Sixteenth Annual Report 2005-2006

M S Swaminathan Research Foundation Centre for Research on Sustainable Agricultural and Rural Development Chennai, India M S Swaminathan Research Foundation Centre for Research on Sustainable Agricultural and Rural Development

Third Cross Road, Institutional Area Taramani, Chennai 600 113 India Telephone : +91 (44) 22541229 +91 (44) 22541698 Fax : +91 (44) 22541319 Email : [email protected]; [email protected] Visit us on the World Wide Web at http://www.mssrf.org

Printed at : AMM Screens Citation : Sixteenth Annual Report: 2005-2006 M S Swaminathan Research Foundation, Chennai 600 113 Contents

Chairman’s Introduction ...... 004

Programme Area 100 Coastal Systems Research ...... 021

Programme Area 200 Biotechnology ...... 040

Programme Area 300 Biodiversity ...... 060

Programme Area 400 Ecotechnology ...... 074

Programme Area 500 Food Security ...... 099

Programme Area 600 Education, Communication, Training and Capacity Building ...... 110

Programme Area 700 Special Projects ...... 136

Publications ...... 150

About the Foundation ...... 160

The Foundation Staff ...... 165

List of Donors ...... 176

Sources of Project Support ...... 179

List of Acronyms ...... 183

ANNUAL REPORT 2005-2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Chairman’s Introduction

The M S Swaminathan Research Foundation of household economic circumstances, they started its work 16 years ago in the thematic remain under-nourished. The feminization areas of coastal systems, biotechnology, of poverty and hunger as well as diseases biodiversity, ecotechnology, food security and like HIV/AIDS are facts of life and should information, education and communication. be confronted with an appropriate The approach was based on strategic and response. participatory research, capacity building, If technology has been a major factor so far networking and partnership building, based in the rich-poor and north-south economic on the principles of social inclusion in access divides, we should now enlist technology to technologies which help to enhance income as an ally in the movement for gender and and environment. Research and outreach social equity. Appropriate technologies strategies were devised to bridge the rich-poor which can help to reduce drudgery and add and gender divides in the areas of information, economic value to the time and labour of knowledge and skill empowerment. the poor need to be identified, tested and popularized. While the redistribution of Details of the work done during the agricultural land, livestock and other productive assets year of 2005-06 (ie, 1 June, 2005 to 31 May 2006) comes under the political domain, asset are given in this Report. Hence, only a few building in the form of market-driven skills highlights of the progress made during the year is within the competence of technically in shaping MSSRF’s future directions are oriented NGOs. The aims should be to mentioned in this introduction. bridge the gap between scientific know-how Strategic Planning and field level do-how, and bring about a paradigm shift from unskilled to skilled The work carried out by MSSRF’s scientists work in the case of assetless poor. and scholars during 1990-2006 has validated the following assumptions, which led to the When cooperation fails, the only hope of rural India for economic and social progress choice of programme priorities in 1989-90. vanishes. Hence, the organization of SHGs The poor are poor as they have no physical or other groups for technological assets such as land and, livestock, empowerment and skill building should be fishponds, and often, education. They hence based on the principle of social inclusion remain, as unskilled labour and women and a “win-win” situation for all, labour invariably do not get even the irrespective of religion, caste, class or prescribed minimum wage. By compulsion gender.

4

CHAIRMAN’S INTRODUCTION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Even in institutions devoted primarily to the job-led economic growth. This resulted in cause of technology incubation and ecotechnologies, based on five E’s (Ecology, dissemination, there is need for a research Economics, Equity, Employment and Energy) back-up, both in social and bio-physical leading to the establishment of the JRD Tata sciences. To quote the Royal Commission Ecotechnology Centre with the generous on Agriculture (1925), “However efficient support of Tata Trusts. The emphasis on food the organization which is built up for and nutrition security and gender agricultural demonstration and extension mainstreaming led to the establishment of the may be, unless that organization is based B V Rao Centre for Sustainable Food Security, on the solid foundation provided by the Uttara Devi Centre for Gender and research, it is merely a house built on sand”. Development, and later the Ford Chair on It was therefore decided in 1990, that MSSRF Women and Food Security and the MSSRF- should concentrate on strategic and WFP Technical Resource Centre on Food anticipatory research in relation to its Security. The B R Barwale Chair in the area of programme in coastal areas, and biodiversity provided an opportunity to work participatory research in relation to its work on the rights of farmers and primary conservers with tribal and rural families in the engaged in the conservation of plant genetic conservation and sustainable and equitable resources. The principles of social inclusion use of biodiversity. in access to technologies, both in gender and economic terms, as well as the conservation ‘Science for an Inclusive Society’ thus became and enhancement of nature and natural the motto of MSSRF. Obviously, the concept of resources became sacred to MSSRF’s approach society should begin with children and women, to harnessing science and technology for and hence MSSRF integrated early childhood fostering agrarian and rural prosperity. care and education services and the gender perspective in its programmes from its early Among technologies, it was decided on the beginning at a rented house in Kotturpuram. basis of inter-disciplinary dialogues to accord Economic replicability, environmental priority to Biotechnology, Information sustainability and social and gender equity Communication Technologies (ICT), Space became the three pillars of MSSRF’s Technologies (Remote Sensing, GIS), Nuclear programmes. Thus began the pro-nature, pro- Technologies (mutants of groundnut and poor, pro-women and pro-sustainable pulses) and Ecotechnologies (i.e. appropriate livelihoods paradigm of technology blend of traditional wisdom and ecological development and dissemination. Since prudence with frontier technologies). inadequate purchasing power is the most Technology blending is the pathway to important cause of under- and mal-nutrition integrate the classic and contemporary in at the household level, the emphasis was on scientific strategies. A great challenge in rural

5

ANNUAL REPORT 2005-2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

India is the development of management tools, India-Canada Environment Facility and other which can help to confer the power and donor agencies have been in general economy of scale to farm families with small complimentary, but have invariably land holdings and to landless labour families. emphasized the need for greater inter- This led to institutional devices like the Bio- programme cooperation within MSSRF. Also, village, Village Knowledge Centres (VKC), the original idea of MSSRF developing into an Sustainable Self-Help Groups (SSHG) and NGO’s NGO, i.e. a resource centre for NGOs Community Food and Water Security systems who are dedicated to the cause of serving designed to convert concepts into field level society, but are weak in science, is yet to fructify. accomplishments. Rural Knowledge Measurement tools to quantify the impact of Connectivity was considered an essential pre- the work done on the economic and nutritional requisite for rural upliftment. This led to the well being of rural families are yet to be establishment of the Jamsetji Tata National formalized. An in-house strategic planning Virtual Academy for Rural Prosperity and the exercise, titled, “Re-engineering of MSSRF” organization of the National Alliance for was therefore undertaken during 2005-06. This Mission 2007: Every Village a Knowledge Centre. exercise led to the concept of Pan-MSSRF At the request of MSSRF and the National programmes, which can help to provide a Alliance, the Government of India has included horizontal dimension to vertically structured knowledge connectivity as a component of activities. Bharat Nirman or a New Deal for Rural India. The first of the PAN-MSSRF projects is being As MSSRF’s human-centred development initiated during 2006 with generous support programmes and pro-poor and pro-nature from SDC. It will bring together in a mutually biotechnology and ICT initiatives made reinforcing manner work relating to food, progress, it became evident that the basic livelihood and ecological security in the problems of rural societies like poverty-induced Koraput region of Orissa, the Kolli Hills area of Tamil Nadu and the Wayanad region of Kerala. under-nutrition, gender discrimination, and The Village Knowledge Centre or Gyan income, work and health insecurity will have Chaupaul programme will provide the ICT to be addressed, if the ultimate goal of hunger infrastructure needed for the knowledge and and poverty-free villages is to be achieved. This skill empowerment of the rural and tribal led to the launch of Mission 2007: A Hunger-free families. Based on benchmark surveys, the India initiative. Thus, MSSRF’s capacity to impact of the programme will be measured in address the issues of nutrition and education relation to the UN Millennium Development was built-up. Goals for sustainable human security. The Most external reviews carried out by the Sir PAN-MSSRF approach will also be extended Dorabji Tata Trust, UNDP, SDC, IDRC, CIDA, to other areas in due course. During the year,

6

CHAIRMAN’S INTRODUCTION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ an internal planning exercise was held with Ecotechnology Centre and the Jamsetji Tata all professional staff to facilitate greater inter- National Virtual Academy, a “Fish for All” disciplinary interaction, inter-programme and Training Centre as well as a Village Resource inter-personal communication and collabo- Centre, which can provide up-to-date ration needed to make the approach a reality. information on wave heights, location of fish, shoals and potential disasters like cyclones, sea Integrated Coastal Zone Management (ICZM) water ingress and tsunami. The “Fish for All” The tsunami of 26 December, 2004 underlined Training Centre will function like a Krishi the urgency of introducing an integrated Vigyan Kendra in terms of pedagogic development-cum-disaster management methodology (i.e., learning by doing) and will programme in coastal areas comprising Bio- provide training in all aspects of fish capture, shields, Bio-villages and Village Knowledge culture, consumption and commerce. The “Fish Centres. Seawater farming and development for All” Training Centre will serve as a Trainers’ and cultivation of salt-tolerant crops will also Training Centre and will have a “Fish Pre- have to be promoted. In the light of these Processing Centre” attached to it. considerations the following core programmes Mangrove Wetlands Research have been identified for inter-disciplinary The Coastal System Research (CSR) carried out action research. during the last 15 years has provided the Resource Centre for Integrated Coastal Zone scientific basis needed for fostering a Management community-centred approach to conserve, restore, and sustain mangrove wetlands. All This Resource Centre will assist the mangrove wetlands, irrespective of ownership, Government, civil society organizations and along the coasts of Tamil Nadu, Pondicherry, Panchayati Raj Institutions in building capacity Andhra Pradesh and Orissa are receiving for conserving and rehabilitating degraded attention. Community restoration techniques, mangrove ecosystems, developing non- such as raising community nurseries, have mangrove bioshields comprising plantations been standardized. Systems of raising agro- of casuarina, cashewnut and appropriate aqua farms through integrated production of halophytes, supporting agronomic rehabili- prawns and fish and the raising of mangrove tation of farm fields subjected to sea-water plantations are currently under development. inundation, and managing of disasters. Monitoring of the status of mangrove wetlands The Resource Centre will assist local through remote sensing is an ongoing activity. communities and Forest and Fisheries A quarterly ‘Mangrove Watch’ newsletter is Department officials to work together in Joint available on the MSSRF website. Mangrove Mangrove Forest Management. In addition, it Atlases have already been published for Tamil will host in collaboration with the JRD Tata Nadu, Andhra Pradesh and Orissa.

7

ANNUAL REPORT 2005-2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Generating opportunities for sustainable Thus, the ICZM programme will give specific livelihoods scientific attention to the conservation and Population pressure is increasing in coastal regeneration of mangrove wetlands and to the areas. Hotels and resorts to promote tourism strengthening of the work and income security are also growing in numbers. Ultimately, the of coastal communities through market-driven fate of coastal ecology will depend upon the eco-enterprises including pro-poor eco-tourism opportunities created for sustainable like the proposed Bird Park in the Gulf of livelihoods for the fisher, farm and non-farm Mannar area. Initiatives like the artificial coral communities living within 10 kms of the reef to rejuvenate fisheries will be replicated, shoreline. Coastal Bio-villages, will be where appropriate. promoted on the basis of the experience gained Biotechnology to Shape our Agricultural in the Gulf of Mannar, Pondicherry, Future Pichavaram and Muthupet areas, as well as in Andhra Pradesh, Orissa and West Bengal. The scientifically innovative and socially Using the Bio-village Tool-Kit already relevant work carried out during the last 13 prepared, capacity building programmes will years by the young Biotechnology team of staff be organized at the Resource Centre for ICZM and scholars has led to MSSRF being for NGOs, Panchayat leaders and CBOs to designated as a “Centre of Excellence” by the address concurrently issues relating to natural Department of Biotechnology. In the area of resources conservation and enhancement, and biotechnology, MSSRF’s policy is to bring about the generation of new market-driven appropriate combinations of Mendelian, enterprises. Spearhead teams capable of Molecular and Participatory Breeding. The preparing business plans in consultation with areas chosen for attention 13 years ago, namely rural families will be organized before tolerance to salinity and drought, have gained introducing the bio-village paradigm of further in relevance since the prospects of sea- sustainable human development. A Gender level rise and reduced precipitation envisaged Code will be introduced in the Bio-village in 1990 are proving to be real. The progress programme, coupled with a gender audit made in the salinity and drought tolerance procedure for assessing the impact of the areas are given in the Report. programme on women and men. The Bio- Construction of Genetic Shields for Sustainable village activities will be managed by a local Food Security Bio-village Council comprising equal numbers of women and men on the model already in Salinity Tolerance: This work, involving the operation in Pondicherry. The council will transfer of sea water tolerant genes from have a few representatives of relevant scientific Avicennia marina to rice and other crops of and financial institutions. importance to coastal agriculture will be taken

8

CHAIRMAN’S INTRODUCTION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ to its logical conclusions in partnership, with cultivation of GM crops will be prepared for farm families resulting in location-specific and dissemination through the Village Knowledge agronomically superior strains. Defensive Centres. patenting is being done, so that the critical Thus, the long-term programmes in the area of genes are not exploited by commercial Biotechnology in an era of climate change and organizations for private profit. sea level rise, will relate to safeguarding food Drought Tolerance: The work in progress with and nutritional security through appropriate Prosopis juliflora will be intensified with such genetic shields involving novel genetic additional inputs of human and other resources combinations, and to promoting a genetic that may be needed. Transgenic material for literacy movement both in rural schools and stress tolerance will be developed in crops of Panchayats. Other programmes like bio- importance such as pulses and oilseeds in dry- prospecting, bio-remediation and micro- farming areas. propagation also made good progress during the year. In addition, the production and Hidden Hunger: Genetic enhancement of demonstration of high quality planting micronutrient content with particular reference material of Jatropha Curcas is paving the way to iron will be combined at the stage of field for launching science-based bio-fuel intervention with biofortification and programmes. The Lichen group made excellent cultivation and consumption of vegetables and progress in the study of lichen diversity and fruits. Finding horticultural remedies to distribution pattern and has identified several nutritional maladies will be an important lichen species which can serve as bioindicators component of the strategy to eradicate hidden to monitor environmental pollution. Novel salt hunger. tolerant beneficial bacterial species have been identified and developed into potential Resource Centre for Genetic Literacy biological softwares for promoting sustainable This programme includes the formation of good agriculture practices in the study areas. Genome Clubs in rural and urban schools. Biodiversity and Food, Nutrition and Panchayat level Rural Science Managers (one woman and one male member of each Livelihood Security Panchayat) will be trained in the handling of Biodiversity conservation, sustainable use and BT, ICT and other frontier technologies by equitable sharing of benefits have been major organizing ‘Trainers’ training programmes. areas of research from the very inception of The Every Child a Scientist programme also lays MSSRF. The significant contributions made so stress on genetic literacy including the far have been at the policy level. The initial importance of genetic resources conservation. drafts of both the Protection of Plant Varieties Suitable educational material on the social and Farmers’ Rights Act and the Biodiversity risks and social benefits involved in the Act were prepared at MSSRF. The very concept

9

ANNUAL REPORT 2005-2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ that India should have an integrated legislation strengthened, following the donation to MSSRF to cover both breeders’ and farmers’ rights was of about 11 acres of prime farm land by Prof M proposed by MSSRF. Getting an integrated Act S Swaminathan, Mina, Soumya, Madhura and covering both farmers’ and breeders’ rights has Nitya Swaminathan. At Koraput, a new eco- been a major policy achievement, since there is friendly building is being constructed in land no parallel for this in the world. kindly made available by the Orissa Government on a 99-year lease. The building At the field level, the major contributions have for the Biju Patnaik Medicinal Plants Garden been the following: Research Centre incorporates rainwater Development of an integrated gene harvesting and solar energy utilization management strategy, consisting of in-situ, procedures. “A Genetic Paradise Park” ex-situ and community conservation (in-situ depicting the bioresources conservation ethos on-farm and ex-situ on-farm, eg Sacred and heritage of tribal communities like Paroja, Groves) Bonda, Kandha, Kutia Kandha, Dongaria Kandha, Koya, Saura, Langia Saura, Gadaba, Promotion of a participatory method of biosphere management through the Bhumia and Bhatra is being developed, establishment of a Biosphere Trust (eg. Gulf highlighting the symbiotic relationship of Mannar Biosphere Trust) between cultural and biological diversity.

Revitalization of community conservation Participatory Plant Breeding (PPB) and traditions through the field gene bank, seed Knowledge Management: bank and grain bank (conservation – This work was started in 1998 in the Koraput cultivation – consumption - commerce region of Orissa in collaboration with tribal chain) families. Koraput is an important centre of Generation of an economic stake in genetic diversity in rice. There were 3,500 land conservation through participatory races of rice in this region in 1950. In 1998, this breeding and linkage with markets number came down to 300, indicating acute genetic erosion. The PPB programme has Enlarging the food security basket by helped to reverse the decline in genetic diversity including in the diet under-utilized crops and provide opportunities for productivity and like millets, tubers, grain legumes and leafy income enhancement. The local Kalajeera vegetables (the 2005 Chennai Declaration strains of rice were improved through PPB in on under-utilized crops captures the both yield and quality. Because of the rising important points relating to ‘orphan’ but demand, nationally and internationally, a life-saving and life-giving crops) Kalajeera Farmers’ Association is being promoted The infrastructure of the Community Agro- for production and market planning. The biodiversity Centre at Kalpetta is being specific identity of the Koraput Kalajeera will

10

CHAIRMAN’S INTRODUCTION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ be protected through DNA finger printing in cause of saving vanishing species and dying collaboration with a leading specialty rice wisdom. export firm. Thus, the partnership will be tripartite – farmer – scientist – marketing Rural System Research (RSR): the Bio- company. PPB thus helps both genetic village Paradigm of Sustainable Human conservation and enhancement and promotes Development synergy between traditional wisdom and Unlike Farming Systems Research (FSR), RSR modern science. These are the essential takes a holistic view of rural livelihoods, both ingredients of a strategy for sustainable agriculture. on-farm, off- and non-farm. Since most rural livelihoods relate to crop and animal A unique programme initiated during 2006 husbandry, fisheries, agro-forestry and farm with generous support from the Sir Dorabji Tata forestry, agro-processing, priority in agro- Trust relates to the development of a Scientists’ based livelihoods goes to enhancing the Corps for saving endangered plant species. productivity and profitability of the major Many species listed in the Indian Red Data farming systems of the village on an Books and the IUCN Red Lists are known only environmentally sustainable basis. In other from one or a few collections that give an words, JRD Tata Ecotechnology Centre’s major insufficient picture of their variation, goal is to enhance productivity in perpetuity population structure and distribution. In order without ecological harm, leading to an to foster the conservation of rare, endemic and evergreen revolution. The Biovillage is RSR in threatened flowering plant species of the action and on-going programmes like precision Western Ghats, eight research fellowships have farming are being integrated to achieve the been created for three years to facilitate committed and skilled students to work on the following three goals: systematics and conservation of 80 rare, Enhance the ecological foundations endemic and threatened species. This also essential for sustainable agriculture, represents an attempt to revitalize the dying particularly soil, water and biodiversity science of taxonomy. Each Fellow will take up an integrated conservation approach (both in- Enhance productivity and reduce the cost situ and ex-situ) and deal with a group of 10 of production through higher factor species within a period of three years by productivity. Techniques will include studying the taxonomy, ecology and precision farming and organic farming distribution and conservation status of each species. They will be made responsible for all Examine opportunities for agro-processing aspects of conservation of the selected 80 and value addition to the biomass through species. This programme will help to create a initiatives like the establishment of Rice Bio cadre of trained taxonomists committed to the Parks

11

ANNUAL REPORT 2005-2006

○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

From Micro-finance to Livelihood Finance : need not only micro-finance, but also Sustainable Self Help Groups (SSHG): appropriate technologies and access to assured Resource poor families will not be able to come and remunerative markets. Thus, there is need out of the poverty trap, unless they gain the for a paradigm shift from micro- to livelihood power and economy of scale at the production finance as emphasized by Dr Vijay Mahajan. and post-production phases of their principal The JRD Tata Ecotechnology Centre will set up source of livelihood. The SHG model of group and operate a “SHG Capacity Building and power is now being promoted on a large scale, Mentoring Centre”, at he Biocentre campus at since cooperatives are not doing well except Pondicherry in order to ensure that this socially in some states and sectors. It is clear that for relevant movement does not collapse. Equal SHGs to be economically and socially attention will be given to the organization of sustainable over a period of time, they will men’s Self-Help Groups and mixed groups.

From Green to an Ever-green Revolution The pathways involved in bringing about this transition are given below:

Green Revolution Evergreen Revolution Commodity-centred increase Increasing productivity in perpetuity without in productivity associated ecological harm

Change in the physiological rythem Organic agriculture: cultivation without use of any insensitivity to photoperiodism chemical inputs like mineral fertilizers and chemical pesticides

Lodging resistance Green Agriculture: cultivation with the help of integrated pest management, integrated nutrient supply and integrated natural resource management systems

High harvest index Ecoagriculture: Based on conservation of soil, water and biodiversity and the application of traditional knowledge and ecological prudence

EM Agriculture: system of farming using Effective Microorganisms (EM)

White agriculture: System of agriculture based on substantial use of microorganisms, particularly fungi

One-straw Revolution: system of natural farming without ploughing, chemical fertilizers, weeding and chemical pesticides and herbicides

12

CHAIRMAN’S INTRODUCTION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

They will be particularly relevant in promoting Gender, Hunger and Poverty IPM, INM and other eco-farming techniques. This core programme is supported by The production and marketing of the biological endowment funds as well as project support. software essential for sustainable agriculture The work is being carried out under three such as bio-pesticides and bio-fertilizers have separate endowments – B V Rao, Uttara Devi been chosen for promoting SSHGs, through and Ford Foundation, and also receives microenterprise activity. generous support from the World Food Climate Management Programme. Developing the data essential for policy advocacy has been the major activity so This important activity of the JRD far. The three Atlases of Food Insecurity in Rural Ecotechnology Centre was started this year with and Urban India and Sustainability of Food support from SDC. All aspects of climate Security, produced in association with WFP management – vulnerability, prevention, have been widely acclaimed as valuable inputs mitigation and adaptation – are receiving in priority setting and policy formulation. This attention. The Rural Farm Science Managers led to MSSRF being invited to prepare a similar will also be trained in climate management. In Atlas for Cambodia. coastal areas, this work will be done through the ICZM Team. The work on Gender and Development has also The future of Indian agriculture depends upon resulted in significant initiatives like the our ability to enhance the productivity of small- preparation of curriculum for engendering the holdings without damage to their long-term curriculum of agricultural colleges and production potential. Transforming the green Universities and the publication of the revolution into an evergreen revolution using situation of women in agriculture in the last one or more of the several pathways described decade. The gender dimensions of food security here will usher in a win-win situation for both have been highlighted and some influence has farmers and ecosystems. Crop-livestock been brought to bear on providing support integration and introduction of stem- services to working mothers. The engendering nodulating legumes or pulse crops in the of the National Rural Employment Guarantee rotation will facilitate the building up of soil Act is another important contribution. fertility. Instead of placing the above-mentioned The work of the B V Rao Centre on Sustainable six approaches to sustainable agriculture in Food Security led to designing the Mission 2007: different compartments, it will be prudent to A Hunger-free India movement. The major develop for each farm an evergreen revolution components of Mission 2007 are: plan based on an appropriate mix of the different approaches, which can ensure both Enlarge the food basket by including in PDS ecological and economic sustainability. grains like, ragi, jowar, bajra, other millets,

13

ANNUAL REPORT 2005-2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

pulses and oilseeds, so that these nutritious can influence both policy formulation and cereals / food crops are also purchased at a programme implementation relating to minimum support price. This will help to legislation in areas such as land rights to enhance the income security of farm families women, Right to Information and Tribal Land in dry farming areas. Rights. Reform and restructure nutrition delivery Information, Education and Communication systems on the basis of a whole life cycle Information communication, capacity building approach, giving special emphasis to and educational programmes are carried out pregnant women, and children in the 0-2 in every Programme Area. The Hindu Media age group with special reference to ICDS. Resource Centre provides website and Foster community managed sustainable documentation facilities, particularly audio- food and water security systems involving visual forms and also organizes media briefing the establishment of Community Seed, and discussion sessions. Besides THMRC, the Grain and Water Banks, in every village. major platform for mobilizing information Fight hidden hunger through a food-cum- technology for sustainable development is the Jamsetji Tata National Virtual Academy for fortification approach. Rural Prosperity (NVA). NVA serves as the Enhance economic access to food through umbrella organization for content creation, multiple livelihood opportunities and non- capacity building and coordination with farm livelihood initiative. agencies like hospitals which can help to Promote convergence and synergy among convert knowledge into application. MSSRF large ongoing government programmes now operates with the help of ISRO eight such as NREG, Bharat Nirman, National Village Resource Centres and forty Village Horticulture Mission and National Rural Health Knowledge Centre in the States of Tamil Nadu Mission. and Pondicherry. In addition, 5 VRCs have been established jointly with ISRO in Another long-term initiative will be the Rajasthan, Maharashtra, Orissa and Andhra organization of National Action Research Network Pradesh. on Women and Agriculture. Such a network could involve appropriate institutions and NVA is creating a cadre of Master Trainers individuals in the major agro-ecological regions who, after a peer review process, are inducted of the country, such as the arid, semi-arid, hill, as Fellows of the Academy. They are the torch coastal and irrigated zones and islands. bearers of the rural knowledge revolution. In the words of President Dr A P J Abdul Kalam, It can help to undertake longitudinal studies “the Fellows of NVA represent a celebration of on all aspects of women and agriculture, and the core competence of rural India”.

14

CHAIRMAN’S INTRODUCTION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

The aim of NVA is to induct 5,00,000 Fellows Virtual Academy will enhance human capacity by 2010 about – one woman and one man from and creativity in all its dimensions and thereby every one of the about 2,40,000 Panchayats/ help in enabling every child, woman and man local bodies, who can become managers of the to lead a healthy and happy life”. This sums Village Knowledge Centres (VKCs). VKCs will up beautifully the power and purpose of a be linked at the block/ district level with Rural Knowledge Revolution. Village Resource Centres (VRCs) established Measuring the Impact of Science and with the support of ISRO. The internet – FM radio / cellphone combination will ensure last Technology on Agriculture and Rural mile and last person connectivity. Development

In addition to capacity building for creating a With support from the Principal Scientific Adviser to the Government of India, Dr R critical mass of rural knowledge managers, Chidambaram, MSSRF undertook the task of NVA also hosts the secretariat for the National developing indicators for measuring the impact Alliance for Mission 2007: Every Village a of science and technology on agriculture and Knowledge Centre. rural development. This study led to the The strength of NVA is its partnership with identification of catalytic technologies which ISRO, NASSCOM, TCS, Microsoft, IDRC, CIDA, could lead to increasing the value of output SDC, UNESCO, FAO and other national, per hectare. A Technology Achievement Index bilateral and multi-lateral organization. When is currently under development, which can fully developed, NVA will be the largest provide a yardstick for measuring the impact Academy of its kind in the world and will be of public good research on crop and animal the flagship of the movement to bridge the husbandry, fisheries and forestry as well as growing urban-rural digital divide. So far, 293 water and energy. rural women and men have been inducted as Fellows of NVA. NVA is developing linkages International Collaboration with all the ongoing Missions of the The partnership with the Ohio State University, Government of India like Bharat Nirman, USA, the Punjab Agricultural University and National Rural Health Mission, Sarva Shiksha the Jawaharlal Nehru Krishi Viswavidyalaya Abhiyan, National Rural Employment Guarantee in developing technologies for sustainable soil Programme and the National Horticulture health and natural resources management has Mission. To quote a rural woman in yielded valuable results and is now nearing Pondicherry, “The green revolution helped to the final stages. Collaboration has also been enhance the productivity of rice and wheat and developed with the Open Knowledge Network, thereby erase the begging bowl picture of our Commonwealth of Learning and Microsoft in country; the knowledge revolution the area of ICT for sustainable development. spearheaded by the Jamsetji Tata National With support from CIDA and IDRC,

15

ANNUAL REPORT 2005-2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ partnership has been developed with the Prof P C Kesavan helped to prepare a strategy Sarvodaya Organisation headed by the great for “Post-Tsunami New Andamans”. The team humanist and visionary, Dr A T Ariyaratne of was particularly inspired by the traditional Sri Lanka. Assistance was rendered to the wisdom of the tribal communities of Nicobar Government of Cambodia in preparing a Food Islands in dealing with calamities like tsunami. Security Atlas. MSSRF’s approach to integrating traditional wisdom with modern science thus received Converting calamities into opportunities for further impetus. progress While natural tragedies like tsunami, cyclones Every natural calamity brings forth an and earthquakes do occur periodically, opportunity for progress both for strengthening avoidable man-made tragedies are a matter of human security, and for being better prepared shame and sorrow. One such is the agrarian to face similar calamities in future. The tsunami crisis leading to farmers’ suicides in several of 26 December, 2004 was one such natural States, particularly Maharashtra, Andhra calamity which brought out the best in Pradesh, Karnataka and Kerala. Punjab is also humankind. The spontaneous outpouring of witnessing such an unfortunate tragedy. help was inspiring. MSSRF scientists and Government relief programmes generally scholars concentrated on developing a “Beyond concentrate on re-starting agriculture. The Tsunami” strategy aimed at strengthening human dimensions of the tragedy like the ecological and livelihood security. This plight of young widows and the future of the involved integrated attention to bioshields, children do not receive as much attention as coastal biovillages and Village Knowledge they need. MSSRF therefore initiated on 1 May Centers. It also involved concurrent attention 2006, a widows’ psychological and livelihood to the problems of fisher and farming rehabilitation and children’s’ education communities. Agricultural rehabilitation in sea programme in the distress hotspots of the water-inundated soils became urgent. The best Vidharbha region of Maharashtra. 78 children available scientific expertise was mobilized for (45 boys and 33 girls) ranging from primary this purpose. Above all, the education of school to junior college level from 37 families orphan children received priority attention, across 36 villages in 8 talukas of Wardha since otherwise they would remain blossoms district have been covered under the education in the dust. In view of the importance of this programme, which is being expanded in a well- programme in human terms, a whole time planned manner. The widows’ rehabilitation position of Programme Director was created to programme includes introduction to coordinate the activities. sustainable livelihoods and training in At the request of the Andaman and Nicobar running Gyan Chaupals. Based on the action Administration, MSSRF team headed by taken by the Central and State Governments,

16

CHAIRMAN’S INTRODUCTION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ this programme is designed to ensure During the year several major national and opportunities for a productive life for the international seminars, workshops and unfortunate victims of the agrarian crisis. consultations were held which have been Credit and market are two key factors in the included in detail in the Report. Among these, agrarian dilemma. The Gyan Chaupals operated a notably holistic and comprehensive one was by the widows or children affected by the crisis the International Conference on “Human- will provide all the needed information on Centred Sustainable Development Paradigm,” credit, insurance, market and technology to held from 8 – 10 August, 2005. The thematic farmers at the right time and place. The State areas discussed included evergreen revolution, Bank of India and MSSRF plan to develop in sustainable livelihoods, natural resource the Wardha district a strategy for financial management, food and nutrition security, inclusion based on the antyodaya principle, so knowledge – empowered com-munities, gender as to cover every family by 15 August, 2007 and development, effective delivery with the needed and timely credit. If mechanism for sustainable livelihood options implemented successfully, Wardha will be the for rural communities and policy issues. In first district in India where the concept of addition, ongoing activities of the Foundation financial inclusion becomes a reality. in relation to developments in the relevant fields were showcased. More than 600 participants As regards market, MSSRF strategy aims to link representing researchers, development nutrition security and income security in a planners, policy makers, various stakeholder mutually reinforcing manner. For this purpose, representatives and students attended the locally adapted cereals, millets, oilseeds, conference. On the pre-conference day, two vegetables, fruits and tuber crops will be sessions were dedicated to highlight contri- promoted based on market tie-ups. Drought butions of Prof. Swaminathan to science and tolerant local millets and cereals like ragi, jowar, technology and public policy. bajra and kodo and other millets will be Human Resource Development continued to recommended for inclusion in the Public receive high priority in the mission of MSSRF. Distribution System, based on a minimum The efforts in capacity building ranged from support price. In addition, local SHGs can providing opportunities to visually impaired operate Community Grain and Feed Banks. children to experience the beauty and diversity Jowar fodder and cottonseed cake can help the of life, to train rural women and men to master families affected by the agrarian crisis in modern ICT and become Fellows of the Jamsetji Vidharbha to broadbase their sources of Tata National Virtual Academy for Rural income through integrated crop-livestock Prosperity. During the year five scholars took farming systems. Once more a human tragedy their Ph.D degrees based on the thesis work can be converted into an opportunity for done at MSSRF. Dr Ajay Parida received the launching a farm revolution in rainfed areas. B M Birla Science Prize in Biology of the Birla

17

ANNUAL REPORT 2005-2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Science Foundation, while Dr Sudha Nair was and present Trustees for their invaluable chosen for the B D Tilak Award of the Indian contributions to the growth and effectiveness National Science Academy. of the organization. Particular thanks go to Shri N Ram, Chief Editor, The Hindu, who chairs The new initiatives in human capacity building the Audit Committee, Dr T Ramasami, included steps for establishing a “Fish for All” Secretary to the Government of India, Training Centre at Poompukar near Department of Science and Technology, who Nagapattinam in Tamil Nadu, and a SHG chairs the Personnel Committee, and to Dr Usha Capacity Building and Mentoring Centre at Barwale, Director, Mahyco Research Pillayarkuppam in Pondicherry. Foundation, who chairs the Programme Management and Policy Oversight Committee, for sparing their valuable time to guide the growth of MSSRF in a scientifically During the year, MSSRF lost one of its valuable and socially meaningful direction. The other Trustees, Dr K N Shyamasundaran Nair, Trustees of MSSRF, Mr Russi M Lala, Smt whose commitment to improving the quality of Anuradha Desai, Dr Soumya Swaminathan, Dr life of the underprivileged and to ensuring Suman Sahai, Shri V Namasivayam and Dr gender equity in development, were sources of Madhura Swaminathan are all pillars of great inspiration and guidance. Another loss strength. Our sincere gratitude goes to all of was the demise of Dr A Sankaram, who was them for their dedication to the growth of a the first Secretary of the Centre for Sustainable unique organization determined to Agriculture and Rural Development. demonstrate that inclusive economic growth Dr Sankaram was a role model for the younger and human development can be accomplished researchers by virtue of his thoroughness in through a fusion of professional skill, public the collection, analyzis and interpretation of action and community involvement. MSSRF is scientific data. He developed the first Soil also committed to showing that seemingly Health Card, to empower farmers with impossible tasks can be achieved by mobilizing information on the Chemistry, Physics and the power of partnership, as for example, Microbiology of the Soil. MSSRF will carry Mission 2007: Every Village a Knowledge Centre. forward the legacy of Drs KNNS Nair and A The work reported in this as well as the earlier Sankaram by intensifying work in the areas reports would obviously not have been initiated by them. possible, but for the generous financial and Pain and pleasure are integral parts of life. technical support of a wide range of national While we lost some of our valued colleagues, and international agencies listed are also listed the Board of Trustees of MSSRF will be enriched in the Report. Particular thanks go to our by the addition of Dr Vijay Mahajan and Smt corpus and endowment donors whose Mina Swaminathan. We are indebted to past generosity and help has imparted stability and

18

CHAIRMAN’S INTRODUCTION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ continuity to the core activities of the Foundation Chairs, Distinguished Fellows, and Foundation. We were particularly moved by other senior staff members for their dedicated the spontaneous support from individuals and work and leadership. Thanks also go to institutions, far and near, to the cause of Dr S Rajagopalan and Dr Malavika bringing comfort and confidence in the lives of Vinodkumar as well as to the Members of the the families affected by natural tragedies like Governing Council of CRSARD, for their tsunami, and man-made tragedies like the contributions to the growth of the sustainable agrarian crisis resulting in farmers’ suicides. agriculture movement. Participating in the meetings of Friends of MSSRF in Japan and Australia brought home Finally, I wish to record my sincere the eternal truth of the ancient words, appreciation of the painstaking efforts of “Vasudeiva Kutumbakam” (the world is Prof Venkatesh Athreya, Dr Ajay Parida and one family). Dr Sudha Nair for bringing out this Report in a timely and reader-friendly manner. Thanks The Trustees wish to express their gratitude to also go to Dr Nandhini Iyengar for her all the scientists, scholars and administrative continued help in editing this Report and to and support staff for their continuous efforts to AMM Screens for ensuring a high quality of give their best. They adhere to Mahatma printing. Gandhi’s dictum, “Be the change you wish to bring about”. Particular thanks go to Dr M Velayutham, Executive Director, all M S Swaminathan Programme Directors, Homi Bhabha and Ford Chairman, MSSRF

19

Programme Area 100

Coastal Systems Research

Promotion of coastal bioshield has been initiated in 71 ha in 7 villages where tsunami rehabilitation programmes of MSSRF are being implemented. An Indo-Srilankan project has been launched covering bioshield, livelihoods and Village Knowledge Centres. Micro water shed development activities have been initiated at Kudankulum.

