracellular matrix in the biomineralization process of teeth or bone. Its excellent biocompatibility, biodegradability, and polyelectrolyte action make it a suitable organic template, which, combined with biomimetic mineralization technology, can be used to develop organic-inorganic composite materials for hard tissue repair. In recent years, various chitosan-based biomimetic organic-inorganic composite materials have been applied in the field of bone tissue engineering and enamel or dentin biomimetic repair in different forms (hydrogels, fibers, porous scaffolds, microspheres, etc.), and the inorganic components of the composites are usually biogenic minerals, such as hydroxyapatite, other calcium phosphate phases, or silica. These composites have good mechanical properties, biocompatibility, bioactivity, osteogenic potential, and other biological properties and are thus considered as promising novel materials for repairing the defects of hard tissue.
    [Show full text]
  • Role of Phosphate in Biomineralization
    Henry Ford Health System Henry Ford Health System Scholarly Commons Endocrinology Articles Endocrinology and Metabolism 7-25-2020 Role of Phosphate in Biomineralization Sanjay Kumar Bhadada Sudhaker D. Rao Henry Ford Health System, [email protected] Follow this and additional works at: https://scholarlycommons.henryford.com/endocrinology_articles Recommended Citation Bhadada SK, and Rao SD. Role of Phosphate in Biomineralization. Calcif Tissue Int 2020. This Article is brought to you for free and open access by the Endocrinology and Metabolism at Henry Ford Health System Scholarly Commons. It has been accepted for inclusion in Endocrinology Articles by an authorized administrator of Henry Ford Health System Scholarly Commons. Calcifed Tissue International https://doi.org/10.1007/s00223-020-00729-9 REVIEW Role of Phosphate in Biomineralization Sanjay Kumar Bhadada1 · Sudhaker D. Rao2,3 Received: 31 March 2020 / Accepted: 14 July 2020 © Springer Science+Business Media, LLC, part of Springer Nature 2020 Abstract Inorganic phosphate is a vital constituent of cells and cell membranes, body fuids, and hard tissues. It is a major intracel- lular divalent anion, participates in many genetic, energy and intermediary metabolic pathways, and is important for bone health. Although we usually think of phosphate mostly in terms of its level in the serum, it is needed for many biological and structural functions of the body. Availability of adequate calcium and inorganic phosphate in the right proportions at the right place is essential for proper acquisition, biomineralization, and maintenance of mass and strength of the skeleton. The three specialized mineralized tissues, bones, teeth, and ossicles, difer from all other tissues in the human body because of their unique ability to mineralize, and the degree and process of mineralization in these tissues also difer to suit the specifc functions: locomotion, chewing, and hearing, respectively.
    [Show full text]
  • Springer Handbookoƒ Marine Biotechnology Kim Editor
    Springer Handbookoƒ Marine Biotechnology Kim Editor 123 1279 58.Biomineraliz Biomineralization in Marine Organisms a Ille C. Gebeshuber 58.2.5 Example of Strontium This chapter describes biominerals and the ma- Mineralization in Various rine organisms that produce them. The proteins Marine Organisms...................... 1290 involved in biomineralization, as well as func- 58.2.6 Example of Biomineralization tions of the biomineralized structures, are treated. of the Unstable Calcium Current and future applications of bioinspired Carbonate Polymorph Vaterite .... 1290 material synthesis in engineering and medicine highlight the enormous potential of biominer- 58.3 Materials – Proteins Controlling alization in marine organisms and the status, Biomineralization................................ 1290 challenges, and prospects regarding successful 58.4 Organisms and Structures marine biotechnology. That They Biomineralize....................... 1290 58.4.1 Example: Molluscan Shells ......... 1293 58.4.2 Example: Coccolithophores......... 1293 58.1 Overview ............................................. 1279 58.1.1 Marine Biomining ..................... 1280 58.5 Functions ............................................ 1294 58.2 Materials – Biominerals 1281 ....................... 58.6 Applications ........................................ 1294 58.2.1 Biominerals Produced 58.6.1 Current Applications by Simple Precipitation of Bioinspired and Oxidation Reactions 1285 ............ Material Synthesis 58.2.2 Biological Production in Engineering and
