Plasma Membrane-Associated Restriction Factors and Their Counteraction by HIV-1 Accessory Proteins
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Impact of Natural HIV-1 Nef Alleles and Polymorphisms on SERINC3/5 Downregulation
Impact of natural HIV-1 Nef alleles and polymorphisms on SERINC3/5 downregulation by Steven W. Jin B.Sc., Simon Fraser University, 2016 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science in the Master of Science Program Faculty of Health Sciences © Steven W. Jin 2019 SIMON FRASER UNIVERSITY Spring 2019 Copyright in this work rests with the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Approval Name: Steven W. Jin Degree: Master of Science Title: Impact of natural HIV-1 Nef alleles and polymorphisms on SERINC3/5 downregulation Examining Committee: Chair: Kanna Hayashi Assistant Professor Mark Brockman Senior Supervisor Associate Professor Masahiro Niikura Supervisor Associate Professor Ralph Pantophlet Supervisor Associate Professor Lisa Craig Examiner Professor Department of Molecular Biology and Biochemistry Date Defended/Approved: April 25, 2019 ii Ethics Statement iii Abstract HIV-1 Nef is a multifunctional accessory protein required for efficient viral pathogenesis. It was recently identified that the serine incorporators (SERINC) 3 and 5 are host restriction factors that decrease the infectivity of HIV-1 when incorporated into newly formed virions. However, Nef counteracts these effects by downregulating SERINC from the cell surface. Currently, there lacks a comprehensive study investigating the impact of primary Nef alleles on SERINC downregulation, as most studies to date utilize lab- adapted or reference HIV strains. In this thesis, I characterized and compared SERINC downregulation from >400 Nef alleles isolated from patients with distinct clinical outcomes and subtypes. I found that primary Nef alleles displayed a dynamic range of SERINC downregulation abilities, thus allowing naturally-occurring polymorphisms that modulate this activity to be identified. -
SERINC5 (NM 178276) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC313396 SERINC5 (NM_178276) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: SERINC5 (NM_178276) Human Untagged Clone Tag: Tag Free Symbol: SERINC5 Synonyms: C5orf12; TPO1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_178276, the custom clone sequence may differ by one or more nucleotides ATGTCAGCTCAGTGCTGTGCGGGCCAGCTGGCCTGCTGCTGTGGGTCTGCAGGCTGCTCTCTCTGCTGTG ATTGCTGCCCCAGGATTCGGCAGTCCCTCAGCACCCGCTTCATGTACGCCCTCTACTTCATTCTGGTCGT CGTCCTCTGCTGCATCATGATGTCAACAACCGTGGCTCACAAGATGAAAGAGCACATTCCTTTTTTTGAA GATATGTGTAAAGGCATTAAAGCTGGTGACACCTGTGAGAAGCTGGTGGGATATTCTGCCGTGTATAGAG TCTGTTTTGGAATGGCTTGTTTCTTCTTTATCTTCTGTCTACTGACCTTGAAAATCAACAACAGCAAAAG TTGTAGAGCTCATATTCACAATGGCTTTTGGTTCTTTAAACTTCTGCTGTTGGGGGCCATGTGCTCAGGA GCTTTCTTCATTCCAGATCAGGACACCTTTCTGAACGCCTGGCGCTATGTGGGAGCCGTCGGAGGCTTCC TCTTCATTGGCATCCAGCTCCTCCTGCTCGTGGAGTTTGCACATAAGTGGAACAAGAACTGGACAGCAGG CACAGCCAGTAACAAGCTGTGGTACGCCTCCCTGGCCCTGGTGACGCTCATCATGTATTCCATTGCCACT GGAGGCTTGGTTTTGATGGCAGTGTTTTATACACAGAAAGACAGCTGCATGGAAAACAAAATTCTGCTGG GAGTAAATGGAGGCCTGTGCCTGCTTATATCATTGGTAGCCATCTCACCCTGGGTCCAAAATCGACAGCC ACACTCGGGGCTCTTACAATCAGGGGTCATAAGCTGCTATGTCACCTACCTCACCTTCTCAGCTCTGTCC AGCAAACCTGCAGAAGTAGTTCTAGATGAACATGGGAAAAATGTTACAATCTGTGTGCCTGACTTTGGTC AAGACCTGTACAGAGATGAAAACTTGGTGACTATACTGGGGACCAGCCTCTTAATCGGATGTATCTTGTA -
Hepatitis C Virus P7—A Viroporin Crucial for Virus Assembly and an Emerging Target for Antiviral Therapy
Viruses 2010, 2, 2078-2095; doi:10.3390/v2092078 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Review Hepatitis C Virus P7—A Viroporin Crucial for Virus Assembly and an Emerging Target for Antiviral Therapy Eike Steinmann and Thomas Pietschmann * TWINCORE †, Division of Experimental Virology, Centre for Experimental and Clinical Infection Research, Feodor-Lynen-Str. 7, 30625 Hannover, Germany; E-Mail: [email protected] † TWINCORE is a joint venture between the Medical School Hannover (MHH) and the Helmholtz Centre for Infection Research (HZI). * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +49-511-220027-130; Fax: +49-511-220027-139. Received: 22 July 2010; in revised form: 2 