101 Coastal Wetlands: Mangrove Conservation and Management ------22

102 Coastal Bioshields ------24

103 Seawater farming ------31

104 Nuclear and Biotechnological Tools for Coastal Systems Research ------32

105 Remote Sensing and Geographical Information System ------37

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

other coastal vegetation as a protective barrier Sub Programme Area 101 against possible tsunami at the macro level. Coastal Wetlands: Mangrove Method: The study was conducted in the southern part of Cuddalore district and northern Conservation and Management part of Nagapattinam district, which were severely affected by the tsunami. The coastal Coastal Systems Research vegetation of Cuddalore consists mainly of mangroves (Pichavaram) whereas Naga- Being the year after the tsunami, activities of pattinam is characterized by the presence of Programme Area 100: Coastal Systems large casuarina shelterbelt plantations raised Research during this year focused on i) by the Tamil Nadu Forest Department (TNFD) scientifically establishing the role of mangroves since the 1970s. The total length of the coast and non-mangroves in mitigating the impact of covered in this study was about 20 km and the tsunami, ii) ecological rehabilitation of the land up to 1 km from the shoreline was taken coastal areas with mangrove and non-mangrove up for the assessment. The topography of the bioshields and iii) building the capacity of the study area is smooth and the elevation of the stakeholders including the community, land is generally between 1 and 3 m above grassroot NGOs, funding agencies and mean sea level. The height of the waves that hit government institutions in bioshield development these coastal areas was about 4.5 m. In this and management through training. study, high resolution pre-tsunami and post- tsunami satellite images were used to find the 101.1 Role of mangroves and other coastal correlation between vegetation cover and vegetation in mitigating the impact of damage caused by the tsunami. Using Quick tsunami Bird satellite imagery of May 2003 (pre-tsunami) to study the vegetation cover, including There have been reports in the media after the mangroves and non-mangroves, the study area tsunami that hit the Indian coast in December was divided into three categories namely, i) 2004, that mangroves and other coastal dense tree vegetation, ii) open tree vegetation vegetation played a role in reducing its impact and iii) no tree vegetation. Mangrove forest with on the lives and property of coastal dense trees and thick casuarina shelterbelt communities. Last year, a micro level study was areas were included in the dense tree vegetation conducted on how mangroves mitigated the category. All other woody vegetation, including impact of the tsunami. This year, scientific degraded mangroves and gaps in plantations, evaluation was carried out in collaboration with were considered open vegetation. For post- Nordic Agency for Development and Ecology, tsunami damage assessment, IKONOS Copenhagen and University of Copenhagen, satellite imageries of December 29, 2004 Denmark, to assess the role of mangroves and (3 days after the tsunami) were used and the

22

COASTAL SYSTEMS RESEARCH ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ damages were divided into three categories 101.2 Restoration of Mangroves in Andhra namely, i) damaged (areas where all or most of Pradesh the physical structures had been destroyed, removed or damaged), ii) partially damaged During the year, activities relating to the Joint (some damage but most of the physical Mangrove Management (JMM) programme were structures remain intact) and iii) undamaged (no initiated in Chollangipetta hamlet of the Chollangipetta Panchayat of East Godavari damage visible on the ground or in the satellite district. Chollangipetta is a farming hamlet with imageries). A comparison was then made a total population of 1,800. A few of these farming between the tree vegetation categories and the families own feral cattle, which live in the tsunami damage using chi-square tests. mangrove forest throughout the year and graze Results: The results showed that within heavily on the mangroves. These families also 1,000 m from the shore, there was statistically utilize the mangrove wood for house significant correlation between tsunami-caused construction. Degraded mangrove area of about damage categories and different tree vegetation 10 ha in the Coringa Reserve Forest has been 2 2 identified as the mangrove management unit of densities: (c4 = 5.15 x 10 , P<0.01), in particular, dense tree vegetation associated with this village. The Andhra Pradesh Forest undamaged areas and dissociated with Department (APFD) has already formed an Eco damaged areas (Table 1.1). Development Committee (EDC) in this hamlet, with 844 members and a 16 member Executive The results have been published in Science Committee (EC). This EDC is actively (310: 643) with online support materials. participating in the planning, implementation and However, the results from the present study are monitoring of the restoration activities as well only a preliminary finding from a single case as in nursery development. The biophysical study and more detailed studies involving more survey indicates that the canal method of sites and using different statistical methods restoration can be followed to restore the such as multivariate analyzis and modelling are degraded areas. Technical and financial support needed, to fully understand the protective role has been given to the EDC to establish a of coastal tree vegetation against tsunami. mangrove nursery near the restoration site. It

Table 1.1 Distribution of tsunami damaged area with reference to tree vegetation cover (numbers in parenthesis indicate % in the study area)

Damage category/ Damaged Partially damaged Undamaged Total area tree cover area (ha) area (ha) area (ha) (ha) Dense tree vegetation 2.2 (0.5) 15.7 (3.5) 437.1 (96.1) 455.0 Open tree vegetation 30.9 (15.4) 84.4 (41.9) 86 (42.7) 201.3 No tree vegetation 502.9 (35.1) 384.2 (26.8) 547.0 (38.1) 1,434.1

23

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ now has about 54,000 seedlings of Avicennia coastal areas as a part of disaster mitigation marina. These seedlings will be planted in the initiatives. The plan of action for the rehabilitation restoration sites. As part of the community of tsunami affected communities and areas, mobilization processes, an awareness rally was published by the National Commission on organized in the village and student members Farmers (NCF), also strongly recommended of the Green Corps of the nearby high school that strengthening the ecological foundation of actively participated in the rally. the coastal areas should be taken up immediately as a long term measure to manage The experiences of the community during the natural disasters in the coastal zone. tsunami and anecdotal evidences published in Considering all these, the coastal bioshield the media about the role of mangroves and non- movement was initiated during the year and the mangrove coastal vegetation in reducing the following activities were completed: i) impact of the tsunami caused changes in the assessment of current practices in establishing mindset of coastal communities and the attitude non-mangrove plantations along the coastal of government agencies towards raising areas, ii) initiating development of mangrove mangrove and non-mangrove vegetation as bioshields, iii) initiating development of non- bioshields along coastal areas. The fishing mangrove bioshields, and iv) establishment of community, which is normally reluctant to participate in restoring, conserving and raising mangrove and non-mangrove nurseries. mangrove and other coastal vegetation 102.1 Assessment of current practices in programmes, now shows a lot of interest in establishing non-mangrove coastal plantation

In addition to mangroves, other coastal Sub Programme Area 102 vegetation such as casuarina plantations, raised Coastal Bioshields by government agencies and individual farmers as crops, and sand dunes, associated sand restoring degraded coastal vegetation as well binders and tree vegetation, also played a role as raising plantations in new areas. This is in reducing the impact of the tsunami. In order indicated by the demands of the fishing to understand the various practices followed to community to government agencies and non- raise and manage these plantations, a study governmental organizations for raising mangrove was conducted in randomly selected areas or other tree vegetation in suitable places around covering the entire coast of TN. The study their villages. Similarly, administrators and covered i) the species used to raise coastal planners are willing to allot large plots of shelterbelts, ii) the techniques followed, iii) the wastelands to the coastal community to raise level of community participation in raising plantations, of either mangroves or non- shelterbelts, and of iv) the community initiatives mangroves, as a protective cover along the in conserving sand dunes and associated

24

COASTAL SYSTEMS RESEARCH ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ coastal vegetations. The following are the major tree vegetation, with the participation of the findings of this study. local community, should be taken up as a priority issue because these dunes act as Almost all the shelterbelts raised by the barriers against cyclones and tsunami and government agencies consist of only one play a dominant role in water conservation species, namely Casuarina equisetifolia. The in coastal areas where water scarcity is a ecological impact of such single shelterbelts recurrent feature during the summer season. is not known, but such single species shelterbelts do not address the issue of Currently, plants in shelterbelts are raised linking livelihood security of the coastal following the square method which can be communities with ecological security of the changed to the V shape method to create coastal areas. Hence, in order to achieve more effective barriers. better results, multispecies shelterbelts with In casuarina shelterbelts which are 2 to 3 tree vegetation that provide economic years old, suitable species can be grown incentives to the local community should be as understory species so that the gaps raised. The local community can be created due to increase in the height of encouraged to cultivate suitable intercrops casuarina trees can be compensated. This within shelterbelts to increase their stake in would also improve the ecological condition shelterbelt development and management. of the plantation.

There has been only token participation of Starting casuarina plantations right from the Panchayati Raj Institutions (PRI) and local high tide line is one of the serious concerns communities in planning and monitoring the relating to shelterbelt plantation along the shelterbelts. Local NGOs can be involved coastal areas. This may have serious as facilitating agencies to bring genuine implications on the ecology of the coastal partnership between PRI, the local areas such as destroying the nesting sites community and government agencies so that of turtles and the habitats of shore crabs. long-term management of shelterbelts can Shelterbelt plantations close to the shore be ensured. may also trigger soil erosion by reducing or Small sand dunes with various kinds of preventing supply of sand to littoral drift. vegetation are present all along the coast. A Hence, shelterbelt plantations should start few of them are owned by individuals but a at least 50 to 60 m away from the high tide majority of them are common property, line. belonging to either the Panchayat or other 102.2 Bioshield development and government agencies. However, there is no management system in place for the management of these coastal sand dunes. Conservation of these The coastal bioshield programme has been sand dunes with suitable sand binding and initiated in the villages where tsunami

25

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ rehabilitation programmes of MSSRF are being However, the community mostly decides the implemented. The following procedure is being tree species for the bioshield. Following this, followed in initiating the bioshield programmes. village level micro plans are prepared with the During the initial phase of the programme, help of the traditional panchayat. In some discussions are held with the villagers about cases, a separate village level committee is the role played by mangrove and non-mangrove formed for the preparation and implementation coastal vegetation in protecting the lives and of the micro plans at the request of the traditional livelihood of the coastal communities during panchayat. These micro plans contain details tsunami. The importance of the vegetation as a of technical interventions and management barrier against cyclone and storm surges and activities to be taken up. As per the micro plan, its role in preventing soil erosion and in funds for bioshield development and ameliorating micro climate are also discussed. management are being provided to the The advantages of multispecies bioshields as traditional panchayat where it directly a source of income are explained in detail. implements the programme, whereas in other Following this, the interest of the community in villages, funds are being provided to village level participating in the development and committees that have been formed exclusively management of mangrove and non-mangrove for the purpose of bioshield development and bioshields is ascertained. After this, lands management. suitable for the development of mangrove and non-mangrove bioshields are identified and 102.3 Development and management of quantified, followed by the assessment of mangrove bioshields ownership of the land. If the land belongs to the Raising mangrove vegetation in areas other than community, permission from the traditional reserve land (otherwise called afforestation of panchayat is obtained. In case the land belongs mangroves) with the participation of the local to government departments, permission is elected government and community is the major obtained, mostly through the concerned elected activity of the current mangrove bioshield panchayat with the concurrence of the traditional development and management programmes. panchayat. So far, no attempt has been made Table 1.2 shows the villages involved in to develop bioshields in private lands. mangrove bioshield programmes, the area where mangrove plantations are being raised and After permission is obtained, biophysical data, village institutions that implement the particularly, soil character, nutrient status and programmes. source of water, are collected. Biophysical data provide an opportunity to determine various The project villages, Muzhukkuthurai, MGR kinds of technical interventions to be taken up Thittu and Mudasalodai of Cuddalore District, in bioshield development. These data also help are located north of the Pichavaram mangrove in determining the species to be planted. reserve forest. Extensive mud flats are present

26

COASTAL SYSTEMS RESEARCH ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Table 1.2 Villages and village level institutions involved in the development of mangrove bioshields in tsunami affected areas

Name of the village District Area (ha) Village level institution

Muzhukkuthurai Cuddalore 20 Grama Nala Sangham MGR Thittu Cuddalore 35 Grama Nala Sangham Mudasalodai Cuddalore 12 Grama Nala Sangham Chandrapadi Nagapattinam 1 Traditional panchayat Pazhayar Nagapattinam to be decided Grama Nala Sangham Sadraskuppam Kanchipuram 2 Traditional panchayat Pattinamcherry Pondicherry 1 Traditional panchayat between the villages and sea. Degraded 102.4 Development and management of mangroves are present in some areas of these non-mangrove bioshields mud flats and other areas are almost barren. Raising of multispecies shelterbelts that take These areas are suitable for raising mangrove care of both ecological and livelihood needs with bioshields. The canal method, which was tested the participation of the local community is the successfully in other areas, is being followed major activity currently being implemented in to raise mangrove plantations here. These mud the non-mangrove bioshield programmes. The flats are classified as revenue poramboke lands following are the villages involved in the and permission from the District Administration, development and management of non-mangrove Cuddalore District, has been obtained through bioshields (Table 1.3). the traditional panchayats of these villages and the elected panchayat of Killai, in which these Table 1.3 Villages and village level project hamlets are located. Demarcation of institutions involved in the development of these areas into management units of three non-mangrove bioshields villages has been completed. Canal digging Name of the District Village level work has been completed in about 20 ha. In village institution the case of Pattinamcherry of Pondicherry, the identified land for the mangrove bioshield Chandrapadi Nagapattinam Traditional panchayat Poompuhar Nagapattinam Elected panchayat belongs to the FD and it has given permission to the traditional panchayat to raise a mangrove Madavamedu Nagapattinam Grama Nala Sangam plantation. In all these areas three species of Muzhukkuthurai Cuddalore Grama Nala Sangam mangrove plants namely, Rhizophora apiculata, MGR Thittu Cuddalore Grama Nala Sangam

Rhizophora mucronata and Avicennia marina, Mudasalodai Cuddalore Grama Nala Sangam have been selected by the local fishing Sadraskuppam Kanchipuram Traditional panchayat community for plantation.

27

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

A non-mangrove bioshield is normally developed of other ecologically valuable trees are planted. in linear patches between the village and the Traditional practices such as mulching using sea. Currently two different models of non- coconut husk and casuarina needles are mangrove bioshield are being developed. The followed as measures to increase the water structure of Model 1 is shown in Figure 1.1. As holding capacity of the soil. In some cases, shown in the figure the first component of this linear ditches are created along the length of bioshield is a small sand dune that starts about the sand dunes, which not only act as a rain 50 to 60 m away from the high tide line. In some water harvesting structure but also aid in the cases, sand dunes that are in degraded recharge of ground water. In addition, new condition due to social causes or flattened due practices such as the application of biofungicide to tsunami waves are restored and considered such as Trichoderma and biofertilizer such as the first component of the Model 1 bioshield. In VAM are introduced in the development of the some other cases, new sand dunes are created non-mangrove bioshield. Plants that yield green using either the traditional method or by piling fodder and green manure are not normally up sand manually. In the traditional method, preferred by the fishing community as they palm fronds are arranged like a fence in the maintain very low livestock and also possess sandy area located between the sea and the limited or no agriculture land. In Model 2, village to facilitate deposition of sand in that (Fig. 1.2) no sand dune is present between the area, leading to the formation of small dunes. beach and the bioshield and the first few rows These dunes are then covered with various sand consist of bushy vegetation. Otherwise, binding creepers such as Ipomoea pes-capare, Multispecies Residential Non - mangrove Area tree Sand dune bioshield Fencing (restored or Spinifex sp and bushes like Vitex sp. In some artificially created areas tree species such as Thespesia sp are Beach grown on these dunes to stabilize them. Sea

The multispecies non-mangrove bioshield starts Sand binding creepers and bushes next to these restored or created sand dunes. The length and breadth of this bioshield is Figure 1.1 Non-mangrove bioshield – Model 1 determined by available land. In the first few rows, ecologically valuable tree species such Multispecies Residential Non - mangrove Area tree bioshield as Pongamia pinnata, Thespesia populenoides, Fencing

Callophyllum inophyllum, neem and casuarina, Beach are planted as per the choice of the local Sea community. Following this, several rows of Species 1 Species 2 Species 3 Species 4 Species 5 coconut trees are planted, as it is the primary choice of the local community for economically Figure 1.2 Non-mangrove bioshield – valuable trees. Behind the coconut trees, rows Model 2

28

COASTAL SYSTEMS RESEARCH ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ bioshield components and methods of raising efforts. Requests were also received from plantations are more or less similar to Model 1. funding agencies to organize training for their staff. Therefore, orientation programmes were 102.5 Training in mangrove and non- organized for them to enhance their capacity mangrove bioshield management to evaluate the project proposals submitted by Orientation and training programmes on the grassroot NGOs. Table 1.4 shows the number development and management of mangrove and of training programmes conducted for different non-mangrove bioshields were conducted for stakeholders and the participants who attended various stakeholders. The objectives of these the programmes. Table 1.5 gives details of the orientation trainings were i) to raise awareness funding agencies, grassroot NGOs and villages among stakeholders (community, NGOs, from which community and Panchayati Raj government agencies, Panchayati Raj leaders attended the training. representatives etc.) about the role of mangrove Table 1.4 Training programmes conducted and other coastal vegetation in reducing the for different stakeholders and the number impact of tsunami and other natural disasters, of participants ii) to provide orientation in technical aspects of Stakeholder No. of No. of raising mangrove and other coastal vegetation programmes participants as bioshields and of iii) to provide orientation in Community and 4 140 the participatory process of developing and Panchayati Raj managing coastal bioshields. leaders

Participants: Orientation / training programmes Grassroot NGOs 2 40 (middle level managers were conducted in response to demands from and field workers) stakeholders. There is an increased interest among the community leaders and Panchayati Funding agencies, 2 65 grassroot NGOs Raj representatives in establishing coastal (top level managers) bioshields around their villages. Hence, and government orientation programmes were organized for agencies community leaders and Panchayati Raj representatives on how to motivate others in Topics covered: The following topics were their villages in bioshield development and covered in these training programmes: i) management as well as on technical know-how identification of suitable lands for mangrove and and participatory processes. A number of non-mangrove bioshields, including analyzis of grassroot NGOs, who are working on environmental conditions, assessment of rehabilitation of tsunami affected villages, ownership, getting permission from the wanted to involve themselves in establishing government agencies through Panchayati Raj coastal bioshields as part of their rehabilitation ii) technical aspects of mangrove and non-

29

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Table 1.5 Participation in the orientation programmes

Funding and other agencies Grassroot NGOs Community, SHG and Panchayat Raj leaders

Care India CREED, Chidambaram 16 villages in Ramnad district CASA CSSR, Cuddalore 4 villages in Tuticorin district World Vision MNTN, Cuddalore 4 villages in Nagapattinam and Cuddalore districts German Agro Action PAD, Vembar 1 village in Karaikkal Centre for Environmental CCD, Madurai Education, Karaikkal SEED, Madurai, SEVAI, SMSS, Sivagangai, PMSSS, Pondicherry CODE, Radhapuram

mangrove bioshield development, including to study and evaluate the existing analyzis of biophysical conditions, species ecosystem management in the coastal suitable to meet the ecological requirement of areas of AP, with special reference to the bioshield and economic requirement of the mangrove and non-mangrove shelterbelts, community, technical intervention to create tidal to study the existing institutional framework flushing in the case of mangroves, planting that is implementing the mangrove methods, and after care and iii) participatory restoration and shelterbelt establishment, and management aspects of bioshields such to identify the various stakeholders involved as group formation in the village, partnership in the management of coastal zone with other agencies, joint planning, ecosystems, implementation and monitoring. The orientation programmes for funding agencies and NGOs to suggest suitable strategies and practices were conducted for three days, whereas for the for the management of coastal zone community, SHGs and Panchayati Raj leaders, ecosystems and they were conducted for two days. to suggest suitable institutional arrangements and roles for stakeholders for 102.6 Development of projects for Andhra the management of coastal ecosystems of Pradesh Forest Department AP

A study of the development of tsunami sensitive The study was conducted by reviewing available areas of Andhra Pradesh (AP) was conducted information, including remotely sensed data, at the request of the APFD. The objectives of collecting primary data in the field and interacting this study were: with various stakeholders such as the

30

COASTAL SYSTEMS RESEARCH ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ community, community-based organizations, livelihood enhancement and knowledge NGOs, panchayat representatives, research empowerment. In Sri Lanka, this project will be institutions and government agencies. A implemented in the eastern districts of Ampara, workshop was conducted separately for each Hambantota and Batticaloa. In India, it is being stakeholder to assess their strengths, implemented in the states of TN and AP. The weaknesses, opportunities and threats relating following are the expected outcome of this to the development and management of project in India: mangrove and non-mangrove bioshields. The Establishment of mangrove and non- Report includes details of technical, social and mangrove bioshields in about 210 ha and developmental interventions that can be taken 50 ha in TN and AP respectively, up for better management of the coastal ecosystems of AP. The Report was developed Establishment of 4 Village Resource Centres into a project proposal and submitted to World (VRCs) and 10 Village Knowledge Centres Bank for support by the APFD which is now (VKCs), approved and MSSRF has been selected as Livelihood opportunities created for about one of the partners to implement this project. 20 % of the people of the project villages, 102.7 Indo-Sri Lanka Project who are below the poverty level. The activities of bioshield development, village A project titled “Strengthening Resilience of resource and knowledge centres and livelihood Tsunami affected Communities: Bioshield, programmes will be implemented in an Livelihood Development and Village Knowledge integrated manner. Centres in India and Sri Lanka” has been developed based on the concept papers submitted by MSSRF, a grassroot NGO of Sri Sub programme area 103 Lanka namely, Lanka Jatika Sarvodaya Sharamadhana Sangam (Sarvodaya), which Seawater farming has its headquarters in Moratuwa and an international NGO namely Practical Actions 103.1Integrating mangrove afforestation with (formerly ITDG) with its headquarters in the cultivation of halophytes and fish and crab Colombo. The aim of the project is to reduce culture the vulnerability of the rural poor in coastal areas of Sri Lanka and India to natural disasters and A seawater farm uses untreated seawater enhance the capacity, resources and collective instead of freshwater to raise crops. An action of the coastal communities, grassroot integrated seawater farm combines the growing organizations and government agencies to of salt tolerant field and orchard crops with the reduce the impact of natural disasters through husbandry of animals, mainly fish, crab and integrating environmental rehabilitation, shrimp. Diminishing freshwater sources,

31

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ shrinking arable land, rising sea level, intrusion coastal tracts through tidal creeks and channels of saline water and depleting capture fishery is tapped and utilized for farming. No artificial resources necessitate the development and feed or chemicals will be used for fish or crab demonstration of an ecologically suitable, culture or halophyte cultivation. A community economically viable and socially equitable based Seawater Farming Monitoring Committee system of seawater farming for the prosperity is being formed with 20 members. Four of coastal communities. Currently, a seawater members, 2 men and 2 women, from the villages farming system is being developed in of Muzhukkuthurai, MGR Thittu, Mudasalodai, partnership with a private entrepreneur and the Madavamedu and Pazhayar will constitute the local community in the Coleroon estuarine committee, which will visit the farm at regular region in Nagapattinam district. In this system, intervals, and monitor the progress and evaluate attempts are being made to integrate raising of results. Modifications and interventions mangrove plantation, halophyte cultivation and suggested by this committee will be analyzed crab and fish culture. It is being developed in a and incorporated. farm of about 0.70 ha. Normally, aquaculture ponds have four bunds to hold the water where fish and shrimp are cultured. In this farm, in Sub Programme Area 104 addition to the four side bunds, the ponds have inner bunds; such an arrangement does not Nuclear and Biotechnological restrict the flow of tidal water in and out of the Tools for Coastal Systems pond and at the same time, provides space for Research mangrove plants as well as halophyte crops. At present, mangrove species Rhizophora The project Nuclear and Biotechnological Tools apiculata and R. mucronata are being grown in for Coastal Systems Research, supported by the lower edge of the inner and outer bunds the Department of Atomic Energy (DAE), has and Avicennia marina is being grown in the been primarily designed to integrate middle portion of the bunds. A halophytic crop conservation of natural resources and namely, Sesuvium portulacastrum will be grown sustainable development in the rural areas at the top of the bunds. The area between the adjoining the Nuclear Power Plants through inner bunds has standing water of about 1.5 strengthening livelihood security, by blending feet, which is suitable for fish and crab culture. frontier science and technology with traditional Fish will be cultured during the first year. Once knowledge systems of rural coastal the Rhizophora species have started producing communities. The primary activity of the still roots, crab fattening or culture will be programme undertaken in Kalpakkam, started. In this extensive system of seawater Chidambaram and Kudankulam regions of TN farming, water is not pumped from the sea into was to introduce new tools and technologies the farms, but seawater entering the saline for sustainable development in agriculture,

32

COASTAL SYSTEMS RESEARCH ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ fisheries and animal husbandry through the three villages in and around Kudankulam. development of grassroot level institutions, and Similar activities were also initiated in strengthening local communities through Chidambaram (See PA 401.1.1) and Kalpakkam capacity building and knowledge empowerment. regions. The net area covered under various In the first five years, the project focused on mutant crop varieties of pulses and groundnut developing suitable models for adoption by the in these regions has gone up substantially. Last people, in the fields of agriculture, water year, more than 200 ha of land was under these management, animal husbandry, fisheries and crops, involving as many farmers. allied activities. Last year the programme had a broader focus and concentrated on the Performance test for the millet species Samai demonstration of models developed jointly with was carried out as per the recommendation of the communities and their adoption by farmers. the soil survey report, in the demo-plot under rainfed condition. Seeds obtained from TNAU 104.1: Location specific performance and and the All India Coordinated Project on millets yield evaluation were sown in one acre of land, and the yield obtained was 85 kg. Seeds produced in the In coastal dryland agriculture as practised in demo-plot were distributed to farmers for further Kudankulam, the amount and distribution of trials in their fields in the coming year. rainfall during the NE monsoon governs the quality and length of the growing season. The Redgram (CO5) variety obtained from the monsoon rains occur at infrequent intervals and Department of Pulses, TNAU, Coimbatore, was are interspersed with drought-like periods, when sown in one acre of land and performance and crops are exposed to moisture deficits. yield parameters were recorded. The yield was found to be satisfactory at 135 kg/ac under Mutant varieties of pulses and oil seeds rainfed condition. The trial also showed the developed by BARC were evaluated and tested production of a large amount of biomass which by farmers. They were found superior and could be used as fodder and fuel. During the drought-tolerant compared to the locally used next season, most of the farmers with assured ones. Table 1.6 shows the mutant varieties irrigation facilities will be cultivating these crops multiplied during the years, involving more than in their fields. 150 farmers, under different soil conditions, in Jatropha (bio-diesel crop) is another promising Table 1.6 BARC seed multiplication during crop to increase the productivity of the dry the year in all the study sites wasteland available in and around Kudankulam. Crops Seed (kg) Area (ha) In the MSSRF demo-plot, 135 different elite Greengram 3,940 67 accessions were planted to identify the location Blackgram 2,569 40 specific genotypes in relation to oil content and Groundnut 12,292 38 yield. This will serve as a gene bank of Jatropha

33

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ germplasm. Four farmers’ groups from nearby medium to low water holding capacity. Shaping villages were trained on the techniques of large- the land surface and grading it in such a way scale plantation and production of bio-diesel that excess water received during rainfall is crops. Four hectares of land with different soil safely conducted to water storage reservoirs (or characteristics were covered by growing tanks) or watershed unit to augment Jatropha for demonstration purpose. Three groundwater recharge is necessary to ensure nurseries have been established with a capacity sustainable availability of water. of more than 10,000 plants, based on the The various activities undertaken in previous interest shown by the farmers. Many of them years at Vijyapathy panchayat with the are interested in quality seed production. Table participation of local people, such as earthwork 1.7 shows the area covered by different crops and contour trench making, were completed and at Kudankulam. different local plant species, mainly fodder Table 1.7 Area covered by different crops based trees, were planted, covering 10 ha of at Kudankulam land. The group responsible for watershed Crops Area (ha) development took up stall fed goat rearing as Pulses 12 one of the income generating activities. Safe Groundnut 7 drinking water, sanitation and health awareness Jatropha 4 were included as various developmental activities Fodder grass 30 around the watershed development area. Fruit crops 14 A few SC farmers applied for subsidized loan Total 67 from NABARD for the construction of water harvesting structures in their fields, with 104.2: Micro-watershed development technical support from MSSRF. MSSRF has taken the initiative to select farmers from nearby The yield of crops is affected during the dry villages to recommend them for available loan period, especially during the flowering stage. schemes. Improving the soil moisture status and providing for lifesaving supplemental irrigation from local 104.3: Fodder production practices water resources is, thus, of primary importance The importance given to nutritious perennial for raising the productivity of rain-fed lands to grass has created a good impact in and around their optimum potential. The local farmers Kudankulam region. About 50 farmers were adopted in situ conservation methods for supplied fodder slips directly from the demo plot. securing the length of the growing period to meet (Table 1.8) This has become an income crop water needs. generation activity as many farmers have In a semiarid region like Kudankulam, seasonal started to sell the fodder slips @ Rs. 30/100 rainfall is less than 400 mm and soils have slips. MSSRF is helping NARDEP Kalluvilai

34

COASTAL SYSTEMS RESEARCH ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Table 1.8 Fodder crop varieties adopted growing in their fields. Azolla is useful in dryland by the farmers agriculture and can be used as manure. Fodder varieties No. of farmers 104.4: Capacity Building Hybrid fodder 30 Regular training programmes, covering various grass var. KKM1 topics, were conducted for SHG members at Hybrid fodder 10 Kudankulam involving 1,480 training days as grass var. CO3 shown in Table 1.9. Lablab 5 During the year 14 new SHGs were formed in Azolla 3 four different villages, taking the total number of centre to establish a fodder bank by providing SHGs to 60. Five SHGs were formed in Ovary all fodder slips/seeds available at the demo-plot. village under Radhapuram Taluk, northeast of NARDEP is one of the technology resource Kudankulam at the request of the local centres under Vivekananda Kendra, panchayat groups. The SHGs have saved about Kanyakumari. Rs 19 lakhs and received about Rs 50 lakhs from local financial institutions as soft loans for Azolla has been introduced as nutritious fodder various activities. in farmers’ fields. Two demonstration plots have been established with help of NARDEP and An ADB sponsored and DRDA supported azolla was distributed to a few farmers for training programme on “Tsunami-Rehabilitation

Table 1.9: Details of the training programmes conducted during the year

Topic Participants Men / Women Training days Concept of SHG / Leadership development 100 / 100 200 Micro-enterprises development 10 / 40 50 Fodder production practices 120 / 60 180 Vermicomposting 100 / 100 200 Dryland agriculture 100 / 100 200 Livestock management 80 / 40 120 Microwatershed 20 / 20 40 Sanitation/health programme 100 / 100 200 Computer and IT uses 100 / 160 260 Azolla production 10 / 20 30 Total 740 / 740 1,480

35

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ and Implementation”, covering almost 180 SHGs training educated unemployed youth in in Vijayapathy panchayat was implemented by animal husbandry with the support of the MSSRF. The training module covered overall District Administration. These groups have skill upgradation. Under total sanitation now obtained financial support from the local campaign for villages with 70 % SC population, bank for starting dairy units. The dairy 50 families benefited through MSSRF initiatives. society plans to establish a small packing Another 20 applications from these villages have unit for selling either milk or curd. The newly been forwarded to the district authority for being formed group of milkmen in Radhapuram has covered under the sanitation scheme. undergone training on value addition of milk. Due to the development of a cosmopolitan 104.5: Eco-Enterprises society in and around Kudankulam the Horticultural species have been found to be a demand for milk and milk based, value added profitable investment by the farmers. They have products has gone up. started raising horticultural crop species under Poultry units started by Kudankulam farmers rainfed conditions through lateral exchange of have proved successful and fetch an average ideas from neighbouring farmers, especially profit of Rs 1,500 to Rs 2,000 per month. those trained by MSSRF. Goat rearing started by an SC group at The following interventions have also helped the Olagachargarpuram is giving good returns. farmers: Fish based, value added products, mainly Sale of fodder slips @Rs.30/100 slips of fish pickles, dry fish and masala fish sold three internodal lengths. by the fisherwomen groups have provided a Sale of OYSTER mushroom at a cost of profit of Rs 500 to 1,000 on 5 kg to 10 kg Rs.20/200 gm. sales, adding to their regular source of income. Vermi-compost which is sold in eco packs @Rs.10/kg. One SHG has been issued PAN Three groups in Kudankulam area have card by the income tax department for signed an MOU with Hindustan Lever Limited starting another compost unit at NPCIL (HLL) to take up dealership and distribution township as per the mandatory requirement. of consumer products among the SHGs in More pits have been started by the farmers nearby villages. The groups have realized a and the total strength is now 30. profit of Rs 1,500 to 1,800 per month in the Strengthening the dairy unit. The dairy first two sales. society at Kudankualm has added another 104.6: Village Knowledge Centre (VKC) 20 milch animals to increase their milk production. Milk distribution has gone up The Village Knowledge Centre, with the support to 500 l/day. They are also receiving milk of students trained earlier, started a computer from other SHGs. MSSRF has helped in literacy campaign to reach out to every house

36

COASTAL SYSTEMS RESEARCH ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ in the village to participate in the process Environment and Forests, Government of India initiated by MSSRF. The campaign has resulted and the Forest Department, Government of in more than 200 girls and boys enrolled for Tamil Nadu. The main objectives of this study computer classes. The VKC also conducts are: summer courses for fishermen and quiz and Mapping and monitoring of Marine Protected essay competitions. It receives various inputs Areas (MPAs) and Marine Biosphere from The Hindu Media Resource Centre, Reserve and Ramsar Coastal Wetlands Informatics and Every Child a Scientist using high resolution remote sensing data, Programme of MSSRF, to improve the working model. Generation of a database indicating previous and current conditions and assessing the 104.7: Genome Club ecological status,

Kuthankuzhy village has been included in Verifying the suitability of present boundaries, genome club activities. Twenty-five students and if not suitable, to define the management joined this year, taking the total strength to 90. boundaries based on the sensitivity of the They were taken on a one - day exposure visit coastal habitats with adequate buffer both to the demo-plot and KKNPP. With the support seaward as well as landward. of the Environmental Survey Laboratory and The study is being conducted in the regions of Science Centre, they have been involved in the Pichavaram, Vedaranyam, Ramanathapuram, “learning by doing programme”. Through this Point Calimere and Pulicat Lake. Mangrove programme they learn basic facts of science. wetlands of Pichavaram and Muthupet are also They were involved in raising a kitchen garden being mapped at the plant community level. of seasonal vegetables. Two villages were Assessment of the health of the mangrove chosen for this programme under the banner of wetland of Pichavaram is also a part of this “Promotion of kitchen garden for nutritional project. Apparent reflectance of the mangrove security”. vegetation from Indian Remote sensing Satellite (IRS) 1D Linear Imaging Self Scanning system Sub Programme Area: 105 (LISS 3) satellite data was used to map Pichavaram mangroves at the community level. Remote Sensing and Geographical Analyzis of the reflectance of mangrove vegetation and non-mangrove vegetation from Information System Landsat 5 TM (Thematic Mapper), Landsat 7 105.1: Coastal Zone Studies ETM data and IKONOS Multispectral data was initiated. Baseline data such as existing During the year, the project “Coastal Zone boundaries of MPAs and wetland maps of Studies” was initiated with the support of the previous periods will be given by SAC to support Space Application Centre (SAC), Ministry of current mapping and assessment activities.

