Del Mejillón Choromytilus Chorus (Molina

UNIVERSIDAD DE ANTOFAGASTA FACULTAD DE RECURSOS DEL MAR PROGRAMA DE DOCTORADO EN CIENCIAS APLICADAS, MENCIÓN SISTEMAS MARINOS COSTEROS

FUNCIÓN DE LOS ESTEROIDES SEXUALES EN LA DIFERENCIACIÓN

SEXUAL (GONADAL) DEL MEJILLÓN CHOROMYTILUS CHORUS (MOLINA

1782) (BIVALVIA MYTILIDAE)

Tesis presentada a la Facultad de Recursos del Mar como requisito para optar al grado académico de Doctor

en Ciencias Aplicadas, mención Sistemas Marinos Costeros

MARYORI IVONNE RUIZ VELÁSQUEZ

Profesor Patrocinante: Dr. Manuel Zapata Arcos Profesor Copatrocinante: Dra. María Teresa González

Enero, 2017 Antofagasta, Chile

CALIFICACIONES

FACULTAD DE RECURSOS DEL MAR PROGRAMA DE DOCTORADO EN CIENCIAS APLICADAS, MENCIÓN SISTEMAS MARINOS COSTEROS

FUNCIÓN DE LOS ESTEROIDES SEXUALES EN LA DIFERENCIACIÓN

SEXUAL (GONADAL) DEL MEJILLÓN CHOROMYTILUS CHORUS (MOLINA

1782) (BIVALVIA MYTILIDAE)

Dr. Manuel Zapata Arcos ------Profesor Patrocinante

Dra. María Teresa González ------Profesor Co Patrocinante

Dr. Eduardo Tarifeño Silva ------Profesor Evaluador Externo

Dr. Aldo Pacheco Velásquez ------Profesor Evaluador Programa

Enero, 2017 Antofagasta, Chile

DEDICATORIA

Esta tesis está dedicada al Señor, a mis amados mis padres y hermano.

iii

AGRADECIMIENTOS

Al concluir esta etapa, deseo agradecer al Señor por su amor, ayuda y por darme la fortaleza de enfrentar este gran desafío y poder finalizarlo con éxito. A mis amados padres Ivón Velásquez Vielma y Daniel Ruiz Sandoval, y a mi hermano Daniel Ruiz Velásquez por estar siempre presentes, constante preocupación, y apoyo incondicionalmente durante todos estos años, con sus palabras de afecto y gran amor, gracias por todo.

La realización de esta Tesis no hubiese sido posible sin el apoyo incondicional de mi profesor tutor (patrocinante), Dr. Manuel Zapata Arcos, por creer en mí y en este proyecto, por estar siempre a mi lado instándome a seguir adelante, brindándome su confianza, conocimiento, paciencia, consejo y amistad, gracias por todo profesor. Deseo agradecer a la Dra. María Teresa Gonzáles, por su confianza, conocimiento y por su constante apoyo para sacar esta iniciativa adelante, gracias profesora. A la profesora Mariella Rivas, por su gran apoyo, y por su gran amabilidad de ayudarme en las actividades metodológicas.

También, deseo agradecer a Daniel Ordenes, Profesor Juan Morales, Maritza Fajardo, Espiridion Montanares, y al grupo de Laboratorio Bioal (Debra, Daniela, Javiera, Alejandro, Mari Carmen, Cristián, David, Alejandra, Lun) por la gran ayuda brindada para el desarrollo de esta tesis, amistad y por sus palabras de aliento. También, extiendo mis agradecimiento a Mauricio Escalona, quién estuvo siempre presente apoyándome, instándome a seguir adelante y quién se convirtió en un gran amigo de Tesis.

Además, deseo extender mis agradecimientos hacia todas las personas que de una u otra forma estuvieron presentes durante todos estos años, en especial a Jessica, José, Nair, Yuri, Nancy, Sidgrid, Diony, Arianna y Mauro, y a mis familiares, amigos y compañeros. Deseo agradecer a la Compañía Santa María Spa., especialmente, al Sr. Pedro Granic, y a todo el personal, por su apoyo en las actividades de campo.

Finalmente, deseo agradecer al apoyo brindado por Conicyt para el desarrollo de esta tesis, mediante la adjudicación de la Beca “Tesis de Doctorado en la Industria” y la Beca asignación anual para gastos operacionales del proyecto de Tesis Doctoral, también de

Conicyt.

TABLA DE CONTENIDOS

Página

Calificaciones ………………………….………..………………...... ii Dedicatoria ……..……………………….………..………………...... iii Agradecimientos ……………………….………..………………...... iv Tabla de contenidos …………………….………..………...……...... vi Lista de tablas ………………………….………..………………...... ix Lista de figuras …………………………..………..……………...... ix Resumen ..….………...…………………………………………..………...... xi Abstract .…………….………………………..…………...……….……...... xii Introducción ………………………………………………...... 1 Características de la sexualidad en los moluscos bivalvos …...... 1 Determinación sexual en los moluscos bivalvos …………………………...... 2 Diferenciación sexual o gonadal en moluscos bivalvos …………………...... 4 Esteroides sexuales en los moluscos bivalvos ………………………...... 6 Tipos de esteroides sexuales ….………….………...... 6 Función de los esteroides sexuales en la reproducción …..…………….…………...7 Función de los esteroides sexuales en la diferenciación sexual .…..…………….....8 Citocromo P450 aromatasa ....…………………...... 10 Modelo biológico ………...….…………...... 12 Objetivo de la tesis ……….……………………...... 16 Hipótesis ..…………….…….……………………...... 18

Capítulo I. Sexual differentiation and size at first maturity of the mussel Choromytilus chorus (Molina, 1782) (Mollusca, Bivalvia) in Northern of Chile ……………………………………………...... 19

Abstract …………………………………………………...... 20 Introduction and objectives ……..………………………...... 21 Metodology ……………………..………………………...... 24 Sampling ……….……..………………………...... 24 Sex ratio ….…….……..…………………………...... 25 Sexual differentiation ....…………………………...... 25 Sexual maturity stages ....…………………………...... 25 Succes of fertilization of the gametes of C. chorus …...... 27 Determination of the size at first sexual maturity …...... 29 Statistical Analysis …………..…………………………...... 29 Results …...……………………..………………………...... 30 Sex ratio ……….………..………………………...... 30 Sexual differentiation .…..………………………...... 30 Histological analysis ..…..………………………...... 31 Sexual maturity ..………….………………………...... 32

Size at first sexual maturity …………………………………...... 32 Success of fertilization of the gametes of C. chorus …….……...... 33 Discussion ……….……………..………………………...... 35 Conclusion ……….……………..………………………...... 40 Acknoledgements ..……………..………………………...... 41 Literature cited …..……………..………………………...... 42 Annex chapter I ………………………………………………….………...... 47

Capítulo II. Role of sex steroids in gonadal differentiation of the mussel Choromytilus chorus (Bivalvia Mytilidae) (Molina 1782) (parte I) ……………………..57

Abstract ………………………………………………………………...... 58 Introduction ………………..…………………………………………...... 59 Material and methods .……..…………………………………………...... 63 Collection of the animals and maintenance …....……….……………………...... 79 Maintenance of animals to experimental cages ……………………...... 63 Exposure experiment to sex steroids …..…..……………………...... 64 Sampling ……………...……………....…..……….……………...... 65 Histology ……………...……………....…..……….……………...... 66 Sexual maturity stages and gonad development …………………………………66 Experiment to determine the success of fertilization of the gametes ...... 67 Statistical analysis …....…………………………………………...... 68 Results ………………………………………………...……...... 69 Treatments effects on survival and biometrics measures ….…...... 69 Effect of sex steroids on differentiation ……...... 69 Effect of sex steroids on sexual maturity ……………...... 70 Effect of steroids on the histology of the gonad ……...…………………….……72 Experiment to determine the viability of gametes ...... 73 Discussion ……..…………..…………………………………………...... 74 Effect on gonadal development in mussels …...... 74 Effect of sex steroids on sexual differentiation ……….……...... 75 . Success of fertilization of the gametes …………………….……...... 78 Conclusion ………………………………………………………………………...... 80 Acknowledgments ...... 80 Literature cited …………...... 81 Annex chapter II ……..……...... 86

Parte II: Estandarización de protocolo para detección de la citocromo P450 Aromatase (parte II) ……...... 94

Extracción de proteínas totales ...... 95 Cuantificación de las proteínas totales purificadas, utilizando el método de Bradford ……………………………………………………………………………….....95 Electroforesis en geles de poliacrilamida en presencia de dodecil sulfato de sodio (SDS-PAGE) ....…………...... 97

vii

Tinción de los geles de SDS-PAGE con azul de Coomassie …...... 97 Análisis de Western Blot …………………………………...…...... 98 Resultados y conclusión ………………………………………...... 99 Literatura citada ……….…………………………………...…...... 100 Anexos capítulo II parte II .………………………………...…...... 101

Capítulo III. Selección y validación de genes de referencias como control interno para estudiar la expresión de genes en tejidos del mejillón gigante Choromytilus chorus (Bivalvia Mytilidae) (Molina, 1782) …………………....104

Introducción y objetivos …………………………………………………………..…….107 Materiales y métodos …………..…...……………………...…...... 111 Muestreo ..…………..…...……………………...…...... 111 Recolección y aclimatación de los animales ….……....…………………..….....111 Muestreo ..…………..…...……………………...…...... 112 Extracción de ARN total.…...……………………...…...... 113 Tratamiento con DNasa y síntesis de cDNA ……………..……………………..114 Grupos experimentales ….….………………...………...... 115 Selección de genes de referencia ………………………………..……………....116 Tm óptimo para los tejidos muestreados …...………………………..………….117 RT-qPCR tiempo real .…...... 118 Análisis de datos ……………………………..…………………………..….…..119 Resultados ……………………...... 120 Cantidad y calidad del ARN total ……...... 120 RT-qPCR amplificación de primers ……….....………...... 120 Análisis de estabilidad de la expresión de los genes de referencia …………….121 Discusión y conclusión …………….………………...………...... 122 Literatura citada ……………………………………...………...... 126 Anexos capítulo III ………………...………………...………...... 130

Conclusiones de la tesis ……………………………………..………………...... 136

Literatura citada …………………………………………………..……………...... 139

viii

LISTADO DE TABLAS

Páginas

Capítulo I. Sexual differentiation and size at first maturity of the mussel Choromytilus chorus (Molina, 1782) (Mollusca, Bivalvia) in Northern of Chile.

Table 1. Sexual differentiation and size at first maturity of the mussel Choromytilus chorus ……….…….………………………...…...... 49 Table 2. Variables obtained in fertilization experiment in Choromytilus chorus ……………………...…..…………………………..…...... 49

Capítulo II. Role of sex steroids in gonadal differentiation of the mussel Choromytilus chorus (Bivalvia Mytilidae) (Molina 1782) (parte I) Estandarización de un protocolo para la deteción de la citocromo P450 Aromatasa (parte II).

Table 1. Characteristics of juvenile of C. chorus exposed to different treatments, and survival of individuals by treatment at the end of experiment ………………..….………87 Table 2. Effect of sex steroids on the sexual differentiation of bivalve mollusks …….....88

Tabla 1. Lista de primers de los genes de referencia para C. chorus ………….……….131 Tabla 2. Porcentaje de los tres genes con mayores valores de eficiencia Obtenidos en el mejillón C. chorus ………………………………………………..……132

LISTADO DE FIGURAS

Capítulo I. Sexual differentiation and size at first maturity of the mussel Choromytilus chorus (Molina, 1782) (Mollusca, Bivalvia) in Northern of Chile

Figure 1. Sexual differentiation visualized in five size ranges in female gonad of Choromytilus chorus ………………………..…………………..………….…..50 Figure 2. Sexual differentiation visualized in five size ranges in male gonad of Choromytilus chorus ………………………………………………………..………....51 Figure 3. Photomicrographs of female gonads, showing the sexual stages predominant of oogenesis in five size ranges in Choromytilus chorus ……………..……52 Figure 4. Photomicrographs of male gonads, showing the sexual stages predominant of spermatogenesis in five size ranges in Choromytilus chorus ……...... 53 Figure 5. Distribution of the stages of sexual maturity of all size ranges

Analyzed ………………………………………………………………………...... 54 Figure 6. Embryonic and larval phase obtained in the experiments of fertilization in Choromytilus chorus ………………………………...……………...... 55

Capítulo II. Role of sex steroids in gonadal differentiation of the mussel Choromytilus chorus (Bivalvia Mytilidae) (Molina 1782) (Parte A) y estándarización de protocolo de detteción de la citocromo P450 aromatasa (Parte B)

Parte A

Figure 1. Effect of treatments with sex steroids on the sexual differentiation in the mussel C. chorus ……………….………………………………………….……....89 Figure 2. Sexual differentiation shown in treatments and control in C. chorus ……....…90 Figure 3. Female gonad photography showing the predominant sexual maturity stages of oogenesis from treatments and control group in C. chorus ………….………...91 Figure 4. Male gonad photography showing predominant sexual maturity stage of spermatogenesis from treatments and control group in C. chorus ……….…...... 92 Figure 5. Embryonic and larval phases obtained from the fertilization experiment in treatments and control in C. chorus …………………………………..…….....93

Parte B

Figura 1. Curva de calibrado para determinar las proteínas totales de muestras de C. chorus ……………………………………………………….……………………….102 Figura 2. Gel de poliacrilamida SDS-PAGE …………………….…………………….102 Figura 3. Western Blot ………………………………...……………………………….103

Capítulo III. Selección y validación de genes de referencias como control interno para estudiar la expresión de genes en tejidos del mejillón gigante Choromytilus Chorus (Bivalvia Mytilidae) (Molina, 1782)

Figura 1. Productos de PCR de 8 genes de referencia en gel de agarosa al 3% …...... 132 Figura 2. Curvas de melting de las diluciones seriadas del gen 18S ……...……….…..133 Figura 3. Curvas de melting de las diluciones seriadas del gen 28S ………….……….134 Figura 4. Curvas de melting de las diluciones seriadas del gen TUBA (αtubulina) …...135

RESUMEN

Los mecanismos moleculares- endocrinos involucrados en la diferenciación sexual en los moluscos bivalvos se desconocen casi por completo; no obstante, los agentes de diferenciación de esteroides sexuales en vertebrados esteroides sexuales han sido establecidos también en invertebrados. En nuestro país, se destaca el mejillón Choromytilus chorus por su importancia ecológica y económica, y por presentar una condición particular en la coloración de la gónada; siendo la gónada femenina de color café oscuro y la masculina crema-amarillenta, condición que permitiría distinguir machos y hembras en los cultivos para la obtención de “poblaciones todo macho", ya que en las plantas de procesos rechazan las hembras por su coloración. En consecuencia, los objetivos de este estudio fueron evaluar el efecto de los esteroides sexuales en la diferenciación gonadal temprana de juveniles del mejillón C. chorus. Además, y debido al restablecimiento de este recurso en el norte de Chile se realizó una estandarización de parámetros biológicos-reproductivos. También, se realizó una selección y validación de genes de referencia como control interno para estudiar la expresión de genes en tejido de C. chorus, como un primer paso para estudios de expresión de genes relacionados a la diferenciación sexual. Para esto, individuos de C. chorus fueron recolectados en la costa de Antofagasta (24°S) desde diciembre 2014 hasta junio 2015. Un total de 1.620 individuos, con tallas entre 5 mm hasta los 100 mm, clasificados en 17 rangos de tallas, fueron examinados mediante histología. Posteriormente, en septiembre de 2015 se seleccionaron juveniles con talla de 15-22 mm, para ser sometidos a la exposición agua en forma de baño durante 60 días a cuatro tratamientos más un control: 1) 17β-estradiol (E2), 2) Dihidrotestosterona (DHT), 3) Fadrozol (F) y 4) Dihidrotestosterona más fadrozol (DF) y 5) control sin aplicación de químicos. También, se determinaron las eficiencias y estabilidad de 12 genes candidatos en C. chorus, en diferentes estadíos del desarrollo ontogenético, tejido y sexo. Los resultados mostraron que del total de los individuos muestreados, 49% fueron machos y 51% fueron hembras. Los mejillones con tallas entre los 22-24 mm empezaron a diferenciarse sexualmente y en el rango 38-40 se registró la talla de primera madurez sexual (50% de los individuos maduros). Se observó que los mejillones sometidos al tratamiento con 17β presentaron una proporción sexual (macho: hembra) de 0.47, comparada a 1:1 en el grupo control. En cambio, en los grupos tratados con DHT, F y DF se observó un incremento en esta razón de 2.0, 1.60 y 1.70, respectivamente. En los ensayos de fecundación se observó que todos los mejillones produjeron gónadas con gametos funcionales, ya que fueron capaces de generar gametos que se desarrollaron a mórula, y larva velígera. Los análisis indicaron que los genes 28S (100% de eficiencia) y 18S (100% de eficiencia) fueron los genes de referencia más estables en todos los tejidos, sexo y rangos de tallas ensayados. Los análisis con el algortismo estadístico Bestkeeper señalaron que los genes 18S y 28S fueron los genes más estables. De este modo, la presente investigación permitió demostrar el efecto de diversos esteroides sobre la diferenciación sexual de C. chorus y comprender aspectos claves referentes a las bases moleculares y fenotípicas involucradas en la diferenciación sexual en los moluscos bivalvos.

ABSTRACT

The molecular-endocrine mechanisms involved in the differentiation of sex in bivalve molluscs are almost completely unknown. However, agents of sex differentiation of vertebrates known as “sex steroids” have been established also in invertebrates. In our country, highlights the mussel Choromytilus chorus by their ecological and economic importance, and for presenting a particular condition in the coloring of the gonad; being female dark brown and the male yellowish cream, a condition which would separate populations of male and females in the bivalve aquaculture to obtain populations “all male”, since in the plants of processes reject females by its coloring. In consequence, the objectives of this study were to evaluate the effect of sex steroids on the early sexual differentiation of juveniles of the mussel C. chorus, and due to the re-establishment of this resource in the north of Chile was made a standardization of biological-reproductive parameters. Also, was made a selection and validation of reference genes as an internal control to study the expression of genes in tissue of C. chorus, as a first step for studies on the expression of genes related to the sexual differentiation. For this, individuals of C. chorus were collected in the coast of Antofagasta (24°S) from December 2014 until June 2015. A total of 1,620 individuals, with sizes between 5 mm to 100 mm, classified in 17 ranges of size, they were examined using histological techniques, and frotis. Subsequently, in September 2015 juveniles were selected with length of 15-22 mm, to be subjected to the exposure in the form of water bath during 60 days, four treatments plus one control: 1) 17β- estradiol, 2) Dihydrotestosterone, 3) Fadrozol and 4) Dihydrotestosterone plus Fadrozol and 5) control without the application of chemicals. Also, determined the levels of expression relative and the stability of twelve candidate genes in C. chorus, in different stages of the ontogeny, tissue and sex. The results indicated that of the total number of individuals sampled, 49% were males and 51% were females, mussels with sizes between the 22-24 mm began to differentiate sexually in the range of 38-40 recorded the size of first sexual maturity. It was noted that the mussels subjected to treatment with 17β-estradiol had a sex ratio (male: female) changed to 0.47, compared to 1:1 in the control group. In contrast, in the groups treated with DHT, F and DF was observed an increase in this reason of 2.0, 1.60 and 1.70, respectively. In the trials of fertilization it was observed that all the mussels were functional gametes, since they were able to generate gametes that were developed to morula, and larva velígera. The analysis indicated that the genes 28S (100% efficiency) and 18S (100% efficiency) were the most stable HKG genes in all tissues, sexes and size ranges tested. Analyzes with BestKeeper showed that 18S and 28S were the most stable genes. These results could help future researches on reproduction, sexual differentiation, thermoregulation and endocrinology in C. chorus. Thus, this research allows us to understand some key aspects of sexual differentiation in bivalve molluscs.

xii

INTRODUCCIÓN

1. Características de la sexualidad en los moluscos

Entre las más de 10.000 especies que constituyen la clase Bivalvia puede haber distinto grado de diferenciación sexual, desde individuos de sexo separado (gonocóricos) hasta hermafroditas consecutivos y simultáneos (Coe 1943; Bayne 1976). Los hermafroditas consecutivos incluyen a los animales protándricos y protogínicos, en el primer caso maduran primero como machos y cambian a hembras a una talla/edad específica, reteniendo esta condición uno o varios ciclos reproductivos hasta que cambian de sexo, etapa en la cual las dos fases sexuales pueden solaparse temporalmente en el mismo folículo (Saucedo and Southgate 2008). Los animales protogínicos maduran primero como hembras y después como machos (Saucedo and Southgate 2008), en tanto que los hermafroditas simultáneos desarrollan una gónada masculina y femenina al mismo tiempo, como los miembros de la Familia Pectinidae.

En los bivalvos gonocóricos la proporción sexual (macho: hembra) es 1:1 y se mantiene constante a partir de la talla/edad de primera madurez (Hart and Joll 2006), a diferencia de los animales hermafroditas quienes se diferencian como machos y después pueden cambiar a hembra o viceversa.

Estas amplias variaciones observadas en la expresión de la sexualidad en diferentes especies de moluscos bivalvos, en individuos de una misma especie y en diferentes períodos de su vida permiten que estos individuos sean buenos modelos biológicos para comprender problemáticas acerca de la determinación y diferenciación del sexo o gónadal, en los bivalvos marinos sometidos a diversas condiciones latitudinales y ambientales.

1.1. Determinación sexual en moluscos bivalvos

La distinción entre la determinación del sexo y diferenciación del sexo es frecuentemente difícil de comprender; Devlin and Nagahama (2002) usan el criterio de diferenciación del sexo (morfológica, celular y molecular) para inferir si el sexo ha sido determinado en una dirección en particular. La determinación del sexo, es usada para describir los procesos genéticos o ambientales por cual se establece el sexo de un individuo, masculino o femenino (Bull 1983), y ocurre previamente al proceso de diferenciación sexual. Existen dos mecanismos determinantes del sexo, la determinación del sexo genotípico (DSG) y la determinación del sexo ambiental (DSA).

El primero se establece en etapas tempranas del desarrollo embrionario e involucra la participación de genes específicos, distribuidos generalmente en cromosomas sexuales heteromórficos; heterogamia masculina y homogamía femenina (♂ XY/♀ XX) en mamíferos, y homogamía masculina y heterogamia femenina (♂ ZZ/♀ ZW) en peces, aves y algunos reptiles (Bull 1983). En mamíferos, la determinación del sexo ha sido

más estudiada, reportándose la activación de una cascada de genes que involucran al

Wt1, Sf1, Sry, Sox9, Gata4, Dmrt 1 y MIH en el macho (Ferguson-Smith 2006; Matsuda et al. 2002) y Wnt4, RSpo1, Foxl2 y Dax1 en la hembra (Wilhelm 2007).

En invertebrados existiría una aparente falta del típico sistema XY/XX o ZZ/ZW. Las investigaciones indican que la información genética relacionada al sexo no estaría contenida en cromosomas sexuales como en los vertebrados, debido a la ausencia de estos; lo que parece ser la regla general en todos los invertebrados (Wada 1978). La presencia de genes ortólogos a Dmrt1 y Dmrt2 ha sido encontrada en Crassostrea gigas

(Naimi et al. 2009) y Pinctada martensii (Yu et al. 2011); determinantes del sexo de la gónada masculina en mamíferos (Raymond et al. 2000), aves (Smith et al. 1999), anfibios (Shibata et al. 2002), reptiles (Torres-Maldonado et al. 2002) y peces (Nanda et al. 2002). Homólogos a Foxl2, uno de los genes involucrados en el desarrollo del ovario en vertebrados (Cocquet et al. 2002), han sido encontrados en esponjas (Adell and

Muller 2004), cnidarios (Magie et al. 2005), cefalocordados (Yu et al. 2008) y bivalvos

(Dheilly et al. 2012). Sin embargo, aún no se ha podido atribuir la función de estos genes en la determinación del sexo en los invertebrados.

La determinación del sexo ambiental (DSA), se atribuye al efecto del entorno en el sexo del individuo, el cual es determinado después de la fertilización. Este mecanismo ha sido establecido en reptiles, anfibios y peces (Yntema 1976). En varias especies de

vertebrados, la temperatura de incubación durante los estadios tempranos influye en el sexo fenotípico de las crías de algunos vertebrados (Yntema 1976). En invertebrados,

Tranter (1958) señala que la reversión sexual podría deberse principalmente a que los rudimentos de células germinales responden a los niveles de reservas de alimento de todo el tejido, argumentando que la "masculinización" usualmente ocurre cuando las reservas de energía dentro del animal son bajas, mientras que la "feminización" se favorece cuando las reservas son altas.

En animales cultivados, la determinación del sexo depende de otros factores tales como la densidad de siembra, la cual en condiciones de hacinamiento favorece la producción de individuos más machos que hembras, por ser los primeros el sexo energéticamente menos costoso de producir (Saucedo and Southgate 2008). Sin embargo, en invertebrados no existe evidencia que soporte la hipótesis de que los factores ambientales pueden estar involucrados en la determinación del sexo como acontece en vertebrados.

1.2. Diferenciación sexual o gonadal en moluscos bivalvos

La diferenciación sexual es el resultado de eventos moleculares, genéticos y fisiológicos que producen una hembra o un macho a partir de un cigoto con un cierto genotipo en un determinado ambiente (Penman and Piferrer 2008). Se ha señalado que los esteroides

sexuales están involucrados en la diferenciación sexual de los invertebrados tal como sucede en vertebrados. Por ejemplo, los estrógenos están involucrados en la diferenciación ovárica de la mayoría de los vertebrados, incluyendo aves (Smith and

Sinclair 2004), reptiles (Pieau and Dorizzi 2004), anfibios (Hayes 1998) y peces (Devlin and Nagahama 2002). En bivalvos existe evidencia que la reversión sexual también puede ser inducida por efecto de los esteroides sexuales igual como acontece en vertebrados (Vizziano et al. 2007; Moss 1989). Mori et al. (1966) señalan que el suministro de estradiol en una temprana etapa de maduración gonádica de Crassostrea gigas induce la reversión sexual de macho a hembra.