    [Show full text]
  • Fossil Microbial Shark Tooth Decay Documents in Situ Metabolism Of
    www.nature.com/scientificreports OPEN Fossil microbial shark tooth decay documents in situ metabolism of enameloid proteins as nutrition source in deep water environments Iris Feichtinger1*, Alexander Lukeneder1, Dan Topa2, Jürgen Kriwet3*, Eugen Libowitzky4 & Frances Westall5 Alteration of organic remains during the transition from the bio- to lithosphere is afected strongly by biotic processes of microbes infuencing the potential of dead matter to become fossilized or vanish ultimately. If fossilized, bones, cartilage, and tooth dentine often display traces of bioerosion caused by destructive microbes. The causal agents, however, usually remain ambiguous. Here we present a new type of tissue alteration in fossil deep-sea shark teeth with in situ preservation of the responsible organisms embedded in a delicate flmy substance identifed as extrapolymeric matter. The invading microorganisms are arranged in nest- or chain-like patterns between fuorapatite bundles of the superfcial enameloid. Chemical analysis of the bacteriomorph structures indicates replacement by a phyllosilicate, which enabled in situ preservation. Our results imply that bacteria invaded the hypermineralized tissue for harvesting intra-crystalline bound organic matter, which provided nutrient supply in a nutrient depleted deep-marine environment they inhabited. We document here for the frst time in situ bacteria preservation in tooth enameloid, one of the hardest mineralized tissues developed by animals. This unambiguously verifes that microbes also colonize highly mineralized dental capping tissues with only minor organic content when nutrients are scarce as in deep-marine environments. Teeth and bones are ofen the only evidence of ancient vertebrate life because of the mineralized nature of tissues. Tere are numerous possibilities for chemical alteration during the transition from the bio- to the lithosphere of which bacterial catabolysis of these tissues and organic matter within the carcass is an important example 1,2.
    [Show full text]
  • Fossils, Histology, and Phylogeny: Why Conodonts Are Not Vertebrates
    234 by Alain Blieck1, Susan Turner2,3, Carole J. Burrow3, Hans-Peter Schultze4, Carl B. Rexroad5, Pierre Bultynck6 and Godfrey S. Nowlan7 Fossils, histology, and phylogeny: Why conodonts are not vertebrates 1Université Lille 1: Sciences de la Terre, FRE 3298 du CNRS «Géosystèmes», F-59655 Villeneuve d’Ascq cedex, France. E-mail: [email protected] 2Monash University, Geosciences, Box 28E, Victoria 3800, Australia 3Queensland Museum, Geosciences, 122 Gerler Road, Hendra, Queensland 4011, Australia 4Kansas University, Biodiversity Institute & Natural History Museum, 1345 Jayhawk Blvd., Lawrence, KS 66045-7593, USA 5Indiana Geological Survey, 611 North Walnut Grove, Bloomington, IN 47405-2208, USA 6Institut Royal des Sciences Naturelles de Belgique, Département de Paléontologie, Rue Vautier, 29, B-1000 Bruxelles, Belgium 7Geological Survey of Canada, 3303 – 33rd Street NW, Calgary, AB T2L 2A7, Canada The term vertebrate is generally viewed by help resolve the phylogenetic relationships of conodonts systematists in two contexts, either as Craniata and chordates, the analysis should be extended to (myxinoids or hagfishes + vertebrates s.s., i.e. basically, include non-chordate taxa. animals possessing a stiff backbone) or as Vertebrata (lampreys + other vertebrae-bearing animals, which Historical background we propose to call here Euvertebrata). Craniates are characterized by a skull; vertebrates by vertebrae A recent paper by Sweet and Cooper (2008), within the classic paper series of Episodes, drew our attention and prompted this (arcualia); euvertebrates are vertebrates with hard response. Their paper concerned the discovery and the concept of phosphatised tissues in the skeleton. The earliest conodonts by Christian Heinrich Pander (1856). He was the first known possible craniate is Myllokunmingia (syn.