37

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

105.2: Mapping indicators of Food Security wise thematic maps such as per-capita Atlas of Cambodia production of food grains, population below poverty, adult literacy, percentage of underweight For the Food Security Atlas of Cambodia, children, children enrolled and stunted children. thematic maps were prepared for three major These thematic maps were used in the groups: Food Availability, Food Access and preparation of the Food Security Atlas of Food Absorption. Natural break classification Cambodia (Details in PA 403.1). in Arc View GIS was used for these mapping. About 15 maps were prepared for Food 105.3: Database integration with Geographic Availability. Of these, 9 maps were prepared as Information System thematic maps of provinces: They were rice production, rice production instability, per- Self Help Groups database of JRD capita deficit of food production, flood prone Ecotechnology center was integrated with the communes, drought prone communes, rainfall, spatial database of Reddiyarchatram block and water bodies, irrigated area and forest cover. Pondicherry. In Pondicherry, commune, road, Other maps such as soil types, land use and river network, landuse, irrigation and other maps land cover, mangroves and rice types of from secondary sources were digitized and Cambodia were prepared by over analyzis of integrated with the SHG database. Farmers maps from secondary data and province maps. and animators of Reddiyarchatram block were Paddy spread vs yield map and soil ranking provided training on “Basics of Remote Sensing map were prepared based on the GIS analyzis and Geographic Information System and their of rice production, yield, land use/ land cover, applications in the field” on 2 and 3 March 2006. rice types, soil and province maps. As a follow up of this training programme, 9 animators (5 women and 4 men) of the VKCs There are 6 maps under the section Access: of Kannnivadi project site were given hands on poverty rate, total literacy, female literacy, training on using Remote Sensing data, entering unemployment rate, incomplete education and data and digitizing maps into GIS and handling primary education attainment. Indicators such Global Positioning System from 22 to 24 May as access to safe drinking water, toilet, infant 2006. mortality rate, sex ratio, juvenile sex ratio and percentage of stunted and underweight children 105.4: Mapping and monitoring of water are mapped in the section Absorption. Index spread areas of Reddiyarchatram block maps of each section and the final Food This was carried out as a part of the GIS Security Index map were also produced based development of Reddiayarchatram block of on composite indices derived. Dindigul district. Mapping and monitoring were A commune-wise Food Security Index map was done using satellite data of Landsat TM, Landsat also produced as a composite of commune- ETM and IRS 1C LISS 3 and 1: 25,000 scale

38

COASTAL SYSTEMS RESEARCH ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ maps of the Survey of India toposheets. This land cover maps to derive mandal-wise soil and study showed that between 1970 and 1990 landuse / land cover. Similarly, different soil there was a great reduction in the water-spread types present under agricultural areas were also areas when compared to the area reduction identified by overlay analyzis, which shows that between 1990 and 2001(Table 1.10). During this clayey calcareous soil has maximum exercise water bodies that were formed after agricultural coverage of about 3,72,313 ha 1970 were also mapped using 2001 satellite followed by cracking clay calcareous soil data. covering an area of 1,39,452 ha. 105.5 Assessment of soil and land use/ land 105.6: Mapping Coastal Geomorphology of cover of Mehbubnagar district Cauvery delta

This study was carried out as an initial step to This study involved the mapping of mapping assistance to the project on geomorphological features of the Nagapattinam vulnerability and adaptation to climatic change. coast, starting from the Coleroon estuary in the The objectives of the study are to prepare the north to Nagapattinam town in the south. first level land use land cover map of Shoreline changes and sedimentation along the Mehbubnagar district using remote sensing data coast through fluvial discharge over a period from and derive mandal-wise extent of soil types and 1930 to 2005 were assessed. The shoreline land use/ land cover. Landsat ETM data of 2001 changes show that there occur both erosion was used to prepare landuse/land cover map. and accretion. Maximum erosion was mapped The soil map of AP prepared by the National in Chinnavaikkal mouth region for about 0.73 Bureau of Soil Survey and Landuse Board of 1: km and maximum accretion in the region south 250,000 scale was used to separate the soils of Vellar mouth to about 0.55 km. It also shows of Mehbubnagar district. The mandal map of the southerly shift of Chinnavaikkal mouth for the district was overlaid with soil and landuse/ about 2.5 km.

Table.1.10 Change in water spread areas of Reddiyarchatram block in hectares

Period No change Other areas into water Waterspread area storage area into other landuse 1970 – 1990 115 92 413 1990 – 2001 67 116 141 2001 – 2005 120 79 64

39 Programme Area 200

BIOTECHNOLOGY

Progress made during the last few years in the area of abiotic stress tolerance has resulted in MSSRF receiving support under the “Centre for Excellence” programme of the Department of Biotechnology, Govt. of India. Compounds exhibiting antimicorbial properties have been characterized. A few leads on new microbial isolates from mangrove rhizosphere have been established.

201 Ecological Restoration and Ecosystem Monitoring ------41

202 Molecular Mapping ------45

203 Bioprospecting for Novel Genes ------46

204 Bioprospecting for Novel Compounds ------53

205 Bioprospecting for Novel Microorganisms ------55

BIOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Progress made during the last few years has Programme Area 200 resulted in the award of long-term funding support for development of location specific crop BIOTECHNOLOGY varieties for abiotic stress tolerance by the Department of Biotechnology (DBT) under its Advances in Biotechnology and Molecular competitive programme of Centre for Genetics have opened up new avenues of Excellence. research and have enormous promise and implications for food, agriculture and nutrition security. Developments in the field of Sub Programme Area 201 bioprospecting of plants, microbes and other organisms during the last few years have Ecological Restoration and opened up new prospects for developing abiotic Ecosystem Monitoring stress tolerant genetic material that are of immense utility in addressing the issues of water 201.1 Production and demonstration of high scarcity, increased salinization and associated quality planting material of Jatropha curcas problems. Jatropha curcas is well known for its oil yield The programmes of the Biotechnology group at for biodiesel production and is a good crop for MSSRF are designed to harness advanced cultivation in the dry lands. The potential of molecular tools and technology in developing Jatropha cultivation has been recognised by the reproducible in vitro propagation methods for Government of India. Technology development species of importance in dry areas; document plans for Jatropha have been developed by diversity among economically important plant organizations like Indian Oil Corporation, Indian species using molecular marker technology; Railways, universities and private institutions. assess ecosystem health using microbes and In TN, the government has introduced schemes lichen species; generate, catalogue and utilize to encourage investment in Jatropha plantations characterized novel genetic combinations from and several individuals and organizations have target species and develop transformation already started cultivating Jatropha in a big way. systems for generation of location specific crop varieties with enhanced nutritional qualities and Collection of Jatropha germplasm increased tolerance to abiotic stress. accessions

The programme objectives have remained Under the micro mission programme of DBT, unchanged over the years with new interventions “Production and demonstration of high quality and initiatives being undertaken to add value to planting material of Jatropha curcas,” genetic resources and ensure their sustainable exploration of elite, high yielding accessions utilization for the ecological and economic from TN was carried out. A total of 315 security of the farming communities. accessions were collected during the year from

41

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ various districts of TN (Table 2.1), based on yield uniform sapling propagation. After treatment with and other parameters. The first 50 accessions IBA and NAA, these cuttings were successfully were submitted to The Energy Resource rooted at field mist chambers. Institute (TERI) for oil parameters analyzis. A Micropropagation number of high oil-yielding accessions suggested by TERI are being maintained in the Direct organogenesis: Explants were selected field nurseries of MSSRF at Kudankulam, from superior saplings. Uninodal explants were Chidambaram, Jeypore and Karaikal. used for induction of shoots. Single shoots were first observed in MS medium in combination Table 2.1. Details of the elite high oil with BA. Additional supplementation with GA yielding accessions of Jatropha collected 3 and PVP gave better shoot development and from TN elongation after 35 days. Second subculture Districts Number of Accessions was carried out in the same medium along with Coimbatore 57 growth promoting endophytic bacteria isolated Erode 68 from Jatropha, and the cultures showed better Salem 22 multiplication and shoot development. The maximum number of shoots (2-5) was obtained Namakkal 17 after 40 days. Further sub-culture was initiated Karur 62 for root induction in ½ MS combination with NAA. Trichy 41 Rooting was obtained after 30 days from the Dindigul 13 date of inoculation. Hardening process is Madurai 11 ongoing.

Virudunagar 24 Indirect organogenesis: Callus initiation was Total 315 done in MS medium in combination with 2-4 D, NAA, KN, and PVP on 35 - day old callus Clonal propagation of Jatropha curcas transferred to multiplication medium. Callus Seed: Seeds were collected from respective differentiation was achieved in MS medium elite germplasm and were sown directly in containing 0.5 mg/l TDZ and shoot elongation nursery bags containing garden soil and is in progress. farmyard manure (1:1). Three-to four-month old Nursery development saplings were kept under nursery conditions and transferred to selected sites for plantation. After Selected elite germplasm were used for large plantation the saplings were irrigated once a scale nursery development in TN (2 nurseries week till the plants were well established. with 15,000 saplings each), Pondicherry (1 nursery with 5,000 saplings) and Orissa Vegetative propagation: Soft wood cuttings were (1 nursery with 10,000 saplings) where saplings collected from selected accessions for rapid are ready for plantation. These nurseries are

42

BIOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ being maintained by the SHGs. About 50,000 Salicornia brachiata cultivation and yield Jatropha saplings will be taken for second phase analyzis plantation. Four acres of Salicornia cultivation from selected Plantation and maintenance high yielding clones was undertaken in Karaikal. The yield parameters were analyzed (edible Jatropha gene pool gardens are being shoot 4,046 kg/acre, oil yield from seeds 8 l/ maintained in TN (5 ha), Pondicherry (2 ha) and acre, herbal salt 1,400 kg/acre and animal feed Orissa (3 ha). Plantations have been carried seed meal 45 kg/acre; husk 1,500 kg/acre). out in Kudankulam (3 ha), Chidambaram (2ha), These results are encouraging for seawater Pondicherry (2 ha) and Jeypore, Orissa (3 ha). farming technology for saline coastal wasted Out of 10 ha of land available for Jatropha lands, to provide a productive and promising cultivation, 6 ha of gene pool garden and 4 ha economic source for resource-poor coastal of plantation are being maintained in the three people. Preliminary analyzis of the results states. Fifteen SHGs have been trained in would be carried out, for cultivation during the nursery establishment and plantation in these current year in other coastal locations to confirm states. Wastelands have already been identified yield analyzis. by the Panchayats in TN, Karaikal region of Pondicherry and Jeypore in Orissa for Jatropha Agro-technology for selected mangrove cultivation. species A complete agro technology package was 201.2 Demonstration of efficient energy developed for selected mangrove plants (Ceriops plantation in coastal regions of TN with decandra, Excoecaria agallocha, Salicornia community participation brachiata and Avicennia marina) for effective Bioenergy plantation and nursery cultivation from managed mangrove forests in management saline coastal land. MSSRF in collaboration with DBT is developing a monograph on energy Both field and bioenergy nurseries of plantations. Rhizophora, Avicennia, Ceriops and Excoecaria species are being maintained by Women Self Micropropagation of Excoecaria agallocha Help Group (WSHG) members. Three lakh Rapid multiplied Excoecaria saplings were plants are being maintained at the bioenergy supplied to Kalpakkam and Karaikal for planting nursery for the coming year and these saplings in tsunami affected coastal areas. About 3,500 will be supplied to the Pondicherry Government. tissue culture raised plants of Excoecaria were A total area of 5 ha of two-year-old Salicornia sent to SHG nurseries at Karaikal and and mangrove plantation is under maintenance Kalpakkam for hardening. After hardening, the in Pondicherry and a 2 ha three-year-old saplings were planted at 2.5 x 2.5 meter spacing plantation is being maintained in Karaikal. at both places and are growing well.

43

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Planting of mangrove tree species at can provide vital information on the levels of Chunnambar and Thengaithittu by women ecosystem health. The impact of cement dust SHGs on lichen diversity and their distribution in Madukkarai-Walayar region (E 76° 45’30" N 10° Six WSHGs were trained in mangrove nursery 49’ 50'’ to E 76° 54’ 10'’, N 10°54’10'’) was techniques, mist propagation, plantation and studied using large scale quantitative ecological plantation maintenance practices. All six of sampling protocols. In the Madukkarai region them were incorporated as a management unit of the Western Ghats, the sources of pollution (Kizhavanjur Magalir Sathuppu Nila Kaadu (cement factory and limestone mining) are Valarppu Kuzhu- KMSNKVK). Its main activities present close to the biodiversity “hot spot” areas. include providing jobs from various sources, managing the income generation activities on Macroplot surveys were carried out in the moist a sustainable basis, and implementing projects and dry deciduous forest types of the Walayar on mangrove afforestation under Government reserve forest range, Kerala, which are Departments and NGOs. SHGs have signed an geographically adjacent to the cement factory MoU with the Government of Pondicherry for and the mining area. The Global Positioning the scheme “Implementation of Integrated System (GPS) assisted dust sampling using Afforestation and Eco-Development Project gravimetric method, indicated intense pollution (Coastal Shelter Belt Plantation) for the year in the forest sites within the radius of 0 km to 2005-2006. This programme would be focussing 1.5 km and moderate pollution within a distance on supply of mangrove saplings, identification of 1.7 km to 5.6 km. Beyond 5.6 km the of suitable coastal sites for mangrove plantation, pollution levels were very low. The dust particles and aftercare plantation practices. KMSNKVK are predominantly calcium and silicon. have received the first instalment of Rs. 1,08,000 (total grant Rs. 4.32 lakhs) from the Government In addition to quantifying the lichen diversity and of Pondicherry. distribution, lichen species selected on the basis of distribution pattern from polluted and 201.3 Lichen Diversity and distribution pattern unpolluted sites, were analyzed for the in the Madukkarai region of the Western Ghats composition of accumulated elements, and their correlation with the disturbance distribution of trace elements within lichen regime layers, quantitative elemental deposition per unit area and ultra structural details, using Scanning It has been established that lichens (symbiotic Electron Microscopy (SEM) associated with fungi with algae or cyanobacteria for nutritional Energy Dispersive X ray Microanalyzis (EDX) requirements), due to the absence of protective (PHILIPS XL 30 ESEM at IGCAR, Kalpakkam). and conductive tissues, are the first indicators of air pollution. The large-scale quantitative data A total of nine trace elements were quantified on lichen diversity and their distribution pattern through EDX (Energy dispersive X ray

44

BIOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ microanalyzis). The element Sulphur was found The lichen species Bacidia sp, Heterodermia to be absent among samples collected from dissecta var. koyana, Physcia tribacoides the polluted sites. The salient findings of the Parmotrema grayanum and Parmotrema study are listed below. planatilobatum, based on their distribution within the polluted and unpolluted areas, explicated The lichen species Bacidia sp, Heterodermia differences with respect to distribution pattern, dissecta var.koyana Kurok., Physcia external and internal morphology, elemental tribacoides Nyl., Parmotrema grayanum accumulation, membrane integrity and pigment (Hue) Hale and P. planatilobatum Hale were composition. These species can be used as identified as species that can indicate indicators of the cement dust contamination in environmental contamination by the pollutant the forest types in the Madukkarai - Walayar in the discontinuous thickets to low region. scattered shrub vegetation types of the Madukkarai - Walayar region located Sub Programme Area 202 between Longitude 76° 45' 30" E - 76° 54’ 10'’ E and Latitude 10° 49’ 50'’ N - 10° 54’ Molecular Mapping 10'’ N in TN state. Molecular Profiling of Kewda genotypes The morphological, ultra structural and physiological studies indicated that lichen Kewda (Pandanus species) extract is one of species from the polluted sites showed the most popular perfumes used in India since higher levels of tissue damage. ancient times. It blends with all types of perfumes used for scenting cloth, lotions, soaps, Bacidia sp. that has to be described as a cosmetics, hair oils, tobacco and incense new species is the only lichen tolerating sticks. It is also used for flavouring various foods higher levels of pollutants. and soft drinks and is popular for use in bath SEM-EDX studies indicated that the waters. A study was conducted on the ascomata of this lichen accumulates high identification of elite genotypes, assessment levels of Calcium and shows vigorous of diversity among the genotypes of Pandanus growth, whereas other lichens show lethal fascicularis and other wild species of Pandanus. symptoms even at 50 % of Ca accumulation. These genotypes and cultivars are being analysed for genetic fingerprinting, with the help Membrane integrity response in lichen of molecular markers such as RAPD, AFLP species analyzed in terms of electrolyte and ISSR. Collection of leaf samples of different leakage indicated that the cell membranes genotypes of Pandanus sp. has been initiated of the lichens from polluted areas have from various locations in Orissa and TN. undergone damage. The Bacidia sp. showed Protocol for DNA isolation has been a lower level of electrolyte leakage. standardized using the CTAB method. Isolated

45

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

DNA would be used for RAPD analyzis with Random Operon primers. AFLP analyzis is Sub Programme Area 203 being performed using the Invitrogen AFLP kit. Genetic relationships among the genotypes will Bioprospecting for Novel Genes be assessed using the presence or absence of 203.1 Analyzis of gene expression under fragments or banding patterns between various various environmental stress conditions genotypes of Pandanus with RAPD and AFLP and ISSR. These bands would be scored and Plant growth and development are influenced analyzed using the NTSYS software package. by the presence of a variety of environmental factors. These abiotic stress factors, including Molecular Profiling of Cajanus salinity, high light intensity, high temperature, Pigeon pea (Cajanus cajan (L.) Millspaugh) is and heavy metals, lead to oxidative stress with one of the major legumes of the tropics and the formation of Reactive Oxygen Species sub-tropics. It belongs to the family (ROS) causing extensive cellular damage and Leguminosae, subfamily Papilionideae, tribe inhibition of photosynthesis. The antioxidant Phaseolae and subtribe Cajaninae. A study has enzymatic pathway consists of different enzymes such as Super Oxide Dismutase been initiated to collect and study the nature (SOD), catalase (CAT) and ferritin (FER), which and extent of diversity among the traditional effectively remove these reactive oxygen landraces of Cajanus sp and Vigna sp regarding species. As a first step towards studying the which there is little or no information. The study role of individual genes in A. marina, the is being undertaken through extensive antioxidant response to salt, iron, light and collections of landraces from tribal regions of mannitol stress was analysed by monitoring the Orissa (Jeypore and adjoining areas), TN (Kolli mRNA levels of Cu–Zn SOD, catalase and Hills) and AP (Vishakapatnam and adjoining ferritin. Cat1 and Fer1 showed short-term areas). Isolated DNA from different accessions induction while Sod1 transcript was found to is being used for AFLP analyzis using the be unaltered in response to NaCl stress. A Invitrogen AFLP kit. Genetic relationship decrease in mRNA levels was observed for Sod1 assessments will be carried out taking into and Cat1 while Fer1 mRNA levels remained account the presence or absence of fragments unaltered with mannitol stress treatment. Sod1, between and among wild relatives and Cat1 and Fer1 mRNA levels were induced by landraces. The objectives of this study are to iron, light stress and by direct H2O2 stress evaluate the extent of resistance to Fusarium treatment, thus confirming their role in oxidative disease, Helicoverpa pest attack and one of stress response. Mangroves face many the most important abiotic stress tolerance traits, environmental stress factors, especially salt drought. The study ultimately aims to identify stress and light. The response of Cat1 and Fer1 elite populations and landraces for conservation. can be categorized as a short-term response

46

BIOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

while Sod1 performs a constitutive role in NaCl and with transgene were forwarded to the BC3 stress. This particular isoform, Sod1, may not F2 and BC3 F3 generation to develop have a contributory role in salt stress response homozygous populations. of A. marina. This study confirmed that relative Field trial of transgenic rice plants at mRNA expression levels could be used as Kalpakkam overexpressing AmCu/ZnSOD indicators to study the role of individual genes of a multigene family in each of these stresses. Transgenic rice plants in four varieties ADT-43, In conclusion, our data confirms that oxidative IR20, white ponni and IR64 were generated with stress positively regulates the functioning of a gene homologous to cytosolic Cu/Zn SOD Sod1, Cat1 and Fer1. from the Mangrove species Avicennia marina. Based on the results obtained from the tests Introgression of AmSOD1 from transgenic done in the laboratory it was decided to take PBI to local varieties up a field trial. The laboratory results were The generation of transgenic lines with the gene examined and the permission for the field trial superoxide dismutage from the mangrove was given by the RCGM for the four varieties. species Avicennia marina has been described The field trials undertaken at Kalpakkam, using in earlier reports. These lines have been tested RBD design, are being assessed for the efficacy for their tolerance to salinity stress as well as of the inserted gene for salinity tolerance and water stress conditions. In order to integrate to assess the safety aspects of the inserted the transgenes into other local varieties, gene. introgression experiments were carried out. Isolation, characterization and overexpre- ADT43, white ponni, IR64 and IR20 were crossed ssion of MnSOD with transgenic PBI and F1 was obtained. The Full-length cDNA encoding MnSOD was F1 were uniform for the respective crosses with

50 % genome of the local variety. The F1 were isolated from Avicennia marina cDNA library. backcrossed with the parent (local variety) to The cDNA was of 925 bp in length. The cDNA had an open reading frame of 680 bp from 90 obtain the BC1F1 seeds. An average of 200-300

BC1F1 plants were raised and analysed for the bp to 770 bp. The MnSOD cDNA was cloned presence of the AmSOD1 gene. The segregation in the prokaryotic expression vector pET32a. ratio for the transgene was in the ratio of 1:1 as The vector was transformed into E. coli BL-21 expected. The plants which were positive for cells and the expression of the recombinant the transgene and had maximum resemblance protein was studied. The Bl-21 cells were grown to respective parents, were selected and to an O.D of 0.5. Recombinant protein backcrossed to obtain BC2F1 seeds. The expression was induced by adding 1mM IPTG. Expression of the recombinant protein was backcross was repeated to obtain the BC3 generation. The plants positive for studied by resolving the total protein from the phenotypically 100 % resemblance to the parent IPTG - induced E. coli cells. The recombinant

47

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

MnSOD protein was of 45 kDa in size. Studies the central region of starchy endosperm. are under way to purify the recombinant protein However, in non-transgenic grains, blue colour from the E.coli. Studies on the expression formation of iron accumulation was restricted pattern of MnSOD in A. marina during stress to the aleurone layer and the intensity of the conditions are also ongoing. colour development was also very low.

Analyzis of ferritin gene expression in Transverse section of mature transgenic rice transgenic rice plants grains passing through the embryo region showed high iron accumulation in the embryo Micronutrient deficiency is among the most as well as in the endosperm. However, in non- challenging problems of global concern. With transgenic rice grains, iron was restricted to an overall objective of fortification of staple the embryo and aleurone layer. Further, when crops, an attempt was made to develop compared to transgenic grains, the intensity of transgenic rice varieties incorporating the ferritin colour development in embryo region was very gene with improved iron content. low. This histochemical analyzis of iron in rice Earlier Reports have described the results of specifically showed temporal and spatial transformation of rice with iron storage protein deposition of storage iron. This finding showed ferritin gene for iron fortification and the presence correlation with the Western blot analyzis of and integration of T-DNA in the rice genome. expression of exogenous ferritin gene. In all the These were corroborated by PCR and Southern transgenic southern positive plants (seeds), a blot analyzis. During the last year, further 28-kda-ferritin protein was detected, confirming improvements in functional analyzis confirmed that ferritin protein accumulates in rice seeds. the expression of the ferritin gene in a tissue Co-expression of Active Oxygen Species specific manner by iron specific histochemical (AOS) scavenging genes in rice and analyzis and western blot analyzis. evaluation of the same for increased salinity Perl’s Prussian blue staining method has been tolerance recommended for locating Fe (III) in animal As part of the ongoing investigation of anti- tissues since it is quick and highly reproducible oxidant systems and their role in stress, two and the reagent can penetrate into bulky tissues cDNA clones from the cDNA library (salt to give a distinctive blue colour reaction. This stressed Avicennia marina), AmAPX1 technique has been used in non-transgenic rice (Ascorbate peroxidase) and AmMDAR1 to find the localization of iron in seed materials. (Monodehydroascorbate reductase), were Perl’s Prussian blue staining of ferritin chosen for investigation. These are the genes transgenic rice grain sections showed the coding for key enzymes involved in scavenging distribution of iron accumulation (blue coloured of the reactive oxygen species during oxidative compound of ferric ferrocyanide) throughout the stress. AmAPX1 is 1179 bp in length while aleurone and sub-aleurone layers and also in AmMDAR1 is 1916 bp in length. Both genes

48

BIOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ were cloned simultaneously in pCAMBIA 1301, withdrawal of the iron stress, the Am-APX either alone or in combination. The constructs, transcript levels decreased. The promoter for pAmAPX, pAm-MDAR and pAmMDAR+ AmAPX1 has been isolated from TAIL PCR AmAPX were used to transform tobacco. and is 1.67 Kb. pAmMDAR+AmAPX was also transformed into the Indica rice variety IR-20. GUS positive 203.2 Gene expression studies with AmDHN AmAPX (18), AmMDAR (21) plants were and localization of the AmDHN-GFP fusion checked by PCR. For tobacco plants protein in the nucleus transformed with AmAPX+AmMDAR, only PCR Dehydrins from many plant species are known was used to confirm the presence of the to express under circadian and/or diurnal transgene as the T_DNA did not carry the GUS rhythms. In order to see if such a pattern exists gene. Among the thirty-three regenerant plants for AmDHN, gene expression studies were obtained, eighteen plants showed the presence carried out. To check for the presence of a of both AmAPX and AmMDAR genes. possible circadian oscillation in AmDHN A cultivated variety of Indica rice, IR-20, was expression, two sets of plants were used for rice transformation. Transformation of acclimatized in half strength MS. One was kept rice calli was performed by using Agrobacterium at constant light while the other was kept in strain LBA 4404 transformed with total dark conditions for 72 hours. The dark- pAmAPX+AmMDAR. Rice calli transformed acclimatized set was moved to light and the with the double constructs are in various stages light-acclimatized set to dark for 12 hours. The of regeneration. Gene expression studies were samples were shifted from a dark to light or carried out with two-month-old A. marina light to dark regime every twelve hours for 48 seedlings to analyze the expression pattern of hours. Northern hybridization analyzis revealed AmAPX1 in the presence of various abiotic a clear profile of sequential waves. The stresses such as salt, hydrogen peroxide, transcript levels oscillate and peak at dawn excessive light and iron, using a gene specific (3 am) and confirmed that the transcipt for probe. With 500 mM salt stress, the AmAPX1 AmDHN did not exhibit circadian behaviour. To transcript levels increased at 12 hrs in leaves, check for a possible diurnal regulation of decreasing thereafter at 24 and 48 hrs of salt AmDHN expression, A. marina seedlings were stress. Upon withdrawal from salt stress, kept in a 16 h/ 8h photoperiod (light/dark) for 72 AmAPX1 expression returned to basal levels. hours and leaf tissue was frozen at 6 hourly AmAPX1 transcript level increased when intervals. A total of 13 time points were taken. Avicennia seedlings were exposed to dark for The Northern hybridization signals were 7 days and were transferred to high light quantified by densitometric analyzis using intensity for 24hr.With excessive iron, AmAPX1 BioRad Quantity One software. The results are mRNA was induced within 30 minutes of transfer yet to be analyzed. Using TAIL-PCR, an 843 of the seedlings to iron excess medium and on bp promoter fragment was obtained in two

49

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ steps. PLACE analyzis revealed the presence 203.3 Analyzis of transgenic tobacco plants of 4 ACGT sequences at -316, -409, -470 and - expressing the Porteresia coarctata Na+/H+ 644 bp respectively. ACGT forms the core of antiporter (PcNHX) and localization of PcNHX- sequences reported to function as ABA- GFP fusion in vacuoles responsive elements (ABREs) in many ABA- responsive genes. GFP was fused with the C- It has been reported that tobacco plants were terminus of the AmDHN ORF and cloned in transformed with PcNHX via Agrobacterium- mediated transformation and PCR and GUS pCAMBIA 1301 under the control of the 2x positive plants used for further Southern 35S Cauliflower mosaic promoter. The construct analyzis. For determining the copy number of has been named pAmDHN-GFP. It was the Na+/H+ antiporter gene in transgenic tobacco mobilized into Agrobacterium tumefaciens plants transformed with the PcNHX, tobacco strain EHA105 by the freeze-thaw method. genomic DNA of the PCR and GUS positive Agrobacterium – mediated transformation of plants were subjected to Southern blot analyzis. tobacco (Nicotiana tabacum ) cv. Petite Havana Out of the seven plants analysed, four were found was carried out by the standard protocol. to be single integration events. Northern-blot Epidermal leaf peels mounted in water were analyzis was also carried out to determine prepared from GUS positive tobacco plants and whether the PcNHX gene was successfully examined under the Nikon Optiphot-2 phase expressed in these transgenic lines. Total RNA contrast microscope fitted with an Episcopic was isolated from 4 independent transgenic fluorescence attachment (100W Hg lamp). plants with single copy insertion of the gene Fluorescence imaging of guard cells was carried and full length PcNHX gene was used as a probe. out using the Nikon B2A filter set. Guard cell The transcript level was very high in transgenic imaging of pAmDHN-GFP transformed tobacco plants, whereas no signal was obtained from plants showed localization of the green untransformed control. Southern analyzis was fluorescence in the nuclei of the guard cells and also carried out to identify transgenic plants the nucleus of the trichome and was confirmed with single copy integration of the PcNHX by DAPI staining of the nucleus. Bright field promoter fused to the GUS gene. Of the eight images and fluorescence images of the same plants analysed, a single hybridization signal guard cell have been taken. Tobacco explants was observed in lines 1 and 7. In all the other (shoot) expressing AmDHN-GFP were placed lines two or more bands were visible, in half strength MS medium containing 200mM corresponding to multiple integration events. NaCl and kept for 10 days. These plants The green fluorescent protein (GFP) fusions have produced roots readily and were shown to grow been successfully used to determine protein better as compared to the control (constructs localization. Expression of GFP fusion proteins transformed with GFP alone) which did not offers an opportunity to introduce specific survive and underwent chlorosis. markers for subcellular structures that can be