En Oncorhynchus mykiss, uno de los factores más importantes que contribuye a la diferenciación sexual femenina es la expresión temprana del gen que codifica para la enzima cyp19a1a o aromatasa ovárica (Vizziano et al. 2007). Esta enzima cataliza la trasformación de testosterona (un andrógeno masculino) a estradiol, un estrógeno principalmente de carácter femenino. La existencia y función de la aromatasa (CYP19;

P450arom) ha sido reportada también en moluscos (Matsumoto et al. 1997), sin embargo, se desconoce si esta enzima estaría involucrada en el proceso de diferenciación sexual en los invertebrados.

2. Esteroides sexuales en los moluscos bivalvos

2.1. Tipos de esteroides sexuales

En moluscos bivalvos la presencia de los esteroides sexuales fue sugerida inicialmente por Steidle (1930) y más tarde confirmada por Hagerman et al. (1957). De igual forma la existencia de un metabolismo esteroidal y mecanismo de acción hormonal ha sido señalado en varias especies de moluscos bivalvos como; Mytilus edulis (Reis-Henriques and Coimbra 1990), Mya arenaria (Siah et al. 2002), Patinopecten yessoensis y

Crassostrea gigas (Matsumoto et al. 1997). En la mayoría de estas especies se ha reportado la presencia de estrógenos, andrógenos y progestinas (Fernandes et al. 2010).

Los primeros corresponden a estrona (E1), 17β-estradiol (E2) y estriol (E3) (Reis-

Henriquez and Coimbra 1990; Gauthier-Clerc et al. 2006; Matsumoto et al. 1997), respectivamente. Los andrógenos incluyen a la testosterona (T), 11-keto-testosterona

(11KT), 5α-dehidrotestosterona, androstenediona (ADD) y dehidroepiandrosterona

(DHEA) (Gauthier-Clerc et al. 2006; Ketata et al. 2007; Fernandes et al. 2010). Las progestinas corresponden a pregnenolona, 17α-hidroxipregnenolona, progesterona y

17α-hidroxiprogesterona (Reis-Henríquez and Coimbra 1990; Fernandes et al. 2010;

Siah et al 2002).

Entre las enzimas que participan en el metabolismo esteroidal está la 17β- hidroxiesteroide deshidrogenasa 17HSD (Le Curieux-Belfond et al. 2001; Mori et al.

1966), 3β-hidroxiesteroide deshidrogenasa 3HSD, 5α-reductasa y citocromo P450 aromatasa (Fernandes et al. 2010; Osada et al. 2004). También, se ha descrito la presencia del receptor de estrógeno en el ostión P. magellanicus (Wang and Croll 2007) y en la ostra C. gigas (Matsumoto et al. 2007). Se ha demostrado que los esteroides sexuales pueden ser bloqueados por moléculas análogas que actúan como antagonistas de los receptores en vertebrados; por ejemplo, se ha señalado que el tamoxifeno es antagonista del estradiol, la flutamina es antagonista de la testosterona y el RU486 es antagonista de la progesterona (Wang 2000; Le Curiex-Belfond et al. 2001).

2.2. Función de los esteroides sexuales en la reproducción

Al respecto, se ha mencionado que los esteroides sexuales de los invertebrados estarían regulando varios aspectos de la reproducción y diferenciación sexual tal como acontece en los vertebrados (Croll and Wang 2007). Existe evidencia que indica que los esteroides sexuales están controlando los procesos reproductivos de la gametogénesis, vitelogénesis, maduración sexual y desove en moluscos bivalvos (Croll and Wang

2007). Varios estudios señalan que los estrógenos son más abundantes en las hembras mientras que los andrógenos son más abundantes en los machos, sugiriendo su potencial función en la reproducción (Wang and Croll 2007). Este rol reproductivo también ha 7

sido referido por el sitio de síntesis de los esteroides, y en varios moluscos se ha señalado a la gónada y glándula digestiva (hepatopáncreas) como los principales

órganos donde se producen los esteroides sexuales (Varaksina and Varaksin 1988).

Las fluctuaciones de los niveles de esteroides sexuales se han correlacionado con el ciclo de maduración sexual en varias especies de bivalvos (Gauthier-Clerc et al. 2006;

Matsumoto et al. 1997). Por ejemplo, el esteroide 17β-estradiol estimula la vitelogénesis y liberación de gametos en Pecten yessoensis (Osada et al. 2004; Wang and Croll 2006, 2007), estimula la gametogénesis en Mytilus galloprovincialis (Janer et al. 2004) y regula la producción de catecolaminas y prostanglandinas en P. yessoesis

(Matsumoto et al. 1997). Moss (1989) indica que la metiltestosterona en almejas acelera la maduración sexual e incrementa la frecuencia de desove. Wang and Croll (2007) indican que la testosterona y progesterona en M. yessoensis estimulan la espermatogenésis, gametogénesis y liberación de gametos en individuos machos.

2.3. Función de los esteroides sexuales en la diferenciación sexual

También existe evidencia que indica que la diferenciación sexual de los bivalvos puede ser modulada por los esteroides sexuales. Mori et al. (1966) señalan que el suministro de estradiol a una temprana etapa de maduración gonádica de C. gigas induce la reversión sexual de machos a hembras. Moss (1989) demostró que el suministro de 8

metil-testosterona en Mulinia lateralis recién desovadas produce un incremento en la razón macho/hembra de 0,8 a 1,6. Wang and Croll (2004) señalan que inyecciones de testosterona, progesterona y DHEA en el ostión Placopecten magellanicus generan un mayor número de organismos diferenciados y una mayor cantidad de individuos machos. Retamal (2003) demostró que juveniles de Choromytilus chorus expuestos durante 30 días al extracto de gónada masculina de C. chorus (como fuente de testosterona) diferenció una mayor cantidad de machos. Observaciones realizadas en juveniles de Mytilus chilensis, Mytilus galloprovincialis y C. chorus señalan que la exposición de estos organismos durante 30 días a testosterona se asocio con un incremento de machos (Ruiz 2010).

Cabe destacar, que a pesar que los resultados de las investigaciones sugieren que los esteroides sexuales pueden estar involucrados en la diferenciación sexual en moluscos, el conocimiento en esta área es bastante limitado, existe poco sustento estadístico en algunos casos, y los mecanismos moleculares para explicar estas diferencias son pocos claros. Al parecer algunos esteroides sexuales pueden tener acciones específicas a lo que acontece en moluscos, un poco diferente a lo que acontece en vertebrados. Por ejemplo, Wang and Croll (2004) señalan que el estradiol y dehidroepiandrosterona pueden estimular el crecimiento de los ovocitos y que las inyecciones con testosterona pueden generar una especie de atresia en algunos ovocitos en la gónada de juveniles hembras de Placopecten magellanicus.

3. Citocromo P450 aromatasa

La enzima aromatasa es parte importante de un complejo enzimático, que incluye a la citocromo P450 aromatasa, la cual es producto del gen cyp19, y dependiente de

NADPH y citocromo P450 reductada. La aromatasa es una enzima microsomal localizada en el retículo endoplasmático liso de las células esteroidogénicas (Guiguen et al. 1999). Esta enzima cataliza la trasformación de testosterona en estradiol, un estrógeno principalmente de carácter femenino. La expresión y actividad de la aromatasa ovárica es fundamental para el desarrollo del ovario, la inactivación a través de inhibidores específicos de la aromatasa causan la transdiferenciación desde una gónada femenina a testículo en peces (Guiguen et al. 2010).

La modulación de la actividad de la enzima aromatasa ha sido fuertemente asociada con la reversión del sexo en varios organismos, fenómeno que ocurre naturalmente y como parte del ciclo de vida de numerosas especies de peces (Guiguen et al. 2010). Un bloqueo a nivel del gen o inhibición a través de inhibidores específicos de la actividad enzimática de la aromatasa causan la transdiferenciación desde una gónada femenina a un testículo (Guiguen et al. 2010), proceso observado en aves (Elbrecht and Smith

1992), reptiles (Dorizzi et al. 1994), anfibios (Yu et al. 1993) y peces (Guiguen et al.

1999).

En peces se utilizan los inhibidores de la aromatasa como una herramienta de aplicación biotecnológica para la producción de peces monosexo “todo macho” (Piferrer et al.

1994), cuyo efecto de masculinización se debe a que los inhibidores de la aromatasa disminuyen la expresión del gen cyp19 y por ende los niveles de estrógenos (Navarro et al. 2009; Bhandari et al. 2003). La presencia del gen cyp19, gen codificante de la aromatasa, no ha sido confirmada en los invertebrados. Sin embargo, la presencia de la enzima si ha sido demostrada mediante ensayos de inmunoreactividad, al igual que su función de convertir andrógenos (C19) a estrógenos (C18) (Fernandes et al. 2010; Le curiex-Belfond et al. 2001). Todos los estudios realizados con esta enzima han demostrado su función de catalizar la reacción de conversión de andrógenos a estrógenos, y su actividad enzimática ha sido correlacionada con el ciclo reproductivo

(Matumoto et al. 1997).

No obstante, su mecanismo de acción ha sido poco estudiado en este grupo y su posible función en la diferenciación del sexo no ha sido investigada aún. Sin embargo, existe literatura que sustentaría en cierto grado la hipótesis que la aromatasa podría tener un rol fundamental en el proceso de diferenciación sexual de los invertebrados, por ejemplo, Gust et al. (2010) encontró que el fadrozol (inhibidor de la citocromo P450 aromatasa) en el gastrópodo Potamopyrgus antipodarum disminuye los niveles de 17β- estradiol. Asimismo, Oberdorster et al. (2000) señala que el compuesto TBT (Tributil estaño), aditivo empleado en pinturas anti-incrustante de embarcaciones y boyas,

produce un efecto de masculinización (imposexo) en hembras de gastrópodos al inhibir la actividad de la aromatasa. La mayoría de las investigaciones realizadas en moluscos con compuestos anti-estrogénicos están invariablemente asociadas a un proceso de masculinización, y señalan a la aromatasa como un elemento clave en este proceso

(Oberdörster et al. 1998; Ruiz et al. 2010).

4. Modelo biológico

La diversidad específica de moluscos bivalvos presente en las costas de Chile provee un amplio campo para hacer estudios experimentales acerca de la diferenciación sexual y biología reproductiva de estas especies, específicamente, para hacer investigaciones acerca de los mecanismos moleculares-endocrinos involucrados en estos dos aspectos, los cuales son bastantes desconocidos en este grupo. Los mitílidos (Mytilidae), conocidos como mejillones o choros, son un grupo de bivalvos de gran importancia ecológica y económica en Chile, principalmente, las especies Mytilus chilensis,

Choromytilus chorus y Aulacomya ater (Moreno 1995; Aldea and Valdovinos 2005;

Tarifeño et al. 2012). Estos mejillones representan el 53.2% de la producción acuícola total a nivel nacional (Sernapesca 2015): M. chilensis con el 51.8% (238,827 ton.) seguido por A. ater (4.519 ton.) con 0.98% y C. chorus con 0.48% (2.089 ton.), con explotaciones concentradas en el sur de Chile (40°S).

Entre estos mejillones se destaca C. chorus, el cual se distribuye desde Callao Perú

(latitude 10°S) hasta el estrecho de Magallanes y el Canal Beagle en el Pacífico Sur

(latitude 54°S), (Osorio 2002), con una distribución batimétrica comprendida sobre los

3 hasta los 20 metros de profundidad (Zagal and Hermosilla 2001). C. chorus ha sido explotado desde tiempos pre-colombinos, como una especie nativa de interés comercial; sin embargo, la fuerte presión extractiva ejercida sobre este recurso resulto inicialmente en la sobre-explotación de bancos naturales en 1940, y su recuperación solo fue posible a través de la implementación de medidas restrictivas, y a la imposición de tallas mínimas de captura (Olave 2003).

En la costa norte de Chile el restablecimiento de este mejillón ha sido exitoso, sin embargo, el régimen de administración de esta pesquería esta basado sobre medidas regulatorias de parámetros biológicos de C. chorus obtenidas de poblaciones del Sur de

Chile (Avendaño and Cantillánez 2011). Por lo cual, estos parámetros (proporción sexual, diferenciación sexual y talla de primera madurez sexual) necesitan ser validados para poblaciones que habitan en la costa norte porque sus sistemas ecológicos difieren entre latitudes norte y sur, y subsecuentemente, los parámetros reproductivos de esta especie, semejante a la talla de diferenciación sexual, proproción sexual y talla de primera madurez sexual, pueden variar entre regiones.

C. chorus tiene una coloración de la gónada bastante particular, siendo la femenina de color café oscura y la masculina crema-amarillenta, esta condición particular de la coloración gonadal permitiría separar poblaciones machos de hembras para la obtención de poblaciones “todo macho, ya que en las plantas de procesos se rechazan las hembras porque la coloración café que no es atractiva para el consumidor, que selecciona consistentemente a los machos. Además, la inexistencia de un dimorfismo sexual externo en esta especie impide visualizar fenotípicamente el sexo y sólo es posible distiguirlo a través de su disección (Tarifeño 2005-2008). Esto trae consigo pérdidas del

50% de la producción para los cultivadores de este recurso, ya que la proporción sexual es 1:1.

Es por esto, que el conocimiento del proceso diferenciación sexual en este mejillón, a través del estudio de la función de los esteroides sexuales y citocromo P450 aromatasa en la diferenciación sexual, no sólo aportaría al conocimiento acerca de los mecanismos moleculares-endocrinos involucrados en la diferenciación del sexo en los moluscos bivalvos, sino que podría tener un enorme potencial de aplicación en la acuicultura del bivalvo C. chorus, para la producción de individuos machos. Especialmente, si el sexo de estos animales es manipulado en etapas tempranas del desarrollo ontogenético, para producir individuos machos de buena calidad (o sexo favorable) para su comercializacion, de modo de fomentar y así potenciar el cultivo de este mejillón en

Chile y diversificar el mercado de los mitílidos en nuestro país, cuyo único mitílido de exportación es Mytilus chilensis.

En este contexto, en este estudió se desarrollaron 2 capítulos. En el capítulo I se desarrolló el objetivo I de la tesis, en el cual se describieron por primera vez algunos parámetros biológicos-reproductivos (proporción sexual, talla de diferenciación sexual y talla de primera madurez sexual) del mejillón C chorus en la costa norte de Chile

(latitude 24°S), para ayudar a implementar medidas de manejo sustentable de este recurso en el norte de Chile y como fuente de información básica para desarrollar el objetivo central de esta tesis (objetivo II). En el capítulo II (objetivo II de la tesis) se determinó la función de los esteroides sexuales y citocromo P450 aromatasa (Cyp19) en la diferenciación sexual temprana de juveniles del mejillón C. chorus (Capítulo II de la tesis Parte A). Asimismo, este capítulo fue complementado con la estandarización de un protocolo para la detección de la citocromo P450 aromatasa en el mejillón C. chorus

(Capítulo II de la tesis Parte B).

En el presente estudio también se incluyó un capítulo III, cuyo objetivo (objetivo III) fue seleccionar y validar genes de referencia como controles internos, también conocido como “genes housekeeping” (HKG) asociados a tejidos blancos implicados en aspectos básicos de biología en mejillones de C. chorus, como un primer paso para estudios de expresión de genes involucrados en la diferenciación sexual de este mejillón, específicamente, el gen cyp19. Los HKG se caracterizan por tener niveles de expresión que no varían independiente del tratamiento experimental en la cual la muestra biológica está sujeta o etapa de desarrollo de la célula o tejido (Eisenberg and Levanon

2013).

OBJETIVOS

A. Objetivo general:

Evaluar la función de los esteroides sexuales en la diferenciación sexual temprana de juveniles del mejillón Choromytilus chorus, y seleccionar genes de referencia como control interno para para futuros estudios de la expresión del gen de la citocromo P450 aromatasa (CYP; P450AROM) en tejidos de este mejillón.

B. Objetivos específicos:

1. Realizar una descripción detallada de los parámetros biológicos-reproductivos

(proporción sexual, talla de diferenciación sexual, talla de primera madurez y funcionalidad de gametos) del mejillón Choromytilus chorus en la costa de Antofagasta, basándose en análisis histológicos e inspección visual de los tejidos manto-gónada.

2. Evaluar la función de los esteroides sexuales en la diferenciación sexual temprana de juveniles del mejillón C. chorus, y determinar la viabilidad y calidad gonadal de los individuos sometidos a reversión sexual.

3.- Seleccionar y validar genes de referencia asociados a tejidos blancos implicados en aspectos básicos de biología en mejillones de C. chorus, como un primer paso para

estudios de expresión de genes involucrados en la reproducción, desarrollo ontogenético y diferenciación sexual de este mejillón.

HIPÓTESIS

H1: Los estrógenos influyen en la diferenciación de la gónada femenina en estadíos juveniles previos a la diferenciación morfológica del sexo en el mejillón Choromytilus chorus.

H2: Los andrógenos influyen en la diferenciación de la gónada masculina en estadíos juveniles previos a la diferenciación morfológica del sexo en el mejillón Choromytilus chorus.

CAPITULO I

Diferenciación sexual y talla de primera madurez del mejillón Choromytilus chorus (Molina, 1782) (Mollusca, Mytilidae) en el norte de Chile

Sexual differentiation and size at first maturity of the mussel Choromytilus chorus (Molina, 1782) (Mollusca, Mytilidae) in northern Chile.

Abstract

The mussel Choromytilus chorus is a commercially and ecologically important bivalve, which is extensively distributed along the Chilean coast (20°S–54°S). However, there are no previous studies regarding the reproductive aspects of this species in the northern part of its range. For what, mussels were collected at Caleta Errázuriz, along the Antofagasta coast (ca. 24°S), between December 2014 and June 2015. Total samples of 1620 individuals were examined using histological techniques and macroscopic visual inspection. Seventeen size categories, which included individuals from 5 mm to 100 mm in length, were analyzed. The size at the onset of sexual differentiation and the size at first sexual maturity (50% mature individuals) were determined. The results shows of the total sample, 49% were males and 51% were females. Mussels from 5–22 mm in valve length were undifferentiated and from 22–24 mm were sexually differentiated. The size at first sexual maturity was recorded as 38–40 mm. In vitro fertilization trials demonstrated that sexually differentiated individuals were able to produce viable gametes. The biological parameters analyzed for C. chorus were similar to those recorded for populations of this bivalve from the southern latitudes. However, the lower number of eggs per female and the smaller egg size suggests that the population parameters may be different for C. chorus between the northern and southern latitudes.

Key-words: maturity size, sex ratio, fertilization, gonad, eggs, bivalve.

1. Introduction

Mussels (Mytilidae) are a group of bivalves of great ecological (Duarte et al. 2006;

Sepúlveda et al. 2015) and economic importance in Chile (Winter et al. 1984), particularly the species Mytilus chilensis, Choromytilus chorus and Aulacomya ater

(Moreno 1995, Aldea and Valdovinos 2005, Tarifeño et al. 2012, Carrasco et al. 2014).

These mollusks represent 53.2% of the total aquaculture production at the national level

(SERNAPESCA 2014): M. chilensis with 51.8% (238,827 tons) followed by A. ater

(4,519 tons) with 0.98% and C. chorus with 0.48% (2,089 tons), with exploitation concentrated between the parallels 40°13' and 44°3' south in the Lakes Region (99.7% of the total mussel harvest in 2011). The national Chilean mussel production is 95% based upon the cultivation of Mytilus chilensis (SERNAPESCA 2014), and these amounts represent 13,5% of the global aquaculture production in 2012 (FAO 2014).

Choromytilus chorus is distributed from Callao, Peru (10°S) to the Strait of Magellan and the Beagle Channel in the southeastern Pacific (54°S) , up to the southern coast of

Brazil in the Atlantic (Osorio 2002), and over a bathymetric range from 3 to 20 meters deep, associated primarily with rocky substrates and sand banks (Zagal and Hermosilla

2001). C. chorus has been exploited since pre-Colombian times (Gorriti 1998), as have several native species of commercial interest; however, the strong extractive pressure exerted on this resource resulted in the early overexploitation of the natural beds in the 21

1940s, and its recovery was only possible through the implementation of a restrictive management plan (Olave 2003) and the imposition of bans and minimum capture sizes

(10.5 cm). Thus, due to the decrease in natural populations of this mussel (Ávila et al.

1994), it has been cultured in the south of Chile (40°S) since 1983 (SERNAPESCA

1983).

Until the year 1998, there were no records of landing of this species north of 29ºS

(Bellolio et al. 1996), although the archaeological record shows that this species was commercially important in the past (Ramorino 1974), and it was an important component of the diet of pre-Hispanic coastal communities (Gorriti 1998). The decrease or disappearance of this resource from northern Chile (Avendaño and Cantillánez 2011) seems to be related to changes in coastal water bodies. Specifically, the “El Niño” condition has been reported as a possible cause of this disappearance, given its status as cold-water species (Díaz and Ortlieb 1992). However, since 1999, this mussel has been recorded in commercial fishing, with a landing of one ton on the coasts of Atacama

(27º04'S) and Antofagasta (23º37'S) in that year (SERNAPESCA 1999–2008) and a landing of 204 tons recorded in 2004 between 18°S and 24°S (SERNAPESCA 2014).

Additionally, the collection of Choromytilus chorus seeds in suspended collectors in

Caleta Errazuriz and Caleta Punta Arenas (Antofagasta coast, 24°S) also reveal the successful re-establishment of this species in northern Chile (Avendaño and Cantillánez

2011, 2012, Avendaño et al. 2016).

This resource has several advantages for cultivation, such as: i) the possibility of cultivation along the Chilean coast due to its extensive distribution from Callao, Peru to the Straits of Magellan, Chile (Osorio et al. 1979); ii) large body mass, can reach maximum size of 20 cm valve length which is ideal for the market (Guzman et al.

1998); iii) documented embryonic and larval development in a controlled environment

(Toledo et al. 1990) iv) high rates of growth during its first year of life (Osorio et al.

1979); v) first sexual maturity at six months of age (Lépez et al. 1981), where the color of the gonad of the female is dark brown and the male is cream-yellow. Nevertheless, most of these parameters have been determined in natural populations of Choromytilus chorus from southern Chile and northern populations remain largely understudied.

In addition, although reestablishment natural of the mussel Choromytilus chorus along the northern coast of Chile has been successful (Avendaño and Cantillanez 2011), the fishery is governed by regulations implemented based on biological population parameters of C. chorus from the south of Chile (Avendaño and Cantillánez 2011).

Biological information on the mussel Choromytilus chorus from the northern Chilean coast (24°S) it is crucial to implement a sustainable fishery management plan for this resource, however, these parameters need to be validated for populations inhabiting the northern coast because ecological systems differ between the northern and southern latitudes (Thiel et al. 2007, Fernández et al. 2010), and consequently, reproductive parameters of this species, such as the size at differentiation and the size at first sexual maturity, may vary between regions. In addition, the absence of knowledge regarding

the ontogenetic cycle of C. chorus in northern Chile threatens the sustainability of this resource because their shallow distribution promotes the easy removal by shellfish divers, putting at serious risk their permanence, considering that their vertical distribution ranges from 4 to 20 meters (Avendaño and Cantillánez 2011).

In this context, this study describes, for the first time, biological and reproductive parameters, such as the sex ratio, size at sexual differentiation, size at first maturity, and functionality of gametes, of the mussel Choromytilus chorus inhabiting the northern coast of Chile (ca. 24°S), with the aim of helping to implement measures that will ensure sustainable management of this resource in northern Chile.

2. Materials and methods

2.1. Sampling

From December 2014 to June 2015, 1620 individuals (adults and juveniles) of

Choromytilus chorus were collected at Caleta Errazuriz, Santa María Island, in the region of Antofagasta, Chile (23°24'S, 70°35'W). Live mussels were transported to the laboratory (University of Antofagasta, Chile) in cold conditions; specimens were subsequently cleaned of epibionts and detritus and were maintained at 18–20°C in 50 L glass fiber tanks with natural sea water circulated through a 1 µm filter. The mussels were acclimatized to laboratory conditions for 2 weeks after each collection from the 24

field. Specimens were then used to determine the i) relative proportion of genders, ii) size at first sexual differentiation, iii) size at first sexual maturity, and iv) functionality of gametes through visual inspection under a binocular magnifying glass and verification using smears, histological sections and fertilization experiments.

2.2. Sex ratio

A visual inspection of 500 adults of Choromytilus chorus ranging from 40 to 100 mm in valve length was conducted. These specimens were dissected and sexed by observing the color of the mantle-gonad using a binocular magnifying glass. Males were identified by a gonad with a cream-yellow color, and females were identified by gonads with a brown coloration. In addition, sex was verified by examining a gonadal smear under an optical microscope identifying oocytes and sperm from females and males, respectively.

2.3. Sexual differentiation

The total length of each mussel was measured (Lt, the distance between the umbo and the opposite edge) using a Vernier caliper (±0.1 mm). For histological analysis, a subset of mussels was selected (N=130) from individuals between 5 and 40 mm maximum valvar length. Individuals less than 20 mm were fixed whole, whereas for specimens greater than or equal to 24 mm, only the mantle-gonad tissue was fixed.

The whole specimens and mantle tissues were placed in histological cassettes and subsequently fixed in a solution of 10% formalin in sea water for 48 hr. The samples were then dehydrated by immersion for one hour each in alcohols of increasing concentration (70, 80, 95, and 100%), and benzol. The samples were embedded in paraffin, and a series of 5 µm cuts were made with a microtome in the transverse plane of the mantle tissue. The serial sections, representative of each plane, were then stained with hematoxylin and eosin and observed under an optical microscope.

2.4. Sexual maturity stages

The determination of the stages of sexual maturity followed the macroscopic visual methodology proposed by Tarifeño (2005–2008) and the histological approach suggested by Kissner and Kroeck (2005). The macroscopic original scale was modified to include a fifth state of maturity. This methodology was based on the area occupied by the gonad lobe in the mantle cavity and the thickness and the gonad color, recognizing the following stages: (0) immature individuals, characterized by a transparent mantle without the development of germ cells, (1) early maturity, an incipient gonad follicle development stage in which gonad coloration is tenuous and sparsely distributed within the mantle, (2) medium maturity, with a developed gonad occupying two-thirds of the mantle tissue, (3) advanced maturity, with a developed gonad occupying more than two- thirds of the mantle tissue, (4) complete maturity, with a fully developed gonad covering the whole mantle, and (5) spawned stage, female and male gametes are 26

released into the environment, it begins with a rapid resorption of the gonad through of the mantle tissue, and at the end this stage the mantle again adopts a transparent appearance.