September 2010 / Accepted: 6 September 2010 / Published: 27 September 2010 Abstract: The hepatitis C virus (HCV), a hepatotropic plus-strand RNA virus of the family Flaviviridae, encodes a set of 10 viral proteins. These viral factors act in concert with host proteins to mediate virus entry, and to coordinate RNA replication and virus production. Recent evidence has highlighted the complexity of HCV assembly, which not only involves viral structural proteins but also relies on host factors important for lipoprotein synthesis, and a number of viral assembly co-factors. The latter include the integral membrane protein p7, which oligomerizes and forms cation-selective pores. Based on these properties, p7 was included into the family of viroporins comprising viral proteins from multiple virus families which share the ability to manipulate membrane permeability for ions and to facilitate virus production. Although the precise mechanism as to how p7 and its ion channel function contributes to virus production is still elusive, recent structural and functional studies have revealed a number of intriguing new facets that should guide future efforts to dissect the role and function of p7 in the viral replication cycle. -
Coevolution of Retroviruses with Serincs Following Whole-Genome
bioRxiv preprint doi: https://doi.org/10.1101/2020.02.24.962506; this version posted February 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Ramdas et al. 1 Coevolution of retroviruses with SERINCs following whole-genome duplication 2 divergence 3 4 Pavitra Ramdas1, Vipin Bhardwaj1, Aman Singh1, Nagarjun Vijay2, Ajit Chande1* 5 1Molecular Virology Laboratory & 2Computational Evolutionary Genomics Lab from the 6 Department of Biological Sciences, Indian Institute of Science Education and Research (IISER) 7 Bhopal, India. 8 9 Abstract 10 The SERINC gene family comprises of five paralogs in humans of which SERINC3 and 11 SERINC5 restrict HIV-1 in a Nef-dependent manner. The origin of this anti-retroviral activity, its 12 prevalence among the remaining human paralogs, and its ability to target retroviruses remain 13 largely unknown. Here we show that despite their early divergence, the anti-retroviral activity is 14 functionally conserved among four human SERINC paralogs with SERINC2 being an 15 exception. The lack of activity in human SERINC2 is associated with its post-whole genome 16 duplication (WGD) divergence, as evidenced by the ability of pre-WGD orthologs from yeast, 17 fly, and a post-WGD-proximate SERINC2 from coelacanth to inhibit HIV-1. Intriguingly, potent 18 retroviral factors from HIV-1 and MLV are not able to relieve the SERINC2-mediated particle 19 infectivity inhibition, indicating that such activity was directed towards other retroviruses that 20 are found in coelacanth (like foamy viruses). -
Tetherin-Mediated Restriction of Filovirus Budding Is Antagonized by the Ebola Glycoprotein
Tetherin-mediated restriction of filovirus budding is antagonized by the Ebola glycoprotein Rachel L. Kaletsky, Joseph R. Francica, Caroline Agrawal-Gamse, and Paul Bates1 Department of Microbiology, School of Medicine, University of Pennsylvania, 225 Johnson Pavilion, 3610 Hamilton Walk, Philadelphia, PA 19104-6076 Edited by Stephen P. Goff, Columbia University College of Physicians and Surgeons, New York, NY, and approved December 19, 2008 (received for review October 31, 2008) Mammalian cells employ numerous innate cellular mechanisms to Ebola Zaire is a highly pathogenic negative-sense RNA virus inhibit viral replication and spread. Tetherin, also known as Bst-2 that causes severe hemorrhagic disease. Ebola belongs to the or CD317, is a recently identified, IFN-induced, cellular response family Filoviridae, whose members, the Ebola and Marburg factor that blocks release of HIV-1 and other retroviruses from viruses, produce filamentous virions. Expression of the Ebola infected cells. The means by which tetherin retains retroviruses on matrix protein, VP40, alone in mammalian cells produces fila- the cell surface, as well as the mechanism used by the HIV-1 mentous virus-like particles (VLPs) that bud from the cell accessory protein Vpu to antagonize tetherin function and pro- surface and structurally resemble infectious Ebola virions (6, 7). mote HIV-1 release, are unknown. Here, we document that tetherin The viral glycoprotein (GP) forms the surface spikes seen in the functions as a broadly acting antiviral factor by demonstrating that viral envelope membrane. Coexpression of Ebola GP with VP40 both human and murine tetherin potently inhibit the release of the produces VLPs that incorporate GP, resemble authentic Ebola filovirus, Ebola, from the surface of cells. -