50

BIOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ directly visualized in live cells. The mGFP6 gene (NCBI, dbEST). One of the genes from the P. fused to the N-terminus of the PcNHX gene juliflora library, Glutathione-S-Transferase through an (alanine)10 linker was cloned in (PjGST), was chosen for further study. Northern PCAMBIA 1301 under the control of the double experiments were done for PjGST for PEG, strength Cauliflower Mosaic promoter (2X 35S). salt, mannitol, cadmium, heat stresses, water This construct, pGFP-Ala-PcNHX, was used to withdrawal and 2,4 D, GSH, methyl viologen, transform tobacco. The plants were screened H2O2 application. PjGST was transformed into for the presence of the gene by both PCR and tobacco (Wisconsin 38) and the presence of GUS assay. Four plants, which showed intense the integrated gene was confirmed by PCR GUS staining, were then used for further Southern. Transformed tobacco plantlets were analyzis. 7-day-old suspension culture derived tested for survival under stress conditions. from the PCR and GUS positive plants was PjGST transformed plants were found to survive screened for GFP fluorescence using the Nikon better under conditions of 150 mM NaCl, 100 Epifluorescence microscope. The imaging of mM mannitol, 25 mM cadmium or 10 % PEG. pGFP-Ala-PcNHX transformed tobacco PjGST was also transformed into Indica rice suspension cells showed localization of the variety ADT 43 and the presence of the green fluorescence at the vacuolar membrane. transgene in the T2 generation was confirmed No detectable signal was present in non- with PCR southern. Stress tolerance studies transgenic tobacco cells. The vacuolar (ability to germinate in medium containing localization of the fusion protein was confirmed 150 mM NaCl, 100 mM mannitol or 25 mM by using the fluorescent styryl dye FM 4-64. cadmium) was carried out with the transgenic For the isolation of genomic clone for PcNHX, rice plants and they showed faster germination primers were designed based on the cDNA as compared to control (untransformed) plants. sequence and used to amplify the entire gene Three isoforms of Type II GSTs found in the P. from the Porteresia DNA by PCR. The genomic juliflora cDNA library were fully sequenced. clone for PcNHX was 4740 bp in length with a Genomic clones for all three GSTs were also total of 13 introns in the gene. The largest intron isolated and the intron number, sequence and was 735 bp in length.The position and position determined. distribution of introns along PcNHX was similar As reported earlier, Type II metallothionein (Pj to that of the OsNHX gene from Oryza sativa, a MTII) was isolated from P. juliflora cDNA library. closely related species. It was cloned in pCAMBIA 1301, transformed 203.4 Characterization of stress induced into A. tumefaciens strain(LBA 4404) and used genes from the Prosopis juliflora library to infect tobacco (Petit Havana) leaf discs. Thirteen hygromycin resistant plants were From the Prosospis juliflora cDNA library, 1,467 regenerated on MS medium containing BAP ESTs were deposited in the public database

51

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ and NAA. Genomic DNA was isolated from these Understanding salinity tolerance mechanism plants and PCR was performed with 5¢ and 3¢ in Sesuvium portulacastrum UTR specific primers. PCR products were S. portulacastrum is a halophyte belonging to blotted on a nylon membrane and Southern the Aizoaceae family. It is found to be associated hybridization was done with 3’ UTR specific with mangrove plants and also grows along the probe. Twelve out of thirteen plants were found coasts in the tropics. Since it can be easily to be positive. Total RNA was isolated from these propagated through stem cuttings and can plants and Northern hybridization was done to tolerate a wide range of stresses that include study the expression level of the transformed drought, salinity and high light intensities, PjMTII gene. Lines 1, 4 and 6 showed higher understanding the mechanism of salinity mRNA expression level than the other plants. tolerance in this plant would be useful for These three lines were further analyzed for their heavy metal tolerance. Sixty-day-old redesigning salt-sensitive crop plants. It is well untransformed and transformed (PjMTII) appreciated in recent times that salinity stress tobacco plants (Lines 1, 4 and 6) were kept in tolerance is a complex trait and it requires a half strength MS for 4 days and then transferred proper understanding of both whole plant and cellular responses to salinity stress. Therefore, to fresh MS containing 100 μM CdSO4. Comparison revealed that transgenic plants experiments were designed to understand were healthier and did not show any necrotic cellular and whole plant level responses of S. lesions even after ten days of treatment when portulacastrum to salt stress. compared to control untransformed plants. To Results from the past year indicate that at least test the ability of E.coli cells expressing PjMTII one response might be common both at the to survive under conditions of metal stress, type cellular and whole plant levels. S. PjMTII cDNA was cloned in the thioredoxin fusion vector pET32a and transformed into E.coli portulacastrum plants responded to salt stress BL21(DE3) cells. Control (vector alone) and by accumulating pink to red coloured pigments, transformed (PjMTII) cells were grown in different which could probably be anthocyanins. It was interesting that at the cellular level the concentrations of CdSO4 (0.3 mM, 0.6 mM, pigmentation response was at low 0.9 mM) for 7 hours (as measured by an concentrations of sodium chloride or salt in the increase in the absorbance OD600 using a spectrophotometer). At the seventh hour, cells growth medium while at the whole plant level it containing PjMTII showed higher absorbance required higher concentrations of salt. Moreover, compared to the control untransformed E.coli it was observed that optimal cell growth was cells. This shows that PjMTII expressing E. coli possible only when a small amount of sodium cells could tolerate heavy metal and grow better chloride was present in the growth medium, than the control cells. The fusion protein was suggesting salt to be a requirement for optimal purified for raising polyclonal antibody. growth in halophytes like S. portulacastrum.

52

BIOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

203.5 Gene mining from Lichens molecular analyzis of the cloned genomic DNA of these species are ongoing. Protocols of RNA Lichens are eukaryotic microbes having the isolation from the above selected species were flexibility of a microorganism to be handled standardized. mRNA were isolated from total comfortably under controlled lab environments, RNA for further construction of cDNA library. and genetic stability because of their eukaryotic nature. The insights into the capabilities or adaptations by these natural microbial Sub Programme Area 204 communities could be well understood by sequencing the genomic DNA of these Bioprospecting for Novel organisms. Lichen genomic DNA are yet to be Compounds screened in a detailed manner, and the novel genetic information could throw valuable 204.1 Lichens information on the mechanisms of adaptation of these organisms, which can be mined and This program aims at harnessing the utilized for crop improvement and nutritional antimicrobial potentials of the secondary schemes for the protection of sustainable compounds of selected lichen species livelihoods as well as fragile environments. The (symbiotic fungi with algae or cyanobacteria for existing genomic DNA studies with specific nutritional requirements) viz. Roccella reference to genes responsible for Polyketide montagnei, Parmotrema praesorediosum, Biosynthesis (PKS), protein expression Dirinaria consimilis, Ramalina celastri and enabling desiccation tolerance (hydrophobins) Usnea sp. The secondary compounds of these etc. have demonstrated that lichens are the lichen species were extracted in organic solvent potential future novel sources of genetic gradients and screened for their antimicrobial material. properties against human bacterial and fungal pathogens. The compounds which exhibited The ongoing study on Dirinaria consimilis and antimicrobial properties were further chemically Pyxine cocoes, such as germplasm characterized in collaboration with the Organic characterization, cDNA library construction, Chemistry Laboratory and Sophisticated large scale EST sequencing, Gene annotation Analytical Instrumentation Facility (SAIF), Indian and standardization of growth conditions are the Institute of Technology, Chennai. As a prerequisites for mining novel genetic prerequisite for drug development, these combinations from these species. Protocols potential compounds were subjected to were standardized for genomic DNA isolation cytotoxic and genotoxic studies on Swiss Albino from Dirinaria consimilis and Pyxine cocoes. mice and Wister rats in collaboration with the Genomic DNA was isolated and digested with Department of Pharmacology & Environmental restriction enzymes and genes below 1kb were Toxicology and Genetics, PGIBMS, University cloned in E.coli. Further sequencing and of Madras.

53

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Qualitative and quantitative extraction of lichen mark. It can grow in both stony and muddy soils secondary metabolites and subsequent and tolerate dry and salty conditions. It is used antimicrobial screening provided the basis for to treat sores and stings from marine creatures. the identification of two novel compounds from Smoke from the bark is used to treat leprosy. Roccella montagnei and Parmotrema The plant is being tested for modern medical praesorediosum. Patent applications for these uses. Preliminary screening at MSSRF showed compounds have been filed. that the plant may have anti-HIV, anti-cancer, anti-bacterial, anti-pest and anti-viral properties. Crude hexane extract of D. consimilis exhibited antimicrobial activity and this extract was Hexane and aqueous extracts of E. agallocha subjected to further fractionation and were found to be active against the third instar subsequent bioassays. Out of the five fractions larvae and the moth of H. armigera in laboratory of the above lichen, two fractions (Fraction 1 assays. Fractionation and subsequent and 5) showed antimicrobial activity against five purification of the hexane extract yielded human bacterial pathogens. Hence these bioactive compounds that were confirmed as fractions were subjected to further purification terpenoid by spray reagents. and structure elucidation of these fractions is being carried out. Similarly, crude acetone Field trials were carried out in cotton, okra, extracts of Ramalina celastri and Usnea sp. pigeon pea and chickpea. The pigeon pea and were found to be bioactive. chickpea trials are ongoing in CBSH, University of Pantnagar, Uttaranchal. The results from okra Lichen culture for secondary compound and cotton indicate a comparable performance production is considered a vital component of of the E. agallocha formulation with positive, the conservation of the lichen species in their Neem Gold. Results from the field trial indicate habitat and sustainable utilization of these novel that the hexane extract in ethanol formulation resources industrially. On these lines, the is comparable with Neem Gold while the extract protocols for in vitro culture for the production in traditional formulation gave better results of secondary compounds through lichen whole (yield 1.8 kg/ plot in the former and 2.4 kg/ plot thallus, fungal and photosynthetic partners for in the latter in the cotton trial). Roccella montagnei, Parmotrema praesorediosum, Dirinaria consimilis and Usnea In pigeon pea, three replications were sp. were standardised. maintained for each treatment. Five spray doses with 1-week time intervals were administered Excoecaria agallocha 204.2 using a hand sprayer. Effective reduction in the Excoecaria agallocha, also called the milky larval count and subsequent crop protection mangrove, is widely distributed across Africa, were observed. The percent pod infestation in

Asia, Australia and the Pacific Islands. The tree T2 (Polygonum + Reetha), T6 (Nimbecidine) and grows further inland, usually at the high water T7 (MSSRF) was significantly lower than control

54

BIOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

(4.43 %). The lowest % infestation was obtained NMR. Crystallization, Mass Spectroscopy and FT-IR are underway to confirm the molecular in T2 (2.21 %) followed by T6 (2.35 %) and T-7 (2.42 %), respectively. However, average yield structure. data showed that it was statistically insignificant due to a high variation within treatments on Sub Programme Area 205 account of a heterogenous seed. Chickpea data is being analyzed and the tomato field trial is Bioprospecting for Novel continuing. Microorganisms Four hexane fractions that show high anti- feedant activity against H. armigera were found 205.1 Microbial diversity in coastal agri- With respect to X-ray crystallography studies, ecosystem data H5 is complete; fraction H4 has been Field testing and product development of crystallized and is being characterized for Plant Growth Promoting Bacteria in the compound structure. Crystallization of Fractions Coastal agri-ecosystem H1 and H2 are underway. Column chromatography of a partially purified bioactive An extensive field trial on a participatory mode was carried out in a coastal area (Chidambaram) component H-5 in SiO2 (60-120) using Pet Ether: Ethyl acetate yielded crystals (Colorless for 200 acres of paddy, using efficient strains of biofertilizers, identified through multi-location needles in CHCl3). They were analyzed by X- Ray Crystallography, ENRAF NONIUS CD-4 field trials, which showed interesting results in model with molybdenum probe (Goniometer the increase in number of tillers and significantly Geometry- Kappa). For structure refinement, increased yield in paddy. The demonstration Full Matrix Least Square on F^2 method was plots for biofertilizers have convinced the farming used. The resolved structure suggested that the community on the effectiveness of this lattice arrangement obeys monoclinic technology, for which there is presently an increasing demand. The promising strains were symmetry with C2 spacer group. The molecular formulated in a vermiculite based carrier medium formula was assigned as C30H51O. ChemFinderä database search with the unit cell parameter in collaboration with a private entrepreneur. values revealed that the compound was novel. Liquid formulations have been prepared for the best performing strains Azospirillum MSA-148 Assignment of the IUPAC nomenclature and the and Phosphobacteria PS-5. class of compound are underway. For further confirmation, 13C and H+ NMR analyzis with Out of the short listed 20 strains, 4 were decoupling was performed. Column purification selected on the basis of their antagonistic of fraction H-4 yielded crystals that are under potential. Using the selected strains of XRD analyzis. Column fraction H-1 (amorphous Pseudomonas, further field trials, mandatory for waxy material) was subjected to 13C and H+ the registration process of the efficient strains,

55

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ were conducted at the Tirur Rice Research As a means to understand the role of K + in Station in three different seasons. Based on the osmotolerance, cells of P. fluorescens MSP- antagonistic potential of the strains and their 393, exponentially growing in minimal medium salt tolerance potential, MSP-393 has been (with 0, 300 and 600 mM of NaCl) were analyzed selected for toxicological analyzis in an for the cellular K+. The study showed that the accredited institution, as this is mandatory for K+ concentration inside the cell increased with formulation and release. Preliminary increasing concentration of NaCl (300 mM & discussions are on for the toxicological analyzis 600 mM). of the primary culture as per Central Insecticide Board (CIB) standards. Once this is through, Plant growth promoting rhizobacteria from the strains will be handed over to entrepreneurs Mangroves for formulations and large-scale production and Last year, initial screening was carried for the release. functional population of rhizosphere Mechanism of salt tolerance in microorganisms with respect to nitrogen Pseudomonas fixation, phosphate solubilisation and biocontrol of plant pathogens. As a result, some strains The FAME analyzis was carried out to study have been identified, which are presumed to be the change in the fatty acid profile of the novel. A total of 45 marine red-pigmented vibrio bacterium upon increasing osmolarity and it were isolated from Portersia coarctata and showed the absence of C7:1, C8:1, C10:1, Avicennia marina. Based on the Rep-PCR C12:1 and C16:0 in MSP-393 grown at high analyzis these 45 isolates have been grouped osmolarity. The percentage of total acids in the into four clusters, depending on their banding normal culture and in the stressed culture had pattern and these isolates show very good significant difference. Fatty acids C14:1, C19:0, biocontrol activity against bacterial C20:1, C22:1 were found only in the stressed phytopathogens, for example Xanthomonas culture; they were identified as Methyl myristate, oryzae (rice sheath blight disease) and its Methyl nonadecanoate, Methyl arachidate and 16SrRNA gene sequence was submitted in Methyl erucate respectively. Analyzis of the lipid composition of cells grown in minimal medium NCBI Database (accession no- DQ273663). containing 300 mM NaCl revealed a 7.61 % Taxonomic characterization is being carried out increase in cellular unsaturated fatty acids with to place this strain at species level. Three yellow- respect to cells grown in the absence of NaCl. pigmented bacteria were identified from The percentage of unsaturated fatty acids was Avicennia marina, which are positive for nitrogen more in the stressed cells compared to the one fixation, confirmed by nifH primers. Its 16SrRNA grown in a medium without NaCl stress. This gene sequence does not form a close phenomenon gives an indirect evidence for the relationship with any genus in the family altered expression of genes involved in Sphingomonadeaceae and its 16SrRNA gene osmoregulation. sequence was submitted in NCBI Database

56

BIOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

(accession no- DQ399262). Similarly red- for analyzing 16S rRNA genes of PCR products. orange pigmented bacteria isolated from all Prominent SSCP bands were excised and mangrove plants and Rep-PCR analyzis of them sequenced to gain insight into the identities of revealed that all had similar banding patterns predominantly present bacterial populations. thereby indicating that all the isolates belong The majority of SSCP band sequences were to a single taxon. All are positive for nitrogen related to bacterial genera of root-free soil fixation, confirmed by nifH primers and its environments, such Bacillus, Planococcus, 16SrRNA gene sequence formed close Planomicrobium, low G+C Gram-positive relationship with Bacillus firmus and its bacterium, glacial ice bacterium and uncultured 16SrRNA gene sequence was submitted in bacteria. The sequences detected by SSCP NCBI Database (Accession no- DQ399261). approach were derived from a wide taxonomic Likewise, the studies also establish other novel range, suggesting that presence in the strains which are associated with mangrove rhizosphere was not determined at broad rhizospheres and the outcome of these studies taxonomic levels but rather was a strain- or shows that there are quite a number of bacteria species-specific phenomenon. other than Pseudomonas and Bacillus, like Novosphingobium sp, Erythrobacter sp, Vibrio The PCR-SSCP profiles of rhizosphere samples sp which can colonize the mangrove showed somewhat distinguishable variations rhizosphere. Detailed studies have to be carried between different mangrove species. SSCP of out to understand the ecological role of these recovered PCR products based on amplified soil microbes in mangrove rhizosphere. DNA from five different rhizosphere samples produced between 11 to 17 bands in 205.2 Genetic diversity of soil DNA from P. coarctata, 11 to 13 bands in R. mucronata, 6 mangrove forests (16S rRNA genes) using to 10 bands in A. marina, 4 to 6 bands in PCR-SSCP. S. apetala and 6 to 10 bands in E. agallocha ranging in mobility from non denaturant gel. A comparative study was carried out to examine the structure of the bacterial community in Sequencing of SSCP bands revealed that the different mangrove rhizosphere samples majority of the dominant populations detected collected from intra and inter sites, by using had 16S rRNA gene sequences that were cultured-independent method. The universal most closely related to those of previously primers, Com1 and Com2 (positions 519 to 536 described soil bacteria (i.e., Planococcus, and 907 to 926, Escherichia coli numbering), Planomicrobium, Bacillus, low G+C Gram- were used for the amplification of V4 and V5 positive bacterium, and Glacial ice bacterium) regions in the rhizosphere soil DNA. To gain a or unidentified bacteria detected as environ- better understanding of the dynamics of the mental clones. Moreover, one sequence bacterial community, Single-Strand recovered was an exact match with a previously Conformation Polymorphism (SSCP) was used recovered sequence of Planomicrobium sp.

57

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

(AY730709). Results suggest that the activity The representatives of the Jhansirani SHG were of bacteria within the rhizosphere is rather strain trained on biofertilizer production technology at or ecotype specific, instead of determined at the Microbiology lab at MSSRF for three days the genus level or a higher taxonomic level. (See PA 401.3.1). Band sequences determined in this study have 205.4 Biological control of finger millet blast been deposited in the NCBI database under accession numbers DQ 322699 and DQ Finger millet, Eleusine coracana L., (Ragi) is 322700; DQ 336196 to DQ 336202 and DQ an important staple food in India and in the 356474 to DQ 356479. eastern and central parts of Africa. Even though finger millet is known to be one of the hardiest 205.3 Low cost biofertiliser unit as an crops, it is affected by many diseases such as enterprise blast, foot rot, smut, streak and mottling virus. As a first step to understand the distribution of Among these, blast, caused by the fungus the plant growth promoting rhizobacteria in the Pyricularia grisea sacc., is the most devastating Kannivadi region, soil samples were collected disease, affecting different aerial parts of the for major cultivated crops (paddy, maize, cotton, plant at all stages of its growth, starting from sugarcane, cluster bean, brinjal, banana, chili, seedling to grain formation. Yield loss due to crosandra, bitter gourd and jasmine).The plant blast may be around 28 %, and sometimes it growth promoting bacteria (Azospirillum and may go as high as high as 80 to 90 %. Since Phosphobacteria) were isolated and finger millet is predominantly grown as a rain characterized. The most efficient strains were fed crop by small farmers, the disease short-listed and growth studies were carried out. management by chemical means is found to Of the Azospirillum strains isolated, Kaz1, be economically unaffordable. Hence, it would Kaz12, Kaz25, Kaz29, Kaz38, Kaz52, Kaz55, be useful for the disease to be managed by Kaz83, Kaz85, and Kaz91 were found to be natural and low cost methods. Biological control efficient and the strains Kaz29 and Kaz83 were using bacteria is not only economical for minimizing the losses caused by the disease, short-listed for production, based on their activity but it is also an environmentally friendly method. and growth rate. Out of the phosphate solubilizing bacteria isolated, KPA and KPB Preliminary work has been initiated towards were found to be efficient and KPA was short- biological control of blast in finger millets. The listed for production as these native strains samples of rhizosphere of finger millet and blast would already be well adapted to the soil affected leaf and neck lesions were collected conditions and would have a cutting edge in from different regions of Villupuram district and the colonization of root surface and Kolli Hills. Monoconidial isolates of establishment in the rhizosphere and thus Magnaporthe grisea were isolated from the perform better. lesions by moist chamber method and the

58

BIOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ isolates were subjected to conidiation for identifying the isolates to belong to confirmation. The finger millet rhizosphere soil Pseudomonas. The DNA was isolated from the samples were serially diluted and plated on putative pseudomonas isolate and was Kings B and Nutrient agar plates. The individual subjected to PCR analyzis of genus specific colonies were isolated and streaked to purity. primers, the forward primer Ps-F The isolated rhizobacteria isolated were (5’GGTCTGAGAGGATGATCAGT) and the screened for their antagonistic potential by dual reverse primer Ps-R (5’TTAGCTCACCTC- plate assay against Magnaporthe grisea, the GCGGC). The products were run on agarose causal organism of Blast disease. The plates gels along with 1Kb ladder and a 1Kb fragment were incubated at room temperature (28 ± 2ºC) was amplified confirming the isolate to belong for four days and the radial growth (cm) of the to the genus Pseudomonas. The isolates were pathogen mycelium was recorded and percent further characterized to deduce their inhibition of the mycelial growth was then mechanism of action. They were found to calculated. Of 180 Rhizobacteria tested, only produce iron chelating compounds, 19 showed antagonistic activity, of which 5 siderophores both by spectrophotometric strains showing 60-64 % were short-listed and method and CAS chemical assay. The isolates subjected to further characterization. The also produced hydrogen cyanide, which exerts shortlisted strain was then observed a cytotoxic effect. They did not produce microscopically and standard biochemical hydrolytic enzymes like pectinase, cellulase, characterization was carried out putatively, lipase or chitinase.

59 Programme Area 300

BIODIVERSITY

The year 2006 marks a decade of CAbC efforts in addressing the issues of strengthening community conservation practice at Wayanad, Kerala. During the year kalajeera was produced on a large scale and fetched a price equivalent to the procurement of basmati rice in the export market. Characterization of the rice germplasm collected from the tsunami areas was initiated at Nagapattinam.

301 Kolli Hills and Namakkal ------61

302 Wayanad ------64

303 Jeypore ------68

304 Community Gene Bank ------73

BIODIVERSITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Sub Programme Area 300 Sub Programme Area 301 Community Based Agro- Kolli Hills and Namakkal biodiversity Conservation and The community-led developmental activities Management were merged with the core action in Kolli Hills, and some notable research attempts on millet There was a dynamic progress in community- crop production and region specific landraces led agro-biodiversity management in all the three were made. intervention sites. Training and capacity building programmes of SHGs, farmers groups and Awareness, Training and Capacity Building grassroot institutions were continued with a focus on income generation, strengthening Training and Capacity Building: Four clusters homestead agro-biodiversity with traditional of SHGs, each with four groups consisting of crops in Wayanad and quality millet seed four members each, were formed and organized production, processing and marketing of value into a Biodiversity Conservation Corp (BCC) to added products in Kolli Hills. A Biodiversity monitor and manage activities in conservation, Conservation Corp (BCC) consisting of women cultivation, input and marketing (processing and SHG members has emerged in Kolli Hills for value addition). the purpose of monitoring and managing the millet based activities. A “Save Millet Seed With the help of CCD, an NGO from Madurai, a Campaign” helped in creating an awareness of 12 -day training programme was extended to the importance of conserving the millet genetic 40 SHGs including the BCC from the villages of variability of the region. A tribal leaders’ support Valavandhi, Selur, Devanur, Valapppur, Ariyur, group has emerged to advice and steer the Gundur, Alathur, Thirupuli, Chithur, Bail, activities of the community agro-biodiversity Perakarai and Edapuli. The members have Centre at Wayanad. taken up enterprises such as minor millet The Gene Bank accessions marked 1,037 processing, vermicompost preparation, petty during the reporting period. Altogether 500 shop, ragimalt preparation, minor millet accessions of paddy and millets were subjected marketing and organic pineapple export under the characterization trial in the field sites marketing. The training programme included of Jeypore, Orissa and Puthoorvayal village in topics such as conservation of resources, Wayanad. With the special support from the sustainable harvesting, identifying available Italian Government a detailed study on resources, improved agronomic and cultivation characterization of the rice germplasm collected practices, agri input and organic farming. Details from tsunami affected areas was initiated at of the various training and capacity building Nagapattinam. programmes are given in Table 3.1.

61

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Table 3.1: Consolidated details of Training, Networking and Capacity Building

Training Male Female Trainee Days

Value addition of minor millet instant mixture preparation at Namakkal 2 2 8 for SHGs

SHG members participated in the exhibition at an international consultation 2 2 12 on Role of Biodiversity

The SHG members attended SC- ST Interface meeting on Biodiversity 1 1 6

Networking meeting organized for the SHGs 9 36 45

Interactive session organized with the farmers of Kolli Hills, Veerabayangaram 68 34 102 and Namakkal region and National Commission on Farmers

National Integration Camp and NYK Awareness Camp 52 6 116

Basic training and introduction to computers 50 230 280

Animal health camp organized at Kolli Hills Panancattupatti 10 8 18

Barefoot taxonomist training organized by the FRLHT 5 15

SHG capacity building 9 90 396

Training on millet value addition and SHG capacity building 12 38 50 organized at KK Trust, Namakkal

Total 220 447 1,048

A group of farmers from Kolli Hills were given development and several training programmes training on seed selection, seed treatment, conducted on fodder development and cattle improved agronomic techniques and organic management. manuring. Field demonstrations on differential performance of millets under traditional Save Millet Seed Campaign: A “Save Millet Seed broadcasting and line sowing, millet Campaign” was organized in four districts around intercropping with tapioca and seed Namakkal and 28 places in Kolli Hills to create multiplication were conducted in Devanur, an awareness of the importance of millets and Valavandhi, Valappur and Edapuli panchayats. the existing genetic variability in the region. In this effort several participatory demonstration Mass media and a travelling workshop with plots were identified in all the four clusters (Table public addressing system were the means used 3.2). A livestock health camp was organized at to reach the people. An audio CD on the Sengarai and Panacattupatti for livestock importance of millets was prepared, shown and

62

BIODIVERSITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Table 3.2: Participatory demonstration of improved agronomic techniques

Place Crop Mixture Trial

Senkarai, Edapuli Sadansamai (Little Millet), Broad casting Vs Line Sowing with out treatment. Kurinkelvaragu (Ragi), Red Broad casting Vs Line Sowing treatment with gram, Mustard, Senthinai Vermicompost/ Azospirillum/ Phosphobacteria (Foxtail Millet), Maize

Peria Kovilur,Valapur Kurunkelvaragu (Ragi), Broad casting Vs Line Sowing Line sowing through Mallisamai, Palanthinai (Little Seed drill/ Line sowing manually Millet) Kadugu (Mustard)

Aripalapatti, Devanur Ragi (Kurunkelvaragu) Ragi with Tapioca with Rows; Ragi inter crop with Tapioca

Kuchakiraipatti, Valavandhi Thinai Seed multiplication distributed. A short film on biodiversity Millet seed production, multiplication and conservation, natural resource management, distribution poverty reduction and food security was Quality seed multiplication: As a part of the produced based on the activities in Namakkal participatory conservation system, land races and is being used as an educational material in of little millet such as Vellaperunsamai, various platforms. An awareness camp on Sadansamai, Thirikulasamai, finger millet such nature and natural resources was jointly as Satai Kelvaragu, Karunsurutai Kelvaragu, conducted with NYK from 1 to 7 August, 2005. Italian millet Senthinai, Palanthinai, Cinna The “M. S. Swaminathan Nature Club” was palanthinai, Karuvaragu, and Panivaragu have inaugurated on 5 December, 2005 at the Tribal been raised in Kondichettipatty seed Residential School in Senkarai to create an multiplication plot. During the season, 714 kg awareness among students and teachers about of millets were multiplied for distribution during medicinal plant conservation and their the sowing season. sustainable utilization. In addition, seeds of little millet landraces were Village Knowledge Centres: Computer collected and kept in the seed bank at infrastructure has been set up at four villages Aripalapatti for distribution during Kharif season. namely, Aripalapatti, Padasolai, Nariankadu and Chinnamangalam in Kolli Hills. Subsequently Seed Distribution: Millet seeds were raised in preliminary training was organized for SHGs in the Kondichettipatti plot and distributed to the different clusters on the basics and farmers through seed banks managed by SHGs management of computers. (Table 3.3).

63

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Table 3.3: Seed supplied to Seed production of seven products: Thinai Payasam Bank of Kolli Hills mix, Samai Uppuma mix, Samai Bajji mix, Millet Local Name Quantity Samai Thinai health beverage mix, Ragi fortified (kg) flour, Samai Thinai omapodi, Samai rava dosai

Barn yard Millet Panivaragu 27 mix). These products were sold at Vanigavalam- Finger Millet Perung Kelvaragu 62 Commercial Complex at Namakkal and also at Sundangi Kelvaragu 75 various exhibitions organized at district and state headquarters. The SHGs got a net profit Sattai Kelvaragu 35 of Rs 14, 492. Little Millet Thirukulasamai 19.5 Kottapattisamai 15 Men SHGs which own millet processing mills Malliyasamai 15 processed about 940 kg of little millets and Sandansamai 15 produced 545 kg of samai rice, 894 kg of Italian Karuperansamai 18 millets and 580 kg rice with the support of millet Chinna Malliyasamai 12 growing farmers. This group has decided to Italian Millet Mokkaanthinai 17 operate the mill by nominating two members Cheenapalanthinai 49 each year by rotation. In November 2005, they Palathinai 35 received Rs 50,000 as a bank loan for internal Perunthinai 62 circulation. This effort has resulted in generating Kellanthinai 45 interest among the SHGs in cultivating traditional Mochanganthinai 35 millets. Another highlight of the year was the Koranganthinai 29 Ion Exchange Enviro Farm Private Limited Chennaperunthinai 3 procuring about 80 tonnes of organic pineapple Chenthinai 3 worth Rs 4,00,000 from the farmers, for which Karunthinai 70 the SHGs have got an additional incentive of Kodo Millet Peruvaragu 43 Rs 20,000.

Total 684.5 In addition, vegetable seeds were distributed Sub Programme Area 302 to SHG members. About 15 kg of Italian millet and 10 kg of little millet were distributed in Wayanad Kalrayan Hills in Salem. The year 2006 marks a decade of the Community Millet based value-added product Agro-biodiversity Centre’s efforts in addressing development the issue of strengthening community Many women SHGs were trained in product conservation practices in Wayanad district of development from millets that resulted in the Kerala. Two new projects on organic farming

64

BIODIVERSITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ inputs and plant taxonomy were launched. The up. Seeds of tubers, vegetables, ginger, Centre also got formal approval from the turmeric, taros, and fruit plant seedlings Japanese Consulate to build training were supplied to the tribal and low-income infrastructure, and from DBT for establishing a families as a part of the home garden Bio-Resource Complex for herbal production diversification programme. Seed exchange and marketing. The organization that came into programmes were conducted for ensuring being with 2 staff members in 1997 now has 30 the availability of vegetable seeds. Now the members with diverse expertise in community villagers depend on their own vegetable seed agro-biodiversity conservation. source and market the same through the outlet initiated in the village. Biodiversity conservation, utilization and genetic enhancement Knowledge Centre strengthened: The VKC, provides a common platform to the villagers The activities of the SDC project were focused to acquire knowledge and share largely on capacity building of the farmers and experiences. The content created during the other stakeholders in Panthippoyil bio-village year is reflected in the titles such as and increasing the crop yield by proposing Importance of paddy cultivation (video); Pest changes in agronomic methods, technologies, and disease management of pepper (video); soil and water conservation approaches, value Mushroom cultivation and Panchakavya addition and employment generation. preparation (text with photos); Soil and water Solution to the water problems of the village: management practices and pest control in Water for agriculture and drinking was a vegetables (text with photos); CD on scarce resource in the village. This problem Dioscorea cultivation; Organic farming and has almost been solved by building five loose nutrient literacy (power point) and SHG boulder check dams, one Gabion check dam activities and bookkeeping practices. and one water tank. Area increased for organic pepper: Organic pepper cultivation is being continued in order Agro-biodiversity strengthened: Pepper, to increase the income of the farmers and rice, and fruit species were conserved in situ conserve the pepper varieties. So far 250 ha on farm by promoting cultivation. Livestock have been brought under organic farming. population has increased after the Since pepper is raised under mixed farming, intervention because organic farming organic pepper cultivation means organic necessitated the increased application of cultivation of other crops as well. cow dung and manure. Women SHGs took up cattle or goat rearing as a profitable Income generating activities: Four more enterprise. Two model farms with integrated SHGs have been formed adding up to 18 soil and water management, crop diversity SHGs in the village and linked with PRIs and organic cultivation practices were set and Community Banking for taking up

65

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

income generating activities like vegetable Medicinal and Special Varieties of Rice: cultivation, sericulture, goat rearing, cattle Validation, Value Addition, Organic rearing, herbal medicine preparation and Cultivation and Market Development pottery. The total savings of all members put The project started in early 2005 is intended to together during the year was Rs 4,44,240. promote cultivation, validation, value addition The internal loan circulated was and market development of rice varieties such Rs 43,12,500. A total of Rs 13 lakhs has as Navara and Chennellu (medicinal) and been mobilized from different sources by Gandhakasala and Mullanchanna (scented). SHGs for starting various micro enterprises. The process involves collection and The National Network on Bio-villages and documentation, genetic purification (to establish Community Banking supported four SHGs distinct types of cultivars, if any), clinical to start cattle and goat rearing units. validation and bio-chemical analyzis of Navara Tribal leaders support group: A separate rice, and studies on value addition of the other platform has been formed to empower three varieties with a view to taking the selected tribal leaders of Wayanad to make commodities developed to non traditional them familiar with biodiversity related markets as a medicinal or neutraceutical legislation. The purpose of this platform is package. It is aimed at promoting wider to provide training for tribal leaders in various cultivation of all the promising varieties. aspects of biodiversity and TK related legislation, and provide them orientation in The results achieved during the year include: sustainable agricultural and rural Special varieties of rice cultivation brought development. This platform is also intended under an area of 23 ha, involving 76 new to advise MSSRF in its intervention in tribal farmers constituting 5 farmer clusters areas of Wayanad. Genetic purification of Navara rice started Malayalam version of Biodiversity Act and at on-farm level Farmers Rights Manual: The Biodiversity Act 2002 and Biodiversity Rule 2004 and Six value added products developed from Farmers’ Rights Manual based on PPVFR Navara rice under trial marketing through Act 2001 were translated into Malayalam women’s initiative and and published. Characterization of Navara golden yellow Water conservation; and black varieties.