For the histological sections, the maturity stages were determined using the microscopic maturity scale proposed by Kissner and Kroeck (2005). This scale includes seven stages categorized according to the cell types of the gametogenic series, the size and shape of the follicles, and the abundance of the tissue reserves, vesicular cells (V) and adipogranular (ADG) cells present in the connective tissue of the mantle.

2.5. Success of fertilization of the gametes of Choromytilus chorus

The success of fertilization of the gametes of Choromytilus chorus was used to determine whether the gonads of newly sexually differentiated animals exhibited functional gametes, able to be fertilized and become embryos and veliger larvae. The gametes were obtained by the stripping technique (scraping the gonad) because the thermal shock technique (Lépez 2005) was unsuccessful. Twenty individuals of C. chorus were randomly selected within each of the following size ranges: 22–24, 26–28,

30–32, 34–36, and 38–40 mm. For each size, female and male gametes were obtained independently for fertilizations. However, prior to fertilization fecundity of the females of each range of size was estimated. Subsequently, the gametes were maintained for 20

minutes for hydration and activation (Ruiz et al. 2008), and then, in vitro fertilization was carried out, mixing eggs and sperm in a ratio of 1:100. In addition, the oocyte sizes and the number of viable oocytes (spherical, not deformed) were recorded for each size range.

The embryos were consecutively deposited in 1 L beakers of sea water (filtered at 0.5

µm), over 48 h with 3 replicates for each size range, and development was followed until reaching the veliger D larval stage. Periodic samplings were conducted for 48 hours under the optical microscope to record the embryonic stages and the formation of

D-stage larvae, using the morphological characteristics of embryonic stages described for Choromytilus chorus by Toledo et al. (1990). The limits of a phase were defined when 50% of the sample showed successful attainment of a specific phase. At 48 hours post-fertilization and at the veliger D larval stage, 30 larvae were randomly selected from each replicate and size range, fixed in Lugol’s solution and measured with an ocular micrometer (10x). Following the methodology of Ramorino and Campos (1983) and Rojas (2004), the maximum length (L) was defined as the long shell axis parallel to the hinge. In addition, the numbers of total and normal veliger larvae were recorded for each size range.

2.6. Determination of the size at first sexual maturity

The calculation of the size of first sexual maturity is based on the methodology proposed by Kissner and Kroeck (2005) with some modifications used for other species

(Cruz and Villalobos 1993, Bigatti et al. 2005). The size of first sexual maturity corresponds to the size at which 50% of the sampled females are under gonadal development of full maturity (equivalent to a sexual maturity stage 2). We consider the females in full maturity because at this stage they present a large number of oocytes that have reached maximum development (oocytes vitelogenics), and its maximum size prior spawning. For this calculation, 80 individuals of each size range (from 18–20 mm to 78–100 mm) were examined through microscopic inspection in tissue mantle-gonad.

2.7. Statistical analysis

A Chi-square test was used to determine whether the sex ratio was 1:1 (Zar 1996).

Kruskal-Wallis analyses were used to evaluate the differences in oocyte sizes and the length of veliger D larvae among the size ranges. The analyses were performed using

Minitab and Statistica software.

3. Results

3.1. Sex ratio

All specimens (N= 1,620) were dioecious; no individuals were hermaphrodites. Forty- nine percent of the individuals were males, and 51% were females. There were no significant differences in the sex ratio (P>0.05; Chi-square test).

3.2. Sexual differentiation

The shell length of the mussels (N= 1620) ranged between 5 and 100 mm maximum length throughout the entire period. Individuals ≤ 22 mm did not show gonad development since they were only characterized by the presence of a thin, translucent mantle formed by connective vesicular connective tissue (VCT).

The sex of the mussel Choromytilus chorus was distinguishable by macroscopic view above 22–24 mm maximum length. The lowest percentage of sexually differentiated animals was recorded in the 22–24 mm size range (18%), with gonads characterized by

a pale brown color in the females (Fig. 1) and a cream-yellow color in the males (Fig.

2). The number of differentiated mussels increased with size, for example, in the size range 30–32 only 60% of individuals sampled were differentiated, while in the ranges ≥

50–52 mm 100% of animals were differentiated (Table 1).

3.3. Histological analysis

The undifferentiated animals (≤ 18 mm maximum lengths) were characterized by a transparent mantle tissue without development of gonad follicles. At the 18–20 mm size range, individuals were observed with collapsed and empty acini containing stem cells, without developing gametes, and sex was undetermined. At this stage, only vesicular connective tissue (VCT) cells and adipogranular (ADG) cells were observed in the mantle.

In the 22–24 mm mussels, individuals were observed with clearly distinguishable either female or male germ cells, primarily in the multiplicative phase. The male mussels showed a large quantity of stem cells and spermatogonia, which quickly differentiated into primary and secondary spermatocytes and a small number of sperm. In females, oogenesis was observed within gonadal follicles with a large quantity of VCT cells and

a low proportion of mature oocytes; furthermore, VCT and ADG cells were dispersed throughout the entire mantle (Figs. 3–4).

In the subsequent larger size ranges, specifically over 34–36 mm maximum length, a remarkable increase in the number of mature oocytes and sperm and a decrease in VCT and ADG cells were observed (Figs. 3–4).

3.4. Sexual maturity

Over the entire study period (December 2014-June 2015) more than 50% of the mussels showed a medium to advanced maturity stage, with a developed gonad occupying at least two-thirds of the mantle tissue (Fig. 5). In the 18–20 mm size range, 100% of individuals were undifferentiated. In the 22–24 mm size range, 18% of individuals were differentiated with incipient maturity (stage 1), and gonadal development was in the early stage of gametogenesis. A high proportion of individuals in the 42–44 mm size range showed advanced stages of maturity (stages 3–4).

3.5. Size at first sexual maturity

First sexual maturity in the population of Choromytilus chorus from northern Chile was reached at the 38–40 mm size range (Table 1).

3.6. Success of fertilization of the gametes of Choromytilus chorus

In this study, fertility was estimated at 7.7–9.6 thousand oocytes per individual in the

38–40 mm size range. The other size ranges were much lower than estimated; 1.0–1.4 thousand oocytes in the 22–24 mm, 1.6–1.8 thousand oocytes in the 26–28 mm, 3.5–5.8 thousand oocytes in the 30–32 mm, 4.1–5.7 thousand oocytes in the 34–36.

The mussels of size ranges 22–24, 26–28, 30–32, 34–36, and 38–40 mm did not show differences in the morphological characteristics of the embryos or veliger D larvae at a temperature of 17–19 °C. However, the oocyte sizes were significantly different among the different valve size ranges tested (Kruskal-Wallis; P ≤0.05), documenting an effect of parent size on oocytes size; the mussels of size ranges 22–24 and 26–28 mm exhibited smaller oocytes (58.57±2.9 and 58.44±3.10 µm, respectively), whereas parents in the 34–36 and 38–40 mm size ranges developed larger diameter oocytes

(61.20±3.19 and 61.26±2.85 µm, respectively) (Table 2). Additionally, smaller mussels produced a lower number of oocytes than larger mussels; 22–24 mm mussels produced a mean of 18,500 (±3,000) oocytes, whereas 38–40 mm mussels produced a mean of

83,653 (±7,727) oocytes.

In all experiments, embryonic development began with the formation of a zygote 5 minutes after fertilization (Fig. 6). Meiosis then occurred with the formation and release

of the first and second polar bodies. After 40 minutes, the first mitotic event (first cell division) began, and multiple consecutive cleavages were observed. After 3–4 hours post-fertilization, the morula, blastula, and gastrula stages were observed, and at 24 hours, the trochophore larvae emerged. At 47–48 hours post-fertilization, the veliger D larvae were observed in all experiments (Fig. 6); mussels of 38–40 mm produced the highest number of veliger larvae (58,000 ±7,722), and mussels of 22–24 mm produced the lowest number of veliger larvae (8,044±388.73). This same pattern was observed for the number of normal larvae produced in these two size ranges (1,111±388.73 and

27,305±1,367, respectively).

All cultured veliger larvae developed successfully (Table 2, Fig. 6). However, the veliger larvae from smaller mussels (22–24 and 26–28 mm) were significantly smaller than the larvae produced by larger mussels (Kruskal-Wallis; P ≤0.05), documenting an effect of parent size on larvae size (Table 2). Additionally, a high percentage of deformed (abnormal) embryos and veliger D larvae were observed in all five size ranges, but the proportion decreased with increasing parent size. The most significant deformations included alterations in the number of cleavages within embryos and alterations in the curvature of the hinge and the asymmetry of the valves.

4. Discussion

4.1. Effect on gonadal development in mussels

There were no significant differences in dry weights and valval maximum length of C. chorus, this matchs with that observed by Wang and Croll (2004) in the scallop

Placopecten magellanicus. In contrast, Unuma et al. (1999) recorded that sex steroids androstenedione and estrone significantly affected the average gonadal index and increased weight in male individuals of the sea urchin Pseudocentrotus depressus, when accelerating the gametogenesis processes. In mussels, the weight fluctuations of the individuals are mainly attributed to the gonadal tissue weight, as this is the main organ that varies throughout the reproductive cycle by 60% (Varaksina and Varaksin 1991).

However, in this study an incipient stage of sexual maturity (1-2) was observed in all experimental groups and thus a low weight of gonadal tissue in mussels.

Sex steroids and fadrozole had not significant effect on the differentiation rate (gonadal development) of C. chorus as similar number of undifferentiating of C. chorus specimens were recorded in treatments and control group. These results are not consistent with observations from previous studies, which have suggested that sex steroids stimulate the morphological differentiation in bivalves (Wang and Croll 2004).

The effect could be caused by the action that sex steroids have on gonads metabolism, as they regulate the main metabolic pathways of the glycogen, proteins and lipids in bivalves (Mathieu et al. 1991; Varaksina and Varaksin 1991; Varaksina et al. 1992;

Wang and Croll 2004). In this context, it has been noted that estradiol may stimulate glycogenolysis and lipidogénesis when regulates the activity of the enzyme glucose-6- phosphate dehydrogenase and malate dehydrogenase in molluscs (Mori 1966; Mori et al. 1972). E2 stimulates vitellogenesis in P. yessoensus; one of the main events involved in gonad development (Osada et al. 2004; Wang and Croll 2006, 2007).

4.2. Effect of sex steroids on sexual differentiation

Early studies have indicated the possible function of sex steroids in sexual differentiation in bivalve mollusks (Moss, 1989). In this study, significantly more males than females of C. chorus were established in treatments with dihydrotestesterone androgen and more females in treatment with 17β-estradiol estrogen, compared to the control group. The exposure to 17β-estradiol, resulted in more females, which is consistent with that reported by Mori et al. (1966) who showed that the estradiol injection in oysters seems to induce sex reversal from males to females but differs from that found by Wang and Croll (2004), who found that the 17β-estradiol has a masculinizing effect in the scallop Placopecten magellanicus. Also, it has been observed that androgens are involved in gamete release in P. magellanicus males and

E2 is involved in the release of oocytes in females of this bivalve (Wang 2000; Wang and Croll 2003).

In contrast, the exposure to dihydrotestesterone androgen resulted in more males. These findings are consistent with results of previous experiments in molluscs and vertebrates, and have pointed out that dihydrotestosterone, testosterone and androstenedione, have an androgenic effect in bivalves (Varaksina et al. 1992; Wang and Croll 2004, 2007).

Moss (1989) showed that the supply of methyl-testosterone in Mulinia lateralis newly spawned produces an increase in the sex ratio (male/female) of 0.8 to 1.6. Likewise,

Wang and Croll (2004) indicated that the administration of androgens, testosterone and dehydroepiandrosterone in early juveniles of P. magellanicus differentiated a greater number of males. The exposure to DF and F treatments had no significant effect on masculinizing of C. chorus unlike reported in fish, where the supply of aromatase inhibitors causes masculinization (Guillen et al. 2010).

Androgenic (masculinizing) could be caused by two possible mechanisms in C. chorus.

First, the exposure to the non-aromatizable androgen dihydrotestosterone induces the development of the male gonad. It has been mentioned that androgens besides binding to their receptors and activating these nuclear transcription factors that control the expression of genes involved in spermatogenesis, may also act through the inhibition of the expression of cyp19 gene (gene encoding aromatase) and subsequently estrogen synthesis (Yeh et al. 2003; Bhandari et al. 2006). Also, androgen treatments (11-

ketotestosterone or 17α-methyltestosterone) in fishes have shown to induce a sex change in Epinephelus merra (Bhandari et al. 2003) by the suppression of cyp19 gene and decrease the estrogen levels during sex reversal from female to male (Yeh et al.

2003;. Bhandari et al. 2006).

Although in this study the inhibition of the enzymatic activity of aromatase through fadrozole treatments (T3-F, T4-DF) had no significant effect on the masculinization of

C. chorus, its action was the sex reversal towards male sex. Fadrozole is a competitive inhibitor non-steroidal that alters steroidogenesis (by decreasing the estrogen synthesis) and reproduction in vertebrates (Ankley et al. 2002). It should be noted that while there is a large phylogenetic distance among the tested species (fish and molluscs), the use of fadrozole has decreased the estrogen concentration and altered some reproductive parameters in the gastropod Potamopyrgus antipodarum (Gust et al. 2010), similar to that observed in fishes. However, the inhibition effect of the aromatase was lower in this gastropod and in the mussel C. chorus than observed in fishes, which could be explained because fadrozol is a drug designed for human (vertebrates), and the binding site of aromatase in C. chorus can be divergent, decreasing fadrozol effect.

It should be noted that most research related to exposure to anti-estrogenic compounds in molluscs and fishes indicates that any suppression of the expression of cyp19 gene, inhibiting the enzymatic activity of aromatase, or a blockage of the estrogens receptivity

(e.g. tamoxifen) are invariably associated with a masculinization, process observed in 38

fishes (Guillen et al. 2000) and mollusks (Ruiz et al. 2010). However, more research are needed to understand the effect of aromatase inhibition on sexual differentiation in invertebrates, since this study would be the first approach made so far in an invertebrate.

4.3. Success of fertilization of the gametes

The steroid 17β-estradiol stimulated the size of differentiated oocytes; the diameter observed in this treatment was higher than that found in other groups and control at the same stage of gonadal development. Although in this study, the exposed individuals were juvenile C. chorus that subsequently were sexually differentiated, the diameter of oocytes from the 17β-estradiol treatment was quite close to that size observed in breeders of this mussel (Ruiz 2008). It was also noted that oocytes showed a cell disruption like atresia in exposures to DHT, DF and F; however, this was found in a low number of oocytes per individual. Wang and Croll (2004) observed a similar phenomenon in the female gonad of the juveniles exposed to androgen testosterone in P. magellanicus, and they attribute it to a treatment effect. However, in most cases, the gonads of the individuals exposed to sex reversal had a morphology, layout pattern and cellular components of the female and male gonadal follicles similar to the control group, which is consistent with histology made in C. chorus specimens of Antofagasta coast (ca. 24 ° S) (Ruiz et al. 2017).

Likewise, both male and female gametes from the animals subjected to sexual reversal were functional, since in all fertilization experiments the phases of the ontogenetic development, morphology of the embryos and development time were similar to the control group and described about this species (Toledo et al. 1990, Ruiz et al. 2017).

This is consistent with the observations of Takatsu et al. (2013), who exposed specimens of Oryzias latipes to high fadrozole concentrations, and obtained fertilized oocytes that developed post-fertilization into normal juveniles. However, they noted that the post-treatment specimens had nonfunctional sperm (without flagella), so they had to make the crossbreds after 2 months of performed treatments. They noted that it was due to a significant deficit of estrogen, which is necessary for the flagella morphogenesis of sperms. In this study, there were not atrophied sperms due to exposure to fadrozole or other masculinizing treatment.

5. Conclusion

In conclusion, our results strongly support the hypothesis that sex steroids play an important role in sexual differentiation in invertebrates, as happens in vertebrates. Sex steroids were involved in sexual differentiation (male: female ratio) of the mollusk C. chorus as has been observed in other bivalves and vertebrates; and could be a useful tool for sex modulation in early stages of its ontogenetic development, specifically, in juvenile stages, and also for environmental impact studies. However, more experiments are needed to clarify the questions concerning the manifestation of mediated sex by sex

steroids, especially, those that help to understand the inhibiting effect of cytochrome

P450 aromatase by using enzymic inhibitors, since this study is the first approach made so far in an invertebrate.

6. Acknowledgments

This study was funded by Doctoral Scholarship thesis in the industry (CONICYT). We thank to the company Santa Maria Spa. and the personnel, for their support in the fieldwork, and the aquaculture engineers Espiridion Montanares and Juan Morales. The fieldwork was done under a collection permit issued by the Ethics Committee of the

University of Antofagasta, Antofagasta, Chile.

7. Literature cited

Aldea C., and C. Valdovinos. 2005. Moluscos del intermareal del Centro-Sur de Chile (36°–38°S): Taxonomía y clave de identificación. Gayana Concepción 69: 364–396. [In Spanish] Ankley G., K. Kahl, K. Jensen, M. Hornung, E. Korte, E. Makynen, and R. Leino. 2002. Evaluation of the aromatase inhibitor Fadrozole in a short-term reproduction assay with the fathead Minnow (Pimephales promelas). Toxicological Sciences 67: 121-130. Bhandari R.K., M. Higa, H. Komuro, S. Nakamura, and M. Nakamura. (2003). Treatment with an aromatase inhibitor induces complete se change in the protogynous honeycomb grouper (Epinephelus merra). Fish Physiology and Biochemistry 28: 141- 142. Bhandari R.K., M..A. Alam, K. Soyano, and M. Nakamura. (2006). Induction of female to male sex change in the honeycomb grouper (Epinephelus merra) by 11- ketotestosterone treatments. Zoological Scientia 23: 65-69. Boticelli C.R., F.L. Hisaw, and H.H. Wotiz. (1961). Estrogens and progesterone in the sea urchin (Stronglyocentrotus franciscanus) and pecten (Pecten maximus). Procedimental Society Experimental Biology Medical 106: 887-889. Dorizzi M., N.L. Richard-Mercier, G. Desvages, M. Girondot, and C. Pieau. (1994). Masculinization of gonads by aromatase inhibitors in a turtle with temperature- dependent sex determination. Differentiation 58: 1-8. Elbrecht A., and R. Smith. (1992). Aromatase enzyme activity and sex determination in chickens. Science 255: 467-470. Janer G., R. Lavado, R. Thibaut, and C. Porte. (2004). Effects of 17β-estradiol exposure in the mussel Mytilus galloprovincialis. Marine Environmental Research 58: 443-446. Fernandes D., L. Barbara, and C. Porte. (2011). Biosynthesis and metabolism of steroids in molluscs. Journal of Steroid Biochemistry and Molecular Biology, 7pp. Gauthier-Clerc S., J. Pellerin, and J.C. Amiard. (2006). Estradiol-17β and testosterone concentrations in male and female Mya arenaria (Mollusca bivalvia) during the reproductive cycle. General and Comparative Endocrinology 145: 133-139. Guiguen Y., J. Baroiller, M. Ricordel, K. Iseki, O. McMeel, S. Martín, and A. Fostier. (1999). Involvement of Estrogens in the Process of Sex Differentiation in two Fish Species: The Rainbow Trout (Oncorhynchus mykiss) and a Tilapia (Oreochromis niloticus). Molecular Reproduction and Development 54: 154-162.

Guiguen Y. (2000). Implication of steroids in fish gonadal sex differentiation and sex inversion. Current Topics in Steroid Research 3: 127–143.

Howard A.W., and C.S. Smith. (1983). Histological techniques for marine bivalve mollusks. NOAA Technical Memorandum NMFS-F/NEC-25, Woods Hole.

Kisnner E., and M. Kroeck. (2005). Estimación de la talla de primera madurez sexual del mejillón, Mytilus edulis platensis (Mollusca: Bivalvia) en el Golfo San Matías. IBMP Serie Publicaciones IV, 21-44. Le Curieux-Belfond O., S. Moslemi, M. Mathieu, and G. Séralini. (2001). Androgen metabolism in oyster Crassostrea gigas: evidence for 17β-HSD activities and characterization of an aromatase-like activity inhibited by pharmacological compounds and a marine pollutant. The Journal of Steroid Biochemistry and Molecular Biology 78: 359-366. Le Curieux-Belfond O., B. Fievet, G. Séralini, and M. Mathieu. (2005). Short-term bioaccumulation, circulation and metabolism of estradiol-17h in the oyster Crassostrea gigas. Journal of Experimental Marine Biology and Ecology 325: 125-133. Lépez I. (2005). Biotecnología aplicada a la producción de choro zapato (Choromytilus chorus) para potenciar su cultivo en Chile. Proyecto Fondef. Universidad de Concepción, Concepción, Chile.

Li Q., M. Osada, T. Suzuki, and K. Mori. (1998). Changes in vitellin during oogenesis and effect of 17β-estradiol on vitellogenesis in the Pacific oyster Crassostrea gigas. Invertebrate Reproduction and Development 33: 87–93. Lozada E., J. Rolleri, and R. Yanez. (1971). Consideraciones biológicas de Choromytilus chorus en dos sustratos diferentes. Biología Pesquera 5: 61–108.

Mathieu M., I. Robbins, and P. Lubet. (1991). The neuroendocrinology of Mytilus edulis. Aquaculture 94: 213-223. 43

Matozzo V., and M. Marin (2008). Can 17β-estradiol induce vitellogenin-like proteins in the clam Tapes philippinarum?. Environmental Toxicology and Pharmacology 26: 38-44.

Matsumoto T., M. Osada, Y. Osawa, and K. Mori. (1997). Gonadal Estrogen Profile and Immunohistochemical Localization of Steroidogenic Enzymes in the Oyster and Scallop during Sexual Maturation. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 118: 811-817. Mori K., H. Tamate, and T. Imai. (1966). Histochemical study on the change of 17B- hydroxysteroid dehidrogenase activity in the oyster during the stages of sexual maturation and spawing. Tokoku Journal of Agricultural Research 17: 179-191. Mori K., T. Muramatsu, and Y. Nakamura. (1972). Effects of steroids on oyster: V. Acceleration of glycogenolysis in female Crassostrea gigas by estradiol-17h injection under natural conditions. Bulletin Japon Society Science Fisheries 38: 1185– 1189.

Moss S. (1989). Effects of exogenous androgens on growth, biochemical composition, and reproduction of the coot clam, Mulinia lateralis. Pacific Scientia 43, 200.

Osorio C. (2002). Moluscos marinos en Chile, especies de importancia económica. Guía para su identificación. Facultad de Ciencias, Universidad de Chile, Concepción, Chile.

Reis-Henriques M., and J. Coimbra. (1990). Variations in the levels of progesterone in Mytilus edulis during the annual reproductive cycle. Comparative Biochemical Physiology 95: 343-348. Ruiz M., E. Tarifeño, A. Llanos-Rivera, C. Padget, and B. Campos. (2008). Efecto de la temperatura en el desarrollo embrionario y larval del mejillón, Mytilus galloprovincialis (Lamarck, 1819). Revista de Biología Marina y Oceanografía 43: 51- 61. Ruiz M. (2010). Efecto de los esteroides sexuales en la diferenciación gonadal de los Mitílidos. Tesis para optar al título de Magíster en Ciencias con mención Zoología. Universidad de Concepción. Facultad de Ciencias Naturales y Oceanográficas. Departamento de Zoología. Concepción, Chile. 68pp.

Ruiz-Velásquez M., M. Zapata, M.T. González, D. Ordenes, and M. Escalona. (2017). Sexual differentiation and size at first maturity of the mussel Choromytilus chorus (Molina, 1782) (Mollusca, Bivalvia) in northern Chile. American Malacological Bulletin 35(1): 31-41.

Saavedra L., M. Maritza, V. Morin, and R. Quiñones. (2012). Induction of vitellogenin- like lipoproteins in the mussel Aulacomya ater under exposure to 17β-estradiol. Revista de Biología Marina y Oceanografía 47: 429-438.

Saliot A., and M. Barbier. (1971). Isolation of progesterone and several ketosteroids of the female part of the gonads of the scallop Pecten maximus. Biochimiecal 53: 265–266.

SERNAPESCA. 2015. Anuario Estadístico de Pesca. Servicio Nacional de Pesca, Valparaíso. 187pp.

Siah A., J. Pellerin, A. Benosman, J. Gagné, and J. Amiard. (2002). Seasonal gonad progesterone pattern in the soft-shell clam Mya arenaria. Comparative Biochemistry and Physiology - Part A: Molecular and Integrative Physiology 132: 499-511. Stefano G.B., P. Cadet, K. Mantione, J. Cho, D. Jones, and W. Zhu. (2003). Estrogen signaling at the cell surface coupled to nitric oxide release in Mytilus edulis nervous system. Endocrinology 144: 1234–1240. Takatsu K., K. Miyaoku, S. Roy, Y. Murono, T. Sago, H. Itagaki, M. Nakmura, and T. Tokumoto. (2013). Induction of Female-to-Male Sex Change in Adult Zebrafish by Aromatase Inhibitor Treatment. Nature 3, 3400.

Tarifeño E. (2005-2008). Producción a escala piloto de hembras de choro zapato con color gonadal modificado mediante técnicas biotecnológicas. Proyecto Fondef D05I10258. Universidad de Concepción, Concepción, Chile. Toledo P., G. Bellolio, and E. Dupré. (1990). Fecundación y desarrollo embrionario de Choromytilus chorus (Molina, 1782) (Bivalvia, Mytilidae). Revista de Biología Marina y Oceanografía 25: 47-57.

Unuma T., T. Yamamoto, and T. Akiyama. (1999). Effect of steroids on gonadal growth and gametogenesis in the juvenile Red Sea urchin Pseudocentrotus depressus. The Biological Bulletin 196: 199–204. Varaksina G.S., and A. Varaksin. (1991). Effects of estradiol, progesterone, and testosterone on oogenesis of yezo scallop. Biology Morya 3: 61– 68.

Varaksina G.S., A.A. Varaksin, and L.A. Maslennikova. (1992). The role of gonadal steroid hormones in the spermatogenesis of the scallop Mizuhopecten yessoensis. Biology Morya Marine Biology 1992: 77– 83. 45

Vizziano D., G. Randuineau, D. Baron, C. Cauty, and Y. Guiguen. (2007). Characterization of early molecular sex differentiation in rainbow trout, Oncorhynchus mykiss. Developmental Dynamics 236: 2198-2206. Wang C. (2000). Roles of sex steroids on reproduction of the sea scallop. PhD thesis. Department of Physiology and Biophysics. Dalhousie University, Halifax. 274 pp.