    [Show full text]
  • A Highly Conspicuous Mineralized Composite Photonic Architecture in the Translucent Shell of the Blue-Rayed Limpet
    ARTICLE Received 8 Aug 2014 | Accepted 17 Jan 2015 | Published 26 Feb 2015 DOI: 10.1038/ncomms7322 OPEN A highly conspicuous mineralized composite photonic architecture in the translucent shell of the blue-rayed limpet Ling Li1,*,w, Stefan Kolle2,3,*, James C. Weaver2, Christine Ortiz1, Joanna Aizenberg2,3,4 & Mathias Kolle5 Many species rely on diverse selections of entirely organic photonic structures for the manipulation of light and the display of striking colours. Here we report the discovery of a mineralized hierarchical photonic architecture embedded within the translucent shell of the blue-rayed limpet Patella pellucida. The bright colour of the limpet’s stripes originates from light interference in a periodically layered zig-zag architecture of crystallographically co-oriented calcite lamellae. Beneath the photonic multilayer, a disordered array of light- absorbing particles provides contrast for the blue colour. This unique mineralized manifes- tation of a synergy of two distinct optical elements at specific locations within the continuum of the limpet’s translucent protective shell ensures the vivid shine of the blue stripes, which can be perceived under water from a wide range of viewing angles. The stripes’ reflection band coincides with the spectral range of minimal light absorption in sea water, raising intriguing questions regarding their functional significance. 1 Department of Materials Science and Engineering, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139, USA. 2 Wyss Institute for Biologically Inspired Engineering, Harvard University, 60 Oxford Street, Cambridge, Massachusetts 02138, USA. 3 School of Engineering and Applied Sciences, Harvard University, 9 Oxford Street, Cambridge, Massachusetts 02138, USA. 4 Kavli Institute for Bionano Science and Technology at Harvard University, 29 Oxford Street, Cambridge, Massachusetts 02138, USA.
    [Show full text]
  • A Diecast Mineralization Process Forms the Tough Mantis Shrimp Dactyl Club
    A diecast mineralization process forms the tough mantis shrimp dactyl club Shahrouz Aminia, Maryam Tadayona, Jun Jie Lokea, Akshita Kumara, Deepankumar Kanagavela, Hortense Le Ferranda, Martial Duchampb, Manfred Raidac, Radoslaw M. Sobotad, Liyan Chend, Shawn Hoone, and Ali Misereza,f,1 aCentre for Biomimetic Sensor Science, School of Materials Science and Engineering, Nanyang Technological University (NTU), 639798 Singapore; bSchool of Materials Science and Engineering, NTU, 639798 Singapore; cLife Science Institutes, Singapore Lipidomics Incubator, National University of Singapore (NUS), 117456 Singapore; dFunctional Proteomics Laboratory, Institute for Molecular, Cell, and Development Biology, Agency for Science, Technology, and Research (A*Star), 138673 Proteos, Singapore; eMolecular Engineering Laboratory, Biomedical Sciences Institutes, A*Star, 138673 Proteos, Singapore; and fSchool of Biological Sciences, NTU, 637551 Singapore Edited by Lia Addadi, Weizmann Institute of Science, Rehovot, Israel, and approved March 19, 2019 (received for review October 2, 2018) Biomineralization, the process by which mineralized tissues grow We used the dactyl club of stomatopods (mantis shrimps) as a and harden via biogenic mineral deposition, is a relatively lengthy model structure to study the entire formation of hard and tough process in many mineral-producing organisms, resulting in challenges apatite-based mineralized appendages. The club is a biological to study the growth and biomineralization of complex hard miner- hammer used by stomatopods to fracture the hard shells of their alized tissues. Arthropods are ideal model organisms to study preys and has emerged in recent years as a fascinating model biomineralization because they regularly molt their exoskeletons structure of bioinspired materials (6–10). The club is the most and grow new ones in a relatively fast timescale, providing oppor- mineralized appendage of the dactyl segment and exhibits a tunities to track mineralization of entire tissues.