On-farm genetic diversity conservation and The project helped to check the pace of paddy a case study of the Kurichiya of Wayanad field conversion in selected cluster areas, which Ecological and environmental impacts of bio- in turn helped to enhance employment village model development. opportunities for women. The last one year

66

BIODIVERSITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ contributed 2,846 women labour days and 1,562 mushrooms and leafy greens. These field guides men labour days under this initiative. would be of help to those who are interested in learning about and conserving such diversity. Livelihood and Food security programme for the most marginalised tribal groups Bio-health programme for conservation and sustainable use of medicinal plants A collaborative programme has been initiated in 10 tribal colonies with the help of CTCRI in The activities of this initiative are aimed at the area of household food security. Under this community level development of bio-health programme, each family in the 10 colonies was products and conservation of medicinal plants, supplied with seedlings of 8 species of fruit trees, with the involvement of underprivileged women, 4 species of fruit yielding climbers, 5 species/ traditional doctors/herbalists and conservation varieties of traditional Dioscorea (15 kg), two experts. varieties of sweet potato (25 cuttings), 2 varieties of colocassia (5 kg) and seeds of 5 Awareness campaign: Awareness classes were traditional vegetable species. The Centre in conducted for students, farmers, the general collaboration with Vanamoolika, a local NGO, public and kudumbashree members and a total implemented an apiary programme for 245 of about 2,000 people were benefited in various selected families scattered over the district by ways. The other notable activities included providing them with 2 honey boxes each. The raising 3,000 medicinal plant seedlings families harvested and marketed about 1,200 belonging to 25 species and distributing them kg of wild honey at a price of Rs 100/litre. to traditional medical practitioners, farmers and school children. A checklist of campus as well The results show that the home garden as shade house plants was prepared as a part diversification programme helped the of documenting the flora of CAbC campus. marginalized tribal families to diversify their diet Internship of students was encouraged. The with various food crops, which served as a buffer stock to meet emergency food needs. The registration of 3 innovations on conversion of honey boxes placed in the vicinity of tribal vegetable wastes of tropical countries to tincture hamlets helped tribal women to harvest wild alcohol was facilitated. honey, an activity that was earlier practised only Bio-health campaign: An evaluation survey was by men. The tribal department has selected this carried out among 15 WSHGs engaged in the initiative as a model for their interventions in preparation of bio-health products, to understand poverty reduction in tribal areas of Kerala. the effect of bio-health training on the health Training was extended to 30 tribal women in status of the SHG members. Attempts were value addition of wild edibles like bamboo shoot made to market 3 bio-health products (fairness and gooseberry. Two publications in the local oil, hair oil and thali powder) through the Biotech language have been prepared on wild edible Park, Chennai.

67

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Database on medicinal plants: The medicinal method and traditional knowledge related to 7 plant database was strengthened with basic target species was documented. A total of 6,900 information on 125 plants of high potential. seedlings of target plants at 3 levels – CAbC nursery, tribal/rural community nursery and Promotion of cultivation of traditional KFRI, Nilambur nursery were raised varieties of yam successfully. A sacred grove was augmented The aim of the programme supported by the with 80 species of plants commonly grown in GEF small grant programme, is to identify all sacred groves. domesticated Dioscorea varieties grown in the Malabar eco-region and enhance their An important outcome of this project was the availability through filed level multiplication of recognition of CAbC-MSSRF Garden as a promising varieties. Extensive field surveys were member in the Botanic Garden Conservation undertaken which resulted in the identification Network. of 18 varieties of Dioscorea, currently grown in Every Child A Scientist programme the Malabar region. Specimens of 15 varieties were collected and a central demonstration plot Twenty-two children who had regularly attended was maintained in the CAbC campus. this programme for a period of three years and Nutritional analyzis of the varieties was done in gained knowledge on biodiversity have formed collaboration with CTCRI, Thiruvananthapuram. a Biodiversity Conservation Corps. These The promising varieties were distributed to tribal children are taking up environmental issues and marginal farmers’ groups for addressing including water scarcity and use of chemicals malnutrition and poverty. Now more than 250 in agriculture (See SPA 604). tribal families and 300 non- tribal families are Linkages have been established with Information involved in this project. More farmers have shown Kerala Mission and C-Dit for expanding the interest in cultivating tubers as they perceive it activities and content development. A detailed as a safe food which is free from chemical curriculum with step by step instructions to the fertilizers and pesticides. trainers has been developed from our past Conserving 10 RET plant species for tribal learnings and is ready to be published. and rural livelihood security Funded by the Invest in Nature (IIN) initiative of Sub Programme Area 303 the Botanic Garden Conservation Network (BGCN) through NBRI, Lucknow, this project Jeypore came to an end in March 2006. An intensive Biodiversity conservation, utilization and systematic survey was undertaken to study the genetic enhancement population of the species in 10 selected pockets (1,000 sq.m each and a total of 10,000 sq.m) Participatory plant breeding - the rising economy of different types of forests, using the Quadrate of poor tribal communities: During the year,

68

BIODIVERSITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Kalajeera was produced on a large scale. transplanting seedlings. The initial dry spell Farmers took pains to maintain a good crop reduced the germination of seeds by 23 %, despite erratic rainfall and incidence of stem inhibited seedling growth and delayed borer. Out of the 377q of Kalajeera produced, transplanting, leading to pest infestations of 293 q were available for sale, the remaining being blast, brown spot, leaf folder, bacterial leaf blight kept by the farmers for their own consumption. and stem borer. The use of biopesticides Marketing such a large quantity of paddy locally controlled the infestation in all but one village. at a remunerative price was found difficult. After field observation, training on IPM and water Therefore, much before the harvest, the management was given in all the villages. Erratic Government was informed of the problem and rainfall during flowering reduced production by their help sought to get the paddy procured using about 40 %. In spite of this drop in production, their tribal development avenues. In response, the yield ranged on an average from 8 – 16 q / the Government of Orissa arranged for acre. procurement through NAFED (National Agricultural Cooperative Marketing Federation Production of Kalajeera- cost - benefit: To get of India Ltd.). Based on the good quality, NAFED an idea of benefit in relation to cost information set a price of Rs 10 per kg which is equivalent was gathered from 13 farmers belonging to 4 to the procurement price of Basmati rice in the hamlets who raised a good crop (Table 3.4). export market. Table 3.4: Cost benefit analyzis of Production of Kalajeera by Farmers realized the value of Village Seed Jeypore farmers Banks (VSB) and the need for their efficient Parameters Range Average management when quality seeds of Kalajeera produced by them were stored there for Area sown (ha) 0.18 – 1.07 - distribution the next year. In all 75 q of pure Yield (q / ha) 16 - 34 25 seeds were selected during Kharif 2005, which Cost (Rs / ha) 6,000 – 9,000 7,100 is sufficient to cover an area of about 160 ha. Profit (Rs / ha) 6,700 – 21,100 13,300

To support farm families producing seed and B : C 1.177 - 3.36 1,904 grain, FYM at the rate of 6 cartloads/acre was Farmers:13: Nuaguda 4; Jhalaguda 2; Taliaguda 3; provided. VSBs of respective villages supplied Kundura 4 pure seeds @ 20 kg/acre. The farm families It is significant that the benefit was about 1.2 to also signed a utilization certificate for the 3.4 times the cost of production of Kalajeera, material supplied to them in the presence of in general with an average B:C of ~2. Despite the Community Seed Bank members. this, there was a farmer who could not raise a Many of the farm families adopted formal good crop resulting in a poor B:C ratio of 0.203. methods of cultivation by raising a nursery and Such farmers would need a few more seasons

69

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ to gain practical knowledge of improved Participatory conservation: Successful cultivation methods. Participatory Plant Breeding (PPB) activities helped people to achieve stable economic gains Characterization of Kalajeera variants and that revived Participatory Conservation Systems similar varieties: Preliminary chronicling and (PCS). The PCS technology reached several collection of variants of Kalajeera have been villages through farmer-to-farmer extension. As completed to get basic information for benefit in the past, farmers returned a good quantity of sharing. Eighteen variants of Kalajeera were seeds after harvest of the PCS plots. This would collected from 10 districts of Orissa; they were be redistributed to others for regenerating fresh directly seeded in farmers plots in Patraput seeds; this method adopted over the past few village. Only 14 of the collections germinated. years has been found very efficient and has led A team of scientists from Jeypore explored 50 to a self-sustaining conservation cycle of sources of information (Table 3.5) to identify valuable farmer-germplasm. This year, 33 Kalajeera variants and varieties looking like popular landraces from upland, medium land and lowland were conserved with a few lines of Table 3.5: Chronicling of Kalajeera (July – August 2005) varieties like Kalajeera. Some of the landraces in the PCS plots showed a potential for good Districts Bolangir Nuapara Kalahandi yield, based on 9 agronomic characters. Details Villages 1 10 2 of participating farmers and the progress in the Farmers 2 14 12 area under PCS are given for Nuaguda hamlet Govt. Officials 6 (Table 3.6). NGOs 3 Village Seed Bank: The earlier “community Kalajeera. The idea is to grow and characterize gene-seed-grain bank” initiative has been them and find out how far they resemble the renamed “Village Seed Bank” (VSB). Jeypore Kalajeera. Designated activities like grain and seed distribution, recovery of interest as seeds on Fourteen variants of Kalajeera were collected landraces earlier distributed on loan, formation and raised during Kharif, 2005. However, their of management committees of seed banks, purity in the next two generations has to be monitoring of plots growing Kalajeera, and re- examined before coming to firm conclusions. activating the earlier approved passbook system In addition, 22 Kalanamak collections which were carried out this year. Supply of seed and have black husk were collected from G.B. Pant grain on loan benefited several farm families University of Agriculture and Technology, (Table 3.7). Pantnagar (courtesy: Dr US Singh) and planted during Kharif, 2005. Since the seeds arrived late, Village gene bank: New Collections: The village the sowing was late, affecting germination and gene bank at Jeypore was augmented with 22 expression. new landraces of rice from Nabarangpur district.

70

BIODIVERSITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Table 3.6: Varieties and progress of area in Participatory Conservation in Nuaguda hamlet

Farmer Variety Area (acre) 2003 2005 Mr.Gobardhan Pujari Osagathiali Upland 0.05 1.3 Mr.Hari Pradhani Dangar basmati Upland 0.02 0.5 Mr.Laxman Minurbalia Tulasiganthi Lowland 0.02 1.5 Mr.Sunadhar Ghiuria Karkoli Lowland 0.04 1.0 Mr.Laba Ghiuria Assamchudi Lowland 0.04 0.7 Mr.Dhanurjoy Ghiuria Machhakanta Lowland 0.05 2.0

pure seeds of Kalajeera, and seeds of a few Table 3.7: Details of farm families benefited by VSBs at Jeypore other land races were produced. Villages other than the MSSRF demonstration villages also Name of the No. of Paddy (kg) availed of seed loans from the VSBs.. As a village beneficiaries consequence, the demand is increasing for Grain Seed Grain Seed establishing VSBs in villages adjacent to the Tolla 55 13 2,920.0 130.5 demonstration villages. Boliguda 29 14 2,227.5 45.0 Patraput 13 21 581.0 95.5 Natural Resource Management Kashiguda 91 98 5,812.5 302.0 Cashew cultivation: The plants in the cashew Pujariput 38 10 1,831.5 109.0 plantation, which was established in 2003 in Nuaguda 28 08 1,425.0 90.0 12 acres of wasteland at Tolla village have Santaliaguda 25 12 250.0 400.0 attained a height of one meter and are healthy. Jhalaguda 25 500.0 Total 304 176 15,547.5 1,172.0 Vermicomposting: The efforts on promoting vermicomposting continued among 54 farm They were multiplied along with the available families belonging to 5 villages by getting support 68 landraces in farmers’ plots. The VSBs from the Spices Board. During the year supported 304 needy families from eight villages 60 – 70 q of vermicompost was applied in fields with 15,547.5 kg of grain. Similarly 6,383.5 kg of landraces of rice and millet at Nuaguda, of seeds of traditional and high yielding varieties Taliaguda and Jhalaguda. This is reported to were distributed among 174 farm families of have reduced the incidence of weed growth and seven villages. Twenty percent of seeds were pest attack. The groups have sold 82 kg of stored in the VSB. This helped some families, earthworm to GOs and NGOs @ Rs 50/-kg and whose farms suffered from flash floods, by imparted training to farm families regarding making available seeds for re-sowing. 75 q of preparation of vermicompost pits.

71

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Fish farming: In the percolation pond of Tolla, IPR of tribal families. The garden and research SHG members introduced 3.5 kg of fish centre is being established as a joint initiative fingerlings with the approval of the Central of MSSRF and the State Government to Village Committee. In the community ponds the conserve the medicinal plant species being fish mortality rate was less and the fishes were used by local tribal communities. MSSRF has attaining an average size of 4 to 5 inches. The taken possession of the allotted land from the CVC of Taliaguda took the decision to sell 2.5q State Government and a basic contour map of of fishes of their village in the nearby weekly the area has been prepared in collaboration with market @ Rs 35/kg. the soil and water conservation research and training centre of ICAR. Detailed soil testing Community vegetable garden: The villagers of has also been carried out. The layout of the Nuaguda developed a wasteland covering 2.80 garden has already been established and nine acres into a community vegetable garden. The one-acre plots have been assigned to be initiation of community farming of turmeric and developed as in situ conservation units for the ginger at Nuaguda in 2003 had a good impact major tribal groups of the region. This will serve in nearby villages. The yield of 2003 was as a repository of various genetic stocks of the preserved as seed and distributed among farm region and will be of immense utility for present families of Nuaguda for cultivation in their and future generations and will serve as a living backyard. This process is gaining momentum gene bank of the tribal families. The design for in the villages. the research centre, that includes training halls for tribal communities and laboratories for Networking, training and capacity building of biomolecular studies, has also been finalized SHGs: A training programme was conducted and the construction work will be completed by for 14 SHGs on formal methods of cultivation, November 2006. As a part of the initiative, two setting up of vermicompost units and interactive programmes involving the traditional establishment of VSBs. The same programme healers and traditional medicinal practitioners was repeated for the benefit of seven NGOs who of the region were conducted and the information brought 49 farmers (42 men and 7 women). obtained from these traditional health practitioners has been compiled as a database. Biju Patnaik Medicinal Plant Garden and This database has been of great use in Research Centre identifying the species and varieties of medicinal Last year, the Government of Orissa had allotted plants to be conserved in the centre. A village 12.5 acres of land to MSSRF for establishing a resource centre has also been established in research, training and capacity building centre this centre. It was inaugurated during the first at Jeypore for strengthening in situ and ex situ Virtual Congress of Farmers in January 2006, conservation of medicinal plants and for at which a meeting was organized between the undertaking validation and identification of active President of India and the local tribal biomolecules as well as for safeguarding the communities.

72

BIODIVERSITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

affected area. A farmer who follows traditional Sub Programme Area 304 cultivation under rainfed condition was identified near the coastal village, with the help of the Community Gene Bank Agricultural Department, Nagapattinam. Tests were conducted in both tsunami affected (with The Gene Bank accessions increased to 1,037 soil casting and without soil casting) and non- during the reporting period. These collections, tsunami affected lands. Varieties such as many of which are drought tolerant, flood tolerant kunthali, kallurundai, kuzhivedichan, and salt tolerant, and also have pest and disease soorakuruvai, katchakombalai, vellakudavalai, resistance features, are largely accessed from kattukothalai, kattuponni and kombalai were different tribal and rural communities, belonging included in the trial with the onset of monsoon. to Orissa, Kerala and Tamil Nadu. Several of In addition to this, varieties collected from Orissa these accessions were subjected to such as bhalungi, kusuma, haroimati, characterization based on the international ratnachudi and kuthiru from Wayanad (those with standard descriptors for the target crops. This low to moderate level of salinity tolerance) were was done across three field stations. Field trials also tested in the same field. These varieties were conducted in MSSRF field sites in Patraput withstood the heavy northeast monsoon that hit village in Jeypore, Orissa and Puthoorvayal TN last year. The overall crop stand and village in Wayanad, Kerala. In TN, the trials were performance were found to be good. International conducted at the Kattupakkam Livestock standard descriptor was used to record data both Research Centre of the TN Veterinary and Animal on agronomic and morphological traits, including Sciences University. All together 500 accessions quantitative and qualitative characters. After of paddy and millets were included for the trial. harvest, considerable amounts of seed material Interaction meetings were held at Puthoorvayal, were obtained from tsunami affected areas and Wayanad during the harvest period inviting men will be used for further trials in the forthcoming and women of the Kuruma tribe. They were season. interested in seed material for the varieties such Soil samples were collected at three different as alliannan, thekkan cheera and kundipullu. stages i.e. during field preparation, time of sowing The requested seed material will be supplied to and at the time of harvest; analyzis was them after seed multiplication trials. Soon after conducted at the IPM lab at MSSRF. Analyzis characterization trials, germplasm accessions included parameters such as pH, electrical received from the field are being processed for conductivity, available nutrient content, organic storage at the gene bank. Corresponding carbon and sodium chloride levels. Subsequent photographs and herbarium voucher specimens germination tests using different salt are being prepared and catalogued. concentrations were taken up with the help of With support from the Italian Government a the biotechnology group at MSSRF. Necessary detailed study on characterization of the field photos, individual variety photo and germplasm collected from tsunami affected corresponding herbarium voucher specimens are areas was initiated at Nagapattinam, the worst housed at the gene bank.

73 Programme Area 400

ECOTECHNOLOGY

Hundred and one ha of farmland were certified as organic in conversion and therefore the produce can be certified as organic. A low cost biofertilizer unit was established and the production technology was demystified. Approximately 39,000 trainee days were completed during the year. A bulletin documenting the achievements under the OSU supported project was brought out in November.

401 JRD Tata Ecotechnology Centre. ------75

402 Sustainable Management of Natural Resources for Food Security and Environmental Quality. ------96

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

A major focus has also been on post tsunami- Sub Programme Area 401 activities, especially in the area of ensuring JRD Tata Ecotechnology Centre livelihood security interventions carried out under the PAN-MSSRF work at multiple locations (see During the year the Centre revisited the PA 702.1). approaches and activities for the purpose of Participatory on-farm trials - System of Rice strengthening the delivery mechanisms under Intensification the human-centred, sustainable development paradigm – the Biovillage Model, which aims at System of Rice Intensification (SRI) method was optimising the use of natural resources and adopted as one of the approaches for enhancing the opportunities of the rural poor in demonstration and creating awareness among terms of sustainable livelihoods. Based on the the paddy-cultivating farmers. SRI provides an revised thrust and focus area, strategies were opportunity among the subsistence farmers to identified for the way forward on a role change double their yields without increasing existing in a couple of sites and launching new initiatives inputs, an alternative approach to rice at two of the sites, based on the strengths production that addresses most of the problems developed over the years. A number of training that are being encountered by our farmers such programmes have also been organized. as more water and higher seed rate.

The following are the highlights of the activities The participatory SRI demonstration was of the Centre. conducted during the samba season with CO- 43 and Ponni rice varieties in the Cauvery delta 401.1 Coastal Region tailend region to compare SRI with conventional methods in relation to growth parameters, yield 401.1.1 Chidambaram attributes, cost and economics. This was done This year the focus was on large-scale with 25 farmers and covered an area of 41 acres. participatory farm trials in relation to water use The results of the CO-43 trials are given in Table efficiency, System of Rice Intensification (SRI), 4.1. An average 30 % increase in yield was crop diversification (finger millet and cotton), observed, compared with production using enhanced biological inputs as part of good conventional practices. The ratio of seed used agricultural practices, promoting a community for transplanting, compared to the paddy seed bank for pulses, initiating the harvested was 1:814 for SRI, whereas with documentation of the (on going) Integrated conventional practices, the ratio was 1:36. The Intensive Farming System (IIFS) and Eco- results of SRI evaluation have shown that with aquaculture practices and strengthening the SRI small farmers are able to increase their rice SHGs and their income generating activists. The production with less input of seed and water. various topics were covered in 773 trainee days. More farmers are planning to replicate this.

75

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Table 4.1: Comparison of economics in SRI and conventional method for CO-43

Particulars Total Gross Net CBR Productivity Production cost (Rs) income (Rs) income (Rs) kg/acre cost/ kg

SRI 7,570 14,531 6,961 1.92 2,442 3.01 Conventional 9,225 10,800 1,575 1.17 1,800 5.13

* data analyzis from 41 acres

BARC- Pulse Seeds Multiplication fertilizers (417 packets each of azosprillum and phosphobacteria @ 500 gm per packet) and The Adhivaraganatham Farmers Welfare biocontrol agents (383 litres). Totally 272 Association took responsibility for distributing farmers participated in an area of 83.2 ha and BARC pulse seeds to 127 members. Each followed the application through seed treatment, farmer received 6 kg of either black gram or seed dipping, soil application and field green gram seed. Totally, 657 kg of pulse seed application after one month of transplanting. were distributed to Adhivaraganatham, Under this trial, 180 soil health cards were Suthukuzhli and Erataikulam village farmers. distributed to farmers. The average yield Out of this, 324 kg of blackgram seeds was increased by 15 to 20 % through the application distributed to 53 farmers with 12.8 ha and 433 of biofertilizer. This mass field trial has resulted kg of green gram seeds were distributed to 74 in a demand to establish low cost production farmers with 14.4 ha of land. The association units in this region with guidance from MSSRF. has initiated the seed bank concept with a contribution of 30 % harvested pulse seed from Thenkoodu Federation every farmer who received initial inputs. A total The Thenkoodu Federation has currently 44 of 50 farmers received soil health cards from SHGs in 14 villages, including 41 women SHGs the department of agriculture, Cuddalore. Ten and 3 men SHGs, grouped into five clusters. farmers prepared vermi bed for vermi compost Among the clusters in the B. Manavelli cluster, production. One of the milestones of the individual average borrowing was Rs 15,859/ Adhivaraganatham Farmers Welfare head (8.85 fold of their savings), followed by Association was opening of their own office Senthirakillai with Rs 9,680/ head (4.91 fold), building. (See PA 104.1) Boothavarayanpettai with Rs 6,766/ head (3.66 fold), Vandurayanpattu cluster Rs 4,615/ head Biological inputs - Mass Field Trial in Rice (2.26 fold) and Keelamanakudy with Rs 1,088 Cultivation head (1.10 fold). Totally 228 women SHG Mass field trials with biofertilizers and members have availed of bank loans worth Rs biocontrols were conducted in samba rice 29,86,000 (@ 28 times their savings) and 74 % cultivation. In this trial, all the 4 grassroot of women (164 members) utilized bank loans institutions participated and applied bio for agriculture and livestock purposes.

76

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Manikollai Lift Irrigation and purchase cost have been documented along with the IIFS directory of all practising The lift irrigation model has been replicated by farmers. the DRDA in one village from Cuddalore Taluk and BLESS NGO replicated this model with 20 Aquaculture activities - Community pond marginal farmers. In addition, the farmers from aquaculture by SHGs this federation developed a community paddy nursery for optimum utilization of available water Composite fish culture techniques are being and cost of cultivation. This nursery serviced used for aquaculture activities. In all, 27 about 20 acres. Because of lift irrigation, 43 members were involved in the demonstration. acres of cotton and 12 acres of finger millet are The culture duration was 10 months. The water- being cultivated by 15 farmers as part of their spread area of the pond was about 0.6 ha. The crop diversification process. The cost of lifting species used were both Indian and Chinese water from Paravanaru is about 20 to 25 % of carps. The total sale from the pond was Rs the total cost of cultivation. So this federation 47,638 and the net profit was Rs 793/head, apart has approached the electricity department for from the regular income. The low income was power supply and in addition, the option for because the pond belongs to the village tapping renewable energy to lift water is also Panchayat and fertilization is not allowed in the being looked into. Lift irrigation farmers, pond. agricultural labourers and others could not reach Backyard ornamental fish breeding the land for irrigation and other agricultural operations. MSSRF worked with DRDA to Backyard ornamental aquaculture is one of the provide access and 1,700 m of road costing Rs activities, in which about 30 women are involved. 6 lakhs, has been laid. Documentation of the Due to the lack of infrastructure, the income experience in the last three years of the from the pond is not much. This issue is being Manikollai Lift Irrigation implementation has addressed. Livebearers like the mollies and been initiated. guppies are the candidates. Goldfish culture is also being planned. A total of 376 training days IIFS Replication have been organized, based on the needs of What started of as a participatory demonstration the SHGs, including pond culture techniques, of Integrated Intensive Farming Systems (IIFS) controlling and addressing carp diseases and has resulted in its replication in three blocks ornamental fish breeding and weed management viz Portnova, MelBhuvanagiri and Keerapalayam in open waters. by nearly 172 farmers. The documentation of Aquatic weed management - Hydrilla the process, replication and key learning have verticillata (Hydrilla) begun. These replications have been mapped at the Chidambaram taluk level. In addition, the A pilot initiative to test the efficiency of the information related to resource recycling, input biological management of the submerged weed

77

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Hydrilla verticillata by the grass carp, harvesting and the hand pumps work when the Ctenopharyngodon idella revealed that the pond is recharged with rainwater. Due to lack biomass decreased to 0 kg/m2 in the treated of water in the pond, the water quality/quantity pond at the end of the experimental period of in the hand pumps is affected. Duckweed is approximately one year. This experiment one of the floating weeds in this water body. established that the grass carp was one of the The weed has been a menace in the pond over efficient biological methods to manage the the last 15 years and it deteriorates the water aquatic weeds. The pond is being monitored quality, which is detrimental to the fish. At the for any reappearance of weeds. Currently about request of the temple authorities, grass carp 20 farm ponds have this weed management in was stocked in the pond early this year as part place and over 4 ha of water surface area is of the weed management practices. The covered under this management. More farm biomass of weed in the pond was estimated ponds will be covered in the coming year. by the quadrangle method. As per the random sampling, the biomass was about 2,980g/m2. Giant duckweed (Spirodella polyrhiza) The weed density was lowered partially before management by grass carp (Cteno- stocking the fish (116 numbers at a total pharyngodon idella) biomass of 66 kg). The basic parameters like The sacred temple pond is one of the biggest dissolved oxygen (3.4 ppm – early morning) and ponds (5115.00 m2) in the town where the sub- pH (7.5) were taken initially. On the 40th day soil aquifer is recharged through water the weed density came down to nil.

Fig. 4.1 Giant duckweed management by grass carp

78

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Fish for All Centre: The proposed centre will (15,000). The saplings were supplied to about function as a training and demonstration centre 200 biovillage members, each of whom is for the fisher men/women on a KVK model replicating floriculture cultivation in about 10-15 (learning by doing) to help in strengthening and cents in their backyard. Dairying activities were diversifying the existing livelihoods and integrated and fodder cultivation increased. identifying alternative livelihoods for the resource Vermicompost pits were established and azolla poor to add value to the chain from “Capture/ was cultivated. The mushroom and biopesticide culture – Consumption”. The Centre will also units were strengthened. About 700 cc of house a Knowledge Centre to enhance the corcyra eggs were produced and marketed to training through ICT based options and a fish cover about 650 acres of paddy and sugarcane pre-processing centre. Preliminary discussions fields in and around the bio-villages. The are under way for the choice of land and nutritional garden was also redone. About 500 discussions with the local community to kg of vegetables was produced from the ascertain their acceptance and needs for Biocentre and nearly 180 SHG members planning the activities of the centre. replicated the concept of nutritional garden through the subsidized vegetable minikit (seed 401.1.2 Pondicherry package) from the Agriculture Department. The Biocentre was established at Pillayarkuppam Village as the hub of the Biovillage Council Biovillage programme for horizontal transfer of The federated Biovillage Council (BVC), Innyur knowledge and to offer a single window system Grama Sangam, currently has 247 SHGs under of extension. Over the years, with the support its umbrella. The focus for this year was of the farmers and SHGs, the programme has strengthening the community banking and been replicated in 40 villages. The focus of the putting in place a database of the SHGs. The Biocentre is training and demonstration on BVC also liaisons between SHGs and banks, various income generating activities for the institutions and universities and has started resource poor, networking with stakeholders, working on Community Banking. The target of linking the SHGs to get credit facility from the more than Rs 1,00,000 in the community bank financial institutions, and helping the farmers has been achieved this year. to sustain the agricultural activities with available natural resources. Training

This year the demonstration area around the Training was inculcated in various enterprises centre was rejuvenated by increasing the such as mushroom cultivation, fodder integration of various activities around the IIFS production, horticulture, floriculture, model, diversifying the crops, redoing the low Trichogramma, establishing a biogas plant, cost green house and using it optimally for vermicompost and biofungicide production. raising crossandra and jasmine saplings Other areas included Accounts and

79

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Bookkeeping, Software Accounts Training, Day. About 1,300 SHG women participated in group management, orientation to new SHGs, these programmes. The Biocentre is acting as credit management and entrepreneur skill a common platform for NGOs, Govt Depts and development. Totally 3,416 (2,990 women and Research Institutions to share their updated 426 men) trainee days were covered during this knowledge with SHG members and the farmers period. Compared with the past years, more of this region. More than 1,500 school children men came forward to take training at the from different schools had a one-day exposure Biocentre. Out of 3,416 trainee days, 1,020 programme at the Biocentre. trainee days were devoted to women SHGs from Kodathur Biovillage - in partnership with SBI, other parts of TN and Pondicherry. A total of ADB Pondicherry 720 trainee days were organized on micro enterprises i.e. on planning, implementing and A couple of steering committee meetings were monitoring. As a new venture, 10 men groups conducted this year. An impact analyzis was were trained on forming SHGs and income carried out on the work done in the last two generating activities. years. Currently, under the Integrated Dairy Management Programme (IDM) 180 members This year, 43 new SHGs were formed. More own cattle and supply milk to Hatsun and than Rs 62, 58,000 have been mobilized from Ponlait. Fifteen members have constructed a various sources to start income generating biogas plant, 15 members have developed fodder activities in the villages. During the year, group cultivation in 10 ha and 9 members have started internal credit was raised up to Rs 95,00,000. vermicompost pits. A subsidy of Rs 42,000 has Thirteen SHG members purchased housing been facilitated for fodder and biogas plants plots in Uruvaiuar, Mangalam, Melsatha- through government departments. About 250 mangalam and Ulavaikal villages. Fodder plots households (HH) have been relieved of debt from were developed in 1 ha to support the dairy moneylenders. Twenty-nine SHGs consisting activity in Mangalam village. Expanded of 19 women, 9 men and 1 mixed have been floriculture activity (jasmine, crossandra, mobilized. Additional calves, milch animals and marigold) was carried out in 2.8 ha. Rs 49,000 goats have been observed. was mobilized as a subsidy for marigold/acre. Thirty-eight members from 7 villages are The SHGs are now able to identify the needs of involved in vermicomposting activity, while 420 the community and help themselves through SHG members were brought under the fold of group activities. Their mobility has increased dairy activity. The SHGs of Mangalam village and they have developed their skills helped Indian Bank to start banking services tremendously in networking with stakeholders to all; Mangalam is the first village to do this. like banks, DRDA, Block Development Office, District Industries of Commerce, Department Other activities included the celebration of of Animal Husbandry, Veterinary College, Aadiperukku vizha and International Women’s Fodder Research Station, Federation, Ponlait,

80

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Hatsun, Deepaoli and MSSRF. The net increase participatory mode with SHGs and Farmer’s in income through dairy activity is Rs 10,56,000. Groups (both men and women groups). An additional 140 labour days have accrued During the last 2 years, the Centre has been through Pseudomonas production with an demonstrating and studying the impact of income of Rs 8, 77,000 which was mobilized to Aquaculture based Integrated Intensive Farming start micro enterprises in the villages. During System (AqIIFS), as a group activity. The first the year group internal credit was raised up to AqIIFS model was established in the common Rs 5, 33,750 and 687 trainee days were community land at Manitiri village in June 2004, organized for women SHGs, clean milk covering an area of 0.6 ha. Currently there are production and Pseudomonas production. Other 2 such model farms at Manitiri and Niyamatpur. activities initiated include mat weaving and These activities were developed to facilitate the vegetable vending. effective utilization of community ponds for water 401.1.3 Kendrapara, Orissa harvesting and cultivation of horticultural crops on the bunds, and enhance fish productivity During the year, the emphasis was on (carp culture/ carp nursery). This group activity strengthening the ongoing activities and forming is being taken up by 165 individuals, of whom a federation of the SHGs and Farmer’s Groups, 109 belong to Scheduled Castes. The ponds which would enable the continuation and have been stocked with composite fish culture replication of the ongoing activities by the viz. Rohu, Catla, Mirigal and Grass carp. grassroot institutions during and post role change, in the 10 villages, namely Manitiri, Besides the cultivation of fish, the pond water Niyamatpur, Padagayaspur and Patana of is used for irrigating seasonal horticultural and Rajagarh Zilla Parishad (ZP); Anduli, Basaghara floricultural crops cultivated on the bunds and and Ghantiapalli of Balipala ZP of Mahakalapara adjacent to the pond, to maximise production block and Nembera, Narendrapur and Balia per unit area, throughout the year. For vine crops villages of Kuhudi ZP in Marsaghai block. roof gardening with nylon net was constructed inside the periphery of the pond for optimum Participatory Demonstration and Replication use of space. Cultivation of fodder crop (hybrid The project activities at Kendrapara were Napier) and hybrid marigold flower cultivation focused towards demonstrating and show promise for upscaling in the project area. strengthening the available livelihood options at the individual household level and community Cultivation of commercial crops as a group based group activities that would be activity is being continued by the members of manageable and sustainable, and integrated the Farmer’s Club at Niyamatpur, under irrigated into the existing lifestyle of the community. All condition. These crops were grown with assured on-farm activities were carried out in a irrigation in Rabi season after paddy. This