Wang C., and R. Croll. (2003). Effects of sex steroids on in vitro gamete release in the sea scallop, Placopecten magellanicus. Invertebrates Reproduction and Developmet 44: 89–100.

Wang C., and R.P. Croll. (2004). Effects of sex steroids on gonadal development and gender determination in the sea scallop, Placopecten magellanicus. Aquaculture 238: 483-498. Wang C., and R. Croll. (2006). Effects of sex steroids on spawning in the sea scallop, Placopecten magellanicus. Aquaculture 256: 423-432. Wang C., and R. Croll. (2007). Estrogen binding sites in the sea scallop: Characterization and possible involvement in reproductive regulation. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 148: 303- 313. Yeh S.L., Y. Chu, C. Kuo, Y. Ting, and C. Chang. (2003). 17 alpha-Methyltestosterone induced sex change in the unilateral ovariectomized protogynous orange-spotted grouper, Epinephelus coioides. Journal Fishery Society Taiwan 30: 91–100.

Yu N.W., C.Y. Hsu, H.H. Ku, L.T. Chang, and H.W. Li. (1993). Gonadal differentiation and secretions of estradiol and testosterone of the ovaries of Rana catesbeiana tadpoles treated with 4-hydroxyandrostenedione. Journal of experimental Zoology 265: 252-257. Zar J.H. (1996). Biostatistical analysis. Prentice-Hall, New Jersey. 663 pp.

ANNEX

CHAPTER I

Table 1. Sexual differentiation and size at first maturity of the mussel Choromytilus chorus. The last column corresponds to the estimation of the size at first sexual maturity in Choromytilus chorus by the method of 50% of individuals mature females.

Size range Percentage of Percentage of Percentage of Percentage of (mm) totally male female females in sexually differentiated differentiated state of sexual differentiated maturity ≥ 2

22-24 18 14 4 25

26-28 47 27 20 25

30-32 60 27 33 36.4

34-36 77 35 41 43.9

38-40 90 47 43 62.8

42-44 92 41 51 78.4

46-48 99 50 49 87.8

50-52 100 53 47 97.9

54-56 100 53 47 95.7

58-60 100 51 49 100

62-64 100 44 46 100

66-68 100 53 57 100

70-76 100 36 64 100

78-100 100 48 52 100

Table 2. Variables obtained in fertilization experiment in Choromytilus chorus. Size

range, oocyte size (n=30), number of oocytes (n=10), total number veliger larvae,

normal veliger larvae, length and high of veliger larvae (n=30). Each value represents

the mean ± standard deviation. Abbreviation: PD, prodissoconch.

Size range Oocyte Average Average Percent of larvae Length PD Height PD (I) of parents diameter number of number of normal by (I) (µm) (µm) (mm) (µm) oocytes larvae normal female delivered by generated by females females

22-24 58.57±2.96 18,500±3,000 8,044±388.73 13.81± 4.81 93.77 ±5.44 64.48±5.23

26-28 58.44±3.10 23,900±1,479 9,861±2,655 28.60 ± 3.13 94.14±8.87 67.10±6.68

30-32 59.62±3.13 48,857±9,954 24,722±1,276 51.23 ± 2.46 97.31±10.21 68.92±6.30

34-36 61.20±3.19 54,300±9,014 28,000±3,500 62.61 ± 7.86 103.97±6.07 68.92±6.30

38-40 61.26±2.85 83,653±7,727 58,000±7,722 47.08 ± 2.34 105.00±4.99 73.11±4.44

Figure 1. Sexual differentiation visualized in five size ranges in female gonad of C. chorus. (A) undifferentiated of 15 mm, (B) female of 22-24 mm size range, (C) female of 26-28 mm size range, (D) female 30-32 mm size range, (E) female of 34-36 mm size range, (F) female of 38-40 mm size range. Abbreviations: M: mantle, Fg: female gonad, Mlo: mantle lobe.

Figure 2. Sexual differentiation visualized in five size ranges in male gonad of C. chorus. (A) undifferentiated of 15 mm, (B) male of 22-24 mm size range, (C) male of 26-28 mm size range, (D) male 30-32 mm size range, (E) male of 34-36 mm size range, (F) male of 38-40 mm size range. Abbreviations: M: mantle, Mg: male gonad, Mlo: mantle lobe.

Figure 3. Photomicrographs of female gonads, showing the sexual stages predominant of oogenesis in five size ranges in C. chorus. (A) Female gonads of the 22-24 mm size range, in phase multiplicative, evidencing the presence of follicles in formation (Ac) and oogony proliferating within acini (Og), and few previtellogenic oocytes (Pro) (B); (C) female gonad of the 26-28 mm size range, in phase of early development, dominatd by previtellogenic oocytes, and few vitellogenic oocytes (Vo); (D) female gonad of the 30-32 mm size range; (E) female gonad in the 34-36 mm size range; (F) female gonad in the 38-40 mm, in phase of mid development with previtellogenic, vitellogenic, and post-vitellogenic oocytes (Pro, Vo, Po).

Figure 4. Photomicrographs of male gonads, showing the sexual stages predominant of spermatogenesis in five size ranges in C. chorus. (A) Male gonads of the 22-24 mm size range, in phase multiplicative, evidencing the presence of follicles in formation (Ac) and spermatogonia proliferating within acini (Sg) (B), and few spermatocytes (Sc); (C) male gonad of the 26-28 mm size range, in phase of early development, with many stem cells and spermatogonia (Sg) rapidly differentiating into spermatocytes; (D) male gonad of the 30-32 mm size range; (E) male gonad in the 34-36 mm size range; (F) male gonad in the 38-40 mm, in phase of mid development characterized by the presence of all type of cellular stages, such as stem cells, spermatogonia (Sg), spermatocytes (Sc), and spermatozoa (Sp).

Figure 5. Distribution of the stages of sexual maturity of all size ranges analyzed. The gonads were classified into 4 groups: (0) Undifferentiated, (1) some follicles and many of reserve cells, (2) follicles and spermatogony/oogonia, (3) spermatogony/oogony and gametes with few reserve cells (4) Mature, almost without reserve cells.

Figure 6. Embryonic and larval phase obtained in the experiments of fertilization in C. chorus. (A-B) Size range 22-24 mm; A. fertilization membrane (40x) and B. veliger larvae (40x); (C-D) size range 26-28 mm: C. fertilization membrane (40x) and D. veliger larvae (10x); (E-F) size range 30-32 mm: E. fertilization membrane (10x) and F. veliger larvae (10x); (G-H) size range 34-36 mm; G. fertilization membrane (10x) and H. veliger larvae (40x); (I-J) size range 38-40 mm; I. fertilization membrane (10x) and J. veliger larvae (40x). Abbreviations: Fm: fertilization membrane, s: stomach, Vc: ciliated velum.

CAPITULO II

PARTE I

Función de los esteroides sexuales en la diferenciación gonadal del mejillón Choromytilus chorus (Bivalvia Mytilidae) (Molina 1782)

Role of sex steroids in gonadal differentiation of the mussel Choromytilus chorus (Bivalvia Mytilidae) (Molina 1782)

Abstract

The manipulation of gonadal differentiation through sex steroids would let to know the role of them in sexual differentiation and could have a potential application in aquaculture of bivalve molluscs. In Chile, the species Choromytilus chorus stands out for its ecological and economic importance. This mussel has a very particular condition in the color of the gonad, being cream-yellow color the male gonad and dark brown the female which is hardly desired by the consumers. In this context, the aim of this research is to determine the role that sex steroids have in gonadal differentiation of the mussel C. chorus. For this, juveniles with sizes 15-22 mm were selected, which were subjected to acute exposure in the form of bath for 60 days to with four treatments: T1: Dihydrotestosterone (DHT); T2: 17β-estradiol (E2), T3: fadrozole (F) and T4: DHT-F (DF), plus a control without sex steroids. Each treatment and control included a total of three replicas with 90 individuals each. The mussels undergoing treatment with E2 had a sex ratio (male: female) of 0.47 compared to 1:1 in the control group. In contrast, in the groups treated with DHT, F and DF the sex ratio changed to 2.0, 1.60 and 1.70, respectively. In the fertilization trials, all the mussels produced functional gametes, as they were able to generate gametes that later were developed into morula, and veliger larva. No morphological changes were observed in the mantle of undifferentiated animals neither in the gonad of the differentiated of the four treatments in comparison with the control group. Nevertheless, it should be noted that the size of oocytes from the group exposed to estradiol (59.84 ± 2.8 µm) was significantly higher than in other groups. These results support the hypothesis that sex steroids would be involved in sexual differentiation of marine bivalves, information that could be used in environmental impact studies about the potential presence of hormone disruptors in marine ecosystems and aquaculture practices.

Keywords: sexual differentiation, Choromytilus chorus, mussel, sex steroids.

1. Introduction

Sex steroids, as well as their major metabolic enzymes and pathways, have been widely identified in mollusks, several studies have demonstrated that the main classes of molluscs, i.e. cephalopods, gastropods and bivalves, are able to synthesize sex steroids from precursors such as cholesterol or pregnenolone (Le Curiex-Belfod et al. 2001;

Fernandes et al. 2011). The presence of steroids in marine bivalves was reported in

1960s (Botticelli et al. 1961) and are considered to have various physiological functions in bivalves (Reis-Henriques and Coimbra 1990; Stefano et al. 2003; Gauthier-Clerc et al. 2006). In particular, estrogens, androgens and progestins (Fernandes et al. 2011) have been reported in various bivalves such as the Pecten hericius (Boticelli et al.

1961), Pecten maximus (Sailot and Barbier 1971), Mytilus edulis (Reis-Henriques and

Coimbra 1990), Mya arenaria (Siah et al. 2002), Patinopecten yessoensis and

Crasostrea gigas (Matsumoto et al. 1997).

The sex steroids may play important roles in reproductive regulation, i.e., in the regulation of gametogenesis, vitellogenesis, gonadal maturation and spawning (Reis-

Henriques and Coimbra 1990; Gauthier-Clerc et al. 2006; Wang and Croll 2004). In the oysters, mussels and scallops, 17β-estradiol (E2) has been detected in the ovary and is considered to exhibit a seasonal change associated with the reproductive cycle and to be involved in the regulation of the yolk protein formation in the scallop (Matsumoto et al.

1997), stimulated vitellogenesis in oyster (Li et al. 1998), and has also a role in the

development of gametes in scallop (Osada et al. 2004), and gametogenesis in mussel

(Janer et al. 2004). Wang and Croll (2004) observed that injections of estradiol, testosterone, progesterone, and dehydroepiandrosterone (DHEA) all accelerated gonadal maturation in the sea scallop.

There is also evidence indicating that the sexual differentiation can be affected by sex steroids in bivalve molluscs. Mori et al. (1966) showed that injection of E2 into oysters at early stages of sex maturation appeared to induce sex reversal from males to females, but if treatment was performed at later stage the sex ratio was not affected. Moss (1989) also reported that the supply of methyltestosterone in the oyster Mulinia lateralis

(provided in the food) increase the reason male: female from 0.8 to 1.6. Wang and Croll

(2004) in the scallop Placopecten magellanicus also found significantly more males than females after injections of testosterone, estradiol, progesterone, and DHEA while the sex ratios in the control groups were not different from 1:1. In addition, testosterone treatment shifted sex ratios toward more males in the mussels Mytilus chilensis and

Mytilus galloprovincialis (Ruiz 2010).

The involved endocrine mechanisms in the sexual differentiation have been barely studied in bivalves. However, the presence of some agents involved in gonad development of vertebrates has been confirmed in invertebrates, the above mentioned sex steroids and the cytochrome P450 aromatase (Matsumoto et al. 1997). The existence

and role of aromatase has been reported in molluscs; one of the most important factors contributing to female sexual differentiation of fishes (Vizziano et al. 2007; Guillen et al. 2010). This enzyme catalyzes the transformation of testosterone to estradiol. A blockage at the level of the cpy19 gene (gene encoding aromatase) or inhibition by specific inhibitors (anastrozole and fadrozole) of the enzymatic activity of aromatase

(IA) causes transdifferentiation from a female gonad to testicle in birds (Elbrecht and

Smith 1992), reptiles (Dorizzi et al. 1994), amphibians (Yu et al. 1993) and fishes

(Guillen et al. 1999; Takatsu et al. 2013).

In Chile, the mussel C. chorus stands out for its ecological (Aldea and Valdovinos

2005) and economic importance (Sernapesca 2015). Choromytilus chorus is distributed from Callao, Peru (latitude 10°S) to the Strait of Magellan and the Beagle Channel in the southeastern Pacific (latitude 54°S) (Osorio 2002). This resource has several advantages for cultivation such as: i) the possibility of cultivation along the Chilean coast due to its extensive distribution from Callao, Peru to the Straits of Magellan, Chile

(Osorio et al. 1979); ii) large body mass, can reach maximum size of 20 cm valve length which is ideal for the market (Guzman et al. 1998); iii) documented embryonic and larval development in a controlled environment (Toledo et al. 1990); iv) high rates of growth during its first year of life (Osorio et al. 1979); v) sexual maturity at six months of age (Lépez et al. 2005), where the color of the gonad of the females is brown and the male is cream-yellow (Lozada et al. 1971).

In spite of that, C. chorus has several advantageous characteristics for their cultivation the color of the gonad of the females has prevented the mass scale production of this species in Chile, since females are rejected in process plants because of the unattractive brown coloration for the consumers, who consistently selects males (Lépez 2005). In this way, the control of sexual differentiation mediated endocrine treatments could have potential application in aquaculture of C. chorus, especially, if the sex of these animals is manipulated in early stages (post-larvas, juveniles) of the ontogenetic development for the production of “all male” populations, to help incentivize the cultivation of this mussel in our country and diversify aquaculture, since the national Chilean mussel production is 95% based upon the cultivation of Mytilus chilensis (Sernapesca 2015) with 238,827 tons.

Therefore, the effects of sex steroids and aromatase inhibition in sexual differentiation in juvenile phases (previous to the gonadic morphological differentiation) of the mussel

C. chorus) were evaluated in order to understand key aspects related to phenotypic- endocrine basis involved in sex differentiation. For this, the following objectives were addressed: (i) to determine the effect of sex steroids in early sexual differentiation of mussel C. chorus, (ii) to determine the success of fertilization of the gametes of animals exposed to sex steroids and (iii) to determine the inhibition effect of cytochrome P450 aromatase in juveniles of C. chorus.

2. Material and methods

2.1. Collection of the animals and acclimated

Juveniles 15-22 mm shell length of C. chorus (n=1350) were collected from Caleta

Errázuriz, Santa Maria Island, Antofagasta region, Chile (Latitude: 23°26'29.98"S,

Longitude: 70°35'46.12"O), in August 2016. They were transported alive to the reproduction laboratory (Building LEA, Universidad de Antofagasta, Chile) under iced conditions, then cleaned from epibionts and detritus stuck in the shells and kept in fiberglass ponds of 50L with constant aeration, natural seawater circulating at 17-20°C and filtered to 1 µm. The mussels were acclimated to the laboratory conditions for at least week before arranged in the experimental cages.

2.2. Maintenance of animals to experimental cages

Consecutively, the collected specimens were placed in a system called "maintenance system". For this, the mussels were arranged in experimental cages 25 cm wide x 11 cm long x 10 cm high, each cage corresponded to a replica, with 90 individuals randomly selected. These cages were immersed in acrylic aquariums 77 L capacity, three cages per aquarium. The animals’ were exposed half aeration conditions, circulating filtered sea water (0,5μm), temperature 17-20°C, photoperiod 12h light/12h dark and daily feed based on a mixture of microalgae: Tetraselmis, Nannocloris, Phaedodactylum sp. and

Nitzschia (80,000-120,000 cel/ml) in a 1:1:2:1 ratio. Histological examination of representative specimens using the procedures described below indicated that no distinguishable gametes were present in these juveniles.

2.3. Exposure experiment to sex steroids

Steroids used in this study included 17β-estradiol (17β), dihydrotestosterone (DHT) and the fadrozole hidrocloride enzymatic inhibitor (F) (Sigma-Aldrich, Chile). The stock solutions of each hormone and fadrozole were first solubilized in analytical grade acetone (Merck, Chile) (Matozzo and Marin 2008; Saavedra et al. 2012) and stored at

4°C, in a 3 ml ratio of acetone per mg hormone to be supplied.

In the exposure experiment, four treatments plus an experimental control were performed, with three replicas each: Treatment 1: Dihydrotestosterone treatment (T1-

DHT), Treatment 2: 17β-estradiol treatment (T2-E2), Treatment 3: Fadrozole hydrochloride treatment (T3-F), Treatment 4: Dihydrotestosterone treatment plus fadrozole (T4-DF) and an experimental control corresponding to filtered seawater without chemicals (Treatment 5, TC). Each treatment consisted of three replicas composed of 90 juveniles of C. chorus of 15-22 mm per replica; each replica corresponded to an experimental cage. The exposure dose was 3.000 ng/l of each steroid and fadrozole solution (Janer et al. 2004; Le Curieux-Belfond et al. 2005; Ruiz 2010).

For the exposure to treatments, work solutions were prepared every 36 hours for each treatment, by diluting the hormone from a stock solution (renewing the solution weekly) to the daily mixture of microalgae to be supplied (Saavedra et al. 2012). These solutions were incorporated in glass aquariums (55 cm x 35 cm x 40 cm) in a system called

“exposure system”, with the subsequent incorporation of experimental cages from

“maintenance system”, after 15 minutes having incorporated the work solution to these aquariums. The cages remained immersed for four hours, with their returned back again to the “maintenance system”. During exposures, mussels were kept with heated seawater at 17-20°C (closed system), constant aeration and in total darkness. The experiment lasted 60 days.

2.4. Sampling

Monthly samplings were performed in the exposure experiment, including a time 0 at the start of experimentation. A total of 18 individuals per replica were sampled for each treatment and control in the first sampling. The following biometric data were obtained in each sampling: mortality (number of individuals), dry weight (g) and maximum length (mm). The entire tissue was extracted to all individuals, and in the last sampling, the sex was determined and then verification was made by smear. Likewise, 6 individuals were randomly chosen from each replica and treatment for the removal of the entire tissue, these were fixed in Davidson solution for histological analysis. 20

individuals were also selected from each replica of each treatment for assays in vitro fertilization.

2.5. Histology

The gonad and mantle tissues were fixed in a solution of Davison for two months. The samples were then dehydrated by immersion for one hour each in alcohols of increasing concentration (70, 80, 95, and 100%), and benzol. The samples were embedded in paraffin, and a series of 5 µm cuts were made with a microtome in the transverse plane of the mantle tissue. The serial sections, representative of each plane, were then stained with hematoxylin and eosin and observed under an optical microscope to differentiate the mantle tissue in the undifferentiated individuals and gonadal development stages in the differentiated animals, arrangement pattern of the gonad components (male and female) and the size of oocytes (Howard and Smith 1983).

2.6. Sexual maturity stages and gonad development

The determination of the stages of sexual maturity followed the macroscopic visual methodology proposed by Tarifeño (2005–2008). The macroscopic scale of Tarifeño was modified to include two more state of maturity. This was based on the area occupied by the gonad lobe in the mantle cavity and the thickness and the gonad color, recognizing the following stages: (0) immature individuals, characterized by a 65

transparent mantle without the development of germ cells, (1) early maturity, an incipient gonad follicle development stage in which gonad coloration is tenuous and sparsely distributed within the mantle, (2) medium maturity, with a developed gonad occupying two-thirds of the mantle tissue, (3) advanced maturity, with a developed gonad occupying more than two-thirds of the mantle tissue, (4) complete maturity, with a fully developed gonad covering the whole mantle, and (5) spawned stage, female and male gametes are released into the environment, it begins with a rapid reabsorption of the gonad through of the mantle tissue, and at the end this stage the mantle again adopts a transparent appearance.

For the histological sections, the gonadal development stages were determined using the microscopic scale proposed by Kissner and Kroeck (2005). This scale includes seven stages categorized according to the cell types of the gametogenic series, the size and shape of the follicles, and the abundance of the tissue reserves, vesicular cells (V) and adipogranular (ADG) cells present in the connective tissue of the mantle.

2.7. Experiment to determine the success of fertilization of the gametes

The success of fertilization of the gametes was used to determine whether the gonads of differentiated animals in all treatments and control group exhibited functional gametes, able to be fertilized and become embryos and veliger larvae. For this, 20 individuals from C. chorus were randomly selected per each replica of each treatment; from these 66

individuals, female and male gametes were obtained independently per each replica through the stripping technique (gonad scraping), as the heat shock did not work.

Gametes were maintained during 20 minutes for hydration and/or activation, and fertilization was performed (Ruiz et al. 2008). Also, measurements of the oocytes size and number of viable oocytes (spherical, not misshapen) were made for each trial.

Consecutively, the embryos were placed in beakers 1L with 0.5 µm filtered seawater during 48 hours, and followed until the state of veliger larva phase D. Periodic sampling were made during 48 hours in order to observe the embryonic stages and formation of larva D, by samples observation in the optical microscope, taking as references the morphological characteristics of embryonic stages described for C. chorus by Toledo et al. (1990).

2.8. Statistical analysis

The data analyses were performed using Minitab 14 and Statistica 7.0 Softwares. To determine whether the sex ratio is 1:1, a Chi-square tests (X2) were used (Zar 1996).

Kruskal-Wallis tests were used to evaluate differences in number of mussel, valve length, weight and diameter of the oocytes between treatments.

3. Results

3.1. Treatments effect on survival and biometrics measures

Specimens of C. chorus from the treatments and control presented similar number of individuals surviving for each group at the end of experimentation. DHT treatment had the lowest number of surviving animals (122 individuals) while the treatment with fadrozole recorded the highest survival (139 individuals), with respect to the control group that recorded 138 individuals (Table 1). No significant differences were found in the number of individuals surviving between the treatments and control group (p> 0.05;

Chi-cuadrado test).

The specimens of C. chorus had a slow increase in size (5 mm/month) during the first month of exposure increasing at the end of the experiment (10 mm/month). After two months of exposure, there were no significant differences in the mussel sizes and dry weights (p> 0.05; Kruskal-Wallis) (Table 1).

3.2. Effect of sex steroids on differentiation

The percentages of individuals reaching sexual differentiation (differentiation rate) were: 67.05% in the 17β-estradiol treatment, 68.9% in the dihydrotestosterone 68

treatment, 72.7% in the fadrozole treatment and 73.4% in the fadrozole treatment plus

DHT while in the control group was 65.9%. There were no significant differences in undifferenced individuals between treatments and control groups (p> 0.05; Chi-square test) (Fig. 1-2).

The exposures to sex steroids and tamoxifen desviated the ratio between the number of male and female animals (sex ratio) in the experimental groups of C. chorus compared to the control group. The sex ratio (male:female) was changed to 2.0 in the dihydrotestosterone treatment (P <0.05; Chi-square test), to 0.47 in the 17β-estradiol treatment (P <0.05; Chi-square test), to 1.60 in the fadrozole treatment (P> 0.05; Chi- square test), to 1.70 in the fadrozole treatment plus DHT, and it was 0.94 in the control group (P> 0.05; Chi-square test) (Fig. 1-2).

3.3. Effect of sex steroids on sexual maturity

There were not significant differences in the stages of sexual maturity between specimens exposed to treatments and those of the control group. In all treatments and control groups more than 95% of the mussels showed an early maturity (stage 1), with an incipient gonad follicle development and gonad coloration tenuous and sparsely distributed within of the mantle. In the 7.6%, the mussels presented medium maturity

(stage 2), with a developed gonad occupying two-thirds of the mantle tissue, and in the

0.4% the mussels presented advanced maturity.

3.4. Effect of steroids on the histology of the gonad

Undifferentiated specimens were observed in treatments and control in stage 0 of gametogenesis (inactive stage). The undifferentiated animals were characterized by a transparent mantle without acini development (or gonadal follicles). Individuals were observed with collapsed and empty acini containing stem cells, without gametes in development; and therefore, sex was undetermined. In this phase, only vesicular connective tissue (VCT) cells and adipogranules (ADG) cells in the mantle were observed (Fig. 3-4).

Meanwhile, the differentiated animals were observed with clearly distinguishable female or male germ cells, with a gonadal development primarily in multiplicative phase in the 70% of all differentiated individuals followed by early (25%) and middle

(5%) stages (Fig. 3-4). In the multiplicative phase, the male mussels showed a large amount of stem cells and spermatogonia that quickly were differentiated in primary and secondary spermatocytes and a low number of sperm. Oogonias in proliferation was observed in females within gonadal follicles with a large amount of VCT cells and a low percentage of mature oocytes; furthermore, VCT and ADG cells were dispersed

through the entire mantle. In the early and middle development, a significant increase was observed in the number of mature oocytes and sperm, and a decrease in VCT and

ADG cells (Fig. 3-4). No hermaphrodite individuals were observed in treatments and control.

No morphological changes were observed in the undifferentiated specimens (types, size and distribution of cells) between the treatment and control group during the first and second month of exposure. Likewise, no differences were observed between males and females in the cell type and follicles structure; all females (treatments and control) had previtellogenic oogonia and oocytes distributed in the periphery and vitellogenic oocytes in the follicles lumen. In males, the spermatogonia and primary and secondary spermatocytes were associated to the follicle periphery, while sperms were visualized in the lumen of the follicle. However, the oocyte sizes exposed to 17β-estradiol were significantly higher (61.12 ± 2.40 µm) and oocytes exposed to T4-DF were lower

(55.1±3.4) compared to that of the control (57.67±4.72) and other treatment groups

(57.9±3.0 µm in T1-DHT; 56.7±4.2 µm in T3-F), with an apparent degeneration of oocytes from the groups exposed to DHT, F and DF. Remarkable, this was observed in a low number of oocytes (<3%).

3.5. Success of fertilization of the gametes

The success of fertilization of the gametes de C. chorus exposed to treatments was used to determine whether the gonads of sexually differentiated animals exhibited functional gametes, able to be fertilized and become embryos and veliger larvae. During the fertilization trials, it was observed that all the mussels (treatments and control group) had a functional gonad which produced viable gametes that were able to fertilize. In all treatments, the embryonic development showed no difference in the morphological characteristics of embryonic stages (first cleavages, morula, blastula and gastrula) and larval (trochophora and veliger phase D) at a temperature of 17-19°C compared to the control (Fig. 5).