UNIVERSITY of CALIFORNIA, SAN DIEGO Investigating Transmitted
UNIVERSITY OF CALIFORNIA, SAN DIEGO Investigating transmitted/founder HIV-1 nef and env effects on SERINC5 inhibition of infectivity A thesis submitted in partial satisfaction of the requirements for the degree Master of Science in Biology by Jasmine Jane Chau Committee in charge: John Guatelli, Chair Michael David, Co-Chair Lisa McDonnell 2017 Copyright Jasmine Jane Chau, 2017 All rights reserved. The Thesis of Jasmine Jane Chau is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California, San Diego 2017 iii DEDICATION This thesis is in dedication to my parents, who have always supported me unconditionally in all my endeavors. I would also like to thank my two sisters for all the love and laughter they bring into my life. I would not be where I am today without all their love and support. iv TABLE OF CONTENTS Signature Page…………………………………………………………………….. iii Dedication…………………………………………………………………………. iv Table of Contents………………………………………………………………….. v List of Figures……………………………………………………………………... vi List of Tables……………………………………………………………………… viii Acknowledgements……………………………………………………………….. ix Abstract of the Thesis……………………………………...……………………… x Introduction……………………………………………………………………….. 1 Materials and Methods……………………………………………………………. 6 Results…………………………………………………………………………….. 13 Discussion………………………………………………………………………… 18 Figures and Tables………………………………………………………………… 24 References………………………………………………………………………… 39 v LIST OF FIGURES Figure 1: Schematic of plans for making Env -
APICAL M2 PROTEIN IS REQUIRED for EFFICIENT INFLUENZA a VIRUS REPLICATION by Nicholas Wohlgemuth a Dissertation Submitted To
APICAL M2 PROTEIN IS REQUIRED FOR EFFICIENT INFLUENZA A VIRUS REPLICATION by Nicholas Wohlgemuth A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland October, 2017 © Nicholas Wohlgemuth 2017 All rights reserved ABSTRACT Influenza virus infections are a major public health burden around the world. This dissertation examines the influenza A virus M2 protein and how it can contribute to a better understanding of influenza virus biology and improve vaccination strategies. M2 is a member of the viroporin class of virus proteins characterized by their predicted ion channel activity. While traditionally studied only for their ion channel activities, viroporins frequently contain long cytoplasmic tails that play important roles in virus replication and disruption of cellular function. The currently licensed live, attenuated influenza vaccine (LAIV) contains a mutation in the M segment coding sequence of the backbone virus which confers a missense mutation (alanine to serine) in the M2 gene at amino acid position 86. Previously discounted for not showing a phenotype in immortalized cell lines, this mutation contributes to both the attenuation and temperature sensitivity phenotypes of LAIV in primary human nasal epithelial cells. Furthermore, viruses encoding serine at M2 position 86 induced greater IFN-λ responses at early times post infection. Reversing mutations such as this, and otherwise altering LAIV’s ability to replicate in vivo, could result in an improved LAIV development strategy. Influenza viruses infect at and egress from the apical plasma membrane of airway epithelial cells. Accordingly, the virus transmembrane proteins, HA, NA, and M2, are all targeted to the apical plasma membrane ii and contribute to egress. -
Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis
Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis by Valbona Luga A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy, Department of Molecular Genetics, University of Toronto © Copyright by Valbona Luga, 2013 Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis Valbona Luga Doctor of Philosophy Department of Molecular Genetics University of Toronto 2013 Abstract The tumour-associated stroma, consisting of fibroblasts, inflammatory cells, vasculature and extracellular matrix proteins, plays a critical role in tumour growth, but how it regulates cancer cell migration and metastasis is poorly understood. The Wnt-planar cell polarity (PCP) pathway regulates convergent extension movements in vertebrate development. However, it is unclear whether this pathway also functions in cancer cell migration. In addition, the factors that mobilize long-range signalling of Wnt morphogens, which are tightly associated with the plasma membrane, have yet to be completely characterized. Here, I show that fibroblasts secrete membrane microvesicles of endocytic origin, termed exosomes, which promote tumour cell protrusive activity, motility and metastasis via the exosome component Cd81. In addition, I demonstrate that fibroblast exosomes activate autocrine Wnt-PCP signalling in breast cancer cells as detected by the association of Wnt with Fzd receptors and the asymmetric distribution of Fzd-Dvl and Vangl-Pk complexes in exosome-stimulated cancer cell protrusive structures. Moreover, I show that Pk expression in breast cancer cells is essential for fibroblast-stimulated cancer cell metastasis. Lastly, I reveal that trafficking in cancer cells promotes tethering of autocrine Wnt11 to fibroblast exosomes. These studies further our understanding of the role of ii the tumour-associated stroma in cancer metastasis and bring us closer to a more targeted approach for the treatment of cancer spread. -
HIV-1) CD4 Receptor and Its Central Role in Promotion of HIV-1 Infection
MICROBIOLOGICAL REVIEWS, Mar. 1995, p. 63–93 Vol. 59, No. 1 0146-0749/95/$04.0010 Copyright q 1995, American Society for Microbiology The Human Immunodeficiency Virus Type 1 (HIV-1) CD4 Receptor and Its Central Role in Promotion of HIV-1 Infection STEPHANE BOUR,* ROMAS GELEZIUNAS,† AND MARK A. WAINBERG* McGill AIDS Centre, Lady Davis Institute-Jewish General Hospital, and Departments of Microbiology and Medicine, McGill University, Montreal, Quebec, Canada H3T 1E2 INTRODUCTION .........................................................................................................................................................63 RETROVIRAL RECEPTORS .....................................................................................................................................64 Receptors for Animal Retroviruses ........................................................................................................................64 CD4 Is the Major Receptor for HIV-1 Infection..................................................................................................65 ROLE OF THE CD4 CORECEPTOR IN T-CELL ACTIVATION........................................................................65 Structural Features of the CD4 Coreceptor..........................................................................................................65 Interactions of CD4 with Class II MHC Determinants ......................................................................................66 CD4–T-Cell Receptor Interactions during T-Cell Activation -
Functional Proteomic Atlas of HIV Infection in Primary Human CD4+ T
TOOLS AND RESOURCES Functional proteomic atlas of HIV infection in primary human CD4+ T cells Adi Naamati1, James C Williamson1,2, Edward JD Greenwood1,2, Sara Marelli1, Paul J Lehner2, Nicholas J Matheson1* 1Department of Medicine, University of Cambridge, Cambridge, United Kingdom; 2Cambridge Institute for Medical Research, University of Cambridge, Cambridge, United Kingdom Abstract Viruses manipulate host cells to enhance their replication, and the identification of cellular factors targeted by viruses has led to key insights into both viral pathogenesis and cell biology. In this study, we develop an HIV reporter virus (HIV-AFMACS) displaying a streptavidin- binding affinity tag at the surface of infected cells, allowing facile one-step selection with streptavidin-conjugated magnetic beads. We use this system to obtain