81

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ cropping system convinced the members of the harvested by some of the SHGs for compost club and other farmers. It is seen from Table preparation. 4.2 that the farmers’ club, consisting of 10 male Vermicompost: During the year, 10 qtls. of members, earned Rs 1,23,886 in 5 months from vermicompost, rich in organic carbon (12.5 %) 11.10 ha of land and each member got a share and high nitrogen content (0.5 – 1.2 %), worth of Rs 12,388. Rs 8,000 has been harvested by SHGs and

Table 4.2 : Commercial crops grown by Farmers’ Club, Niyamatpur, during Rabi, 2005-2006

Crops Area Production Actual sale Expenditure Net profit (ha) in Quintal price (Rs) (Rs) (Rs) Sunflower 0.48 7.0 15,924 5,250 10,674 Summer paddy 6.00 247.50 1,18,800 48,500 70,300 Green gram 4.00 35.0 50,000 16,780 33,220 Chilli (Green) 0.20 2.25 2,700 1,025 1,675 Spinach 0.06 1.36 340 185 155 Brinjal 0.20 5.12 3,032 1,130 1,902 Ladies finger 0.16 13.00 7,800 1,840 5,960

Total 11.10 311.23 1,98,596 74,710 1,23,886

Other Activities used at the AqIIFS demonstration area at As the confidence and skill of the SHG Manitiri. The use of vermicompost, and other members in the smooth functioning of the organic manure like oil cakes instead of activities related to upkeep and running of the chemical fertilizers or pesticides yielded community AqIIFS pond increases, newer satisfactory results and could lead to the components are also being introduced, such promotion of organic farming in the region. as NADAP composting, vermicomposting, Azolla nursery and apiculture. These new Azolla: Training on Azolla production has been elements not only serve the purpose of initiated to replace the requirement of FYM demonstrating and training but are also being which is not available as a major amount of cow integrated into the local cultural practices. For dung is used for fuel. One Azolla tank is the purpose of NADAP compost, locally maintained at the demonstration plot of Manitiri available biomass are used, especially water village. During the period under report 55 farmers weeds (water hyacinth, pistia etc). This has have taken up Azolla culture for in situ indirectly benefited and encouraged the use of production in rice fields at the beginning of Kharif ponds for fish culture, as the water weeds are 2005 and covered 17 acre. In addition, 12 SHG

82

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ members maintained Azolla in ponds for mushroom. The mushrooms were sold at Rs incorporation into their kitchen gardens as 40 – 60 per kg in the market, getting a net profit compost before vegetable cultivation. This is of Rs 13,000 during the season. The SHGs being practised by the people of this locality for members have also been given training in vegetable production. making mushroom pickle, soup, and other products. Apiculture: Apiculture as an activity is being encouraged at the project site, especially with Poultry: Maintaining poultry birds is gaining the introduction of sunflower. Currently apiculture momentum as within a period of 2 – 3 months has been taken up by the SHGs of Manitiri, they get a net profit of Rs 55,000. This year Padagayaspur and Niyamatpur for pollination 1,500 chicks have been procured by the of crops and securing honey. During the year members and 5-15 chicks per family are being about 4 kg of honey worth Rs 600 was reared as per our recommendations. Altogether harvested. 126 SHG and farmers’ club members have reared these birds and sold them within 3 Sunflower cultivation: The cultivation of months @ Rs 40-45 per kg body weight. sunflower for edible oil was introduced last year at the project site for the first time in the region. Kitchen garden: Kitchen garden activities at the This year 8 SHGs have cultivated sunflower Var household level are continuing, with quality MFSH-8 in 2.5 acre. and received up to 6.0 seeds being used as inputs. The produce is quintals seed yield per acre from which they mostly used for their own consumption although extracted about 300 kg of oil. Sunflower oil cake the excess is sold. Some of them are growing is used as fish feed and manure at the project vegetables as a group; for instance, 18 site. Large-scale sunflower cultivation at the members in Ghantiapalli and 5 gardens in project site appears promising and could be Padagayaspur maintained by 5 members of a suggested as an alternate crop to paddy under group. conditions unfavourable for paddy cultivation. As System of Rice Intensification: SRI technique the sunflower is slightly salt tolerant, it is well was taken up for demonstration. Trials were suited for this region. After observing the results conducted in the Rabi season of 2005 in two of sunflower demonstration of 2004-05, farmers farmers’ plots in Niyamatpur. In this trial, 15 - are ready to grow this corp. In the Rabi season day and 30 - day seedlings of the rice variety of 2005-06, the area under sunflower after Kharif ‘Lalata’ were transplanted in 20 x 20 cm and 25 paddy has multiplied covering 25 acre and x 25 cm spacing and farmers’ practice (not line involving 73 farmers. planting) of each spacing was maintained for Mushroom cultivation: Mushroom yields comparison. The highest grain yield i.e. 66.24 recorded during the year per bed were in the q/ha was from 15 - day old seedlings planted in order of 2 kg for oyster and 1 kg for straw 20 x 20 cm. space, followed by 30 - day old

83

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ seedlings at the same spacing. Satisfactory Need based training and capacity building grain yield was also obtained from 30 - day old Other than strengthening the existing ongoing seedlings at 25 x 25 cm spacing. It is concluded activities with new inputs, specialised need that 20 x 20 cm spacing with two seedlings per based training such as rodent control was also hill recorded higher grain yield and there was conducted. During the training, use of not much difference in 15 or 30 - day - old and rodenticides like Roban, Zinc Phosphide and one or two seedling / hill. The trial has also sticky traps were demonstrated. been conducted in 15 farmers’ fields with the rice variety “Swarna” during Kharif 2005. To create an awareness of the activities Observations showed that the height of the crop undertaken by research institutions and on the was maximum in one seedling / hill whereas technologies they have developed, two maximum tillers and productive tillers were exposure visits were organized to institutes at recorded in 15 - day - old plants at one seedling/ Cuttack and Bhubaneswar. These exposure hill. Lowest stem borer infestation, healthy and visits have helped the farmers in having direct heavier grains and grain yield were recorded interaction with the scientists and clearing their doubts and the exposure is helping them in where one seedling was transplanted per hill undertaking income generating activities in an followed by two seedlings. organised manner. One hundred individuals In the Rabi season trial, two seedlings / hill participated in this programme (69 women and showed best performance. This may be due to 31 men). congenial atmospheric moisture and moderate The beneficiaries have given their options for temperature. Therefore, to save the cost of seed, income generating activities as follows: 45 % one or two seedlings / hill can be recommended for poultry, apiary, mushroom and vegetable to the farmers. The SRI technique is becoming cultivation (small holding groups); 30 % for popular in this area as 27 farmers followed this vegetable and flower cultivation, dairy, poultry, practice in Narendrapur, Nembera and other mushroom, rice parboiling and processing; 15 villages and received 10-15 % extra yield with % for rice, vegetable cultivation, dairy and less seed and labour. poultry and 10 % for rearing ducks, fish and New initiatives taken up during the year included coloured fish production, rice and vegetable the cultivation of green manure crops (sunhemp cultivation. These are now being initiated by and dhaincha) before transplanting of paddy them. seedlings and planting fruit and agro-forestry During the reporting period 510 farmers, both trees. Saplings of Accacia mangium (Australian men and women, were trained and 5,100 trainee Teak) (250), Areca nut (50), Coconut (250), days were completed under the Commonwealth Drumstick (200), Guava (75), Lemon (450) and of Learning (COL) project activities. The topics Papaya (255) were distributed. covered ranged from general agricultural

84

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ practices in crop production, post harvest of brinjal shoot and fruit borers. These pest techniques, processing and value addition and control methods are new to the area and have marketing, along with ecofriendly techniques, elicited a positive response from the farmers. and included field visits and demonstration. Based on their feedback, an appropriate Training was imparted in allied activities such integrated package of practices (such as IPM) as pisiculture, backyard poultry rearing, bee is being developed. keeping, goat rearing, mushroom cultivation and Currently, there is one Computer Training Centre nursery for plantation crops. The impact of functioning in Nembera village; 25 members of Farmer’s Training initiated in June 2003, was the local SHGs are making use of this facility studied/ surveyed, covering 15 villages and the along with the nearby college and school going salient features of the study show that most of children. There is good scope and demand for the farmers are illiterate, though they may have setting up of such Computer Training Centres more than 4 acre. of land. They felt topics such at the project site and in upgrading these as soil testing, biofertilizers, cultivation of Centres into VKC. oilseeds, vegetables and fruit were helpful. They felt that activities such as bee keeping, Strengthening the grassroot institutions mushroom cultivation, and floriculture would help During the year, grassroot institutions worked them in getting extra income and the training in to define the path of development through dairy, poultry and fisheries is helping them. managing development programmes, Training on food preservation, apiary, mushroom conducting participatory research, introducing cultivation and poultry were found to be preferred innovative practices, and being involved in by the women trainees. networking, negotiation and policy advances. All the members of SHGs are participating Biological Software actively in the group activities like participatory The Centre is also making a conscious effort to research, community banking management, introduce good agricultural practices at the kitchen gardening, poultry, mushroom project site. During the year, as part of integrating cultivation, apiary, flower cultivation and small biological pest management at the project site, business. training and demonstration in the use of Under the various training programmes, 1,699 Trichogramma, Bracon, water and pheromone individuals (503 men and 1,196 women) were traps were taken up. Trichogramma (egg trained on different aspects. In the farmer to parasite) were introduced for control of paddy farmers learning programme, 210 men and stem borer, covering an area of 2 ha. Cocoons women were trained in a 10 day course on of Bracon brevicornis were released 3 times in agriculture. 42 coconut trees, showing pest attack by leaf eating caterpillars. Water traps and funnel Some of the training materials published include pheromone traps were demonstrated for control booklets on cultivation of rice and control of pests

85

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ and diseases; floriculture; fruit cultivation; oil the local people. Records pertaining to small seed cultivation; mushroom cultivation; apiary holders, organic certification and Internal Control and application of biofertilizers for increasing System (ICS) are being managed by the VKC. crop yield. These materials are in the local Organic farming: Considering the market language (Oriya). Video material on mushroom, advantage and traditional management apiary and vermicompost were prepared along systems, organic farming has been promoted with audio material on vegetables, paddy as a value addition strategy to enhance the cultivation and bee-keeping. income of small and marginal land holders. An Networking and Partnership agreement has been made among the International Institute for Market Ecology (IMO), The project has established a good rapport with certification agency, farmers’ group and MSSRF, all district and block functionaries, PRIs, local and after an internal inspection, 101 ha of land bodies, Agricultural University functionaries, was certified as organic in conversion from NGOs, banks and other projects of MSSRF. November 2003 and therefore the produce can The activities at the project site have also be certified as organic from November 2006; encouraged individuals from other institutions the remaining 119 ha were certified from to visit the site for gaining first hand information. November 2005. The products include coffee – The project activities also received media Arabica and Robusta, parchment and cherry, attention during this period. ETV-Oriya black pepper dry, lemon fresh and banana broadcast a feature on AqIIFS model at Manitiri green. Potential buyers are being identified and and Prasar Bharati (DD) broadcast a feature on plans to promote multiple market links both at loan fair and the impact of training. the regional and foreign markets is underway. Steps have been taken to further strengthen the 401.2.Hill Region ICS and facilitate the IMO certification process. 401.2.1 Thonimalai Good Agricultural Practices: Efforts have been Thonimalai and Pulayar Colony are remote taken to disseminate Good Agricultural villages in the forests on the western slopes of Practices (GAP), especially on agronomic Lower Palani hills. Pulayars and Mannadiyars management and pest and disease are the inhabitants of the region. The multi-tiered management, particularly for citrus bug and twig cropping system of coffee-lemon-pepper along die back, coffee-berry borer, pepper-wilt and with a few trees of jack/sweet orange/sour banana-stem weevil and bunchy top with the orange/banana/pomegranate, is their primary support of the Coffee Board, Horticultural source of livelihood. The VKC located at the College and Research Institute and State school building teaches functional literacy to Horticultural Department. Efforts have been taken adult learners as well as school children and to control pests and diseases. To promote the continues to cater to the information needs of use of organic seedlings, a local nursery was

86

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ established by one SHG which produced 600 Linkages were established with Keystone coffee seedlings. An attempt was made to Foundation for periodical field visits. produce lemon and pepper seedlings for the Application of Geographic Information System coming season under organic conditions. To (GIS) in farm and village level planning: The improve soil fertility and nutrient management, GIS tool was applied to develop a farm-level map an efficient composting system through of Thonimalai, covering 99 farmers and an area vermiculture and biodynamic formulations has of 220 ha, to plan for the optimal management been initiated. Land has been identified in the of natural resources at the farm level. Initially Thonimalai village to establish the community the GIS layers will be used to plan for field based units managed by the SHGs. The farmers specific water harvesting structures and were registered as a society as Thonimalai maintain organic farming certification details. Thottakkalai Vivasaikal Suyavudhavi Sangam Also, efforts have been made to develop a tool which manages the organic farming activity at kit on the preparation of field level maps using the village level. It has been decided to establish the GIS tool (See SPA 105.3). a production facility for biological products like Beauveria and Metarhyzium to cater to the local 401.3 Semi-Arid Region needs with the technical support of TNAU and 401.3.1 Kannivadi Coffee Board. This being the 9th year of operation and Apiculture – An Ecoenterprise: The Pulayars association of MSSRF in this region, it was who are traditional honey collectors, were proposed to initiate role change of the on-going mobilized into SHGs and trained on improved activities such as sustainable agriculture, apiculture techniques with the support of horizontal transfer of knowledge, diversification Keystone foundation, Kothagiri, The Nilgiris. The of livelihoods through promoting ecoenterprises TN Adidravidar Development Corporation and application of modern ICT for promoting (THADCO) extended credit support to establish literacy and rural development. It was done by the infrastructure and training. Each of the group institutionalising the activities through two major members manages three production units. With grassroot institutions functioning in the site. the help of traditional knowledge of the Much focus was given to increasing the capacity movement of bees and the knowledge acquired of the grassroot institutions through need based during the training, the group members identified training and capacity building to prepare them the wild bee colonies in the forest, collected for role change. Also, efforts were taken to and filled the hives. The domestication process initiate self-sustainability of the organizations took a long time. However, this year, the yield on institutional and financial perspectives. increased from 35 to nearly 60 %. Nearly Grassroot Institutions 35 % of the hives have reached the honey extraction stage. The members were trained on Kulumai, a federation of around 145 SHGs, and hygienic extraction and handling processes. Reddiyarchatram Seed Growers Association

87

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

(RSGA), a farmers’ association with 90 groups. Three printed materials, four CDs and members, are the two grassroot level institutions two audio cassettes were prepared with the functioning at Kannivadi. During the year two technical support of MSSRF which was also more organizations namely Thonimalai involved in facilitating informal Open and Thottakkalai Vivasaikal Suyavudhavi Sangam Distance Learning among farmer and agricultural and Oddanchatram Vegetable Traders Welfare labour groups. Association were formed and registered under the Societies Act. Need based training and The association has been managing the website capacity building on institutional and financial www.oddanchatrammarket.com in close management were made available with the collaboration with the market commission support of external agencies. agents. An export group, has been registered under the Societies Act with the broader Farmers Association: The farmers’ association objective of strengthening formal farmer-trader continued its efforts to facilitate horizontal forward linkages in the region. The market transfer of knowledge and carried out 1,200 commission agents were trained in the export trainee days. The directory of local resource logistics and identification of potential buyers. persons was prepared, indicating their core The group received the APEDA registration and expertise. The association is slowly emerging is linked with TANSTIA – FNF Service Centre as a local resource centre. It has established a (TFSC) for a six month period. TFSC will provide cotton Farmers Field School with the handholding support on export, especially on collaboration of the Department of Agriculture the identification of potential buyers, export and National Watershed Development Agency pricing and logistic consultancy. in Rainfed Areas and extended its support for mobilizing around 120 ha under sugarcane With reference to the medium range weather contract farming with a processing mill in the and seasonal climate forecasting, the Centre region. Small-scale experiments and field is recognized as an Agricultural Field demonstrations were carried out on introducing Measurement Unit by the Indian Meteorological alternative crops for the region such as hybrid Department. The Centre started issuing agro castor and coleus. The initial performances of advisories through the network of Knowledge the crops were encouraging. Technologies such Centres twice a week based on the local as SRI and Bt Cotton varieties, long stapled cropping systems. Suvin cotton species and low cost machines for processing castor were demonstrated by the For the effective dissemination of locale specific organization to their members. To strengthen dynamic information, a detailed content its activities seven thematic groups were analyzis was carried out for frequently asked proposed of which 4 groups have been formed. questions. This indicates that more importance Strategies were evolved to bring microcredit was given to pest management practices and facility to the members through these thematic season-based agricultural practices focusing on

88

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ the crops suitable for that period/ region as well dairy. It is in the process of expanding its as information on agricultural inputs. support services to the group members and has started offering business development services Kulumai- SHG Federation: The Federation such as technology, credit and market continued its efforts to strengthen its community assistance. To achieve institutional and financial banking operations. Fifteen new groups were sustainability and to support the group formed during the year, taking the total to 145 members, it has started retail trade in animal with an annual turnover of Rs 2.3 crores. The feed with the support of a leading animal feed repayment rate is more than 90 % and during manufacturing company. External auditing has the year it mobilized around Rs 41,35,000, of been initiated to establish transparency in which Rs 29,50,000 was through commercial financial transactions. banks and Rs 11,85,000 from government departments. The composition of the groups Community Informatics: VRCs continued their indicates that nearly 70.5 % of them belong to efforts in providing need based locale-specific Backward Communities. Animators were information on commodity-based market trends, sensitized to put more effort in targeting the government schemes, educational socially disadvantaged groups. The utilization opportunities, simple remedies based on locally pattern of microcredit shows that nearly 57 % available medicinal herbs, agriculture, pest of the members used credit support to management and weather forecast to the local strengthen/initiate livelihood activities like men and women. Seven VRCs, including a hub agriculture, livestock, petty business and centre are functioning in this region. Apart from microenterprises; 6.2 % is used for educational providing need-based information, five centres purpose; 10.3 % on medical expenses; 9.5 % are facilitating functional literacy and livelihood on festivals and 7.6 % on housing. training, one centre is involved in managing the weather station and one manages the market Need based training and capacity building website. The hub of the VRCs, located at programmes were carried out for SHG leaders. Kannivadi, continues to be an active point for Nearly 300 trainee days were organized on SHG information access and computer-based management and microcredit. Efforts also training on sustainable agriculture. continued on the accounts management system using special software and animators Ecoenterprises for livelihood Security were trained on the operation. Micro-insurance The Reddiarchattram Union is unique in that programmes were initiated in addition to credit initiatives in the last few years have seen the and saving services. establishment of 5 units which cater directly to Kulumai facilitates group dairy farming among the promotion of good agricultural practices, SHG members and is slowly increasing its waste value addition and introduction of strength towards evolving into a local cooperative livestock.

89

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Banana paper unit: Special initiatives were taken Pseudomonas fluorescens unit: The unit refined to revamp the unit by enhancing its the production process and reduced the infrastructure, especially the hydraulic press production cost by 35 % of the estimated cost, and the drying yard. Need based training and which is 10 % higher than the previous year. capacity building programmes were organized The unit applied for registration under the Central for machinery management, paper and board Insecticides Act, 1971. It produced 3 tonnes of preparation of various thickness and colour the product, which helped to generate 600 days combinations. The group members participated of employment. The group has entered into an in district, state and national level exhibitions agreement with a market dealer and is slowly and shared their experiences with bank officials, expanding its local network. The group members NGOs, farmers’ associations and develop- trained 24 members of the SHGs from mental workers. The unit generated 400 labour Pondicherry and Kannivadi in the production of days and produced new products like herbarium other biological products. sheets and water absorbing sheets, based on the market demand. Efforts have been taken to Trichogramma biopesticide production: Two identify market links. SHGs in Kannivadi region are producing and Trichoderma viride unit: The unit stabilized the collectively marketing the pesticide both at the production technique and generated nearly 470 local level as well as to a sugarcane factory. labour days, produced 2.5 tonnes and The groups generated nearly 750 labour days distributed nearly 8 % of the production to local and produced 6,500 cc, which could cover nearly farmers. The production and labour days 450 ha. Selected NGOs in TN and AP received generated were slightly lower than the previous three days intensive hands-on training on the year, mainly due to the difficulty in market links. production technology, business plan Efforts have been taken to increase the local preparation and marketing strategies from the trade by contacting the plantation estates in group members. Constraints in the production nearby Kodaikanal hills as well as other process like the incidence of Tribolium (an potential buyers in the region. Now the group insect pest, which causes damage at the time has entered into an agreement with two more of web formation of Corcyra) and a fungal marketing agencies and created local demand disease are being managed through integrated through farmers’ network in different villages of methods. This year Bracon, an insect pest the region. Hilly ecosystem based local strains attack, was encountered. The members were of Trichoderma were bought and multiplied to trained on the identification, precautionary meet the local demand, which increased the measures and management methods. Efforts farmer’s confidence. The unit is acting as a have been made to increase the scale of training centre and provided hands-on training production in each of the units in consultation to NGO workers both in TN and AP as well as to the trainers of KVK. with the sugarcane industry.

90

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Production of low cost biofertilizers: Kaliyammal field level, a unit was established by agricultural women SHG, Kappliyapatti was selected and women labourers in tsunami affected regions trained on the production process. But due to of Nagapattinam district. the lack of cooperation among the members Credit linked Biovillage – Integrated Scientific as well as constraints in identifying a suitable Dairy: Sixty-five members came together and place, it was decided to select another group. 59 of them received credit support to purchase Jhansirani women SHG was selected and animals. Kulumai purchases the milk from the hands-on training was organized at Chennai for members and has established multiple market four members. The unit was established in links with three agencies in the region. In February 2006 and the production process addition, it arranges need-based training. stabilised. The members are landless Programmes on animal identification while agricultural labourers belonging to economically buying, insurance, integrated dairy farming and disadvantaged groups. Subsequently exposure disease management were organized for the visits were organized to a low cost members. Efforts were made to introduce pseudomonas production unit, successfully improved fodder sources; bio gas and managed by a woman SHG in a nearby village vermicompost units were established at the as well as to a production facility based at household level. Chennai. It gave them confidence to take up the enterprise. An orientation workshop was also Sesame Seed Village organized at the group level and a business plan The Sesame Village Project was taken up as was prepared. Efforts were taken to establish an explorative project in August 2004. The market linkage for the 300 kg produced, using project envisages the promotion of an integrated vermicompost as carrier material. Field level management approach through community intensive training was started on participation to create a sesame seed village phosphobacteria production. The process of for the production of quality seeds. Linkages demystification using cost effective chemicals are being established with industries and was initiated. (See SPA 205.3) institutions using appropriate technologies for Low cost decentralized production of Arbuscular the improvement of sesame production in the Mycorrhiza (AM): Puduvai women SHG of farmers field through a Public-Private Partnership Pudupatti have started the production unit. mode with Idhayam Group, Virudhunagar. The Market linkage was identified and the group mode adopted for the implementation of the marketed nearly 400 kg of VAM and generated project is extension service for the farmers. The nearly 50 labour days. The group prepared a project is creating awareness of good cultivation business plan and production facility of 3 tonnes practices and management. The project is also was established in the leased land. The facilitating mechanisms for mitigating the members entered into an agreement with a constraints, e.g. availability of quality seeds. market agency and received credit support from The project area is distributed in three districts the Federation. Based on the success at the of TN, namely Namakkal, Erode and Salem,

91

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ with an outreach programme extending to in initiating and planning income generating Villupuram district. 172 farmers (168 men and activities, minimizing the risk involved, and 4 women) participated in the programme as core increasing the marketing linkages. trainees, covering 23 villages and 464 acres Database on SHGs formed under under sesame cultivation, of which 89 acres Ecotechnology Centre were rainfed. 274 trainee days (270 men and 4 women) have been completed under this It was decided that the Centre should have a programme. The average yield increase among common database of the institutions set up over the participating farmers against the district the years which should be easily available. A average is estimated as 32 % under irrigated prescribed format was developed in consultation and 65 % under rainfed conditions. The cost- with all the people concerned and desirable benefit ratios for individual farmers range parameters for inclusion in the database were between 1.26 to 4.09 and as this is market prepared. determined, the project is looking into the The broad objective of the exercise was to aspects of reducing the input cost through compile a database on the existing SHGs, with efficient management practices. To provide details of their current status in terms of profile, quality certified seeds to the farmers, the project functioning, financial transactions, training, and has taken up seed multiplication at Poolampatti income generating activities. The methodology (Salem district) and Tottipalayam (Namakkal adopted included designing the questionnaire, district) field centres, covering an area of 6.5 discussing with the staff, BVC and Kulumai acres, with an average seed yield of 600 kg/ members, and conducting a pilot study in both acre. The project is currently evolving strategies sites. The survey was completed in December to create a better delivery system in reaching 2005 and February 2006 and the outcome of out to farmers, extending its operational area the survey shared with BVC members of and documenting the process of farmer- Pondicherry and Kulumai. Similar activities have participatory seed production. also been completed at Chidambaram and Kendrapara (Table 4.3). Community Banking, Micro-credit and Enterprise Development Microcredit and enterprise development This is a very important component of the This year the entire focus has been in three activities in enhancing livelihood options. This areas: rebuilding lost livelihoods of tsunami year, the focus was to understand our SHGS affected victims, setting up enterprises in areas better and so a study was initiated to set up a where Village Knowledge Centres have been database. Also, the community-banking set up by MSSRF, and including other sites component has been strengthened at all the where MSSRF has ongoing projects. Thus, 28 sites. Enterprise development and marketing income generating activities were started with have received greater focus, leading to interest free loans amounting to Rs 26 lakhs. streamlining of guiding principles for the SHGs Out of this, Rs 12 lakhs was given to tsunami

92

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Table 4. 3 Progress of SHGs Training during 2005 – 2006 MSSRF conducted for the first time, on request, Site SHGs formed Cumulative no. of a 12-day training program for graduate students during SHGs as on of Temple University, Tokyo on “The role of 2005-2006 March 2006 NGOs in Rural Development”. This was made Pondicherry 43 247 possible through the facilitation provided by the Kannivadi 15 149 Friends of MSSRF, Japan. The objectives of the Chidambaram 19 35 training were to expose students to science Kendrapara 5 38 based approach to rural development; to prepare

Total 82 469 the students to work for NGOs; to critically examine the development structure and role of NGOs and to introduce students to field work. affected women SHGs for restarting their The methodology adopted was a travelling livelihood activities. Thirty SHGs consisting of workshop mode. The course content comprised 400 families were supported through micro- classroom lectures and discussions, field visits, credit in Nagercoil, Chidambaram and guest lectures by experts/NGOs in the field, Kakinada; 12 micro credit banks have been interaction with communities and grassroot initiated by the Friends of MSSRF, Japan and institutions and preparation of a case study. On 16 micro credit banks by Friends of MSSRF, the final day of the program the students made Australia. a presentation with valuable suggestions on what As part of the withdrawal strategy and role these programs meant for the rural poor as they change in Kannivadi and in our endeavour to saw it. strengthen the grassroot Federation Kulumai, State Development Report of Pondicherry a loan of Rs 5 lakhs was given to the Federation. They, in turn will give loans to SHGs to start MSSRF has been involved in the preparation of small income generating activities. a State Development Report of Pondicherry for the Planning Commission, Government of India. Training and capacity building on enterprise The other partners in the effort are Madras initiation and development for SHGs and local Institute of Development Studies (MIDS) and NGOs forms an important component for each Institute for Financial Management and enterprise that is being initiated. To ensure that Research (IFMR). MSSRF is preparing chapters the SHGs starting new enterprises have on Agriculture and Rural Development; Health sufficient exposure and knowledge on all the and Social Security. Trend analyzis is being four components – technology, credit, market carried out, based on the data collected (from and management, a two-day training 1980s onwards) from different published sources programme on how to develop a micro-plan and covering the four regions Mahe, Yanam, Karaikal to write a bankable proposal was given to SHG and Pondicherry. Regionwise meetings were members at different project sites. organized and discussions held with the line

93

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ department heads. The draft report was malformed moths (83-100 %). Exposure of submitted to the Planning Commission and H.armigera to all fractions from M. dubia comments were received. The process of resulted in 100 % larval mortality. improving the chapters is going on. It is planned to get expert opinions for each of the chapters Another serious agricultural pest Spodoptera and submit them shortly. litura was also tested. Maximum inhibition of S. litura growth was observed in A. mexicana 401.4 Chennai fraction 1, hence there was no pupation. The Centre at Chennai concentrates on research However, 13 % pupation was recorded in fraction in exploring less utilised indigenous plants, 2, compared to control (96 % pupation). The conducts frequent training for SHGs and larval duration was extended in fraction 4 treated harnesses beneficial organisms for IPM and larvae (6.3 days) compared to untreated larvae increasing crop productivity. (4.6 days). Further, a drastic reduction in pupal The major activities carried out by the laboratory weight was recorded in all the treatments. It were in the area of bioassay of a few botanicals ranged from 129-284 mg (normal control was (crude extracts and fractions) against 304 mg), with 248 mg in fraction 5. Maximum Helicoverpa armigera and determination of malformed moth emergence was recorded in antimicrobial properties against human fraction 3 (92 %), followed by fraction 5 (89 %) pathogens, biodegradation of endosulfan, field as against the untreated ones (3 %). trials, training and support. Antimicrobial activity was studied against 6 Fractions of Argemone mexicana, Cipadessa human pathogens using different plants viz., baccifera and Melia dubia were tested against Helicoverpa armigera for determining distinct A. mexicana, C. baccifera, C. dentata, bioassay properties. Fractions (1 and 4) from D. angustifolia and M. dubia. The results A. mexicana, were able to reduce the pupation revealed that test pathogens were highly to the maximum (nil pupation) as against susceptible to hexane and chloroform extracts 100 % pupation in untreated larvae. The larval of D. angustifolia and C. baccifera. Among all duration was prolonged in fraction 2 (14.7 days) the extracts of A.mexicana, chloroform extract compared to untreated larvae (6.6 days) and was found to be effective against most human nearly 8 % were malformed. pathogens. The crude extracts were further Fractions of petroleum ether extract of C. fractionated and tested against pathogens. baccifera, were able to inhibit larval growth Fraction 1 of A. mexicana chloroform extract particularly in the first fraction. Except fraction showed maximum growth inhibition of 3, all other treatments resulted in less than 50 Micrococcus sp. and Vibrio cholerae (6 mm). % pupation as against 100 % pupation in D.angustifolia hexane fraction 2 at 10 % untreated larvae. Further, a drastic reduction in concentration inhibited the growth of Vibrio pupal weight from 251 mg to 150 mg (normal cholerae and Salmonella typhi (7 mm). Shigella control was 306 mg) was recorded in all the flexineri was highly susceptible to 5 % and treatments, which subsequently resulted in 10 % of Clausena hexane fraction 2 (8 mm).

94

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Among the fractions of Cipedessa (chloroform), Pseudomonas flouresence and P6 as fraction 4 had more inhibitory activity against Xanthomonas sp. Pseudomonas aeruginosa, Micrococcus,Vibrio cholerae, Salmonella and Shigella. Field Trials Biodegradation of endosulfan using tolerant Two field trials against H. armigera on chickpea bacteria was carried out. Seven different and pigeonpea were conducted at Samiyarpatti bacterial colonies were isolated from the soil and Palaniyur. Plant extract was effective in amended with pesticides; these strains were controlling the insect population. Dodonaea tested for their tolerance to different alone, and when combined with Trichogramma concentrations of insecticide, (endosulfan, or NPV had the similar effect. quinalphos, cypermethrin, carbofuran, Training and Technical Support acephate) herbicides (butachlor, metsulfron metyl and chlorimuron ethyl) and fungicides Need-based technical support to already (kasugamycin, carbendazim). P1, P2 and P6 established Trichogramma units in the field sites strains were tolerant to endosulfan and and in-depth training to newly formed SHGs on quinalphos up to 200 ml. P1 and P6 were able IPM, and Trichogramma (314 trainee days) and to tolerate 200 ml of butachlor and P1 alone oyster mushroom (360 trainee days) were was able to resist 200 ml of carbendazim. The organized in the coastal villages of Pondicherry. tolerant strains were characterised and identified using biochemical tests. The tolerant strain P1 The training programmes conducted by the was identified as Pseudomonas sp, P2 as centre are listed in Table 4.4

Table 4.4 Training programmes held at the JRD Tata Ecotechnology Centre during 2005 - 2006

Sl. No. Details Trainee Days Men Women Total 1. Functional literacy 10,130 13,774 23,904 2. Farmer to farmer training 3,875 1,465 5,340 3. Skill enhancement for income generating activities 553 3,007 3,560 4. Capacity building, leadership & management of grassroot institutions 788 2,558 3,346 5. Integrated cultivation and farm management 881 615 1,496 6. Post harvest & value addition 0 110 110 7. Computer literacy and GIS application 100 378 478 8. Health and hygiene 50 143 193 9. Sponsored exposure visits from other organizations to the field sites * 225 312 537 Total 16,602 22,362 38,964 * In addition, 1,530 school students also visited the field sites.