The embryonic development began with the formation of zygote after 5 minutes of the fertilization in all experiments (Fig. 5). Then, the meiosis occurred with the formation and release of the first and second polar body. After 40 minutes, the first mitotic event

(first cell division) began, and consecutively, multiple cleavages were observed. After

3-4 hours post-fertilization, the morula stage, and subsequently blastula, gastrula arose, and at 24 hours emerged the trochophore larva. At 47-48 hours post-fertilization, the veliger D larva was observed in all experiments (Fig. 5).

4. Discussion

4.1. Effect on gonadal development in mussels

In C. chorus no significant differences were observed in dry weights and valval maximum length, this matches with that observed by Wang and Croll (2004) in the scallop Placopecten magellanicus. In contrast to what described by Umuna et al.

(1999), who observed that sex steroids androstenedione and estrone significantly affected the average gonadal index and increased weight in male individuals of the sea urchin Pseudocentrotus depressus, when accelerating the gametogenesis processes. In mussels, the weight fluctuations of the individuals are mainly attributed to the gonadal tissue weight, as this is the main organ that varies throughout the reproductive cycle by

60% (Varaksina and Varaksin 1991). However, in this study an incipient stage of sexual maturity (1-2) was observed in all experimental groups and thus a low weight of gonadal tissue in mussels.

Sex steroids and fadrozole had a remarkable effect on the differentiation of C. chorus, a higher differentiation rate of those treated was observed compared to the control. These results are consistent with observations from previous studies, which have suggested that sex steroids stimulate the morphological differentiation in bivalves (Wang and

Croll 2004). This effect could be caused by the action that sex steroids have on gonads metabolism, as they regulate the main metabolic pathways of the glycogen, proteins and lipids in bivalves (Matheiu et al. 1991), (Varaksina and Varaksin 1991; Varaksina et al.

1992; Wang and Croll 2004). In this context, it has been noted that estradiol may stimulate glycogenolysis and lipidogénesis when regulates the activity of the enzyme glucose-6-phosphate dehydrogenase and malate dehydrogenase in molluscs (Mori 1966;

Mori et al. 1972). E2 stimulates vitellogenesis in P. yessoensus; one of the main events involved in gonad development (Osada et al. 2004; Wang and Croll 2006, 2007).

4.2. Effect of sex steroids on sexual differentiation

In this study, significantly more males than females of C. chorus were established in treatments with Dihydrotestesterone androgen and more females in treatment with 17β- estradiol estrogen, compared to the control group. Early studies have also indicated the possible function of sex steroids in sexual differentiation in bivalve molluscs. Moss

(1989) showed that the supply of methyl-testosterone in Mulinia lateralis newly spawned produces an increase in the sex ratio (male/female) of 0.8 to 1.6. Likewise, researches by Wang and Croll (2004) indicate that the administration of androgens, testosterone and dehydroepiandrosterone in early juveniles of P. magellanicus differed a greater number of males. In contrast, the exposure to 17β-estradiol, which resulted in more females, is consistent with that reported by Mori et al. (1966) who showed that the

estradiol injection in oysters seems to induce sex reversal from males to females and differs from that found by Wang and Croll (2004), who found that the 17β-estradiol has a masculinizing effect.

The exposure to DHT, F and DF differentiated more males than females, although these differences were not statistically significant in the last two treatments compared to control. These findings are consistent with results of previous experiments in molluscs and vertebrates, and have pointed out that dihydrotestosterone, testosterone and androstenedione, have an androgenic effect in bivalves (Varaksina et al. 1992; Wang and Croll 2004, 2007) (Table II). Also, it has been observed that androgens are involved in gamete release in P. magellanicus males and E2 is involved in the release of oocytes in females of this bivalve (Wang 2000; Wang and Croll 2003).

These results suggest that steroids DHT and E2 may have a similar role in molluscs as happens in vertebrates. The exposure to DF and F treatments also had an masculinizing effect on C. chorus. Similarly, the supply of aromatase inhibitors cause masculinization in fishes (Guillen et al. 2010). In fact, these types of treatments are used as a tool for biotechnological application in the production of monosex "all male" (Piferrer et al.

1994; Penman and Piferrer 2008).

This action called androgenic (masculinizing) could be caused by two possible mechanisms in C. chorus. First, the exposure to the non-aromatizable androgen

dihydrotestosterone induces the development of the male gonad. It has been mentioned that androgens besides binding to their receptors and activating these nuclear transcription factors that control the expression of genes involved in spermatogenesis, may also act through the inhibition of the expression of cyp19 gene (gene encoding aromatase) and subsequently estrogen synthesis (Yeh et al. 2003a; Bhandari et al.

2006). Also, androgens treatments (11-ketotestosterone or 17α-methyltestosterone) in fishes have shown to induce a sex change in Epinephelus merra (Bhandari et al. 2003) by the suppression of cyp19 gene and decrease the estrogen levels during sex reversal from female to male (Yeh et al. 2003a;. Bhandari et al. 2006).

Second, although in this study the inhibition of the enzymatic activity of aromatase through fadrozole treatments (F, DF) had no significant effect on the masculinization of

C. chorus, its action was the sex reversal towards male sex. Fadrozole is a competitive inhibitor non-steroidal reversible of aromatase, that alters steroidogenesis (by decreasing the estrogen synthesis) and reproduction in vertebrates (Ankley et al. 2002).

It should be noted, that while there is a large phylogenetic distance among the tested species (fish and molluscs), as well as changes in the pathway and time of exposure, the observed effect of fadrozole in invertebrates has been to decrease the estrogen concentration and alter some reproductive parameters in the gastropod Potamopyrgus antipodarum (Gust et al. 2010), similar to that observed in fishes. However, the

inhibition effect was smaller in this gastropod and in C. chorus, than that observed in fishes, Fadrozole is a drug designed for humans, and the binding site of aromatase in C. chorus can be divergent, decreasing fadrozole effect.

(e.g. tamoxifen) are invariably associated with a masculinization, process observed in fishes (Guillen et al. 2000) and mollusks (Ruiz et al. 2010). However, more research are needed to understand the effect of aromatase inhibition on sexual differentiation in invertebrates, since this study would be the first approach made so far in an invertebrate.

4.3. Success of fertilization of the gametes

Estradiol stimulated the size of differentiated oocytes; the diameter observed in this treatment was higher than that found in other groups and control at this same stage of gonadal development. Although in this study, the exposed individuals were juvenile C. chorus that subsequently were sexually differentiated, the diameter of oocytes from the

17β-estradiol treatment was quite close to that size observed in breeders of this mussel

(Ruiz 2008). It was noted as well that oocytes showed a cell disruption like an atresia in exposures to DHT, DF and F; however, this was found in a low number of oocytes per

individual. Wang and Croll (2004) observed a similar phenomenon in the female gonad of the juveniles exposed to androgen testosterone in P. magellanicus, and they attribute it to a treatment effect. However, in most cases, the gonads of the individuals exposed to sex reversal had a morphology, layout pattern and cellular components of the female and male gonadal follicles similar to the control group, which is consistent with histology made in C. chorus specimens of Antofagasta coast (ca. 24°S) (Ruiz et al.

2017).

Likewise, both male and female gametes from the animals subjected to sexual reversal were functional, since in all fertilization experiments the phases of the ontogenetic development (zygote, cleavages, morula, blastula, gastrula, trocófora larva and Veliger

D larva), morphology of the embryos and development time were similar to the control group and to what Toledo et al. (1990) and Ruiz et al. (2016) described about this species. This is consistent with the observations of Takatsu et al. (2013), who exposed specimens of (Oryzias latipes) to high fadrozole concentrations, and obtained fertilized oocytes that developed post-fertilization into normal juveniles. However, they noted that the post-treatment specimens had nonfunctional sperm (without flagella), so they had to make the crossbreds after 2 months of performed treatments. They noted that it was due to a significant deficit of estrogen, which is necessary for the flagella morphogenesis of sperms. In this study, there were not no atrophied sperms due to exposure to fadrozole or other masculinizing treatment.

5. Conclusion

In conclusion, our results strongly support the hypothesis that sex steroids play an important role in sexual differentiation in invertebrates, as happens in vertebrates. Sex steroids were involved in sexual differentiation of the mollusk C. chorus as has been observed in other bivalves, and vertebrates; and could be a useful tool for sex modulation in early stages of its ontogenetic development, specifically, in juvenile stages, and also for environmental impact studies. However, more experiments are needed to clarify the questions concerning the manifestation of mediated sex by sex steroids, especially, those that help to understand the inhibiting effect of cytochrome

P450 aromatase by using enzymic inhibitors, since this study be the first approach made so far in an invertebrate.

6. Acknowledgments

University of Antofagasta, Antofagasta, Chile.

7. Literature cited

Aldea C., and C. Valdovinos. (2005). Moluscos del intermareal del Centro-Sur de Chile (36° - 38°S): taxonomía y clave de identificación. Gayana 69: 364-396. [In Spanish] Ankley G., M. Kahl, K. Jensen, M. Hornung, J. Korte, E. Makynen, and R. Leino. (2002). Evaluation of the Aromatase Inhibitor Fadrozole in a Short-Term Reproduction Assay with the Fathead Minnow (Pimephales promelas). Toxicological Sciences 67: 121-130. Bhandari R.K., M. Higa, H. Komuro, S. Nakamura, and M. Nakamura. (2003). Treatment with an aromatase inhibitor induces complete sex change in the protogynous honeycomb grouper (Epinephelus merra). Fish Physiology and Biochemical 28: 141– 142.

Bhandari R.K., M.A. Alam, K. Soyano, and M. Nakamura. (2006). Induction of female- tomale sex change in the honeycomb grouper (Epinephelus merra) by 11- ketotestosterone treatments. Zoological Scientia 23: 65–69.

Boticelli C.R., F.L. Hisaw, and H.H. Wotiz. (1961). Estrogens and progesterone in the sea urchin (Stronglyocentrotus franciscanus) and Pecten (Pecten maximus). Procedimental Society Experimental Biology Medical 106: 887–889.

Dorizzi M., N.L. Richard-Mercier, G. Desvages, M. Girondot, and C. Pieau. (1994). Masculinization of gonads by aromatase inhibitors in a turtle with temperature- dependent sex determination. Differentiation 58: 1-8. Elbrecht A., and S. Smit. (1992). Aromatase enzyme activity and sex determination in chickens. Science 255: 467-470. Janer G., R. Lavado, R. Thibaut, and C. Porte. (2004). Effects of 17β-estradiol exposure in the mussel Mytilus galloprovincialis. Marine Environmental Research 58: 443-446. Fernandes D., L. Barbara, and C. Porte. (2010). Biosynthesis and metabolism of steroids in molluscs. Journal of Steroid Biochemistry and Molecular Biology, 7pp. Gauthier-Clerc S., J. Pellerin, and J.C. Amiard. (2006). Estradiol-17β and testosterone concentrations in male and female Mya arenaria (Mollusca bivalvia) during the reproductive cycle. General and Comparative Endocrinology 145: 133-139. Guiguen Y., J. Baroiller, M. Ricordel, K. Iseki, O. McMeel, S. Martín, and A. Fostier. (1999). Involvement of Estrogens in the Process of Sex Differentiation in two Fish Species: The Rainbow Trout (Oncorhynchus mykiss) and a Tilapia (Oreochromis niloticus). Molecular Reproduction and Development 54: 154-162.

Guiguen Y. (2000). Implication of steroids in fish gonadal sex differentiation and sex inversion. Current Topics in Steroid Research 3: 127–143.

Guiguen Y., A. Fostier, F. Piferrer, and C.F. Chang. (2010). Ovarian aromatase and estrogens: A pivotal role for gonadal sex differentiation and sex change in fish. General and Comparative Endocrinology 165: 352-366. Gust M., J. Garric, L. Giamberini, R. Mons, K. Abbaci, F. Garnier, and T. Buronfosse. (2010). Sensitivity of New Zealand mudsnail Potamopyrgus antipodarum (Gray) to a specific aromatase inhibitor. Chemosphere 79: 47-53. Howard D.W., and C.S. Smith. (1983). Histological techniques for marine bivalve mollusks. NOAA Technical Memorandum NMFS-F/NEC 25: 1-97. Kisnner E., and M. Kroeck. (2005). Estimación de la talla de primera madurez sexual del mejillón, Mytilus edulis platensis (Mollusca: Bivalvia) en el Golfo San Matías. IBMP Serie Publicaciones IV, 21-44. [In Spanish] Le Curieux-Belfond O., S. Moslemi, M. Mathieu, and G. Séralini. (2001). Androgen metabolism in oyster Crassostrea gigas: evidence for 17β-HSD activities and characterization of an aromatase-like activity inhibited by pharmacological compounds and a marine pollutant. The Journal of Steroid Biochemistry and Molecular Biology 78: 359-366. Le Curieux-Belfond O., B. Fievet, G. Séralini, and M. Mathieu. (2005). Short-term bioaccumulation, circulation and metabolism of estradiol-17h in the oyster Crassostrea gigas. Journal of Experimental Marine Biology and Ecology 325: 125-133. Li Q., M. Osada, T. Suzuki, and K. Mori. (1998). Changes in vitellin during oogenesis and effect of 17β-estradiol on vitellogenesis in the Pacific oyster Crassostrea gigas. Invertebrate Reproduction and Development. 33: 87–93.

Matsumoto T., M. Osada, Y. Osawa, and K. Mori. (1997). Gonadal Estrogen Profile and Immunohistochemical Localization of Steroidogenic Enzymes in the Oyster and Scallop during Sexual Maturation. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 118: 811-817. Mathieu M., I. Robbins, and P. Lubet. (1991). The neuroendocrinology of Mytilus edulis. Aquaculture 94: 213-223. Mori K., H. Tamate, and T. Imai. (1966). Histochemical study on the change of 17B- hydroxysteroid dehidrogenase activity in the oyster during the stages of sexual maturation and spawing. Tokoku Journal of Agricultural Research 17: 179-191.

Mori K., T. Muramatsu, and Y. Nakamura. (1972). Effects of steroids on oyster: V. Acceleration of glycogenolysis in female Crassostrea gigas by estradiol-17h injection under natural conditions. Bulletin Japon Society Science Fisheries 38: 1185– 1189.

Moss S. (1989). Effects of exogenous androgens on growth, biochemical composition, and reproduction of the coot clam, Mulinia lateralis. Pacific Scientia 43, 200.

Osada M., H. Tawarayama, and K. Mori. (2004). Estrogen synthesis in relation to gonadal development of Japanese scallop, Patinopecten yessoensis: gonadal profile and immunolocalization of P450 aromatase and estrogen. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 139: 123-128. Penman D., and F. Piferrer. (2008). Fish Gonadogenesis. Part I: Genetic and Enviromental Mechanisms of Sex Determination. Reviews in Fisheries Science 16: 16- 34. Piferrer F., S. Zanuy, M. Carrillo, I. Solar, R. Devlin, and F. Donaldson. (1994). Brief Treatment with an Aromatase Inhibitor During Sex Differentiation Causes Chromosomally Female Salmon to Develo as Normal, Functional Males. The Journal of Experimental Zoology 270: 255-262. Reis-Henriques M., and J. Coimbra. (1990). Variations in the levels of progesterone in Mytilus edulis during the annual reproductive cycle. Comparative Biochemical Physiology 95: 343-348. Retamal R. (2003). Modificación de la Proporción sexual en Individuos Juveniles de Choromytilus chorus Mediante la Administración de Extracto Gonadal. Seminario De Título presentado al Departamento de Oceanografía de la Universidad de Concepción para optar al título de Biologo Marino, 35pp. [In Spanish] Ruiz M., E. Tarifeño, A. Llanos-Rivera, C. Padget, and B. Campos. (2008). Efecto de la temperatura en el desarrollo embrionario y larval del mejillón, Mytilus galloprovincialis (Lamarck, 1819). Revista de Biología Marina y Oceanografía 43: 51- 61. [In Spanish]

Ruiz M. (2010). Efecto de los esteroides sexuales en la diferenciación gonadal de los Mitílidos. Tesis para optar al título de Magíster en Ciencias con mención Zoología. Universidad de Concepción. Facultad de Ciencias Naturales y Oceanográficas. Departamento de Zoología. Concepción, Chile. 68pp. [In Spanish] Saliot A. and M. Barbier. (1971). Isolation of progesterone and several ketosteroids of the female part of the gonads of the scallop Pecten maximus. Biochemical 53: 265–266.

SERNAPESCA. (2015). Anuario Estadístico de Pesca. Servicio Nacional de Pesca, Valparaíso. 187pp. [In Spanish] Stefano G.B., P. Cadet, K. Mantione, J. Cho, D. Jones, and W. Zhu. (2003). Estrogen signaling at the cell surface coupled to nitric oxide release in Mytilus edulis nervous system. Endocrinology 144: 1234–1240. Siah A., J. Pellerin, A. Benosman, J. Gagné, and J. Amiard. (2002). Seasonal gonad progesterone pattern in the soft-shell clam Mya arenaria. Comparative Biochemistry and Physiology - Part A: Molecular and Integrative Physiology 132: 499-511. Takatsu K., K. Miyaoku, S. Roy, Y. Murono, T. Sago, H. Itagaki, M. Nakmura, and T. Tokumoto. (2013). Induction of Female-to-Male Sex Change in Adult Zebrafish by Aromatase Inhibitor Treatment. Nature 3, 3400.

Toledo P., G. Bellolio, and E. Dupré. (1990). Fecundación y desarrollo embrionario de Choromytilus chorus (Molina, 1782) (Bivalvia, Mytilidae). Revista de Biología Marina y Oceanografía 25: 47-57. [In Spanish] Tarifeño E. (2005-2008). Producción a escala piloto de hembras de choro zapato con color gonadal modificado mediante técnicas biotecnológicas. Proyecto Fondef D05I10258. Universidad de Concepción, Concepción, Chile. [In Spanish] Toledo P., G. Bellolio, and E. Dupré. (1990). Fecundación y desarrollo embrionario de Choromytilus chorus (Molina, 1782) (Bivalvia, Mytilidae). Revista de Biología Marina y Oceanografía 25: 47-57. [In Spanish] Unuma T., T. Yamamoto, and T. Akiyama. (1999). Effect of steroids on gonadal growth and gametogenesis in the juvenile Red Sea urchin Pseudocentrotus depressus. The Biological Bulletin 196: 199–204. Varaksina G.S., and A. Varaksin. (1991). Effects of estradiol, progesterone, and testosterone on oogenesis of yezo scallop. Biology Morya 3: 61– 68.

Wang C. (2000). Roles of sex steroids on reproduction of the sea scallop. PhD thesis. Department of Physiology and Biophysics. Dalhousie University, Halifax. 274 pp.

Wang C., and R. Croll. (2003). Effects of sex steroids on in vitro gamete release in the sea scallop, Placopecten magellanicus. Invertebrates Reproduction and Developmet 44: 89–100.

Wang C., and R.P Croll. (2004). Effects of sex steroids on gonadal development and gender determination in the sea scallop, Placopecten magellanicus. Aquaculture 238: 483-498. Wang C., and R. Croll. (2006). Effects of sex steroids on spawning in the sea scallop, Placopecten magellanicus. Aquaculture 256: 423-432. Wang C., and R. Croll. (2007). Estrogen binding sites in the sea scallop: Characterization and possible involvement in reproductive regulation. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 148: 303- 313. Yeh S.L., Y. Chu, C. Kuo, Y. Ting, and C. Chang. (2003). 17 alpha-Methyltestosterone induced sex change in the unilateral ovariectomized protogynous orange-spotted grouper, Epinephelus coioides. Journal Fishery Society Taiwan 30: 91–100.

Yu N.W., C.Y. Hsu, H.H. Ku, L.T. Chang, and H.W. Liu. (1993). Gonadal differentiation and secretions of estradiol and testosterone of the ovaries of Rana catesbeiana tadpoles treated with 4-hydroxyandrostenedione. Journal of experimental Zoology 265: 252-257. Zar J.H. (1996). Biostatistical analysis. Prentice-Hall, New Jersey. 663 pp.

ANNEX

CHAPTER II

PART I

Table 1. Characteristics of juveniles of C. chorus exposed to different treatments, and survival of individuals by treatment at the end of experiment. S.D. : standard deviation.

Treatment Mean drained Mean size Number of Mortality weight (gr) ) ± (mm) ± S.D. individuals for each S.D. surviving for each treatment treatment.

TC 2.4±1.0 27.2±3.7 138 11

T1-DHT 2.2±0.8 26.4±3.4 122 15

T2-E2 2.5±1.1 27.1±4.5 136 11

T3-F 2.2±0.6 26.5±2.8 139 13

T4-DF 2.2±0.7 26.7±3.3 135 15

Each value represents the average ± standard deviation (S.D.). The range of the number of individuals for each group shown in the last two columns (n).

Table II. Effect of sex steroids on the sexual differentiation of bivalve mollusks

Species Treatment Supply form Effect on the sexual differentiation Reference Treatment Crassostrea gigas Treatment of 17β-estradiol Supply in form of bath The injection of E2 into oysters at early stages of sex Mori et al. maturation appeared to induce sex reversal from males 1966 to females Mulinia lateralis Treatment of methyltestosterone Supply in the food. Increased the ratio of male female from 0.8 to 1.6 Moss 1989 Placopecten Treatment of testosterone Supply in form of The sex ratio was: Wang and magellanicus Treatment of progesterone bath. 6.75 in the 17β-estradiol treatment Croll 2004 Treatment of 6.00 in the testosterone treatment dehydroepiandrosterone 8.67 in the progesterone treatment Treatment of 17β-estradiol. 5.25 in the DHEA treatment 1.22 in the control group. C. chorus Treatment of male macerate Supply in form of The sex ratio was: Retamal gonad (source of testosterone) of bath. 1.50 in the male macerate gonad 2003 C. chorus. 1.00 in the control group. M. chilensis Treatment of testosterone Supply in form of The sex ratio (male: female) was: Ruiz 2010 Treatment of progesterone. bath. 1.57 in the testosterone treatment 0.61 in the progesterone treatment 1.00 in the control group. M. Treatment of testosterone Supply in form of The sex ratio (male/female) was: Ruiz 2010 galloprovincialis Treatment of progesterone. bath. 2.68 in the testosterone treatment 0.60 in the progesterone treatment 1.00 in the control group. C. chorus Treatment of 17β-estradiol Supply in form of The sex ratio (male:female) was changed to: In this study Treatment of bath. 0.47 in the 17β-estradiol treatment Dihydrotestosterone (DHT) 2.00 in the DHT treatment Treatment of Fadrozole (F) 1.60 in the fadrozole treatment Treatment of DHT with F. 1.70 in the treatment of DF 1.00 in the control group.

Males (%) 100 Females (%) 90 Undifferentiated (%) 80 70 60 50 40 30

20 Percentage of differentiated animals animals differentiated of Percentage 10 0 TC T1-DHT T2-E2 T3-F T4-DF Treatments

Figure 1. Effect of treatments with sex steroids on the sexual differentiation in the mussel C. chorus. To determine the percentage of undifferentiated we use the average number of animals for each treatment and for the percentage of males and females was used the average number of animals differentiated for each treatment. Abbreviations: TC: control treatment; T1-DHT: Dihydrotestosterone treatment; T2-E2: 17β-estradiol treatment; T3-F: Fadrozole hydrochloride treatment; T4-DF: Dihydrotestosterone treatment plus fadrozole.

(A) (B) (C) Lm Lm Lm

M Gf Gm

5 mm 5 mm 5 mm

(D) Lm (E) (F) Lm Lm

M Gf Gm 5 mm 5 mm 5 mm

(G) (H) Lm (I) Lm Lm

Gf Gm M 5 mm 5 mm 5 mm

(J) (K) Lm (L) Lm Lm

M Gf Gm 5 mm 5 mm 5 mm

(M) (N) Lm (O) Lm Lm

M Fg Gm

5 mm 5 mm 5 mm

Figure 2. Sexual differentiation shown in treatments and control in C. chorus. Control treatment: Undifferentiated (A), Female (B), and Male (C). 17β-estradiol treatment: Undifferentiated (D) Female (E), and Male (F). DHT treatment: Undifferentiated (G), Female (H), and Male 40X (I). F treatment: Undifferentiated (J), Female (K), and Male (L). DF treatment: Undifferentiated (M), female (N), and Male (O). Abbreviations: mantle (M), mantle lobe (Lmo), female gonad (Fg), male gonad (Gm).

(A) (B) Ff (C) Tc Tc Vo

Vo Vo

100 µm 100 µm 70 µm

(D) (E) Ff (F) O Ov Ov

Tc Tc 100 µm Opr Ov 80 µm 100 µm

(G) (H) (I) F Ag f

Ov Opr Opr 120 µm Ov 100 µm 100 µm

(J) (K) (L) Ov Ag Ov Tc Tc Ov Ff Opr 100 µm 100 µm 50 µm

(J) (J) Ff (J) Apo Op Tc Tc Ov Op

Ov Ov 50 µm 120 µm Apo 120 µm

Figure 3. Female gonad photography showing the predominant sexual maturity stages of oogenesis from treatments and control group in C. chorus. Control group: Undifferentiated 10X (A), female gonad 20X (B) and 40X (C). 17β-estradiol treatment: Undifferentiated 10X (D), female gonad 20X (E) and 40X (F). DHT treatment: Undifferentiated 10X (G), female gonad 20X (H) and 40X (I). F treatment: Undifferentiated 10X (J), female gonad 20X (K) and 40X (L). DF treatment: Undifferentiated 10X (M), female gonad 20X (N) and 40X (O). Abbreviations: connective tissue (Tc), vesicular connective tissue cells (Tcv), adipogranular cells (Ag), female follicle (Fm), vitellogenic oocyte (Ov), previtelogenic oocyte (Opr), post-vitellogenic oocyte (Op), cell apoptosis (Apo).