pure populations of HIV- infected primary human CD4+ T cells for detailed proteomic analysis, and quantitate approximately 9000 proteins across multiple donors on a dynamic background of T cell activation. Amongst 650 HIV-dependent changes (q < 0.05), we describe novel Vif-dependent targets FMR1 and DPH7, and 192 proteins not identified and/or regulated in T cell lines, such as ARID5A and PTPN22. We therefore provide a high-coverage functional proteomic atlas of HIV infection, and a mechanistic account of host factors subverted by the virus in its natural target cell. DOI: https://doi.org/10.7554/eLife.41431.001 Introduction *For correspondence: Remodelling of the host proteome during viral infection may reflect direct effects of viral proteins, [email protected] secondary effects or cytopathicity accompanying viral replication, or host countermeasures such as the interferon (IFN) response. -
Coevolution of Retroviruses with Serincs Following Whole-Genome
bioRxiv preprint doi: https://doi.org/10.1101/2020.02.24.962506; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Ramdas et al. 1 Coevolution of retroviruses with SERINCs following whole-genome duplication 2 divergence 3 4 Pavitra Ramdas1, Vipin Bhardwaj1, Aman Singh1, Nagarjun Vijay2, Ajit Chande1* 5 1Molecular Virology Laboratory & 2Computational Evolutionary Genomics Lab from the 6 Department of Biological Sciences, Indian Institute of Science Education and Research (IISER) 7 Bhopal, India. 8 9 Abstract 10 The SERINC gene family comprises of five paralogs in humans of which SERINC3 and 11 SERINC5 inhibit HIV-1 infectivity and are counteracted by Nef. The origin of this anti-retroviral 12 activity, its prevalence among the remaining human paralogs, and its ability to target 13 retroviruses remain largely unknown. Here we show that despite their early divergence, the 14 anti-retroviral activity is functionally conserved among four human SERINC paralogs with 15 SERINC2 being an exception. The lack of activity in human SERINC2 is associated with its 16 post-whole genome duplication (WGD) divergence, as evidenced by the ability of pre-WGD 17 orthologs from yeast, fly, and a post-WGD-proximate SERINC2 from coelacanth to inhibit nef- 18 defective HIV-1. Intriguingly, potent retroviral factors from HIV-1 and MLV are not able to relieve 19 the SERINC2-mediated particle infectivity inhibition, indicating that such activity was directed 20 towards other retroviruses that are found in coelacanth (like foamy viruses). -
Analysis of Determinants in Filovirus Glycoproteins Required for Tetherin Antagonism
Viruses 2014, 6, 1654-1671; doi:10.3390/v6041654 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Article Analysis of Determinants in Filovirus Glycoproteins Required for Tetherin Antagonism † † † Kerstin Gnirß 1,2, , Marie Fiedler 1, , Annika Krämer-Kühl 1,2, ,‡, Sebastian Bolduan 3, Eva Mittler 4,#, Stephan Becker 4, Michael Schindler 3 and Stefan Pöhlmann 1,2,* 1 Infection Biology Unit, German Primate Center, 37077 Göttingen, Germany; E-Mails: [email protected] (K.G.); [email protected] (M.F.); [email protected] (A.K.-K.) 2 Institute of Virology, Hannover Medical School, 30625 Hannover, Germany 3 Institute of Virology, Helmholtz Center Munich, 85764 Neuherberg, Germany; E-Mails: [email protected] (S.B.); [email protected] (M.S.) 4 Institute of Virology, Philipps-University-Marburg, 35043 Marburg, Germany; E-Mails: [email protected] (E.M.); [email protected] (S.B.) † These authors contributed equally to this work. ‡ Present address: Boehringer Ingelheim Veterinary Research Center GmbH & Co. KG, 30559 Hannover, Germany. # Present address: Department of Microbiology and Immunology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +49-551-3851-150, Fax: +49-551-3851-184. Received: 25 November 2013; in revised form: 27 March 2014 / Accepted: 30 March 2014 / Published: 9 April 2014 Abstract: The host cell protein tetherin can restrict the release of enveloped viruses from infected cells. The HIV-1 protein Vpu counteracts tetherin by removing it from the site of viral budding, the plasma membrane, and this process depends on specific interactions between the transmembrane domains of Vpu and tetherin.