95

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

A zero energy gravitational ground level drip Sub Programme Area 402 irrigation system was introduced to promote cultivation of vegetables. This saved about Sustainable Management of 40 % irrigation water, besides improving the Natural Resources for Food productivity and quality of the vegetables. Security and Environmental Soil: Surface hardening and inadequate Quality phosphorus availability due to excessive presence of iron and aluminium oxides were This project was initiated in technical identified as major constraints in red soils. A collaboration with Ohio State University, Ohio, low-cost, fast-composting technique was USA from 2001-2002 with generous financial introduced, using locally available crop residues assistance from Sir Dorabji Tata Trust in three and press mud from the nearby sugar factory major soil sites of India: the red soils of as the base. The compost was enriched with Pudukottai and Dindigul districts in TN, the rock phosphate and bio-fertilizers. Application alluvial soils of Nawashahr and Faridkot districts of this biocompost in the last ploughing in the Punjab, and the black soils of Narsinghpur improved the crop productivity significantly and Hoshangabad districts of Madhya Pradesh. without increasing the cost of inputs too much. This year (2005-2006) being the last year of the Water conservation in the soil profile has also project, the results are summarized for the improved. project period as a whole. During the year, the application of rice bran to 402.1 Pudukottai, TN the soil at the rate of 1 mt per acre was tried in Water: Channels were formed from the the farmers’ fields at Maringipatti and participating farmers’ fields to carry the excess Ariyamuthupatti. The yield of groundnut was 423 rainwater received during the monsoon season kg per acre in the control plot as against 708 to the village tank for storage, and use. This kg per acre in the experimental plot. year, due to the high rainfall of 1,323 mm, the Cropping Patterns: In the red soil regions of TN, excess run off water was effectively harvested single cropping is the normal practice under and the farmers were able to bring about 15 acres of additional land under irrigation and rainfed conditions. Double cropping is possible cultivate short duration vegetables and greens. in the years of normal rainfall, with short- This also improved the water level in the open duration pulses like green gram/cowpea in the wells in the area. Summer ploughing opened southwest monsoon season and millets in the up the soil and facilitated infiltration of rainwater. northeast monsoon season. Intercropping of Formation of tied ridges or ridges and furrows green gram/cowpea/groundnut in the long- before the start of the rains helped in early duration red gram is a viable alternative, with sowing and conserving rainwater in the fields. high economic returns. New varieties both of

96

ECOTECHNOLOGY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ red gram and green gram performed very well Soil: Due to intensive cultivation, organic matter under rainfed conditions and are gaining content has been declining and multiple nutrient popularity among the farmers. As a long-term deficiencies are becoming common in the measure, dryland horticulture was taken up and alluvial soils. Burning of rice straw before wheat saplings of fruit trees such as mango and sapota sowing is a common practice. This not only have been planted; intercropping of annual crops deprives the soil of the much-needed organic is being taken up until the canopies of the fruit matter but also causes environmental pollution. trees cover the ground area. To mitigate this problem, incorporation of rice straw before wheat sowing was attempted. Enhancement of Livelihood Opportunities: Though there was increase in organic matter, it Women in the project villages were organized is too early to come to a conclusion. There was into SHGs. Production of the biopesticide no perceptible increase in wheat yield. This Trichogramma was identified as a viable micro practice has to be continued to assess any enterprise for the area as the nearby sugar significant improvement in soil fertility and crop factory was prepared to buy the entire productivity. The main constraint in adopting the production. Five SHGs comprising 76 women practice seems to be the non-availability of were able to produce 26,993 Tricho cards and suitable machinery for incorporation of rice earned Rs 5.19 lakhs. Other micro enterprises straw. such as vermicompost production and turkey rearing are also being taken up by some SHG Cropping Patterns: To replace the unsustainable members. rice-wheat cropping system, demonstrations 402.2 Punjab Agricultural University, with various alternate cropping systems were Ludhiana laid out in farmers’ fields. Cotton-wheat, cotton- chickpea, maize-wheat, and maize-gobi/sarson Water: The intensive rice-wheat cropping performed well, with much less demand on system followed by the Punjab farmers water and nutrients. Intercropping of gobi/sarson consumes large amounts of water, energy and in sugarcane proved to be economical. Agro- nutrients. The system is becoming forestry with poplar was attempted with wheat unsustainable due to excessive exploitation of as intercrop, and initial results show promise. water. Hence attempts were made to test Alternate cropping system studies have to be alternate cropping systems that would use less continued to demonstrate their economic water. Upland crops such as cotton and maize viability and to observe their effect on soil fertility. in the place of lowland rice in the kharif season saved substantial quantities of water and gave Nineteen training sessions were organized for high productivity. Drip irrigation was introduced farmers in agriculture and related activities. for vegetable crops, considerably increasing the They were taken to the university centres, efficient use of water. production units, and marketing yards.

97

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

402.3 Jawaharlal Nehru Krishi Vishwa application of the recommended fertilizers and Vidyalaya, Jabalpur farmyard manure.

Water: In the State of Madhya Pradesh in central Cropping Patterns: With good land management India, water-logging is common in the kharif systems such as raised and sunken beds, and season due to high rainfall and poor infiltration ridges and furrows, double cropping such as rate of the heavy black soil. As a result, many paddy and soybean-gram/wheat was found to farmers leave the lands fallow during kharif and be profitable as water-logging could be raise one crop in the rabi season with the minimized and excess water could be stored residual moisture in the soil profile. In the for future use. Wheat and gram were sown in Narsinghpur project site, the system of raised the rabi season after the fish harvest. Fish and sunken beds drained the excess water and culture was introduced during kharif and three reduced water-logging. Farmers could raise two species of fish were stocked in the field. crops in a year. In Hoshangabad, ridges and furrows provided adequate drainage, facilitating Enhancement of Livelihood Opportunities: Many farmers to raise a crop in kharif. Wherever water farmers have started production of simple stagnated, fish culture was introduced. In areas chulas, low cost latrines, and biopesticides and where rice is grown, irrigation only at critical compost, thus enhancing their income. stages of crop growth reduced the water Twenty-eight training programmes, 14 fairs and requirement substantially without reducing the 10 field days were organized. Various land yield. management systems, compost making and Soil: Integrated plant nutrient supply, involving crop management activities formed the major the use of locally made compost (farm yard themes of training. Field visits were arranged manure), bio fertilizers improved the productivity for farmers to exchange information on their of the crops and maintained the soil fertility at experiences. fairly high levels. A bulletin explaining the natural resource This year’s trials on wheat in three villages management problems, the interventions made namely, Dangidhana, Murlipondi and Karakbel and the achievements during the project period of Narsinghpur district, also demonstrated the at the three sites was brought out in November increased yield of 6 tons/ha from the combined 2005.

98 Programme Area 500

Food Security

The corpus stock of grain in the community grain bank at Jeypore has gone up to 15,410 kg. The TRC on Food Security supported by WFP was formally inaugurated in Jan 2005. The Food Security Atlas of Cambodia has been completed. A three credit course on ‘Hunger, Famine and Food Security’ for the UN University of Peace in Costa Rica was developed.

501 B.V.Rao Centre for Sustainable Food Security...... 100

502 Ford Foundation Chair for Women and Sustainable Food Security...... 105

503 The Sustainability of Farming Systems...... 108

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

and Michashola in Kalahandi district. In all, Sub Programme Area 500 there are 377 CFB member households. Food Security The corpus stock of grain in the CFBs has grown from 5,509 kg at the time of initiation in August The work on food security at the Foundation is 2002 to 15,410 kg as of January 2006 through built around the flagship programme of Mission interest collection and annual contributions of 2007: A Hunger Free India. members. During the period of report, a total of 167 households availed of 3,507 kg of foodgrain MSSRF’s work in the area of food security loan from CFBs. consists of several strands. The Ford Chair focuses on gender issues in food security. The Role of MSSRF Technical Resource Centre (TRC) on Food With three full cycles of CFB operation complete Security, supported by the World Food and the fourth in progress, the role of MSSRF Programme, seeks to address all aspects of has gradually changed from that of guide to Food and Nutrition Security (FANS). advisor and it is interesting to observe the group dynamics and the synergies at play for cohesive action. For instance, while the total foodgrain Sub Programme Area 501 corpus has grown, not all villages are regular in making annual voluntary contributions. But B.V. Rao Centre for Sustainable Maliguda village with 35 households has been Food Security regular in the annual contribution by members, the amount varying depending on the yield and The TRC functions as part of the B.V.Rao Centre consensus decision by the members; starting for Sustainable Food Security, which is with an initial corpus of 697 kg in August 2002, implementing projects in the areas of the year-wise contribution of foodgrain in community food and feed banks in Jeypore in Maliguda (in kilograms) has been 5,10, 2,899 Orissa and Namakkal district in Tamil Nadu. and 1,750 during 2003, 2004 and 2005 respectively. The foodgrain corpus in Maliguda 501.1 Community Food and Feed grain Banks stood at 5,423 kg in January 2006, including Jeypore (Orissa) an interest component of 367 kg. Surplus The Community Foodgrain Bank (CFBs) foodgrain after lending has been sold in the market and the money deposited in the village initiative, started in mid 2002, is now operating development fund. in 8 project villages under the Jeypore Site office. The villages are Maliguda, Kanjei, Support is provided to the handicapped, Bedhaguda, Chemiyaguda, Balia, Badapar and destitute and elderly by way of free grain or Bisoiput, all in Jeypore block of Koraput district, interest-free loans of grain on a case-by-case

100

FOOD SECURITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ basis in many of the villages. For instance, 120 The VDF supports villagers in times of need kg of rice was distributed free among 8 people and has helped lower dependence on above 65 years of age in Balia village in 2005. moneylenders. The period of loan and the rate of interest depend on the purpose for which the New Initiatives loan is taken. Moving forward from addressing just food An initiative to link the CFB with the Public scarcity, several local initiatives have sought to Distribution System PDS was started in the address livelihood security and improve quality village of Mitchashola in November 2005. This of life. While essentially small and micro in was felt to be necessary as the nearest Fair terms of scale, these initiatives may be seen Price Shop (FPS) is very far from the village as the first step to sustainable development. and the residents of the village are unable to In all villages, there is a Village Development purchase their quota of PDS supplies in one lot Committee (VDC) and a Village Development because of lack of purchasing power. An SHG Fund (VDF). Taking all the 8 VDFs together, in the village has got a license to run a ration the total amount in the VDFs was Rs1,06,000 shop. They have raised funds for lifting kerosene as on Jan’06. stock and selling it to the villagers. Means are The VDF has been put to innovative and locally being explored to get funds to lift the rice stock. relevant uses. In Maliguda, Rs 3,200 realised Self Help Groups from selling 8 quintals of paddy, was utilized for renovation of the water harvesting structure, As on date, 19 SHGs are functioning in the 8 completion of the community bathroom, and project villages. These SHGs availed of a bank purchase of tarpaulin to sit on during community loan of Rs 3.29 lakhs, repaid Rs 1.81 lakhs, meetings. The Badapar VDC used Rs 2,500 saved Rs 1.24 lakhs and have now an from the VDF to purchase utensils, for hiring outstanding amount of only Rs 1.48 lakhs to out to other villages for catering purposes. There be repaid to the bank. is no charge for the members of the same The SHGs and SHG members have moved on village. In Chhemiaguda village, 1 ha of land from thrift to small micro-enterprise activities belonging to a landowner in a neighbouring for additional income generation. Some of the village has been given to the VDC for cultivation activities include: making value added products for Rs 3,000. In Michashola village, Rs 2,285 from millet, rice and paddy; vegetable cultivation; from the VDF was incurred as legal expense fish cultivation; goat rearing; and vermi- for recovering 1 ha of village common land composting. illegally occupied by a landlord from an adjacent village. This land is now in the Committee’s name Networking and is under community farming. Another Linkage has been established with the residual Rs 620 was used for community fish farming. literacy campaign for all age groups

101

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ implemented by the Zilla Sakshrata Samiti replication of the activity in their villages with (ZSS) for achieving universal literacy in 7 project support from World Vision. villages. A total of 120 farmers and volunteers There has been 100 % food grain repayment in led by Orissa Tribal Empowerment and the 2 CFBs. Needy, non-food bank members Livelihood Programme (OTELP) and by some are also approaching the CFB for food grain NGOs (AKUSS, ORRISSA, NEED) were given assistance. A survey in the two villages reveals orientation by the project personnel on food that migration by members of CFB member security approaches. In the light of this households has fallen. This has also helped experience, NABARD, Kalahandi has promoted promote school enrolment. A detailed study of three area level grain banks through a local these developments has to be undertaken. NGO, Antyodaya, based on the CFB model. World Vision has taken a policy-level decision Namakkal, Tamil Nadu Community to promote CFBs in all its project areas. Foodgrain Banks in Kalrayan Hills A zero energy cool chamber linked to a vegetable The project has been in operation since July retail shop has been facilitated in Melvazhapady 2003. Operating in collaboration with World village and is being managed by a SHG. Aided Vision, the NGO already working in the area, by good monsoon and following training in millet MSSRF helped to set up CFBs in two villages cultivation and distribution of seeds through – Melvazhapadi and Thalvellar. The CFBs are TNAU, about additional 28 ha were brought managed by women’s SHGs - 30 members from under millet cultivation in 2005. Following a tie up with Rural Innovations Network, the purchase 2 SHGs in Melvazhapady and 12 from one in and distribution of 200 insect traps worth Thalvellar. The initial corpus grain support was Rs 18,000 to 100 women SHG members, to from MSSRF. In each village, World Vision promote grain storage was facilitated. helped to construct a storehouse for a CFB of 12-ton capacity at a cost of Rs 2 lakhs. The A baseline survey to collect village-level SHG members contributed foodgrain to the information was completed in 8 villages in corpus stock and labour for storehouse Vellimalai Block in preparation for setting up a construction. At a camp conducted by the VKC with help from the Informatics Division at Villupuram District Collector in a neighbouring MSSRF. A draft Household Entitlement Card village in mid-2005, further corpus grain support (HEC) listing details of government schemes in was promised under the Government Grain Bank the State has been prepared in Tamil. This is to scheme. This has been received recently. be finalized and printed for dissemination at all Similar support has been promised for other our field sites in the State through the VKCs. CFBs that may be set up. Community Feedgrain Banks

SHG members from 6 neighbouring villages who The Community Feedgrain Bank (CFGB) has visited the CFB villages, have now initiated been operating through two farmers’ clubs, one

102

FOOD SECURITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ in Varagur, Namakkal district and the other in enterprise activities such as feed preparation Veerabhayangaram, Villupuram district. and seed production.

Carrying forward the efforts to increase maize Training, Networking and Capacity Building cultivation in the region, a participatory Networking was carried on with the Agriculture demonstration trial on short duration maize Department to conduct a Mobile Soil Health varieties (Diara & Sakthi) was conducted. The Camp in Veerabhayangaram. Animal health area under maize has increased by nearly 1,000 camps were held in both villages by the Animal acres in the last season. Nearly 250 tonnes of Husbandry Department on our initiative. A new quality maize grain were marketed directly by Farmers’ Club was formed in Pakkampadi, the farmers’ club to poultry units through the Villupuram District in Feb 2006. They wish to CFGB. Eight resource persons from the project replicate the CFGB model. villages were selected to undergo training as village animal healthcare workers at KVK, Initiatives in Ladakh Veterinary College, Namakkal. With the help of Sir Dorabji Tata Trust, funding was provided to the Departments of Horticulture A Computer Information Centre was inaugurated in Leh and Kargil to provide on-site training to at Varagur in Namakkal in December 2005. The farmers in fruit processing and post harvest Informatics division at MSSRF has been technologies. Two such programmes were requested to make it a VKC. Required baseline conducted in Leh in October 2005 and 33 information has been submitted for both Varagur farmers underwent training. Nine camps were and Veerabhayangaram villages. conducted in six villages of Kargil district, with There are 6 SHGs in Varagur and 4 in thrust on osmotic dehydrarion of apricot fruits. Veerabhayangaram. Of these, 4 in Varagur and The Departments of Horticulture of Leh and 3 in Veerabhayangaram consist solely of Kargil have now sought assistance to establish landless women. There is an all-male SHG in high-tech mini-solar apricot drier units. each village. Two of the SHGs were formed this 501.2 The Technical Resource Centre on Food year. An Integrated Farmers’ Club-SHG Security Vermicomposting model was inaugurated at Varagur in March 2006. The TRC on Food Security, supported by the WFP, was inaugurated in January 2005. MSSRF played a facilitator role in helping 9 However, it became operational effectively only farmers’ club members to install micro-irrigation in June 2005.Over the twelve months from June systems worth Rs 2,88,000, with assistance 2005, the TRC has guided the work of the from a bank and a government subsidy of community food and feed banks in Jeypore and Rs 72,000 at Veerabhayangaram. Loans to the Namakkal. It has also developed an action plan extent of Rs 5,00,000 were received by SHGs to be implemented over the three-year period, and Varagur Farmers’ Club from banks for micro- 2005-2008.

103

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Based on the experience in initiating, operating Food Security Documentation and managing of CFBs by the community, a An important task of the TRC is to update the Training Manual has been prepared for setting MSSRF-WFP work on documenting food up of CFBs at the community level. The Manual security issues through Atlases and Reports. was discussed at a workshop in Jeypore on 6 During the year, the major effort was on updating October, 2005 with other NGOs, bankers and government functionaries. It has since been of the Food Insecurity Atlas of Rural India. A finalised for printing. The OTELP is using the meeting of the Technical Advisory Group (TAG) manual for the promotion of CFBs in Laxmipur was held in Delhi on 28 March, 2006, to obtain Block of Koraput district. A draft translation of valuable inputs in this regard from expert the Training Manual in Tamil has been prepared, academicians, policy makers and national and and will be printed after revisions. international development partners. It was decided that the document, to be brought out The process of setting up and managing CFBs before the end of 2006, would serve as a Report in Orissa and in TN is being documented. An on the State of Food Insecurity in Rural India. evaluation of the CFB project villages is currently Besides working out various indicators as well in progress. as an overall index of food insecurity, using the A workshop to discuss the need for a Food most recent data available, the Report would Guarantee Bill was organized in June 2005 with focus on a chosen theme related to food support from the NCF. The recommendations security. The theme of the public food delivery of the workshop were submitted to the NCF and systems, including the PDS, the Mid Day Meals have found a place in the second report scheme (MDM) and the Integrated Child submitted by the NCF to the Govt of India in Development Services (ICDS), has been August 2005. chosen. The Report would deal primarily with The TRC worked with the Uttara Devi Resource chronic food insecurity. Centre for Gender and Development (UDRC) of Plans for 2006-07 MSSRF in organising the workshop on Women in Agriculture – What Next? in November 2005. The TRC is working towards becoming a The TRC has been participating in the meetings Training and Resource Centre on food security convened by the National Alliance Against issues. Hunger, set up by the Government of India. Two meetings were held in 2005. Some of the activities already ongoing and those planned for the year include: The TRC staff have participated in and contributed to various forums on Food Security Developing modules on food and nutrition issues, addressing, in the process, diverse security and CFBs, through conducting groups such as students, academicians and workshops for Panchayat functionaries, and farmers. nutritionists in Home Science and

104

FOOD SECURITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Agricultural Institutions for upgradation of assessment and measurement of food and Nutrition Syllabus nutrition insecurity, urban food security and approaches in the mitigation of food and nutrition Preparation of the Training Manual on CFBs insecurity. The pedagogic approach built into and conducting dissemination workshops the deign of the course consisted of proceeding Developing a Report on the State of Food from self-analyzis to local and global issues with Security in Rural India 2006 a view to sensitizing students to look at hunger Developing and consolidating a database on and poverty issues not merely as a subject of food and nutrition security academic study, but as a humanitarian issue with a ‘rights perspective’. The draft outline was Developing linkages with VKCs for wider first circulated within the Foundation and useful dissemination of materials on Food and comments and suggestions were received, Nutrition Security which helped to enrich the draft curriculum. Conducting an evaluation study of the impact of CFBs Sub Programme Area 502 501.3 Course developed for UN University of Peace FORD FOUNDATION CHAIR FOR The BV Rao Centre helped a consultancy on WOMEN AND SUSTAINABLE developing a three credit course on “Hunger, FOOD SECURITY Famine and Food Security” for the UN University of Peace in Costa Rica. The course, leading to 502.1. The Food Security Atlas of Cambodia a Master’s degree in Environmental Science, United Nations World Food Programme, offered to students from different ethnic Cambodia Country Office had requested Prof. backgrounds, consisted of twelve classroom MS Swaminathan, Chairman, MSSRF to help sessions. The course was divided into three them to produce a Food security Atlas of units. The first unit addressed food security Cambodia. The work was entrusted to the issues, which began with the synergy between MSSRF team already experienced in producing environment and agriculture with a historical three similar atlases for India. The work has perspective, the concept of food and nutrition been completed and will shortly be made security, balanced diet, and cultural and gender available on the World Food Programme (WFP) perspectives in food security. The second unit Cambodia web site. addressed food insecurity issues such as hunger and famine, basic concepts such as The country Director of WFP, Cambodia, in the access, rights and entitlements, distribution and Preface to the publication, has stated that “This pricing and impact of agricultural technology on is a unique venture for both MSSRF and the environment and hence on food and Cambodia and a true example of South /South nutritional insecurity. The third unit included collaboration.”

105

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Prof M S Swaminathan, in his foreword to the the whole, iron deficiency, manifested as book, has noted that MSSRF has defined food anaemia, was unacceptably high across a large security as the “physical, economic, social and section of the county especially in children and environmental access to a balanced diet and women. The states of Chattisgarh, Rajasthan clean drinking water.” Non-food factors like and Karnataka are affected, as also the eastern access to sanitation, primary healthcare and states. education are also important for providing every The Report has attempted to compile citizen with an opportunity for a healthy and micronutrient deficiencies in the average diets productive life. Poverty reduction, food security of urban and rural people in India and in the and nutrition improvement are clearly interlinked. various states. The findings have limitations due The Royal Government of Cambodia (RGC) is to two major problems: one, of fixing average committed to reducing poverty in Cambodia, norms for population, which could be quite enhancing the welfare and living standard of the erroneous and second, of uncertainty as to the people and ensuring food security and nutrition content of the actual consumption and the levels for all. By “mapping” the intensity and locations of absorption. Nevertheless, they bring out the of poverty, child malnutrition, literacy, etc., an existence across the country of widespread attempt has been made in the Atlas to micronutrient deficiencies in the population. determine where the Cambodian people are the most vulnerable and food-insecure. The first ever At the all - India level, the urban intakes of of its kind in Cambodia, the Atlas presents the calcium, iron, beta carotene, riboflavin, and zinc food security situation of Cambodia in its three are below the norm in the average diets of urban dimensions of food availability, food access and India. The intakes of thiamine, niacin and food absorption. vitamin ‘C’ are also below the norm for the lowest expenditure group in urban India, in addition to 502.2 Micronutrient Deficiencies in India the other nutrients in which the average diets The Ford Chair prepared a paper on Micro are deficient. It appears that dietary diversification of rural India has been Nutrient Deficiencies in India – Approaches to accompanied not by improved macro and tackle them for the Micronutrient Initiative (MI), micronutrient intake as would be expected, but Canada. The findings of the report have been rather, by a worsening. The observed increase included by MI in their Country report. in the head count ratio for micronutrient The broad picture with respect to malnutrition deprivation is almost entirely attributable to the at the all India level and that of the states may reduced cereal intake since intake of all other be summarized as follows. Judged from the food items has either increased or remained impact of the deficiency manifesting as disease, constant. Although cereals are a poor source the most important deficiencies to fight against of micronutrients per se, the sheer dependence are iron and iodine, followed by vitamin ‘A’. On of the Indian diet on cereals implies that they

106

FOOD SECURITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ are the single largest source of most lectures/ refresher courses to impress upon the micronutrients. faculty and research students of the colleges and universities the need to introduce some Unlike the case of the urban population, almost interdisciplinary topics related to gender and all the classes of rural population show food security in the Social Sciences curriculum. extremely low levels of intake of micronutrients, which probably explains the alarmingly high 502.4 Rural distress in a semi arid region and levels of malnourishment in children observed its impact on gender specific livelihoods as underweight for age and stunting. Only micronutrients such as nicotinic acid, The Ford Chair proposes to study watershed phosphorous, thiamine, vitamin C, and folic acid development strategies to alleviate rural distress are consumed in excess of the RDA by the high- and provide gender specific livelihood in semi- income class. The middle-income class seems arid regions through a case study of Mahabub to consume folic acid alone in excess of the Nagar district of AP. RDA. The state level study reveals that zinc, The District profile has already been prepared vitamin ‘C’ vitamin ‘A’, riboflavin, calcium, iron, with special reference to the gender issues such thiamine and niacin in that order are the most deficient micronutrients in the average urban as feminization of agriculture, heavy seasonal diets of the country. and permanent out-migration and impact of farmers’ suicides on women. Nearly half the 502.3 Introducing Gender and Food Security households in the district are below the poverty Concerns into the post graduate Curriculum line, while the rural poverty level for the state for of Social Sciences the year 1999-2000 as per the fifty-fifth round of Many colleges and Universities in India are yet the NSS is as low as 11 %. It is one of the to offer topics related to gender concerns as a most backward districts of the country as part of the curriculum of Social Sciences. Many categorized by the Planning Commission. It has Women’s Centres are involved in outreach been selected for the National Rural activities rather than upgrading the curriculum. Employment Guarantee Scheme. Watershed The universities and colleges that do offer such development programmes and drought prone courses appear to be broadly covering basic area programmes are of major importance in theoretical aspects and the contemporary the district. Mehbubnagar district, a hot spot of thought related to equality and rights of women. farmer’s suicides, has a semi-arid, rain-fed They cover some broadly identified gender ecosystem. Some initial GIS work of overlaying issues related to a discipline. Food security maps of soil types, land uses, land cover and does not seem to be a key component of these rainfall data on block level political map has been curricula. The Ford Chair is in the process of done to assess the impact of drought on various identifying activities in terms of workshops/ factors at the micro level.

107

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Environmental health: The environmental health Sub Programme Area 503 of a farming system includes soil health, biodiversity, water availability, crop and micro The Sustainability of Farming nutrient levels in the soil and pesticide residue Systems in the soil. A Case study of the Rice-based Farming Economic viability: The economic viability of any System in Northeast Tamil Nadu agricultural system is measured as gross production and net farm incomes realised, and The overall aim of this research programme is is a function of the efficiency of resource use, to study the ecological stability and economic adequate post harvest mechanisms, pricing viability of rice farming systems and to mechanisms and credit and risk insurance. understand the causes and concerns for Social wellbeing: This is reflected in education, unsustainability in farming systems. The health and nutrition, sanitation and hygiene specific objectives to meet the research aim which permit both women and men to perform are: their roles and responsibilities efficiently.

To assess soil quality in terms of physical, With the help of Rice Research Station, Tirur, chemical and biological parameters Thiruvallur district and Krishi Vigyan Kendra, To derive an aggregated soil health index for Putlur, Kancheepuram district, one village, the cropping system Avaloor in Kancheepuram district was selected for a detailed study. The village is representative To assess groundwater quality and irrigation of the irrigated intensive farming system typical water management of the region. To document cropping pattern, fertility, pest The activities for the year were focused on and water management practices primary data collection including soil sampling To estimate productivity per acre and net and analyzis and questionnaires on incomes management and socio-economic parameters. Simple random sampling has been followed to To record the socio-economic conditions of select the plots and the households. the farming households. A preliminary assessment of the biophysical With the help of the inputs received from the resource base was carried out with the help of Ohio State University, Ohio, USA and the Water village maps, assessment of soil differences Technology Centre, TNAU, the conceptual based on a touch and feel method and framework and methodology of research were discussions with a few farmers. Initial findings worked out. The conceptual framework includes revealed that the soil was predominantly sandy the following components: clay loam. Paddy is the predominant crop and

108

FOOD SECURITY ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ there is intensive mono cropping, with three domestic uses. Discussions revealed that successive crops of rice. Tanks are a major several farmers have received training in source of irrigation, supplemented with integrated nutrient management practices and groundwater. Excessive pumping of have been practicing them for more than five groundwater has led to a reduction in water years. This provides scope for a comparative availability and hence the area under paddy study of plots with high levels of integrated cultivation. Competing demands on water are nutrient management and those with lower levels being made by nearby towns and cities for of integration.

109 Sub Programme Area 600

Information, Education and Communication

Under the NVA, MSSRF has set up 8 Village Resource Centres and 40 Village Knowledge Centres in TN and Pondicherry as well as 5 Village Resource Centres in Rajasthan, Maharashtra, Orissa and AP. A National Consultation was organized on ‘Women in Agriculture in India – ten years after Beijing’. An International Conference on “Human Centred Sustainable Development Paradigm” was organized in August 2005 to commemorate the 80th birthday of Prof Swaminathan.

601 Jamsetji Tata National Virtual Academy...... 111

602 Uttara Devi Resource Centre for Gender and Development...... 115

603 The Hindu Media Resource Centre...... 118

604 Every Child a Scientist Programme ...... 121

605 Library and Information Services...... 122

606 Conferences and Workshops...... 123

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

In setting up of VRCs and VKCs, NVA has been Sub Programme Area 601 working with a number of boundary partners (individuals, groups, or organizations) such as Jamsetji Tata National Virtual the elected Panchayat, traditional Panchayat, Academy Gandhigram Trust, SHG Federation, fishermen associations, NGOs, Temple Trust, Village The Jamsetji Tata National Virtual Academy Development Council, Ponlait (Milk Producers (NVA) has become the pivotal base for MSSRF’s Co-operative union), youth associations and initiatives in ICT-led development. The main aims Parish Councils. of the programme are to empower vulnerable communities to make better choices, achieve The organogram of the knowledge dissemination better control of their own development and build between VRCs and VKCs is seen in the inside the skills and capacities of the rural poor with a back cover (Figure 6.1). view to enhancing livelihood opportunities The processes adopted for setting up the VKCs include conducting village level surveys and VRCs and VKCs meetings; collection of data; consulting policy Under the NVA, MSSRF has set up 8 Village makers at the district and block level; identifying Resource Centres (VRCs) and 40 Village the interested groups / partners / areas; carrying Knowledge Centres (VKCs) in TN and out a situation analyzis and need assessment; Pondicherry, as well as 5 VRCs in Rajasthan, signing an MOU with partner organizations; Maharashtra, Orissa and AP. All the VRCs are selecting Knowledge Workers (KWs) and connected through ISRO uplink and downlink facilitating the formation of Village Management satellite. Committees (VMCs).

The VKCs are located in public buildings Training Knowledge Workers (Panchayat or SHG building, community hall, NVA has organized several training programmes school, etc.). The local community takes care for the KWs (91 KWs – male 27 and female 64) of the rent and electricity from day one. NVA who maintain the 40 VKCs, on aspects such takes care of capacity building, monitoring and as concept of VKCs; method of collection and evaluation, as also facilitating several training dissemination of need-based content; assisting programmes. The information content is users and visitors; maintaining user register, bill developed in close interaction with the local books and other records pertaining to the VKC; people in a bottom-up manner. All the block level building rapport among users and community knowledge centres are called Village Resource members; gender concerns; sensitizing the Centres (VRCs). MSSRF project staff operate KWs on the objectives and activities of the VKCs these VRCs. and the use of computer hardware and software.

111

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Connectivity copies are produced and these are distributed in 186 villages, to farmers and fishermen NVA has tested different technologies like VHF associations, SHGs, women federations, and Direct Sequence Spread Spectrum for rural panchayats, temples, churches, government communication. ISRO VSAT helps departments, libraries, consumer federations, communication between the different VRCs and research institutions, etc. On 1 May 2006, NVA Chennai VRC. Multi Commodity Exchange started the Marathi version of the community Market Information Terminal provides spot newspaper (“Amchi Gram Vartha”). market prices of more than 250 commodities and future exchange prices. Intel Rural PC has Awareness, Training, Knowledge been designed to run on car batteries in order Dissemination and Action to overcome the problem of erratic power supply. A series of need based awareness, training and This rural PC also has wireless Internet access. knowledge dissemination programmes for In July 2005, Pondicherry VRC submitted a farmers and SHG members was facilitated proposal to the Department of Science and through networking with various research Technology (DST) regarding the implementation organizations, NGOs and Government of Edusat in VRC. In December 2005, the DST agencies. The details are given in Table 6.1: approved the proposal and set up a distance education programme nodal center through Multipurpose Centre EduSat at a VRC as one of the 20 nodal points With the help of the Azim Premji Foundation, in India. This pilot programme is being VRCs are running a Computer Aided Learning implemented by Vigyan Prasar, which has Programme (CALP) for children in classes 4 to identified six teaching ends namely, ISRO, 8. From January 2005 to May 2006, a total of IGNOU, DST, CEC, AICTE and VIGYAN 6,188 children were trained in the VRCs, VKCs PRASAR, and has provided training to the staff and schools in Thiruvaiyaru, Annavasal, on operating the EduSat network. Through this Sempatti, Thangatchimadam, Pondicherry, network rural children participated in the national Nagapattinam and Kovalam. quiz related to astronomy and in the Children’s Science Congress. With the help of Microsoft Unlimited Potential Programme (MUPP), VRCs at Thiruvaiyaru, Community Newspaper Annavasal, Sempatti, Thangatchimadam, NVA has adopted different technologies for Pondicherry and Nagapattinam trained 2,095 spreading knowledge to the rural community. beneficiaries in Word, Powerpoint, Excel, One of the technologies is the community Access and web design. Certificates were given newspaper (“Namma Ooru Seithi”). This is a to those who successfully completed the fortnightly newspaper. Every month 18,000 training.

112

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Table 6.1: Need based awareness, training and knowledge dissemination programmes conducted

Programme Partners Topics discussed

Groundnut Advisory Department of Agriculture, Seed selection and treatment, land reforming, soil (May and June 2005) ICRISAT and NABARD testing, soil care, irrigation management, weed control, water analyzis, crop production and cultivation practices for improving the groundnut yield in irrigated and rainfed conditions. This led to the preparation of a “Farmers’ Guide for Improved Groundnut Production – Tamil Nadu”.

Clean milk production and Rajiv Gandhi Veterinary and Methods to improve milk production, hygienic quality milk procurement Animal Sciences Institute, practices, goat rearing, deworming in cows (June and November 2005) Ponlait

Soil testing camp (July 2005) Department of Agriculture Contract farming, soil testing, fertilizer and water management.

Crop insurance (August 2005) Agriculture Insurance Crop insurance, methods of estimation of crop yield Company of India Ltd.

Livestock and fodder management ICRISAT, TANUVAS, Veterinary Fodder management, rearing of healthy goat, sheep, interaction meeting (August 2005) University Training and cattle and poultry Research Centre

Agrometeorology advisory TNAU, TRRI, Gandhigram Crop contingency plans and records of cropping (August 2005) Rural Institute practices to be provided by VKCs and VRCs, and KVK monitoring crop development by VRCs, online information on cropping practices to be provided by VRCs; training of VKC managers and volunteers, role of the Indian Meteorological Department as facilitator in collection and transmission of data, provision of rain gauges and thermometers in villages, use of models for agricultural practices developed by research organizations such as ICRISAT, TRRI, CRIDA, soil testing

Coconut farmers’ interaction Department of Agriculture, Measures to control mite problem, value added meeting (September 2005) Coconut Growers Association products from coconut, schemes related to APEDA.