(A) (B) (C) Tc Tc Tc Fm

80 µm 50 µm 50 µm

(D) (E) (F) (g) Tc Tc Tc Fm Sg Ag Tc Sp Sp 80 µm 1200 µm µm 10100 µm Tc

(G) Ag (H) (I) Fm Tc Tc Sp Tc Dd

120 µm 150 µm 1200 µm µm

(J) (K) (L) Fm Tc

100 µm 100 µm 100 µm

(M) (N) (O) Fm Tc Sp

50 µm 80 µm 90 µm 90 µm

Figure 4. Male gonad photography showing predominant sexual maturity stage of spermatogenesis from treatments and control group in C. chorus. Control group: Undifferentiated 10X (A), male gonad 20X (B) and 40X (C). 17β-estradiol treatment: Undifferentiated 10X (D), male gonad 20X (E) and 40X (F). DHT treatment: Undifferentiated 10X (G), male gonad 20X (H) and 40X (I). F treatment: Undifferentiated 10X (J), male gonad 20X (K) and 40X (L). DF treatment: Undifferentiated 10X (M), male gonad 20X (N) and 40X (O). Abbreviations: connective tissue (Tc), vesicular connective tissue cells (Tcv), adipogranular cells (Ag), female follicle (Fm), sperm (Sp), spermatogonia (Sg), digestive diverticula (Dd).

(A) (B) (C) Mf (B) E

20 µm 26 µm 50 µm

(D) (E) (F) Mf

Cp E

20 µm 26 µm 35 µm

(G) (G)(H) (I) Mf

25 µm 26 µm 35 µm

(J) (K) (L) Mf

20 µm 30 µm 35 µm

(M) (N) (L) Mf Fc Vc E

20 µm 35 µm 50 µm

Figure 5. Embryonic and larval phases obtained from the fertilization experiment in treatments and control in C. chorus. Control: zygote (A), embryo cleavage II (B), larva veliger D (C). 17β-estradiol treatment: zygote (D), embryo cleavage II (E), larva veliger D (F). Dihydrotestosterone treatment: zygote (G) first embryo cleaving (H), larva veliger D (I). Fadrozole treatment: zygote (J), multiple embryo cleavages (K), larva Veliger D (L). Dihydrotestosterone treatment plus fadrozole: zygote (M), rotary blastula (N), larva veliger D (O). Abbreviations: fertilization membrane (Mf), polar body (Cp), cilia (C), stomach (E) and ciliated veil (Vc).

CAPITULO II

PARTE II

Estandarización de un protocolo para detección de la citocromo P450 aromatasa

Standardization of protocol for detection of cytochrome P450 aromatase

1. Estandarización de un protocolo para identificar la citocromo P450 aromatasa

1.1. Extracción y purificación de proteínas totales

Los ejemplares de C. chorus, fueron purificados por el método descrito por Rivas (2000)

Para esto se pesaron 100 mg de tejido de cada ejemplar de C. chorus, con un n de 30 individuos por cada tratamiento (10 individuos por réplica). Se homogenizaron con 1 ml de buffer de lisis (urea 7 M, Tris pH 8 40 mM, Tween 20, DTT 65 mM, PMSF 5 mM y agua destilada esterilizada) en tubo falcón de 15 ml puesto en hielo, y se trituraron en el homogeneizador de tejido marca Ultra Turrax. Posteriormente, fueron centrifugadas a

14.000 r.p.m por 10 min a 4 °C (Boeco M-24, Alemania) y agitadas durante 2 horas a temperatura ambiente en un vortex, realizando intervalos de 20 minutos de agitación por 10 minutos de descanso por seguridad del equipo. Luego las muestras fueron centrifugadas a

10.000 RPM por 20 segundos a 4°C. Se recuperó el sobrenadante y se realizó una cuantificación con el método de Bradford.

1.2. Cuantificación de proteínas totales, utilizando el método de Bradford

La cantidad de proteína total presente en la fracción eluída fue determinada a través del microensayo propuesto por Bradford (1976). Este método se basa en la medición del máximo de absorbancia que alcanza una solución ácida de Coomassie Brillant Blue G-250 al unirse a la proteína receptora, la cual cambia su máximo de absorbancia a 595 cuando ocurre la unión a la proteína. Se realizó una curva de calibrado usando como patrón

albúmina de suero de bovino (BSA) como patrón. Se prepararon varias diluciones del estándar de proteínas (BSA), diluidas en NaOH 0,8 N: 0,2 mg, 0,6 mg, 0,8 mg, 1,0 mg, 1,2 mg, 1,4 mg y 2 mg (estas diluciones se hicieron por triplicado y el promedio de ellas fue usado para la curva de calibrado de proteínas). Posteriormente, todos los tubos fueron inoculados con 760 µl de agua miliQ y 200 µl del reactivo Bradford (Dye Reagent

Concentrate Bio-Rad protein assay), se homogenizó y se dejaron incubar a temperatura ambiente durante 5 minutos y se midió la absorbancia a 595 nm en el equipo Multiskan GO

(Thermo Scientific).

Para cuantificar la cantidad de protenías purificada se graficó la absorbancia a 595 nm versus la concentración de BSA. La pendiente (m) de la regresión lineal obtenida se uso para calcular los µg de la proteína purificada, de acuerdo a la siguiente fórmula:

µg proteínas totales = abs 595 nm m m = Δ y Δ x

donde, abs595 nm es la absorbancia obtenida a 595 nm, m es la pendiente de la regresión lineal obtenida (Figura 1).

1.3. Electroforesis en geles de poliacrilamida en presencia de dodecil sulfato de sodio (SDS-PAGE)

La muestra homogenizada fue analizada por electroforesis SDS-PAGE siguiendo el protocolo descrito por Laemmli (1970). Se preparan 2 gel al 12%, que constaban de una parte denominada gel seprador (agua, acril-Bis 30%, Tris-Hcl 15 M pH 8.8, SDS 10%, PSA

10% y Temed) al 3% y de un gel concentrador o “Staking” al 5% (agua, acril-Bis 29:1,

Tris-Hcl 1 M pH 6,8, SDS 10%, PSA 10% y Temed). Posteriormente, se tomaron 20 µl de cada muestra y se le agregó un volumen de 10 µl de buffer de carga (Tris-Hcl 50 mM pH

6.8, dodecil sulfato de sodio (SDS) 2%, azul bromofenol 0,1%, glicerol 10% y 2- mercaptoetanol 5%) en un tubo Eppendorf, esta mezcla fue homogenizada durante mediante pipeteo. El gel fue ubicado en una cámara electroforética (Modelo Mini-Protean,

Tetra System, Bio-Rad) con el buffer de corrida (Tris- HCL pH 8,3; glicina 0,25 M, dodecil sulfato de sodio (SDS) y agua destilada esterilizada), luego las muestras fue corridas durante 90 minutos a 150 V. Como estándar de peso molecular se utilizó el PageRulerTM

Plus Prestained Protein Ladder (Fermentas).

1.4. Tinción del gel de SDS-PAGE con azul de Coomassie

Los geles fueron retirados de la cámara electroforética, y uno se dispuso en una placa de petri con solución de tinción (metanol 45% (v/v), ácido acético glacial 10% (v/v), azul de

Coomassie G-250 0,25% (p/v), y el otro se utilizó para la realizar la técnica de western blot.

Esta placa se mantuvo con el buffer de tinción a temperatura ambiente durante 30 minutos en el equipo Mini BlotBoy (Benchmarck), realizando movimientos oscilatorios suaves.

Posteriormente, la solución de tinción fue eliminada y reemplazada por una solución de desteñido (metanol 45% (v/v), ácido acético glacial 10% (v/v)), renovándola tres veces a lo menos hasta visualizar las bandas de proteínas. Luego, al gel se le incorporó agua destilada para eliminar el exceso de solución de desteñido (Figura 2).

1.5. Análisis de Western blot

Para los análisis de Western blot, las proteínas fueron transferidas al interior de una membrana de PVDF 0,2 (Polyscreen 2, Perkin Elmer), previamente activadas en alcohol por 20 segundos, y montadas en un cassette. Este dispositivo se introdujo en una cámara electroforética (Modelo Mini-Protean, Tetra System, Bio-Rad) con un tampón de transferencia (25 mM Tris, 192 mM glicina, 20% de metanol, pH 8.3), a temperatura ambiente por 90 minutos a 300 mA. La membrana se bloqueó “overnight” a 4ºC con 5% de leche en polvo descremada, 0,1% de Twen-20 en PBS 1X, con oscilación permanente.

Posteriormente, se incubó con el anticuerpo policlonal anti-P450 aromatasa humana procedente de conejo (Raybiotech, Chile) overnight, a 4ºC, diluido 1:500, con Buffer de

Bloqueo (PBS 1X y BSA 0,1%). Se lavó la membrana con PBS 1X dos veces por 10 minutos; repitiendo esto dos veces. Posteriormente se incubó con anticuerpo secundario,

PierceTM Goat Anti-Rabbit IgG (H+L), diluido 1:1000 con Buffer de Bloqueo (PBS 1X y

BSA 0,1%) durante 1 hora a temperatura ambiente. Posteriormente, tras diversos lavados

en PBS 1X, los blots se revelaron con 2 ml del Kit de detección 1-StepTM NBT/BCIP plus

Suppressor (Thermo Scientific) durante aproximadamente 5-10 minutos.

2. Resultados y conclusión

Las concentraciones de proteínas totales para C. chorus registró valores entre los 0,843 y

1,059 mg/ml, según el método de Bradford, utilizando una curva de calibrado de BSA

(Figura 1). La visualización de las proteínas totales extraídas, se realizó con la tinción con azul de Coomassie del gel SDS-PAGE, permitiendo además verificar la integridad de las muestras de C. chorus extraídas de los diferentes tratamientos de manejo endocrino, que fueron desarrollado en el capítulo II parte I. Se ha puesto a punto, y estandarizado el método de extracción de proteínas, SDS-PAGE y análisis de western blot para la detección de la citocromo P450 aromatasa en el bivalvo C. chorus. En este sentido, esta será una útil herramienta para detectar la presencia de esta enzima en los tejidos de moluscos y así realizar investigaciones referentes a una de las enzimas involucradas en la síntesis de los esteroides sexuales.

3. Literatura citada

Rivas M., C. GARCÍA, J. LIBERONA, and N. LAGOS. 2000. Biochemical characterization and inhibitory effects of dinophysistoxin-1, okadaic acid and microcystine l-r on protein phosphatase 2a purified from the mussel Mytilus chilensis. Biological Reseach 33: 3-4.

ANEXOS

CAPÍTULO II

PARTE II

100

Figura 1. Curva de calibrado para determinar las proteínas totales de las muestras de C. chorus.

Figura 2. Gel de poliacrilamida SDS-PAGE. A: Estándar de Proteína; B: Control; C:

Tratamiento Dihidrotestosterona, DHT; D: Tratamiento DF; E: Tratamiento 17β-estradiol

(E2); F: Tratamiento Fadrozol F.

101

Kda A B C D E F

Figura 3. Western Blot. A: Estándar de Proteína; B: Control; C: Tratamiento

Dihidrotestosterona, DHT; D: Tratamiento DF; E: Tratamiento 17β-estradiol (E2); F:

Tratamiento Fadrozol F.

102

CAPÍTULO III

Selección y validación de genes de referencias como control interno para estudiar la

expresión de genes en tejidos del mejillón gigante Choromytilus chorus (Bivalvia

Mytilidae; Molina 1782)

Selection and validation of reference genes as internal controls to study gene

expression in tissues of the giant mussels Choromytilus chorus (Bivalvia Mytilidae;

Molina 1782)

103

Resumen

El objetivo del presente trabajo fue seleccionar genes de referencia como control interno para estudiar la expresión de genes en tejidos del mejillón Choromytilus chorus. Niveles de expresión relativa de doce genes candidatos: 1) ARN ribosomal 18S [18S], 2) ARN ribosomal 28S [28S], 3) beta actina [ACTB], 4) factor de elongación 1 alfa [ELF1α], 5) factor de elongación 2 alfa [ELF2α], 6) gliceraldehído-3-fosfato deshidrogenasa a [GAPDHa], 7) proteína ribosomal L7 [RPL7], 8) alfa tubulina [αTUB], 9) helicasa [HEL], 10) tubulina [TUB], 11) gliceraldehído-3-fosfato deshidrogenasa b [GAPDHb] y 12) factor de elongación 1 alfa b [ELF1b], fueron determinados en mejillones de Choromytilus chorus en diferentes estadíos del desarrollo ontogenético, tejido y sexo, además, de su estabilidad usando el algoritomo BestKeeper. Estos fueron examinados mediante la técnica de transcripción reversa PCR tiempo-real (qRT-PCR) en el tejido completo, glándula digestiva y gónada de C. chorus, en individuos de diferentes tallas (0,6 hasta los 100 mm), y sexo (indiferenciado, macho y hembra). Cinco diluciones seriadas de cDNA (desde 0,4 ng µL-1 a 20 ng µL-1) fueron usadas para preparar la curva estándar, y determinar la eficiencia de los genes, entre 96 y 100%, con un R2 = 0,9954. El análisis señalo a los genes 28S (100% de eficiencia) y 18S (100% de eficiencia) como los genes HKGs más estables en todos los tejidos, sexos y rangos de tallas ensayados. Los análisis con BestKeeper mostraron que 18S y 28S fueron los genes más estables. Estos resultados podrían ayudar a investigaciones futuras en aspectos de la reproducción, diferenciación sexual, desarrollo ontogenético, termorregulación y endocrinología en C. chorus.

Palabras claves: genes de referencia, mejillones, expresión de genes, eficiencia y estabilidad

104

Abstract

The objective of the present work was to select reference genes as an internal control to study the expression of genes in tissues of the mussel Choromytilus chorus. Relative levels of expression of twelve candidate genes: 1) 18S ribosomal ARN [18S], 2) 28S ribosomal ARN [28S], 3) beta actin [ACTB], 4) elongation factor 1 alpha [ELF1α], 5) elongation factor 2 alpha [ELF2], 6) gliceraldehydo-3-phosphate dehydrogenase [GAPDHa], 7) ribosomal protein L7 [RPl17], 8) Alpha tubulin [TUBA], 9) helicase [HEL], 10) tubulin [TUB], 11) gliceraldehído-3-phosphate dehydrogenase b [GAPDHb] and 12) elongation factor 1 alpha b [ELF1α_b], were determined in mussels of C. chorus in different stages of their ontogeny, tissue and sex, moreover, its stability using the software BestKeeper. These were examined by the real-time PCR (qRT-PCR) reverse transcription technique in the whole tissue, digestive gland and C. chorus gonad, in individuals of different sizes (0.6 to 100 mm), and sex undifferentiated, (male and female). Five serial dilutions of cDNA (from 0.4 ng µL-1 to 20 ng µL-1) were used to prepare the standard curve, and this showed a gene efficiency between 96 and 100%, with R2 = 0.9954.The analysis indicated that the genes 28S (100% efficiency) and 18S (100% efficiency) were the most stable HKG genes in all tissues, sexes and size ranges tested. Analyzes with BestKeeper showed that 18S and 28S were the most stable genes. These results could help future research on reproduction, sexual differentiation, ontogenetic development, thermoregulation and endocrinology in C. chorus.

Key word: reference genes, mussels, expression of genes, efficiency and stability.

105

1. Introducción

Los análisis de expresión son importantes en el campo de la biología molecular. La cuantificación de la expresión de genes pueden ser medidos usando técnicas semejantes a

PCR semi-cuantitativa, Northern Blot, microarrays y transcripción reversa PCR tiempo real

(RT-qPCR), entre otros (Garson et al. 2005). Sin embargo, la técnica más utilizada es la

PCR Cuantitativa Tiempo-real (qRT-PCR) por su alta sensibilidad para detectar mínimas cantidades iniciales de ácidos nucleicos, especificidad, velocidad de análisis, medición precisa del material examinado en la muestra, detección en tiempo real del progreso de la reacción, reproducibilidad y amplio rango dinámico de su metodología (Garson et al. 2005;

Bustin and Nolan 2004; Kubista et al. 2006). Los niveles de expresión de los genes mediante esta técnica son determinados por la cuantificación de la cantidad relativa de mRNA blanco en diferentes condiciones, usando la comparación de Ct (2-ΔΔCT, Livak and

Schmittgen 2001), o Pfaffl (2001) incluye un método que consiste en el ajuste por eficiencia de amplificación.

El ensayo de RT-qPCR, sin duda, es una de las herramientas más importantes (Wan et al.

2011), no estante, diversas variables pueden influir en los resultados de los análisis. Esta técnica está sujeta a un considerable error experimental y variación, atribuidas a la recolección y estabilización de la muestra, cantidad de muestra, aislación del ARN, diferencias en la cantidad y calidad del ARN, co-purificación de compuestos inhibitorios, error de pipeteo, variabilidad biológica, eficiencia de la transcripción reversa y al diseño

106

experimental (Dheda et al. 2004). Para contar esta variación, es comúnmente reconocida la normalización usando genes internos que se expresan en niveles constantes. Estos genes son comúnmente conocidos como “genes de referencia” o genes housekeeping en inglés, son ampliamente utilizados y se caracterizan por tener niveles de transcripción de mARN estables (intensidad o duración) no afectadas por las condiciones experimentales a las cuales están siendo sometidos (Dondero et al. 2006; Cellura et al. 2006).

La expresión diferencial de genes blancos es normalizada y cuantificada en relación a estos genes de referencia. Por lo tanto, determinar la estabilidad de expresión bajo situaciones experimentales es un requerimiento esencial previamente a la utilización de un gen dado como estandarización interna. Es usualmente aceptado que los genes de referencia son expresados a niveles constante porque ellos están asociados con mantener la homeostasis

(García-Vallejo et al. 2004) y viabilidad celular (Arenz et al. 2007); pero su expresión puede fluctuar en diferentes tejidos (Barber et al. 2005; Rubie et al. 2005), tipos de células

(Bas et al. 2004) y diferentes estímulos ambientales (Arenz et al. 2007; Nicot et al. 2005).

Los genes de referencia más usados en RT-qPCR son 18S rRNA, gliceraldehído -3-fosfato dehidrogenasa (GAPDH) y β-actina (Hugget et al. 2005; Suzuki et al. 2000). Estos genes están involucrados en la estructura del ribosoma, metabolismo y citoesqueleto, respectivamente, y sus niveles de expresión asumen niveles constantes (Huvet et al. 2003;

Dondero et al. 2006).

107

Al presente, no se ha descrito un gen de referencia ideal y que sea estable bajo todas las circunstancias experimentales, varias investigaciones han demostrado que los genes de referencia utilizados tradicionalmente pueden generar perfiles de expresión variables bajo diferentes condiciones experimentales, y que los resultados obtenidos con un gen de referencia validado y no validado para normalizar los datos pueden ser significativamente diferentes (Cubero-Leon et al. 2012). La selección del mejor control depende del tipo de tejido usado, y por lo tanto, es necesario evaluar varios tipos de genes con diferentes funciones biológicas y determinar su valor de estabilidad (Vandesompele et al. 2002). Para esto, varios algoritmos matemáticos (GeNorm, BestKeeper y NorFinder) están disponibles para asegurar la estabilidad de genes de referencia como genes normalizadores en experimentos de qPCR (Vandesompele et al. 2002; Andersen et al. 2004).

En moluscos, existe una falta de estudios acerca de la selección de los genes de referencia

(Wan et al. 2011). Al presente, existen pocos reportes acerca de los genes de referencia en bivalvos marinos (Araya et al. 2008; Cubero-Leon et al. 2012; Dheilly et al. 2011; Morga et al. 2010; Siah et al. 2008) y en los bivalvos la mayoría se han realizado en hemocitos

(Araya et al. 2008; Morga et al. 2010; Siah et al. 2008). Los diferentes genes de referencia han sido validados en moluscos para: determinar los niveles de expresión de genes a respuestas inmunes (Araya et al. 2008), detección de ploidia de hemocitos (Siah et al.

2008), cuantificación de los niveles de infección por agentes virales (Dhar et al. 2009), determinar interacción parásito-hospedador (Morga et al. 2010) y estudios de ontogenia

(Du et al. 2013; López-Landavery et al. 2014).

108

En Chile, se destaca el mejillón Choromytilus chorus (Molina 1782), conocido comúnmente como “choro zapato” o “choro maltón”, se distribuye desde Callao (Perú) hasta el Estrecho de Magallanes en Chile (Osorio et al. 1979). Su distribución batimétrica está comprendida desde los 3 hasta los 20 m de profundidad, habita sustratos rocosos.

Generalmente, mantiene una proporción sexual macho: hembra cercana a 1:1 de manera estable (Stuardo 1959), con una talla de diferenciación sexual y primera madurez sexual en el rango de 22-24 mm y 38-40 mm, respectivamente (Ruiz et al. 2016), basados en análisis histológicos. En C. chorus, no existen estudios referentes a validaciones de genes de referencias, las investigaciones se han focalizados en aspectos reproductivos y fisiológicos

(Navarro 1988; Toledo et al. 1990; Davis and Moreno 1995; Moreno 1995; Bellolio et al.

1996; Thiriot-Quievreux 2002; Lafarga-De la Cruz 2008; Avendaño and Cantillánez 2011).

Sin embargo, este mejillón es una especie de importancia ecológica y económica (Moreno

1995; Navarro 1988) en nuestro país, por lo tanto es fundamental comprender aspectos relacionados a la reproducción, diferenciación sexual, fisiología y endocrinología.

Al mismo tiempo, es de interés mejorar el conocimiento de este mejillón y de invertebrados en aspectos relacionados a la determinación y diferenciación sexual, reproducción y maduración gonadal para fines de acuicultura a través de estudios moleculares. En respuesta a esto, el objetivo del presente estudio fue seleccionar y validar genes de referencia asociados a tejidos blancos implicados en aspectos básicos de biología en mejillones de C. chorus, como un primer paso para estudios de expresión de genes relacionados a la reproducción, desarrollo ontogenético y diferenciación sexual de este mejillón. En este contexto, se comparó la estabilidad de doce genes de referencia: 1) ARN

109

ribosomal [18S], 2) ARN ribosomal [28S], 3) beta actina [ACTB], 4) factor de elongación

1 alfa [ELF1α], 5) factor de elongación 2 alfa [ELF2α], 6) gliceraldehído-3-fosfato deshidrogenasa [GAPDHa], 7) proteína ribosomal L7 [RPL7], 8) alfa tubulina [αTUB], 9) helicasa [HEL], 10) tubulina [TUB], 11) gliceraldehído-3-fosfato deshidrogenasa

[GAPDHb] y 12) factor de elongación 1 alfa [ELF1αb] en mejillones, Choromytilus chorus, en diferentes estadíos del desarrollo ontogenético usando el algoritmo estadístico

BestKeeper.

2. Materirales y métodos

2.1. Recolección y aclimatación de los animales

Individuos en fase juvenil de C. chorus (n=100) fueron recolectados desde un sitio relativamente libre de contaminación con poca actividad antropogénica, Caleta Errázuriz,

Isla Santa María, región de Antofagasta, Chile (Latitud: 23°26'29.98"S, Longitud:

70°35'46.12"O), en Septiembre de 2015. Estos fueron trasladados vivos al laboratorio de reproducción (Edificio LEA, Universidad de Antofagasta, Chile) bajo condiciones frías, posteriormente, limpiados de epibiontes y detritus adheridos en las valvas y mantenidos en estanques de 50L de fibra de vidrio con aireación constante, agua de mar natural circulante a 17-20°C y filtrada a 1 µm, durante 3 días. Estos especímenes fueron usados para la selección y validación de los genes de referencia.

110

2.2. Muestreo

A cada individuo se le midió, mediante un piedemetro (±0,1mm), la talla total (Lt: distancia entre el umbo y el borde opuesto) de los mejillones y peso drenado, posteriormente fueron clasificados en ocho rangos de tallas: rango de talla 1= 0,6-10 mm, rango de talla 2= 11-20 mm, rango de talla 3= 21-30 mm, rango de talla 4= 31-40 mm, rango de talla 5= 41-50 mm, rango de talla 6= 51-60 mm, rango de talla 7= 61-70 mm y rango de talla 8= 7,1-8 mm, muestreando 12 individuos por cada rango de talla. Se seleccionó este amplio rango de tallas porque dentro de estas tallas se encuentran individuos indiferenciados, individuos en talla de primera diferenciación sexual y reproductores (Retamal 2003; Ruiz et al. 2016).

Los mejillones se lavaron con agua de mar (SW) filtrada a 1µm, las fibras del biso fueron removidos y posteriormente diseccionados. Los animales diferenciados fueron clasificados por sexos, mediante la observación de la coloración del lóbulo manto-gónada bajo lupa binocular; donde la gónada de color crema-amarillento correspondió a macho, y la gónada de coloración café a hembra. Además, se realizó la verificación del sexo mediante el análisis de la muestra de una biopsia de la gónada visualizado bajo microscopio óptico, reconociendo los ovocitos y los espermatozoides de las hembras y machos, respectivamente. Además, en estos individuos se determinó el estado de madurez sexual, de acuerdo a la metodología de Tarifeño (2005-2008), realizando una modificación a esta escala al adicionar un cuarto estado de madurez.

111

Para realizar el muestreo, a cada individuo se le extrajo el tejido completo, gónada y glándula digestiva de acuerdo al rango de talla muestreado, en una placa de petri con agua de mar y hielo. A los animales con rangos de talla menores a los 30 mm se les extrajo el tejido completo y a los de mayores tamaños los tejidos del manto-gónada y glándula digestiva. Consecutivamente, el tejido obtenido se depositó en tubos eppendorf de 2 ml y falcón de 15 ml, manteniendo la independencia por rango de talla, tejido y por sexo. Las muestras fueron fijadas en nitrógeno líquido e inmediatamente almacenadas a -80°C hasta realizar la extracción de ARN.

2.3. Extracción de ARN total

El tejido fue preparado para análisis de ARN total, síntesis de cDNA y PCR en tiempo real para los genes de referencia. Para la extracción de ARN total, se utilizó el método de extracción fenólica con Trizol (Reagent® InvitrogenTM Life Technologies), estandarizada para mitílidos en el presente estudio. De cada tejido muestreado se tomaron 10 mg de muestra, se trituraron en el homogenizador de tejido marca Ultra Turrax, y se lisaron con una solución de Trizol® (500 µl) y solución A (500 µl, SDS 10%, NaOAC 3M Ph 5.0,

EDTA 0,5M), dejándola incubar a 65°C durante 20 minutos para recuperar la fase acuosa.