    [Show full text]
  • Abstracts BIOMIN XV: 15Th International Symposium on Biomineralization 9–13 September 2019 • Munich, Germany
    Abstracts BIOMIN XV: 15th International Symposium on Biomineralization 9–13 September 2019 • Munich, Germany 1. Keynote lectures (K1 – K8) ................................................................................................................. 2 2. Talks (T1 – T89) ................................................................................................................................... 4 3. Posters (P1 – P107) ............................................................................................................................. 31 Design/Layout Layout: www.conventus.de Editorial Deadline: 31 August 2019 1 K 1 K 3 On ion transport and concentration toward mineral formation Getting to the roots of apatite-based biomineralization of dental in sea urchin larvae hard tissues: from Conodonts and Cichlids to related Keren Kahi1, Neta Varsano1, Andrea Sorrentino2, Eva Pereiro2, Peter Rez3, bioinspired materials Steve Weiner1 and Lia Addadi*1 Elena V. Sturm*1 (née Rosseeva) 1Department of Structural Biology, Weizmann Institute of Science, Rehovot, 1Physical Chemistry, Zukunftskolleg, University of Konstanz, Konstanz, Israel Germany 2ALBA Synchrotron Light Source, MISTRAL Beamline−Experiments Division, Barcelona, Spain Chordates and especially vertebrates represent the most highly advanced and 3Department of Physics, Arizona State University, Tempe, AZ, USA complex group of organisms. The formation of their hierarchical apatite- organic based hard tissues is evolutionary optimized and exhibits high During mineralized tissue
    [Show full text]
  • Some Trends on How One Can Learn from and Mimic Nature in Order to Design Better Biomaterials
    Materials Science and Engineering C 25 (2005) 93–95 www.elsevier.com/locate/msec Editorial Some trends on how one can learn from and mimic nature in order to design better biomaterials It is our great privilege as Director and one of the main natural anisotropic composite structures with adequate organizers of the NATO Advanced Study Institute (ASI) on mechanical properties. In fact, Nature is and will continue bLearning from Nature How to Design New Implantable to be the best material scientist ever. Who better than Nature Biomaterials: From Biomineralization Fundamentals to can design complex structures and control the intricate Biomimetic Materials and Processing RoutesQ, held from phenomena (processing routes) that lead to the final shape the 13th to the 24th of October 2003 in Alvor, Algarve, and structure (from the macro to the nano level) of living Portugal, to introduce you to a selection of papers resulting creatures? Who can combine biological and physico- from the original contributions presented by the ASI chemical mechanisms in such a way that can build ideal students. structure–properties relationships? Who else than Nature It is rather typical that an ASI results on a state of the art can really design smart structural components that respond book composed by invited chapters prepared by the ASI in-situ to exterior stimulus, being able of adapting con- faculty. This was also the case for this NATO-ASI and a stantly their microstructure and correspondent properties? In wonderful book has already been published by Kluwer. the described philosophy line, mineralized tissues and These books are of course very useful research and biomineralization processes are ideal examples to learn- education tools.
    [Show full text]
  • Evolutionary Origins of Animal Skeletal Biomineralization
    Cells Tissues Organs Published online: May 27, 2011 DOI: 10.1159/000324245 Evolutionary Origins of Animal Skeletal Biomineralization Duncan J.E. Murdock Philip C.J. Donoghue School of Earth Sciences, University of Bristol, Wills Memorial Building, Queen’s Road, Bristol , UK Key Words Introduction Biomineralization ؒ Animal skeleton ؒ Evolution ؒ Fossil record ؒ Cambrian explosion Biomineralogy has long been the focus of materials scientists, chemists and palaeontologists, but it has only recently captured the interest of developmental biologists Abstract [Wilt, 2005] who in short order have begun to address The evolutionary history of biomineralization in animals is some of the fundamental questions in biomineralogy. crucial to our understanding of modern mineralized tissues. Foremost is the question of whether disparate animal lin- Traditional methods of unravelling this history have aimed to eages evolved their mineralized skeletons independently derive a theory of the development of biomineralization or the ability to develop a mineralized skeleton is inher- through evolution by the comparison of mineralized systems ited from a common ancestor. The prospect of a skeleton- in model organisms. This has led to the recognition of the ized universal ancestor of animals has been revived in ‘biomineralization toolkit’ and raised the question of the ho- light of the discovery that orthologous genes and their mology of mineralized tissues versus convergent or parallel encoded proteins are implicated in skeletal development evolution. The ‘new animal phylogeny’ reveals that many of in organisms as diverse as vertebrates, echinoderms, the groups known to biomineralize sit among close relatives molluscs and sponges [Ettensohn et al., 2003; Livingston that do not, and it favours an interpretation of convergent or et al., 2006; Jackson et al., 2007].
    [Show full text]