Posteriormente, se procedió a la etapa de precipitación para esto a cada muestra se le incorporó 500 µl de cloroformo Isoamílico (CI:IAA) y se centrifugo a 12.500 RPM durante

5 minutos a 4°C, recolectando el sobrenadante en el cual se encontraba el ARN. Después de la adición de fenol ácido (500 µl) más cloroformo (100 µl), la muestra fue centrifugada

112

durante 5 minutos a 12.500 RPM a 4°C, repitiendo tres veces este proceso y rescatando la fase acuosa superior en todos los casos. Dos volúmenes de etanol biológico al 100 % fueron incorporados al volumen de la fase acuosa obtenida, y se dejó incubar a -20°C durante toda la noche. Subsiguientemente, las muestras fueron centrifugadas durante 25 minutos a

12.500 RPM a 4ºC, y se desechó el sobrenadante. El pellet de ARN resultante fue lavado con etanol al 70% (1 ml), se dejó secar al aire durante 10 minutos (bajo campana).

Finalmente, se le adicionaron 20 µl de agua de grado molecular para su cuantificación y mantención a -80°C, hasta realizar los análisis.

2.4. Tratamiento con DNasa y síntesis de cDNA

La calidad y cantidad de ARN fue determinada usando un espectrofotómetro BioSpec-nano

(Shimadzu Biotech). Las muestras de ARN a una razón 260/280 >1,8 fueron usadas para los análisis (indicando pureza), para lo cual previamente a la síntesis de cDNA se realizó una purificación del ARN de todas las muestras para cumplir con este rango óptimo, mediante un tratamiento con la enzima DNAa I Thermo Scientific. Para esto, 10 µg de RNA de cada muestra fueron aforados a 20 µl con agua calidad microbiológica (DEPC), a la cual se le incorporó 2 µl de buffer 10X y 2 µl de la enzima DNasa I. Se dejaron incubar a temperatura de 37°C durante 30 minutos, para su posterior inoculación de 2 µl de EDTA, e incubando durante 10 minutos a 65°C. Se mantuvieron en hielo para su cuantificación en el espectrofotómetro BioSpec-nano (Shimadzu Biotech). Posteriormente, se almacenaron a -

80°C hasta su análisis.

113

La primera banda de cDNA fue sintetizada a partir de 3 µg de ARN total usando la transcriptasa reversa modelo K1621 Thermofisher Scientific. Se realizaron 2 master mix, el primero consistió en 3 µl de ARN tratadas con DNasa I, 1 µL de oligonucleótidos (primers random) y 8 µl de agua DEPC (aforando a 12 µl), se mezclaron e incubaron en el termociclador marca Applied Biosystems by Life Technologies a 65°C durante 5 minutos y mantuvieron sobre hielo durante 1 minuto. El segundo mix fue de 4 µl de buffer de reacción 5X, 1 µl de ribolock (inhibidor de ARNasas), 2 µl del mix DNTPs 10 nM y 1 µl de la transcriptasa reversa fueron incorporados al volumen total de 20 µl, resultando en un volumen final de 8 µl, que fue incubado a 47°C durante 60 minutos seguidos por 70°C durante 5 minutos.

La calidad y cantidad del cDNA fue verificada a través de la absorbancia. El cDNA fue llevado a un volumen final de 20 µl de muestra. Posteriormente, fueron mantenidas a 4°C para su cuantificación en el espectrofotómetro BioSpec-nano (Shimadzu Biotech) y almacenadas a-80°C.

2.5. Grupos experimentales

Se realizaron los siguientes tres grupos experimentales: i) rango de talla, ii) sexo y iii) tejido. El primer grupo, estuvo clasificado en 8 clases: 0,6-10, 11-20, 21-30, 31-40, 41-50,

51-60, 61-70 y 71-80 mm y el segundo fue clasificado en las categorías de indiferenciado,

114

macho y hembra. En tanto, el tercer grupo fue subdividido en tejido completo, glándula digestiva y gónada (masculina y femenina). Del total de muestras obtenidas (incluyendo a los tres grupos experimentales) se obtuvo un total de 69 muestras de cDNA, de las cuales se extrajo 1µl de cDNA por muestra para la realización de pool (mix). Se realizó un total de dos pool con los tres grupos, cada uno fue considerado como una réplica biológica, de acuerdo a la metodología de López –Landavery et al. (2014). El pool fue cuantificado para comprobar su concentración e integridad mediante el espectrofotómetro BioSpec-nano

(Shimadzu Biotech). Finalmente, cada pool fue evaluado independientemente como ha sido reportado por McCurley and Callard (2008).

2.6. Selección de genes de referencia

Doce genes de referencia citados frecuentemente en las investigaciones en el género

Mytilus fueron usados en este estudio (Tabla 1), ya que se diseñaron primers degenerados y no funcionaron para C. chorus. Los genes que se incluyeron tenían una gran eficiencia y estabilidad: 1) ARN ribosomal [18S], 2) ARN ribosomal [28S], 3) beta actina [ACTB], 4) factor de elongación 1 alfa [ELF1α], 5) factor de elongación 2 alfa [ELF2α], 6) gliceraldehído-3-fosfato deshidrogenasa [GAPDHa], 7) proteína ribosomal L7 [RPL7], 8) alfa tubulina [αTUB], 9) helicasa [HEL], 10) tubulina [TUB], 11) gliceraldehído-3-fosfato deshidrogenasa [GAPDHb] y 12) factor de elongación 1 alfa [ELF1αb] (Cubero-Leon et al. 2010; Martínez-Escauriaza 2013; Lacroix et al. 2014). Los oligonucleótidos fueron sintetizados por Integrated DNA Technologies (Coralville, Iowa). En este contexto, se

115

comparó la estabilidad de los genes de referencia que registraron una alta eficiencia en C. chorus.

2.7. Tm óptimo para los tejidos muestreados

Para cada par de primers de los 12 genes de referencia se realizó un PCR usando cDNA.

Este incluyo un master mix, con 12,5 µl de la polimerasa Sapphire Amp Fast PCR Takara,

2 µL de ADNc, 9,5 µl de agua DEPC, y 1 µl de primer, se mezclaron e incubaron en el termociclador SimpliAmp (Applied Biosystems by Life Technologies). Las condiciones de la reacción fueron las siguientes: 5 min a 95°C, 35 ciclos de 1 min a 95°C seguido por 1 min a 55°C (temperatura de melting o alineamiento) y 1 min a 72 °C, y finalmente 5 min a

72°C. Se ensayaron distintas temperaturas de melting para los 12 genes, las que estuvieron dentro del rango 51°C- 60°C, esto con el propósito de obtener la temperatura de alineamiento más óptima para realizar la hibridación de los cDNA de los genes.

Alícuotas iguales de cada reacción de PCR fueron separadas sobre un gel de agarosa 3%

(3g) usando buffer TAE 1X (100 ml), 8 µl de gelred (marcador de ADN), 2 µl de buffer de carga por muestra y 20 µl del producto de PCR. Se dejaron correr en una cámara de electroforesis durante 25 min a 90 volt, para después ser registradas en el analizador de imágenes Gel Doc™ Imager, y analizadas con el software Image Lab (versión 5.1).

Finalmente, los genes de referencia que amplificaron fueron visualizados en un gel de

116

agarosa. Se observó que la temperatura de 55°C fue la Tm óptima en las muestras ensayadas, así es que con esta se realizó la hibridación de los cDNA de los genes (figura 1).

2.8. RT-qPCR tiempo real

SYBR Green real-time PCR fue corrido en el equipo de qPCR Applied Biosystem by Life

Technologies, en triplicado. Controles no-templados (CNT) también fueron incluidos en cada corrida. La reacción de RT-qPCR estaba compuesta por 5 µl de SYBR® Green PCR master mix de thermofisher scientific, 0,5 µl de mix primers forwars más reverse 10 µM, 1

µl de cDNA del pool, 3,5 µl de agua DEPC y un volumen final homogenizado de 10 µl.

Las condiciones de reacción fueron las siguientes: 10 min a 95°C, 40 ciclos de 15 s a 95°C seguido por 1 min a 55°C y 15 s a 95°C, y finalmente 60°C durante 1 min y 95°C durante

15 s . Al final de cada corrida se obtuvo una curva de melting: 20 s a 95°C y 30 s a 60°C seguido por incrementos de la temperatura desde 60 a 100°C (la temperatura incremento en pasos de 0,5 °C cada 10 s). Los valores basales fueron automáticamente determinados para todas las muestras usando el algoritmo estadístico BestKeeper.

Para generar la base de datos para determinar la eficiencia de amplificación del PCR de cada transcripto de cada gen de referencia, se realizaron diluciones seriadas de todos los cDNAs disponibles (Pfaffl et al. 2002) para tener un mayor rango de detección de la expresión de los oligonucleótidos, utilizando el Programa StepOneTM Software (For

StepOneTM and StepOne PlusTM Real-Time PCR System versión 2.3). Por lo tanto para

117

cada par de primer, se obtuvo una curva estándar basada en la cantidad de cDNA conocida

(5 diluciones seriadas fueron hechas: 1/10, 1/25, 1/100, 1/250 y 1/500, ensayadas en triplicado). La tabla 2 y figura 1 indican la eficiencia de amplificación por PCR. La eficiencia del PCR de amplificación debe considerarse para tener una cuantificación confiable, y se define como el porcentaje (desde 0 a 1, o desde 0 a 100) o como un folds de incremento del producto de PCR por ciclo (desde 1 a 2). La eficiencia del PCR (definida como porcentaje) fue calculada a partir de la pendiente de la curva estándar (Rasmussen

2001):

E = 10(-1/pendiente) – 1 E(%) = (10(-1/pendiente) – 1) x 100

2.9. Análisis de datos

El algoritmo estadístico BestKeeper (Pfaffl et al. 2004) fue usado para determinar la estabilidad de expresión de los genes de referencia. Previamente a la entrada de datos, los valores de los ciclos de cuantificación (Cq) fueron convertidos en cantidades relativas

(RQ). El más bajo valor de Cq o el máximo nivel de expresión de cada gen fue usado para calibrar y arbitrariamente se le asigno un valor de 1. Asumiendo que la eficiencia de qPCR fue 100%, la cantidad relativa fue calculada usando la formula de RQ=1 / (2(Cq,sample −

Cq,calibrater) (Latham 2010).

118

3. Resultados

3.1. Cantidad y calidad del ARN total

El ARN total fue purificado desde el tejido completo, glándula digestiva y gónada y la concentración de ARN total promedio fue de 1.500 ng/µl para estos tres tejidos. El promedio total de la relación de la absorbancia A260/280 fue de 1,90 y 1 en la relación

A260/230. Estos valores indican una alta pureza de ARN, libre de proteínas, compuestos fenólicos y tiocianato guanidina. Además, el gel denaturado de electroforesis de agarosa confirmo la integridad del ARN.

3.2. RT-qPCR amplificación de primers

Doce genes de referencia con diferentes funciones celulares (18S, 28S, ACTB, ELF1α,

ELF2α, GAPDHa, RPL7, αTUB, HEL, TUB, y GAPDHb) fueron medidos por RT-qPCR en tres tipos de tejidos de C. chorus (tejido completo, glándula digestiva y gónada.

Cuando los NTC tuvieron amplificación, estos mostraron estas características: a) Cq ≥ 35 y b) Cq, NTC – Cq max, muestra > 10; esto indica una correcta amplificación entre muestras y control (López-Landavery et al. 2014). De los 12 genes ensayados, sólo 3 de ellos registraron un porcentaje de eficiencia aceptable mayor, mayor al 90%, correspondiendo al

18S, 28S y TUBA (tabla 2).

119

El coeficiente de determinación (R2) para las curvas estándar de estos 3 genes presentó valores dentro de los 0,78 y 0,9954. Estos resultados demostraron la alta reproducibilidad y especificidad de los primers seleccionados, como fue confirmado por el análisis de las curvas de melting con un solo peak (figura 2-3-4). Estos resultados permitieron seleccionar sólo 2 pares de primers 18S y 28S, para determinar la estabilidad. Los valores de estabilidad fueron calculados utilizando el algoritmo BestKeeper.

3.3 Análisis de estabilidad de la expresión de los genes de referencia

El algoritomo BestKeeper fue usado para analizar la expresión de la estabilidad de los genes, donde los genes 18S y 28S fueron los más estables. Estos resultados fueron clasificados por tipo de tejido (glándula digestiva y gónada) y talla (juveniles tempranos, juveniles tardíos y adultos). En la glándula digestiva el gen 28S fue el más estable, con un valor de 1,1 seguido por el gen 18S con un valor de 2,32. Asimismo, en la gónada el gen

28S registró el mejor valor de estabilidad de 1 y de 2,24 el gen 18S. En la talla aconteció de forma similar a los otros tejidos, ya el gen 28S registró un valor de 0,84 y el gen 18S un valor de 2,21. En consecuencia, los resultados obtenidos para C. chorus indican que el gen más estable es el 28S.

120

4. Discusión

La validación de los genes de referencia para estudios acerca de la expresión de genes usando datos de RT-qPCR es importante para tener una intertepretación biológica apropiada y sus implicancias en las funciones de la célula o tejido. Se ha relizado ampliamente la validación de genes en muchas líneas de células; células de cáncer de prostata, líneas celulares de neuroblastoma y cultivo de células T0 en el salmón del atlántico (Mogal and Abdulkadir 2006; Ingerslev et al. 2006) y en organismos modelo para la investigación en diferentes campos; Mya arenaria, Pecten maximus, Haliotis rusfescens,

Pseudo-nitzschia multistriata, Homo sapiens y Salmo salar (Araya et al. 2008; Cubero-

Leon et al. 2012; Adelfi et al. 2014; Siah et al. 2008; Wan et al. 2011). No obstante, este estudio representa el primer esfuerzo hacia la validación de genes de referencia o genes housekeeping (GHK), en Choromytilus chorus, un importante molusco de importancia ecológica y económica para nuestro país.

Debido a la alta sensibilidad y robustes de la técnica, el RT-qPCR es ampliamente usado para la cuantificación de la expresión de genes. Sin embargo, la cuantificación de la expresión de genes de transcritos estables que pueden ser usados como controles internos es absolutamente necesario y es un prerrequisito (Arenz et al. 2007). Los estudios han demostrado que el uso de un solo gen de referencia no es exacto para normalizar la cuantificación de la expresión de un gen y que un set de varios genes de referencia es fundamental para esto (Vandesompele et al. 2002; Bustin et al. 2009). Los genes de referencia reducen la variabilidad generada por el tamaño de muestra, cantidad y calidad de

121

ARN, eficiencia de la síntesis de cADN o la presencia de compuestos inhibidores de PCR

(Bustin and Nolan 2004; Dheda et al. 2004; Nolan et al. 2006).

El protocolo de extracción estandarizado para mitílidos en el laboratorio permitió obtener la cantidad de ARN total suficiente para el procedimiento posterior; para la obtención de cDNA, PCR y RT-qPCR. Assimisno, la relación de la absorbancia A260/280 fue de 1.9, la integridad del ARN fue verificada mediante geles de agarosa y acrilamida, y la misma cantidad de ARN total fue usada para la síntesis de cDNA. Estas consideraciones son importantes no sólo cuando los genes de referencia son validados, sino que también cuando los ensayos de expresión se realizan con el gen de interés per se (Bustin et al. 2009). En la presente investigación se ha demostrado que la relación de la absorbancia A260/280 fue mayor a 1.8 lo que asegura una buena calidad de ARN, y en los geles de e observó una buena integridad de ARN.

Los parámetros usados y que fueron determinados en la presente investigación para definir la calidad de la amplificación de la RT-qPCR fueron la eficiencia, coeficiente de determinación (R2) y un único peak de la curva de melting. Los valores de eficiencia recomendada varian entre 0.9 y 1.1 (Doak and Zair 2012; Schmittgen and Livak 2008) y el valor de R2 debe ser mayor a ≥ 0.985 (Kavanagh et al. 2011). En el presente estudio, los valores de eficiencia y valores de R2 (Tabla 2) cumplen con estas especificaciones. Los valores de eficiencia reflejan el primer paso de especificidad y también relacionan al tamaño del amplicon. El tamaño del amplicón recomendado para PCR tiempo real recomendado es de 60 a 150 bp (Czechowski et al. 2004; Nolan et al. 2006; Udvardi et al.

122

2008), con un máximo de 300 pb (Dussault and Pouliot 2006). En este caso, el tamaño del amplicon para los genes de referencia vario entre los 114 y 274 pb, y esto probablemente contribuyo a un buen valor de eficiencia.

En este estudió, se reportó la expresión de 12 genes de referencia usados en diferentes especies del género Mytilus (Mytilus spp., Mytilus edulis y Mytilus galloprovincialis). Los valores de estabilidad fueron evaluados en diferentes tejidos (glándula digestiva y gónadas), y talla (juveniles tempranos y tardíos, y reproductores), en C. chorus el algoritmo

BestKeeper. Los genes candidates están involucrados como proteínas ribosomales (18S y

28S) y fueron elegidos porque tuvieron una mayor eficiencia. Los análisis de estabilidad usando el algoritomo de BestKeeper demostraron que el gen 28S es el más estable en diferentes estadíos ontogeneticos, gónada y tejido. Estos genes han sido usados frecuentemente como genes de referencia de varios órganos en especies de mitílidos.

Estudios realizados en Mya areanaria señalan a EF-1 y 18S como los genes más estables

(Araya et al. 2008).

En conclusión, doce genes de referencia con diferentes funciones fueron seleccionados y validados por primera vez en diferentes tejidos, estadíos ontogenéticos (juveniles tempranos, tardíos y adultos) y sexo en el mejillón C. chorus. De estos genes sólo tres de ellos fueron los más eficientes; αtubulina, 18S ARN ribosomal y 28S ARN ribosomal. El

último gen demostró ser el más estable y ya puede ser usado para normalizar datos de estudios de RT-qPCR en C. chorus. Los resultados de los grupos experimentales de mostraron la clara importancia de seleccionar y validar genes de referencia con una o más

123

aproximaciones para evitar preferencia o fallar en la selección de los genes que son verdaderamente estables. Finalmente, los resultados obtenidos en el presente estudio pueden ser una guía para futuros estudios de RT-qPCR en moluscos bivalvos, mitílidos, ya que claramente se requieren más investigaciones en esta área.

124

Literatura citada

Araya M.T., A. Siah, D. Mateo, F. Markham, P. McKenna, G. Johnson, and F.C.Berthe. 2008. Selection and evaluation of housekeeping genes for haemocytes of soft-shell clams (Mya arenaria) challenged with Vibrio splendidus. Journal Invertebrates Pathological 99: 326-331.

Arenz A., N. Stojicic, P. Lau, C.E. Hellweg, and C. Baumstark-Khan. 2007. Suitability of commonly used housekeeping genes in gene expression studies for space radiation research. Advances in Space Research 39: 1050–1055.

Avendaño, M. and M. Cantillánez. 2011. Reestablecimiento de Choromytilus chorus (Molina, 1782) (Bivalvia: Mytilidae) en el norte de Chile. Latin American Journal Aquatic Research 39: 390-396. [In Spanish]

Bellolio, G., E. Toledo and E. Dupre. 1996. Desarrollo larvario de Choromytilus chorus en condiciones de laboratorio. Scientia Marina 60: 353-360. [In Spanish]

Bustin, S.A. and T. Nolan. 2004. Pitfalls of quantitative real-time reverse –transcription polymerase chain reaction. Journal of Biomolecular Techniques 15: 155-166.

Cellura, C., M. Toubiana, N. Parrinello, and P. Roch. 2006. HSP70 gene expression in Mytilus galloprovincialis hemocytes is triggered by moderate heat shock and Vibrio anguillarum, but not by V. splendidus or Micrococcus lysodeikticus. Developmental Comparative and Immunology 30: 984–997.

Cubero-Leon, E., C. Ciocan, C. Minier, and J. Rotchell. 2012. Reference gene selection for qPCR in mussel, Mytilus edulis, during gametogenesis and exogenous estrogen exposure. Environmental Science Pollution Research 19: 2728-2733.

Davis, A. and C. Moreno. 1995. Selection of substrata by juvenile Choromytilus chorus (Mytilidae): are chemical cues important?. Journal of Experimental Marine Biology and Ecology 191: 167-180.

Dhar, A.K., R.M. Bowers, K.S. Licon, G. Veazey, and B. Read. 2009. Validation of reference genes for quantitative measurement of immune gene expression in shrimp. Molecular Immunology 46: 1688-1695.

Dheda, K., J. Huggett, S. Bustin, M. Johnson, G. Rook, and Z. Alimddin. 2004. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. BioTechniques 37: 112-119.

Dheilly, N.M., C. Lelong, A. Huvet, and P. Favrel. 2011. Development of a Pacific oyster (Crassostrea gigas) 31, 918-feature microarray: identification of reference genes and tissue .enriched expression patterns. BMC Genomics 12, 468.

125

Dondero, F., A. Dagnino, H. Jonsson, F. Caprí, L. Gastaldi, and A. Viarengo. 2006. Assessing the occurrence of a stress syndrome in mussels (Mytilus edulis) using a combined biomarker/gene expression approach. Aquatic Toxocology 78S: S13-S24.

Du, Y., L. Zhang, F. Xu, B. Huang, G. Zhang, and L. Li. 2013. Validation of housekeeping genes as internal controls for studying gene expression during Pacific oyster (Crassostrea gigas) development by quantitative real-time PCR. Fish Shellfish Inmmunology 34: 939- 945.

García-Vallejo, J.J., B. Van het Hof, J. Robben, J.A. Van Wijk, I. Van Die, D.H. Joziasse, and W. Van Dijk. 2004. Approach for defining endogenous reference genes in gene expression experiments. Analytical Biochemistry 329: 293–299.

Huggett, J., K. Dheda, S. Bustin, A. Zumla. 2005. Real-time RT-PCR normalisation; strategies and considerations. Genes Immunology 6 (4): 279–284.

Huvet, A, J.Y. Daniela, C. Quéré, S. Dubois, M. Prudence, and V. Wormhoudt. 2003. Tissue expression of two a-amylase genes in the Pacific oyster Crassostrea gigas:effects of two different food rations. Aquaculture 228: 321-333.

Kubista, ., . . Andrade, . Bengtsson, A. Forootan, . onák, K. Lind, R. Sindelka, R. Sj back, B. Sj green, L. Str mbon, A. St hlberg, and N. Zoric. 2006. The real-time polymerase chain reaction. Molecular Aspects of Medicine 27: 95-125.

Lacroix, C., V. Coquille, J. Guymarch, M. Auffret, and D. Moraga. 2014. Selection of reference genes and early-warning mRNA biomarkers for environmental monitoring using Mytilus spp. as sentinel species. Marine Pollution Bulletin 86: 304–313.

Latham G.J. 2010. Normalization of microRNA quantitative RT-PCR data in reduced scale experimental designs. In: Monticelli, S. (Ed.), MicroRNAs and the Immune System: Methods and Protocols, Methods in Molecular Biology. vol. 667. Humana Press Inc., Totowa, NJ, pp. 19–31.

Lafarga-De la Cruz, F., M. Valenzuela-Bustamante, E. Dupré, M. Del Río-Portilla, and E. Gallardo-Escárgaate. 2008. Genomic integrity evaluation in sperm of Choromytilus chorus (Molina, 1782) by comet assay. Gayana 72: 36-44. Livak, K.J. and T.D. Schmittgern. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Deltaa C(T)). Method, Methods 25: 402-408.

López-Landavery, A., A. Portillo-López, C. Gallardo-Escárate, M. Del Río-Portilla. 2014. Selection of reference genes as internal controls for gene expression in tissues of red abalone Haliotis rufescens (Mollusca, Vetigastropoda; Swainson, 1822). Gene 549: 258– 265.

126

Martínez-Escauriaza, A. 2013. Identificación de genes implicados en la eliminación de biotoxinas en el mejillón Mytilus galloprovincialis Lmk.: clonación y expresión de los cDNA que codifican para dos proteínas transportadoras ABC de la subfamilia B (proteínas MDR). Memoria de tesis doctoral para optar al título de Doctor. Universidad de Santiago de Compostela. [In Spanish]

McCurley, A.T. and G.V. Callard. 2008. Characterization of housekeeping genes in zebrafish: male–female differences and effects of tissue type, developmental stage and chemical treatment. BMC Journal of Molecular Biology 9, 102.

Moreno, C. 1995. Macroalgae as a refuge from predation for recruits of the mussel Choromytilus chorus (Molina, 1782) in Southern Chile. Journal of Experimental Marine Biology and Ecology 191: 181-193.

Morga, B., I. Arzul, N. Faury, and T. Renault. 2010. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish Shellfish Immunology 29: 937-945.

Navarro, J. 1988. The effects of salinity on the physiological ecology of Choromytilus chorus (Molina, 1782) (Bivalvia: Mytilidae). Journal Experimental Marine Biology and Ecology 122:19-33.

Nicot, N., J.F. Hausman, L. Hoffmann, and D. Evers. 2005. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. Journal of Experimental Botany 56: 2907–2914.

Osorio, C., J. Atria, and S. Mann. 1979. Moluscos marinos de importancia económica en Chile. Biología Pesquera Chile 11: 3-47. [In Spanish]

Pfaffl, M. 2001. A new mathematical model for relative quantification in real-time RT- PCR. Nucleic Acids Research 29: 2002-2007.

Pfaffl, M., G. Horgan, and L. Dempfle. 2002. Relative expression software tool (Rest ©) for group-wise comparison and statistical analysis of relative expression results in real time PCR. Nucleic Acids Research 30:36.

Rasmussen, R. 2001. Quantification on the LightCycler. In S. Meuer., C. Wittwer, and K. Nakagawara (eds), Rapid Cycle Real-time PCR, Methods and Applications. Springer Press, Heidelberg, pp. 21–34.

Retamal, R. 2003. Modificación de la proporción sexual en individuos juveniles de Choromytilus chorus mediante la administración de extracto gonadal. Seminario de Título, Carrera de Biología Marina, Universidad de Concepción. Chile. [In Spanish]

127

Ruiz, A., M. Zapata, M.T. González, D. Ordenes, and M. Escalona. 2017. Sexual differentiation and size at first maturity of the mussel Choromytilus chorus (Molina, 1782) (Mollusca, Mytilidae) in northern of Chile. American Malacological Bulletin 35(1):31-41.

Rubie, C., K. Kempf, J. Hans, T. Su, B. Tilton, T. Georg, B. Brittner, B. Ludwig, and M. Schilling. 2005. Housekeeping gene variability in normal and cancerous colo rectal, pancreatic, esophageal, gastric and hepatic tissues. Molecular and Cellular Probes 19: 101–109.

Siah, A., C. Dohoo, P. Mckenna, M. Delaporte, and F.C. Berthe. 2008. Selecting a set of housekeeping genes for quantitative real-time PCR in normal and tetraploid haemocytes of soft-shell clams, Mya arenaria. Fish Shellfish Immunology 25: 202-207.

Bas, A., G. Forsberg, S. Hammarstrom, and M.L. Hammarstrom. 2004. Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphatedehydrogenase for normalization in real-time quantitative reverse transcriptase-polymerase chain reaction analysis of gene expression in human T lymphocytes. Scandinavian Journal of Immunology 59: 566–573.

Suzuki, T., J. Paul, and R. Dana. 2000. Review control selection for RNA quantitation. BioTechniques 29: 332-337.

Tarifeño, E. 2005-2008. Producción a escala piloto de hembras de choro zapato con color gonadal modificado mediante técnicas biotecnológicas. Proyecto Fondef D05I10258. Universidad de Concepción, Concepción, Chile. [In Spanish]

Thiriot-Quiévreux, C. 2002. Review of the literature on bivalve cytogenetics in the ten years. Cahiers de Biologie Marine 43: 17-26.

Toledo, P., G. Bellolio, and E. Dupre. 1990. Fecundación y desarrollo embrionario de Choromytilus chorus (Molina, 1782) (Bivalvia, Mytilidae). Revista de Biología Marina 25: 47-57. [In Spanish]

Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, and F. Speleman, F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3(7).

Wan, Q., I. Whang, C.Y. Cho, and J.S. Lee. 2011. Validation of housekeeping genes as internal controls for studying biomarkers of endocrine-disrupting chemical in disk abalone by real-time PCR. Comparative Biochemistry and Physiology 153: 259-268.

128

ANEXOS

CAPÍTULO III

129

Tabla 1. Genes de referencia citados frecuentemente en las investigaciones en el género Mytilus que fueron usados en este estudio

Symbol Nombre del gen Función Primers pb Tm (°C) Especie Referencia 18S ARN ribosomal 18S Constituyente estructural del ribosoma AAACGGCTACCACATCCAAG 248 55 Mytilus spp. Lacroix et al. 2014 GACCCGAGATCCAACTACGA 28S ARN ribosomal 28S Constituyente estructural del ribosoma GGAGGTCCGTAGCGATTCTG 274 55 Mytilus spp. Lacroix et al. 2014 CGTCCCCAAGGCCTCTAATC ACTB β actina Proteína estructural del citoesqueleto GGGAGTCATGGTTGGTATGG 194 55 Mytilus spp. Lacroix et al. 2014 TCAGAAGGACTGGGTGCTCT ELF1a Factor de elongación 1 Componente esencial de células eucariotas ACCCAAGGGAGCCAAAAGTT 212 55 Mytilus spp. Lacroix et al. 2014 TGTCAACGATACCAGCATCC ELF2 Factor de elongación 2 Componente esencial de células eucariotas GCAGTACATCACCCAGCAAA 249 55 Mytilus spp. Lacroix et al. 2014 GTCAACAAGGCCAAGTCCAT GAPDHa Gliceraldeído-3 fosfato dehidrogenasa Enzima glicolítica GTCTGGTGATGAGAGCTGCC 220 55 Mytilus spp. Lacroix et al. 2014 GCGTCTCCCCATTTGATAGCT RPL7 Ribosomal protein L7 Protein synthesis CAGAGACAGGCCAAGAAAGG 227 55 Mytilus edulis Lacroix et al. 2014 TGGGTAGCCCCATGTAATGT TUBA α-Tubulina Proteína estructural GGATTCAAGGTCGGAATCAA 179 55 Mytilus spp. Lacroix et al. 2014 ACGTACCAATGGACGAAAGC ELF1b Factor de elongación 1 Componente esencial de células eucariotas CACCACGAGTCTCTCCCAGA 106 55 Mytilus edulis Cubero-Leon et al. 2010 GCTGTCACCACAGACCATTCC TUB Tubulina Proteína estructural TTGCAACCATCAAGACCAAG 135 55 Mytilus edulis Cubero-Leon et al. 2010 TGCAGACGGCTCTCTGT HEL Helicasa Proteína estructural GCACTCATCAGAAGAAGGTGGC 129 55 Mytilus edulis Cubero-Leon et al. 2010 GCTCTCACTTGTGAAGGGTGAC GAPDHb Gliceraldeído-3 fosfato dehidrogenasa Enzima glicolítica AGGAATGGCCTTCAGGGTAC 114 55 Mytilus galloprovincialis Martínez-Escauriaza 2013 TCAGATGCTGCTTTAATGGCTG

130

Tabla 2. Porcentaje de los tres genes con mayores valores de eficiencia obtenidos en el mejillón C. chorus. Las últimas dos columnas indican los valores de eficiencia de los genes y coeficiente de determinación (R2), respectivamente.

Nombre del gen % Eficiencia cDNA R2 18S 100 0,9634 28S 100 0,9954 TUBA 96 0,7800

M 1 2 3 4 5 6 7 8

Figura 1. Productos de PCR de 8 genes de referencia en gel de agarosa al 3%. M: marcador ADN ladder (100 pb); 1: 18S, 2: 28S: 3: ACTA, 4: ACTB, 5: GADPHa, 6: TUBA, 7: ELF1a y 8: ELF1a. En rojo se destacan los genes que amplificaron.

131

Figura 2. Curvas de melting de las diluciones seriadas del gen 18S. En el eje X se observa la temperatura (°C) y en el eje Y el Derivative Reporter (-Rn). El Rn (reportero normalizador), o valor informador normalizado, es la señal fluorescente de SYBR Green normalizada a (dividida por) la señal del colorante de referencia pasivo para una reacción dada. Rn- es el valor que no ha reaccionado de una muestra obtenida de los primeros ciclos del PCR. Se puede observar un único pico de amplificación que corresponde a la curva de disociación o curva melting que indica la especificidad de la reacción, es decir, que los amplicones que se formaron son del tamaño esperado.

132

Figura 3. Curvas de melting de las diluciones seriadas del gen 28S. En el eje X se observa la temperatura (°C) y en el eje Y el Derivative Reporter (-Rn). El Rn (reportero normalizador), o valor informador normalizado, es la señal fluorescente de SYBR Green normalizada a (dividida por) la señal del colorante de referencia pasivo para una reacción dada. Rn- es el valor que no ha reaccionado de una muestra obtenida de los primeros ciclos del PCR. Se puede observar un único pico de amplificación que corresponde a la curva de disociación o curva melting que indica la especificidad de la reacción, es decir, que los amplicones que se formaron son del tamaño esperado.

133

Figura 4. Curvas de melting de las diluciones seriadas del gen TUBA (αtubulina). En el eje X se observa la temperatura (°C) y en el eje Y el Derivative Reporter (-Rn). El Rn (reportero normalizador), o valor informador normalizado, es la señal fluorescente de SYBR Green normalizada a (dividida por) la señal del colorante de referencia pasivo para una reacción dada. Rn- es el valor que no ha reaccionado de una muestra obtenida de los primeros ciclos del PCR. Se puede observar un único pico de amplificación que corresponde a la curva de disociación o curva melting que indica la especificidad de la reacción, es decir, que los amplicones que se formaron son del tamaño esperado.

134

CONCLUSIONES

1. Los parámetros biológicos-reproductivos; proporción sexual (macho:hembra) 1:1, talla de diferenciación sexual de 22-24 mm y talla de primera madurez sexual de 38-40 mm, del mejillón C. chorus en latitudes norte de Chile (24 °S), son similares a los parámetros reportados para poblaciones de este mejillón distribuidas en el sur de Chile. Esta información podría ser utilizada en planes de manejo pesquero de este recurso, sin embargo, se sugieren estudios de dinámica poblacional local para complementar esta información y así diseñar planes sustentables de este recurso en la costa norte de Chile.

2. Los resultados señalan que los esteroides sexuales pueden estar involucrados en la diferenciación sexual en moluscos bivalvos. La exposición, a los esteroides sexuales 17β- estradiol y la dihidrotestesterona tienen un efecto sexo-específico en las hembras y machos, respectivamente. También, se observó que el 17β- estradiol estimula el crecimiento de los oocitos mientras que la dihidrostestosterona produce un efecto degenerativo en estos. Estos resultados soportan fuertemente la hipótesis que los esteroides sexuales juegan un importante rol en invertebrados, como lo hacen en vertebrados.

3. La metodología desarrollada en la presente investigación logró modular exitosamente el sexo mediante tratamientos endocrinos (por ejemplo, exposición a dihidrotestosterona) en juveniles de C. chorus expuestos, y podría ser utilizada como protocolo de masculinización

135

de semillas “todo macho” en los hatcheries de producción de mitílidos, específicamente, para reincentivar el cultivo de este mejillón en nuestro país.

4. Más experimentación debe realizarse para afinar los protocolos de modulación del sexo para aplicalos en los centros de mitílicultura con fines de comercialización, evaluando por ejemplo; dosis de exposición, estadíos más temprano de su ontogenia (post-larvas y juveniles tempranos), y efecto de reversión sexual después de la primera maduración sexual. Además, para comprender en mayor profundidad los mecanismos por el cual están actuando los esteroides sexuales en la diferenciación del sexo en moluscos bivalvos.

Especialmente, las relacionadas a la citocromo P450 aromatasa, ya que si bien en este estudió la inhibición de esta enzima no tuvo un efecto de masculinización significativo su tendencia fue producir más individuos machos que hembras en C. chorus, por lo cual se podrían realizar ensayos con otros tipos de inhibidores (anastrozol y letrozol) y aumentar la dosis de fadrozol.

5. Se ha puesto a punto, y estandarizado el método de extracción de proteínas, SDS-PAGE y análisis de western blot para la detección de la citocromo P450 aromatasa en el bivalvo C. chorus. En este sentido, esta será una útil herramienta para detectar la presencia de esta enzima en los tejidos de moluscos y así realizar investigaciones referentes a una de las enzimas involucradas en la síntesis de los esteroides sexuales.

136

6. En la selección y validación de genes de referencia para C. chorus, de los 12 genes de referencia que fueron seleccionados por primera vez en diferentes tejidos, estadíos ontogenéticos y sexo en el mejillón C. chorus sólo 2 fueron los genes más estables y pueden ser usados para normalizar datos de estudios de RT-qPCR. Los resultados de los grupos experimentales mostraron la clara importancia de seleccionar y validar genes de referencia con una o más aproximaciones para evitar preferencias o fallar en la selección de los genes que son verdaderamente estables. Finalmente, los resultados obtenidos en el presente estudio servirán como guía para futuros estudios moleculares en mitílidos, ya que una de las futuras proyecciones de la presente tesis es determinar la expresión relativa de genes involucrados en la diferenciación sexual de C. chorus, tales como los genes: cyp19

(citocromo P450 aromatasa), ER (receptor de estrógenos), AR (receptor de andrógenos) y genes vasa.

137

Literatura citada

Adell T., and W. Muller. (2004). Isolation and characterization of five Fox (Forkhead) genes from the sponge Suberites domuncula. Gene 334: 35-46. Aldea C., and C. Valdovinos. (2005). Moluscos del intermareal del Centro-Sur de Chile (36° - 38°S): taxonomía y clave de identificación. Gayana 69: 364-396. [In Spanish]

Avendaño M., and M. Cantillánez. (2011). Restablecimiento de Choromytilus chorus (Molina, 1782) (Bivalvia: Mytilidae) en el norte de Chile. Latin American Journal Aquatic Research 39: 390-396. [In Spanish]

Bayne B. (1976). Marine mussels, their ecology and physiology. Cambridge University Press, London, 506pp. Bhandari R.K., M. Higa, H. Komuro, S. Nakamura, and M. Nakamura. (2003). Treatment with an aromatase inhibitor induces complete sex change in the protogynous honeycomb grouper (Epinephelus merra). Fish Physiology and Biochemical 28: 141–142.

Bull J. (1983). Evolution of Sex Determining Mechanisms. Benjamin-Cummings, Menlo Park, California. Cocquet J., E. Paihoux, F. Jaubert, N. Servel, X. Xia, M. Pannetier, E. De Baere, L. Messianen, C. Cotinot, and M. Fellous. (2002). Evolution and expression of Foxl2. Journal medical Genetic 39: 916-921. Coe W.R. (1943). Sexual Differentiation in Mollusks. I. Pelecypods. The Quarterly Review of Biology 18: 154-164. Croll R., and C. Wang. (2007). Possible roles of sex steroids in the control of reproduction in bivalve molluscs. Aquaculture 272: 76-86. Devlin R.H., and Y. Nagahama. (2002). Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences. Aquaculture 208: 191-364. Dheilly N., C. Lelong, A. Huvet, K. Kellner, M. Dubos, G. Riviere, P. Boudry, and P. Favrel. (2012). Gametogenesis in the Pacific Oyster Crassostrea gigas: A Microarrays- Based Analysis Identifies Sex and Stage Specific Genes. PLOS ONE 7, 15. Dorizzi M., N. Richard-Mercier, G. Desvages, M. Girondot, and C. Pieau. (1994). Masculinization of gonads by aromatase inhibitors in a turtle with temperature-dependent sex determination. Differentiation 58: 1-8. Eisenberg E., and Y. Levanon. (2013). Human housekeeping genes, revisited. Trend in Genectics 29: 569-574.

138

Elbrecht A., and R. Smit. (1992). Aromatase enzyme activity and sex determination in chickens. Science 255: 467-470. Ferguson-Smith M. (2007). The evolution of sex chromosomes and sex determination in vertebrates and the key role of DMRT1. Sexual Development 1: 2-11. Fernandes D., L. Barbara, and L. Cinta Porte. (2010). Biosynthesis and metabolism of steroids in molluscs. Journal of Steroid Biochemistry and Molecular Biology, 7pp. Gauthier-Clerc S., J. Pellerin, and J.C. Amiard. (2006). Estradiol-17β and testosterone concentrations in male and female Mya arenaria (Mollusca bivalvia) during the reproductive cycle. General and Comparative Endocrinology 145: 133-139. Guiguen Y., J. Baroiller, M. Ricordel, K. Iseki, O. McMeel, S. Martín, and A. Fostier. (1999). Involvement of Estrogens in the Process of Sex Differentiation in two Fish Species: The Rainbow Trout (Oncorhynchus mykiss) and a Tilapia (Oreochromis niloticus). Molecular Reproduction and Development 54: 154-162. Guiguen Y., A. Fostier, F. Piferrer, and C.F. Chang. (2010). Ovarian aromatase and estrogens: A pivotal role for gonadal sex differentiation and sex change in fish. General and Comparative Endocrinology 165: 352-366. Hagerman DD., F.M. Wellington, and C. Villee. (1957). Estrogens in marine invertebrates. The Biological Bulletin 1957:112-180.

Hayes T.B. (1998). Sex determination and primary sex differentiation in amphibians: Genetic and developmental mechanisms. Journal of experimental Zoology 281: 373-399. Hart A., and L. Joll. (2006). Growth, mortality, recruitment, and sex ratio in wild stocks of the silver-lipped pearl oyster Pinctada maxima (Jameson) (Mollusca: Pteriidae) in Western Australia. Journal Shellfish 25: 201-210. Ketata I., X. Denier, A. Hamza-Chaffai, and C. Minier. (2007). Endocrine-related reproductive effects in molluscs. Comparative Biochemical and Physiology C 147: 261–70.

Le Curieux-Belfond O., S. Moslemi, M. Mathieu, and G. Séralini. (2001). Androgen metabolism in oyster Crassostrea gigas: evidence for 17β-HSD activities and characterization of an aromatase-like activity inhibited by pharmacological compounds and a marine pollutant. The Journal of Steroid Biochemistry and Molecular Biology 78: 359- 366. Magie C., K. Pang, and M. Martindale. (2005). Genomic inventory and expression of Sox and Fox genes in the cnidarian Nematostella vectensis Development Gene Evolution 215: 618-630.

139

Matsuda M., Y. Nagahama, A. Shinomiya, T. Sato, C. Matsuda, T. Kobayashi, C. Morrey, N. Shibata, S. Asakawa, and N. Shimizu. (2002). DMY is a Y-specific DM-domain gene required for male development in the medaka fish. Nature 417:559-563. Matsumoto T., M. Osada, Y. Osawa, and K. Mori. (1997). Gonadal Estrogen Profile and Immunohistochemical Localization of Steroidogenic Enzymes in the Oyster and Scallop during Sexual Maturation. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 118:811-817. Matsumoto T., A. Nakamura, K. Mori, I. Akiyama, H. Hirose, and Y. Takahashi. (2007). Oyster estrogen receptor: cDNA cloning and immunolocalization. General and Comparative Endocrinology 151:195-201. Moreno C. (1995). Macroalgae as a refuge from predation for recruits of the mussel Choromytilus chorus (Molina, 1782) in Southern Chile. Journal of Experimental Marine Biology and Ecology 191: 181-193. Mori K., H. Tamate, and T. Imai. (1966). Histochemical study on the change of 17B- hydroxysteroid dehidrogenase activity in the oyster during the stages of sexual maturation and spawing. Tokoku Journal of Agricultural Research 17: 179-191. Moss S. (1989). Effects of exogenous androgens on growth, biochemical composition, and reproduction of the coot clam, Mulinia lateralis. Pacific Scientia 43: 200. Naimi A., A. Martinez, M. Specq, A. Mrac, B. Diss, M. Mathieu, and P. Sourdaine. (2009). Identification and expression of a factor of the DM family in the oyster Crassostrea gigas. Comparative Biochemistry and Physiology - Part A: Molecular and Integrative Physiology 152: 189-196. Nanda I., M. Kondo, U. Hornung, S. Asakawa, C. Winkler, A. Shimizy, Z. Shan, T. Haaf, M. Shimizu, and A. Shima. (2002). A duplicated copy of DMRT1 in the sex determining region of the Y cromosome of the medaka, Oryzias latipes. Procedimental Natl Academic Sciencie Usa 99: 11778-11783. Navarro-Martín L., M. Blázquez, and F. Piferrer. (2009). Masculinization of the European sea bass (Dicentrarchus labrax) by treatment with an androgen or aromatase inhibitor involves different gene expression and has distinct lasting effects on maturation. General and Comparative Endocrinology 160: 3-11. Oberdörster E., and P. McClellan-Green. (2000). The neuropeptide APGWamide induces imposex in the mud snail, Ilyanassa obsoleta. Peptides 21: 1323-1330. Osada M., H. Tawarayama, and K. Mori. (2004). Estrogen synthesis in relation to gonadal development of Japanese scallop, Patinopecten yessoensis: gonadal profile and immunolocalization of P450 aromatase and estrogen. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 139: 123-128.

140

Oberdörster E., D. Rittschof, and P. McClellan-Green. (1998). Testosterone metabolism in imposex and normal Ilyanassa obsoleta: Comparison of Field and TBTA Cl-induced imposex. Marine Pollution Bulletin 36: 144-151. Olave J. (2003). Efecto de la Temperatura y la Densidad en el Crecimiento y Supervivencia Durante el Cultivo larval de Choro zapato (Choromytilus chorus, Molina 1782) en Sistema Controlado Seminario de Título presentado al Departamento de Oceanografía de la Universidad de Concepción para optar al título de Biologo Marino Mención en Acuicultura y Pesquerías, 50pp. [In Spanish]

Osorio C. (2002). Moluscos marinos en Chile. Especies de importancia económica. Editorial Salesianos, Santiago Chile. [In Spanish]

Penman D., and F. Piferrer. (2008). Fish Gonadogenesis. Part I: Genetic and Enviromental Mechanisms of Sex Determination. Reviews in Fisheries Science 16: 16-34. Pieau C., and M. Dorizzi. (2004). Oestrogens and temperature-dependent sex determination in reptiles: all is in the gonads. Journal of Endocrinology 181: 367-377. Piferrer F., S. Zanuy, M. Carrillo, I. Solar, R. Devlin, and F. Donaldson. (1994). Brief Treatment with an Aromatase Inhibitor During Sex Differentiation Causes Chromosomally Female Salmon to Developmental as Normal, Functional Males. The Journal of Experimental Zoology 270: 255-262. Raymond C., M. Murphy, O. Sullivan, V. Bardwell, and D. Zarkower. (2000). Dmrt1, a gene related to worm and fly sexual regulators, is required for mammalian testis differentiation. Genes 14: 2587-2595. Reis-Henriques M., and J. Coimbra. (1990). Variations in the levels of progesterone in Mytilus edulis during the annual reproductive cycle. Comparative Biochemical Physiology 95: 343-348. Retamal R. (2003). Modificación de la Proporción sexual en Individuos Juveniles de Choromytilus chorus Mediante la Administración de Extracto Gonadal. Seminario De Título presentado al Departamento de Oceanografía de la Universidad de Concepción para optar al título de Biólogo Marino, 35pp. [In Spanish] Ruiz M. (2010). Efecto de los esteroides sexuales en la diferenciación gonadal de los Mitílidos. Tesis para optar al título de Magíster en Ciencias con mención Zoología. Universidad de Concepción. Facultad de Ciencias Naturales y Oceanográficas. Departamento de Zoología. Concepción, Chile. 68pp. [In Spanish]

Ruiz-Velásquez M., M. Zapata, M. González, D. Ordenes, and M. Escalona. (2017). Sexual differentiation and size at fi rst maturity of the mussel Choromytilus chorus (Molina, 1782) (Mollusca, Bivalvia) in northern Chile. American Malacological Bulletin 35(1): 31–41.

141

Saucedo P., and P. Southgate. (2008). Reproduction, Development, and Growth. En: Southgate, P.C., Lucas, J.S. (Eds.), The pearl oyster. Elsevier Science, Amsterdam, Holanda, pp. 131–186.

SERNAPESCA. (2015). Anuario Estadístico de Pesca. Servicio Nacional de Pesca, Valparaíso. 187pp. [In Spanish]

Shibata K., M. Takase, and M. Nakamura. (2002). The Dmrt1 expression protein in sex reversed gonads of amphibians. Gen Composition Endocrinology 27: 232-241. Siah A., J. Pellerin, A. Benosman, J. Gagné, and J. Amiard. (2002). Seasonal gonad progesterone pattern in the soft-shell clam Mya arenaria. Comparative Biochemistry and Physiology - Part A: Molecular and Integrative Physiology 132: 499-511. Sinclair A., P. Berta, M. Palmer, J. Hawkins, B. Griffiths, M. Smith, J. Foster, A. Frischauf, R, Lovell-Badge, and P. Goodfellow. (1990). A gene from the human sex determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346: 240-244. Smit C., P. McClive, P. Western, K. Reed, and A. Sinclair. (1999). Conservation of a sex- determining gen. Nature 402: 601-602. Smith C.A., and A.H. Sinclair. (2004). Sex determination: insights from the chicken. BioEssays 26: 120-132.

Steidle H. (1930). Über die Verbreitung des weiblichen Sexual hormones. Archiv für Experimentelle Pathologie und Pharmakologie 157:89.

Tarifeño E. (2005-2008). Producción a escala piloto de hembras de choro zapato con color gonadal modificado mediante técnicas biotecnológicas. Proyecto Fondef D05I10258. Universidad de Concepción, Concepción, Chile. [In Spanish] Tarifeño E., R. Galleguillos, A. Llanos-Rivera, D. Arriagada, S. Ferrada, C. Canales-Aguirre, and M. Seguel. (2012). “Erroneous identification of the mussel, Mytilus galloprovincialis (Lamarck 1819) as the species, Mytilus chilensis (Hupe 1854) in the Bay of Concepcion, Chile”. Gayana 76: 167-172. Torres-Maldonado L., P. Landa, M. Moreno, V. Marmolejo, M. Meza, and L. Merchant. (2002). Expression profiles of Dax1, Dmrt1, and Sox9 during temperature sex determination in gonads of the sea turtle Lepidochelys olivacea. Gen Composition Endocrinolology 129: 20-26. Tranter D.J. (1958). Reproduction in Australian pearl oysters (Lamellibranchia). III. Pinctada albina (Lamark): Breeding season and sexuality. Australian Journal Marine and Freshwater Research 9: 191–216.

142

Varaksina G.S., and A. Varaksin. (1988). Localization of 17 betahydroxysteroid dehydrogenase in the gonads of bivalve mollusks the sea pecten (Patinopecten yessoensis Jay) and Gray's mussel (Crenomytilus grayanus Dunker). Arkh. Anatomic Gistol. Embriology 95: 79–82. Wada K. (1978). Chromosome karyotypes of three bivalves: the oyster, Isognomon alatus and Pinctada imbricata, and the Bay Scallop, Argopecten irradians irradians. Biological Bulletin 155: 235-245. Wang C. (2000). Roles of sex steroids on reproduction of the sea scallop. PhD thesis. Department of Physiology and Biophysics. Dalhousie University, Halifax. 274 pp.

Wang C., and R.P. Croll. (2004). Effects of sex steroids on gonadal development and gender determination in the sea scallop, Placopecten magellanicus. Aquaculture 238: 483- 498. Wang C., and R. Croll. (2006). Effects of sex steroids on spawning in the sea scallop, Placopecten magellanicus. Aquaculture 256: 423-432. Vizziano D., G. Randuineau, D. Baron, C. Cauty, and Y. Guiguen. (2007). Characterization of early molecular sex differentiation in rainbow trout, Oncorhynchus mykiss. Developmental Dynamics 236: 2198-2206. Yntema C. (1976). Effects of incubation temperatures on sexual differentiation in the turtle, Chelydra serpentina. Morphology 150: 453-461. Yu N.W., C.Y. Hsu, H.H. Ku, L.T. Chang, and H.W. Liu. (1993). Gonadal differentiation and secretions of estradiol and testosterone of the ovaries of Rana catesbeiana tadpoles treated with 4-hydroxyandrostenedione. Journal of experimental Zoology 265: 252-257.

Yu J., F. Mazet, Y. Chen, S. Huang, K. Jung, and S. Shimeld. (2008). The Fox genes of Branchiostoma floridae. Developmental Gene Evolution 218: 629-638. Yu F., M. Wang, L. Zhou, J. Gui, and X. Yu. (2011). Molecular Cloning and Expression Characterization of Dmrt2 in Akoya Pearl Oysters, Pinctada martensii. Journal of Shellfish Research 30: 247-254. Zagal C., and H. Hermosilla. (2001). Guía de Invertebrados Marinos Del Litoral Valdiviano, 1st ed., Santiago, Chile. [In Spanish]

143

ANEXOS

144