113

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Programme Partners Topics discussed

Seminar on Samba Crop SWMRI, PPRC Paddy preservation and storage, cultivation practices (September 2005) Thirukattupalli for system of rice intensification, use of fungicides and bio-fertilizers and irrigation management.

Veterinary camps Tamil Nadu Veterinary Vaccination, artificial inseminations, fodder (September 2005) Department, Thiruvaiyaru cultivation methods

Crop advisory Department of Agriculture, Contingency plan in the event of natural calamities (October 2005) TRRI, SWMRI like floods

Gingelly (sesame) advisory TNAU, Department of Cultivation practices, weed management, post Agriculture, TRRI SWMRI, harvest technology IDHAYAM

Demonstration cum training Fisheries College, Tuticorin, Importance of turtles, species available in the Gulf of programme on Turtle MPEDA Mannar, use of Turtle Excluder Device (TED) Excluder Device (November 2005)

Compost preparation Department of Agriculture Methods of preparation using waste coconut coir (November 2005)

Role of Panchayati Raj MSSRF Role of village panchayats, SHG, fishermen and institutions in setting up farmers’ associations new VKCs

Adult Literacy Programme Tata Consultancy Services Training to Knowledge Workers and Animators

Training in plant protection – Horticulture College and Crop rotation, intercrop cultivation, panchakavya organic methods Research Institute, preparation, biological control of pests (January 2006) Periakulam

Mushroom cultivation and MSSRF Cultivation practices, harvesting, packing and training (February 2006) marketing.

Manufacture and preservation MSSRF Training in fish pickle manufacture of fish pickle (March 2006)

114

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Expanding the VRC programme in the National Virtual Congress of Farmers during Maharashtra, Rajasthan, Orissa and Andhra the 93rd Indian Science Congress at Hyderabad. Pradesh Participatory Knowledge Management MSSRF-ISRO connected 8 VRCs (Pudukkottai Workshops for Fellows and Nagapattinam in Tamil Nadu, Waifad and On 10 and 11 July, 2005 (New Delhi), 3 and 4 Anandwan in Maharashtra, Jeypore in Orissa, January, 2006 (Hyderabad), 14 and 15 March, Pokran in Rajasthan and ICRISAT and Addakal 2006 (Pondicherry) and 30 April, 2006 rd in AP) during the 93 Indian Science Congress (Maharashtra), NVA conducted Participatory on 5 January, 2006. During the discussions Knowledge Management Workshops for the many issues were raised pertaining to fodder Fellows. These workshops covered subjects management, water management, boll worm such as water management, bio-diversity, attack in Bt cotton, health, livestock, fisheries disaster management and world trade. and credit. On 1 May 2006, NVA expanded the Monitoring and Evaluation VRC programme in the Vidarbha region. VRCs and VKCs have a user register in which NVA Fellows details of the user such as age, education, and Contributions from grassroot academicians are services received from the VRC/VKC are essential to tackle the problems of rural recorded. VRCs conduct village level meetings communities. In this connection, NVA selected and surveys to monitor the programme, on a 298 Fellows (Male - 155; Female - 143) from regular basis. In all 63,584 people utilized the AP, Assam, Chattisgarh, Delhi, Gujarat, services of the VRCs and VKCs during the year. Haryana, MP, Maharashtra, Orissa, NVA conducted a study on VKCs in Pondicherry Pondicherry, Punjab, Rajasthan, TN, UP, HP, from an anthropological perspective; it has also Karnataka, WB and Uttaranchal. collected case studies based on different NVA has brought out two publications related services provided by VRCs. to its Fellows, detailing the wide range of their expertise and competencies in the field of Sub Programme Area 602 agriculture, education, micro-finance, environment and health, Uttara Devi Resource Centre for Gender and Development On 11 July, 2005, the Hon’ble President inaugurated the Second Convention of the Last year, the activities of the UDRC were fewer National Alliance for Mission 2007 and than in previous years, due to the absence of a addressed the first Convocation of the Jamsetji full-time faculty member for the entire period. Tata National Virtual Academy for Rural However, both the external and internal Prosperity. On 5 January, 2006, NVA organized mandates were addressed.

115

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

602.1 External Food Security, held in September, 2004 to mark the International Year of Rice, while some new As 2005 marked the passage of ten years ones were added. Dr Krishnaraj is currently since the Beijing World Conference on Women, engaged in editing the collection of papers. which put forward a Platform of Action that India has also ratified, it was felt that it would Advocacy for the KAU-MSSRF undergraduate be useful to review the progress of women in curriculum titled Gender in Agriculture and India, with special reference to agriculture and Rural Livelihoods continued throughout the natural resource based livelihoods, during the year through presentations at various fora, decade. Ms CP Sujaya, an experienced dissemination through our web-site and printed administrator and women’s studies specialist, brochures, and other measures. Schools of was invited in July 2005 to prepare such a review Social Work, Women’s Studies Centres and paper as Visiting Fellow for Gender and several NGOs involved in rural development Development for 2005. The paper formed the have expressed interest and copies have been basis of the discussion at the workshop held sold. on 11 and 12 November on the topic: Beijing + Advocacy on gender issues continued through 10: Women in Agriculture in India - What Next? public lectures at different fora, presentations, The workshop was held with the participation participation in seminars, workshops and of a number of specialists and administrators. conferences, public meetings, campaigns, and A package of recommendations has been sent social movements. to the National Commission on Farmers, Planning Commission, Ministries of Agriculture 602.2 Internal and Women and Child Development and other concerned authorities as an input into planning Two formal training courses on gender issues for the future. The paper has now been were held for the staff of MSSRF, with the published as a small book titled Climbing a Long involvement of senior Faculty. The first, a four- Road: Women in Agriculture in India- Ten Years day orientation for staff recruited recently, was after Beijing, and is being widely disseminated. held in September, 2005. Four main themes were taken up, one on each day, with each day In March 2006, following an expression of and theme handled by one Faculty member. interest from STHREE publishers, Dr Maithreyi The themes were: Village Studies, or Krishnaraj, one of the most distinguished understanding the village community; scholars in women’s studies in the country, was livelihoods, or understanding the local economic invited as the Visiting Fellow for 2006 to prepare and social situation; gender, or understanding and edit a collection of invited papers on the the gender issues at the village level; and theme Gender, Livelihoods and Food Security process methodology, or understanding in Rural India. Some of the papers had been MSSRF’s approach to science-led develop- presented at the seminar Gender, Rice and ment and how to put the approach into practice.

116

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

The course included a number of practical group The feedback from participants indicated that exercises each day and concluded with all of them appreciated the opportunity for individual assignments to be carried out in the independent learning according to the field. The course has been documented in depth individual’s need and pace, and to continue for future use. learning over a long period from the materials.

In November 2005, a three day FAO-sponsored Gender mainstreaming, or the process of ICT-enabled course was held for 21 senior staff institutionalizing the gender perspective in all of MSSRF, mostly from the field sites, as well the programmes and activities of MSSRF, as partner organizations, and one observer. The continued through informal meetings and discussions with staff, individually or in groups, training was primarily based on the CDROM- workshops, staff seminars, and visits to field based learning resource package titled Women sites to discuss context-specific issues, and and Gender in Agriculture and Rural specific programmes developed according to Development in Asia developed by FAO, as well need. The in-house research study undertaken as MSSRF’s undergraduate course, also in 2004 is being analyzed and interpreted and available on CD. The FAO CD has a number of the report is under preparation. links to web-sites. The course was directed by FAO’s Gender Specialist from Bangkok, with 602.3 Voicing Silence the support of an external ICT specialist, as Now in its fourteenth year, Voicing Silence has well as a senior faculty member from MSSRF. shrunk into a small-budget activity at MSSRF, The objectives of the course were both to but continues to play its role as a catalyst in familiarise and contextuallise gender concerns bridging the gap between theatre and in the relevant development area and gain development, and has explored new avenues experience in using ICT based learning each year. resources to enhance organisational capacity. Last year, the main task was to nurture, support After an initial introduction to the course and develop Kannadi Kalai Kuzhu, the aravani materials and guided tours with explanations theatre group set up the previous year. The play by the resource person, the participants worked Manasin Azhaippu, developed and widely individually; sessions for review and performed in the first year, succeeded not only classification were followed by group in creating widespread interest and awareness discussions in the evenings and late night about the social and human rights issues it assignments. This procedure was followed for projected, but also brought many concrete three days. On the last day, the assignment benefits and support from both Government and was to develop an action plan for their own non-governmental bodies. The most significant situation to show how they would achievement was getting the right to vote early operationalise the learnings, both to modify in 2006; thousands of aravanis got their voter programmes where needed and train others. identity cards and voted in May, 2006.

117

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

After about 40 performances throughout TN, the interaction, bringing together both media group felt it was time to have one more play in professionals and experts from diverse fields. their repertoire and approached Voicing Silence The mass media communication systems that for help. Through a series of workshops during are networked by THMRC include radio, September and October, 2005, involving several television, print and the web. It covers resource persons, a new play was developed and launched at a special show held in late Community Radio (CR), satellite commercial November, 2006. Unlike the first play, this one private television network, cable network, Uraiyadha Ninaivugal, (Unsettling Memories) is neighbourhood journals, community more inward-looking, and explores in depth the newspapers, VRCs and online groups. relationships, the joys and sorrows in family Three media workshops were organized during and personal relationships, the pains of the year. On 26 December, 2005, a workshop suffering, and the comforts of finding a new titled “Managing Tsunami: Lessons of 26 community, ending with a powerful challenge December 2004” discussed the post-tsunami to society to accept them just as they are — initiatives taken up by MSSRF. One of the persons. The two plays together give an insight panelists, Prof PC Kesavan, enlightened the into both the public and private lives of aravanis, media on the possibility of creating a new profile and can form a good package for this year’s for Andaman, especially in organic farming, campaign, which has already started. formation of bio-villages, cultivation of mangroves Besides creating and rehearsing a new play for and aquaculture of mud crabs and prawns. Prof performance, the second main form of support MS Swaminathan who chaired the workshop has been in helping the group to manage their explained the role of post-disaster reconstruction own fund-raising for the theatre campaign, by strategies factoring geo-physical and geo- helping them to draw up project proposals and morphological studies, vulnerability mapping, putting them in touch with potential donors. computer simulation models, harnessing Hopefully, they should become self-reliant in the traditional wisdom, and establishing community near future. food and water banks.

The second workshop on “Integrated Coastal Sub Programme Area603 Zone Management: on CRZ Notification 1991”, The Hindu Media Resource Centre was organized for the benefit of media personnel in Visakhapattinam. The leading national dailies To create an understanding and awareness of carried headlines on the workshop and the socially and scientifically relevant issues, highlighted the 12 recommendations for using the mass media communication systems integrated CMZ in which regulation, education as a tool, MSSRF’s The Hindu Media Resource and social mobilization are the major Centre (THMRC) creates a platform for components.

118

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

The third workshop titled “Vetriyin Marupakam” integrating frontier science and technology with meaning “The Other Side of Success” was traditional wisdom and associated cropping organized in coordination with The Hunger patterns to eliminate hunger and poverty, was Project (THP) team to highlight the issues and the lead article in all the mass media. challenges faced by women in their journey Another public forum titled “Beyond Tsunami: towards empowerment. The Hunger Project is New Lives and Livelihoods” showcased the a global strategic organization and a worldwide power of global convergences and partnerships. movement committed to the sustainable end of Prof MS Swaminathan, Chairman, MSSRF, in world hunger. Eighty women Panchayat his remarks sounded a wake-up call by showing representatives and leaders covering the entire up deficiencies in calamity management. He state of TN participated to discuss the power observed, “Tsunami opened up possibilities to issues. They regretted that in spite of many of deliberate on sustainable fishing opportunities. them actively working in the public sphere, they The coastal systems were under severe still face opposition from men in entering the anthropogenic stress. The calamity united every political arena. Successful women concluded one and proved what synergies could achieve”. that it was only the 33 % reservation bill that Fifteen print journalists in addition to students, gave them empowerment to contest in research scholars and public attended both the elections; otherwise, their plight would have fora. remained miserable and they could not even have come out of their houses. Public lectures and special seminars are frequently organized to help understand issues Ninety-one media professionals participated in at the global and national level. THMRC the 3 media workshops and brought out 32 organised 6 such seminars this year. One was feature stories in addition to 5 news stories in a significant event to commemorate the 75th the mainstream media. Anneversary of Mahatma Gandhi’s Dandi March Two public Fora were organized and the first and Salt Sathyagraha on 2 April, 2006. The one, titled “Biodiversity and Freedom From seminar titled “Beyond Tsunami: Significance Hunger” was a follow up of the international of the Dandi March” was chaired by the then consultation on “Role of Biodiversity in Achieving Union Minister of Petroleum and Panchayati the United Nations Millennium Development Raj Shri Mani Shankar Aiyer. The Minster Goal of Freedom From Hunger and Poverty”. In advocated a participative approach for the the public forum, concern was expressed on rehabilitation plans, stating that development the narrowing base of global food and nutritional and prosperity must not be imposed, as that security and the need for better deployment of would be disruptive. In this context he also added plant biodiversity. The Prime Minister’s that Panchayat institutions should be involved message, which stressed the need for in all planning and implementation activities

119

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ besides making the decisions for the Communication Department of the University community. Mr N Ravi, Editor, The Hindu, who of Madras, Chennai, took up an in-depth study was the panelist, said that the context of the to analyse the effectiveness of the strategies Dandi March is significant even today, as it adopted by THMRC in achieving the mandate highlights the message that traditional rights of reaching the mass media. The researchers to resources are to be safeguarded as an participated in and tracked the media reports, interaction between man and nature. in addition to interacting with the editors of the media. The findings of the study are listed Another seminar titled “Fish For All” was below: organized to felicitate World Food Prize winner Dr Modadugu Vijay Guptha, for his work in The media professionals prefer specific enhancing the nutrition status of nearly a million media interactions for reporting news people in Asia and Africa. He stressed the stories. importance of aquaculture to improve fish Media workshops are very useful for writing production, as wild stock production is not in-depth, issue-based feature writing. keeping pace with demand. Media workshops are preferable to seminars To report the findings of a three-year study and lectures. undertaken by India-United Kingdom research To help the media further, a Concept Bank is institutions on the impact of climate change in being maintained and updated. This involves India, a seminar titled “Indo-UK programme on compilation of write-ups, which can be developed Impact of Climate Change in India” was into soft news feature articles and are classified organized in coordination with the British High on the basis of themes like women Commission. Prof NH Ravindra Nath, member empowerment, SHG success stories, of the study team, remarked that the impact of education, bio-tech research, livelihood climate change on forest ecosystems would be interventions, biodiversity, tsunami rehabilitation felt in the next 30 to 40 years. activities, audio video resources directory and Participating in the 6 seminars, 75 media so on. Today the Concept Bank possesses 102 professionals brought out 16 feature stories and such stories, which can motivate the media 7 news stories. This year THMRC collaborated professionals to identify their theme for news for 24 national and international consultations, features. in which 181 published feature articles, Another tool used to reach the media, students contributed by 262 media representatives, have and general public at large is the website. been documented and placed in the media (www.mssrf.org). New initiatives like Chairman’s tracking column of our website. Desk and Ask the Expert have been well received Students of the Journalism and Mass by one and all. Regular monitoring of the access

120

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ of our website reveals that there is a substantial increase in page hits. Sub Programme 604

MSSRF Info Ticker: Ticker is a software Every Child a Scientist Programme developed by THMRC, which can be The programme was started in August 2002 in downloaded from the website. Once installed, Chennai, for children in the age group of 13-15 it will fetch details and information from our years and belonging to economically under- website and display the same. It is mainly used privileged sections of society. The Centre has for providing information about important public a number of computers and multimedia material events and happenings at MSSRF Head Office to make learning an enjoyable experience. With and site offices. In addition to the general encouragement from the Deputy Commissioner dissemination, the Ticker also communicates of Education, Chennai, it has established a good across projects and site offices. rapport with corporation school headmasters, teachers, orphanage schools and government- As part of visual documentation a film titled “15 aided schools in Zones VIII, IX and X. years…15 Steps….” was produced. This film illustrates 15 significant achievements of Around 350 students were introduced to topics MSSRF in the 15 years. like eco-technology, biodiversity, information and communication technology, health and hygiene, An exclusive website named “DISCOURSE” environmental issues, and bio-technology. was developed for the benefit of the MSSRF The Centre has also developed resource material staff both at the headquarters and at the site on various topics like biodiversity, marine offices. The website has the feature of restricted animals, seaweeds and information technology, access using a user Id and password. in the local language.

As an internal mandate, a workshop was New initiatives included this year were butterfly organized at Thangatchimadam of Rama- rearing, making charts on environmental issues nathapuram District to enhance the with newspaper cuttings and holding communication skills of the KWs of the VRCs. competitions every month to sustain their Twenty-five KWs were taught various interest in nature. Students were encouraged communication techniques which can be to collect information on plants and animals and adopted for dissemination. were asked to make posters which were then displayed in their respective school notice Public relations is another concern of THMRC. boards to benefit all the students in that school. There were 1,773 visitors, including foreign delegates, government officials, students from Touch and Smell Garden schools and colleges, research scholars and This garden was developed to allow the visually representatives from NGOs. challenged to experience the biodiversity in

121

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ plants and learn through the senses of touch For the Panchayat leaders, the workshop and smell. The programme was strengthened included topics like basic biology of gene and with a Braille embosser that runs on software genetic diversity of rice from the Jeypore tract, in different Indian languages and has options to genetic literacy, genome club and convert from Braille to Tamil text and vice versa. biotechnology and the importance of genetic This facility is being used to generate resource awareness for rural development. A workshop booklets for the visually challenged on a number was conducted for school teachers on the role of topics of relevance. of teachers in rural development and biodiversity conservation through genetic awareness Additional seed albums on condiments and programmes. spices were developed, facilitating children to Vacation training programme for school learn about different types and shapes of plant children on Bioresources and Biotechnology seeds and their characteristic features. This year MSSRF conducted a programme for A national-level workshop for Heads / Principals 25 students of standard X in Chennai from 22 of all schools for the visually impaired in the April to 18 May 2006, to create an awareness country is being planned with an aim to reach on biodiversity conservation. The programme out to as many schools as possible to replicate offered them a unique opportunity to interact such a garden in their premises. with experts in the field and be inspired while learning from them. As part of the course, the Genetic literacy and Genome clubs students visited the biodiversity rich areas of This programme is in its third year with the focus Siruvani hills, and prominent institutes in on two major target groups, namely, school Coimbatore, Kottakkal, Sadras Kuppam and children and Panchayat members at the Kalpakkam. They conducted experiments in the grassroot level. Thirteen camps/workshops were laboratory at MSSRF and submitted a project held during the year, benefiting more than 1,000 report at the end of the programme. participants who were introduced to topics such as biodiversity and biotechnology, implications of biotechnology for rural development, Sub Programme Area 605 biodiversity acts and the role of institutions Library and Information Services dealing with biodiversity material, biodiversity and its conservation through genome clubs, The library is pursuing the objective of providing implication of biological diversity in research, efficient information service to the users. commercialization related to Indian systems of Currently, there are 15,155 books of which 1,110 medicine, ethno medicine of tribal communities were included during the year. In addition it also of South India and the fundamental need for holds 194 CDs, 113 journals, 184 newspaper conservation of biodiversity. clippings for the year 2005-2006 and 1,954 back

122

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ volumes of journals. The library also houses representatives of NGOs and multilateral reports of MSSRF, development reports and institutions who participated, submitted their annual reports of different organizations. recommendations as an input for the report of the NCF. It was decided to constitute a small The library services range from reference service working group to draft a food guarantee bill. to current awareness service, selective dissemination service, document delivery, Some of the major conclusions of the publication and distribution service and deliberations were: photocopying service. Various web-sites are The proposed legislation should integrate the browsed to cull-out information relating to the features of the Employment Guarantee Acts research undertaken by MSSRF and the same is sent to in-house staff through electronic (National and Maharashtra) and Food for media. The library is also planning to implement Work Programmes. a web-based library catalogue whereby a larger It should be gender sensitive. community would be benefited. The concept of “work” should be enlarged to The library serves not only the in-house staff, cover also skilled work related to human and but also caters to the needs of users from social development, as for example, various organizations, universities, colleges and establishing and running crèches, balwadis, schools. There were 1,087 external users during preparing noon meals, etc.; the year. About 20 school students made use The Gram Panchayat / Local Body can form of the library. Around 200 students and research in the respective village a Consortium of scholars from different universities within India Agencies like SHGs, Mahila Mandals, and the University of Ottawa, University of Farmers’ Clubs etc, to provide oversight to Bristol, University of Tokyo, Yale University, the implementation of the integrated food for University of San Francisco and University of work and employment guarantee approach Bonn, Germany, visited the library. to the elimination of hunger and poverty.

The recently enacted Right to Information Sub Programme Area 606 Act will facilitate the process of empowering Conferences and Workshops the rural poor (often illiterate) in understanding their entitlements under Workshop on National Food Guarantee Act, various pro-poor schemes of the Central and 19 June, 2005, MSSRF, Chennai State Governments.

The TRC on food security organized a workshop The Act should provide scope for including at MSSRF on Sunday, 19 June, 2005 to discuss feasible land reform measures like providing the need for a National Food Guarantee Act. dalits and the poor with homestead land of The group of academicians, lawyers and sufficient extent to ensure, besides living

123

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

space for the household, land to grow in 18 fields, held discussions with farmers in all vegetables, fruits and other produce, villages in Nagappatinam and Cuddalore districts contributing to household nutrition and food and made suggestions regarding soil and water security. SHGs can also be given space on rehabilitation measures and livelihoods lease in common property land for raising restoration. These suggestions have been nutrition gardens. printed in Tamil and English and distributed extensively to farmers in the affected villages, Integration with primary health care is officials of the state agricultural department and exceedingly important. NGOs working in the tsunami affected villages. The Act could stimulate a movement for storing grain and water everywhere through International Conference on Human Centred community food and water banks. A national Sustainable Development Paradigm, 7-10 network of community food banks could be August, 2005, Chennai established. An international conference was organized at Travelling workshop on Agronomic the Chennai Trade Centre in commemoration th Rehabilitation of Tsunami Ravaged Lands of the 80 birthday of Prof MS Swaminathan. in Tamil Nadu, 16-19 July, 2005, The conference was intended to showcase Nagapattinam, Cuddalore various ongoing activities of MSSRF in relation to developments in the field of sustainable Tsunami waves caused extensive damage to agriculture and rural development. The the basic agricultural resources like soil and conference was attended by more than 650 water as well as to standing crops like paddy participants including researchers, development and groundnut, in some parts of TN and planners, policy makers, stake holder Pondicherry. Since the devastation took place, representatives involved in various programmes several institutions such as the Department of and projects of MSSRF and a large number of Agriculture, TN, research institutes and NGOs, students. The conference was inaugurated by have been involved in rehabilitating the affected Shri. Surjit Singh Barnala, Honourable Governor communities. To understand the multi- of TN while Shri SM Krishna, Honourable dimensional nature of the problem and develop Governor of Maharashtra was the Chief Guest a soil health rehabilitation package, a traveling at the valedictory session. A large number of workshop was organized from 16 to 18 July, thematic areas were discussed, including 2005, with multidisciplinary experts representing evergreen revolution, sustainable livelihood, eleven organizations (soil survey, soil testing, natural resource management, food and agronomy, soil science, livelihoods, natural nutrition security, knowledge empowered resources, plant breeding and genetics, communities, gender and development and anthropology etc) from different parts of the policy issues in effective delivery mechanism country. The participants visited nine villages, for sustainable livelihood options for rural conducted spot measurements for pH and EC communities. Many invitees representing

124

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ international research centres and long time scientists of advanced research centres and associates of Professor M S Swaminathan also national agricultural research systems to bring participated in the meeting. The conference the power of partnership in providing viable had two sessions highlighting the contributions solutions to hunger and poverty in the global of Professor MS Swaminathan to science and context through accelerated agricultural technology and public policy. The conference research. provided a platform for elaborate discussions Mission 2007 Trainers Workshop, 22-23 on issues related to sustainable development September, 2005, Chennai in a human centered approach to provide an impetus for developing an action plan for The participants included 16 leading Mission ensuring food and nutritional security of rural 2007 partners. The workshop was jointly communities. organized by IDRC’s Telecenter.org and MSSRF. The main goal of the workshop was to International Workshop on Molecular draw up a capacity building programme for Markers for Allele Mining, 22-26 August, training village knowledge workers. Based on 2005, Chennai the inputs from the meeting, Telecenter.org is In collaboration with the Generation Challenge now in the process of developing a capacity Programme of CGIAR, MSSRF hosted the building programme. It will include three international workshop to highlight the components, namely, participatory train-the- developments in the field of molecular markers trainer workshops, online practice for Mission in genetic resource characterization, 2007 partners; and a common curriculum for conservation and management and to provide all Mission 2007 partners. new genetic combinations for identifying desired International Workshop on ICT for genetic material for crop improvement. It had Community Empowerment, 3 - 7 October, 49 scientists representing the CGIAR System 2005, Kannivadi that included participants from IRRI, CIMMYT, ICRISAT, IITA, CIAT, representatives from An international workshop on ICT for community Advanced Research Institutions from Australia, empowerment through NFE was organized and France, USA, Germany and Netherlands as nearly 45 participants from South and South- well as participants from the National East Asian countries participated. The computer Agricultural Research Centres in India. The based functional literacy model developed by workshop brought out the recent developments the VKCs was shared with the Community in the field of molecular marker technology and Learning Centres and Community Multimedia provided an opportunity for discussions on Centres. 23,740 trainee days were organized possible pros and cons for utilizing these in the five centres covering nearly 177 learners, techniques for genetic resources management including 120 women. These centres focus on and crop improvement. The workshop also non-formal education related to the livelihood provided a platform for sharing expertise between security of the forest-based tribal groups,

125

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ agricultural labourers and small and marginal Ten Years after Beijing: Gender, Science and farmers of semiarid regions. Skill enhancement Technology, 18-19 November, 2005, New programmes were carried out, based on the Delhi need for hardware management and software MSSRF worked closely with the National programmes. The centres are slowly emerging Academy of Agricultural Sciences (NAAS) and as the focal points in the villages to organise the National Commission on Farmers (NCF), training programmes and village meetings. in organizing a two-day consultation on Ten Years after Beijing: Gender, Science and Women in Agriculture in India – What Next? Technology. The event was supported by UNDP, 11-12 November 2005, Chennai Government of NCT of Delhi and Department of A two-day workshop was organized by MSSRF Women and Child Development, Government on Nov 11-12, 2005, on the theme: Women in of India. Agriculture in India: What Next? to discuss the The meeting was convened to take stock of the status and problems of women in agriculture in situation facing women in the country ten years India ten years after the Fourth World Women’s after the World Women’s Conference in Beijing Conference held in Beijing in 1995, in the light in 1995. There were about 75 participants from of the commitments made by the Government all over the country, largely women professionals of India at the Beijing conference and later in from agricultural and home science universities, the Common Minimum Programme of the UPA government departments, national and Government. About 25 participants drawn from international donor agencies and NGOs. the government, academia and civil society participated. The meeting provided a platform for taking stock of the situation facing women in agriculture in The consensus that emerged, noted that issues the country and requested deliberation on issues concerning Indian women ten years after the like engendering various programmes and Beijing Conference of 1995 must be seen in formation of a National Action and Policy the background of the consequences of the Research Network for Women in Agriculture. implementation of neoliberal macroeconomic This was followed by a panel discussion on policies since 1991, as well as the overall path Science for Women and Women in Science. of economic development since Independence. There were technical sessions on Agriculture, The major recommendations of the meeting Health, Environment and Food Security, Civil were classified under the heads of Land and Society Initiatives – Learning from Successes, Productive Assets, Labour and Employment and Access to Technology and Skill Generation, Common Property Resources and Empowerment, with presentations by invited NRM, Support Services, Self Help Groups, speakers followed by interactive discussion. Data Gathering and Women in Technology. National and International Roadmaps for the

126

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ future were presented by key participants at managing mangrove and non-mangrove the penultimate session. bioshields. Representatives from 14 grassroot NGOs such as Centre for Rural Education and The Chief Guest at the valedictory session was Economic Development, Chidambaram, HRH Princess Maha Chakri Sirindhorn of People’s Action for Development, Vembar, Thailand. The draft of the recommendations of Covenant Centre for Development, Madurai, the consultation was presented at the Centre for Ecology and Research, Thanjavur, concluding session. Aranya: Forest and Sanctuary, Auroville, NGO Workshop on Bioshield Development SNEHA, Nagapattinam participated in the and Management, 23-24 November, 2005, workshop. Chennai The following topics were covered in the Immediately after the tsunami there were reports workshop: how to identify suitable lands for in the electronic and print media that the mangrove and non-mangrove bioshield, mangroves, shelterbelts and other coastal including analyzis of environmental condition, vegetation had played a role in reducing its assessment of ownership, getting concurrence impact which was later confirmed by from Panchayat and government institutions; systematic scientific studies. This has created technical aspects including biophysical a great deal of interest among grassroot NGOs condition, species suitable to meet the and funding and supporting agencies to become ecological requirement of the bioshield and involved in coastal bioshield development and economical requirement of the community, management as a measure of preparedness to planting methods and aftercare; and tsunami and other sea-borne natural disasters. participatory and management aspects such To gain an insight into the technical and as group formation in the village, partnership participatory aspects of bioshield development with other agencies, joint planning, and management, many NGOs approached implementation and monitoring. The MSSRF to provide training to their middle level experiences gained during the implementation managers and field level staff. Hence, a three- of the JMM programme from 1993-2003 formed day workshop on Bioshield Development and the basis of the curriculum development for this Management was conducted, the objectives of orientation workshop. which were to raise awareness about the role Workshop on ICT-enabled development: of mangroves and other coastal vegetation in South-South Exchange through Travelling reducing the impact of coastal disasters such Workshop, 28 November – 5 December, as cyclone, storm surges and tsunami; to 2005, Chennai provide orientation to technical aspects of raising mangrove and non-mangrove vegetation The South-South Exchange travelling workshop as bioshields; to provide orientation to the was organized for the fourth successive year. It participatory process of developing and brought together 20 development practitioners

127

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ from 11 countries (including five from India) to levels of communities, grassroot democratic learn and discuss the MSSRF approach on ICT- institutions and administrators, for deriving the enabled development activities, share full benefits from these two acts by the local knowledge with others and interact directly with communities and farmers. the community, knowledge workers and NVA The recommendations that emerged at the Fellows. These workshops acted as informal symposium are as follows: classrooms and provided a platform for cross- cultural exchange of knowledge between the The laws and policies on biodiversity and villagers and the visitors. associated traditional knowledge have a profound impact on the livelihood of people, National Symposium on Biodiversity, particularly the poorest, women and 6 December, 2005, Chennai marginalized, and therefore need to be MSSRF organized a national symposium on formulated and implemented with the active Biodiversity, Agriculture and Nutritional Security and total participation of civil society. along with the National Academy of Sciences, The national policy on biodiversity needs to Allahabad at MSSRF, Chennai. This be mainstreamed with the larger public symposium, dedicated to the memory of the interest. late Dr TN Khoshoo had the following objectives: The full benefits of the Biological Diversity to review the existing national framework on Act and the Protection of Plant Varieties and biodiversity, particularly the policy and legal Farmers’ Rights Act will not accrue to the components influencing conservation, communities and farmers without a massive sustainable use, access and benefit sharing, national awareness campaign involving the to assess the existing framework on agro- stakeholders and empowering them with biodiversity conservation and utilization capacity building and appropriate towards meeting the arising challenges on institutional linkages. The concerned national food and nutritional security, and Ministries are requested to undertake this capacity building campaign involving all to examine the embedding of the grassroot competent civil society institutions, including democratic/community institutions in non-governmental organizations. conservation, sustainable use, access and equitable benefit sharing. Documentation of traditional knowledge, its validation and further research to create a Prof Swaminathan in his address recalled the larger economic stake to such knowledge contributions of late Dr TN Khoshoo towards with ecological safeguards may be the cause of national biodiversity. He undertaken on a priority basis. emphasized the importance of awareness generation on two legislations related to Stronger governmental interventions are biological diversity and farmers’ rights at the required to support and promote in situ on

128

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

farm conservation of plant genetic resources from coastal regions. Very few of them were and for recognizing and rewarding farm familiar with mangroves and found lectures and women and men and communities field visits helpful. They felt that more training undertaking conservation in centres of programmes should be conducted for coastal genetic diversity and innovating plant genetic Panchayat leaders and stakeholders for the resources. effective establishment of coastal bioshield.

National Virtual Congress of Farmers, World Wetlands Day Celebrations, 5 January, 2006, Hyderabad 2 February, 2006, Kakinada There is a growing incidence of suicides among MSSRF Kakinada field centre, Andhra Pradesh, farmers living in “distress hotspots” in the states and India and Wildlife Management Division, of AP and Maharashtra. The causes for such Rajahmundry jointly organized an awareness suicides vary from area to area, but are broadly rally in Coringa village abutting Coringa Wild connected to the cumulative impact of the life sanctuary on the occasion of World failure of the formal credit system, poor quality Wetlands Day. Students of the Green Corps of of inputs, lack of credible and timely extension Aditya Public School, Jagannaickpur, Kakinada, advice as well as an exploitative marketing participated in this awareness rally. Placards system. Timely information and knowledge on the importance of wetlands, particularly the empowerment can help to save lives and conservation of mangroves for coastal and livelihoods. Knowledge of Government livelihood security, were prepared by the programmes for socially and economically students. At the end, a meeting was held at underprivileged sections of farming and rural the Coringa Wildlife Sanctuary Forest complex. communities will be of great help. In this background MSSRF-ISRO connected 8 VRCs The need to conserve wetlands as they are the during the 93rd Indian Science Congress, on 5 livelihood resources of the poor, particularly the January, 2006. H E the President of India, along fishermen, was emphasized. with dignitaries from ICRISAT, ISRO, Interactive Workshop on Crop Government of AP, FAO and NCF, held a video- Biofortification for alleviating micronutrient conference with farmers, fishers and tribal malnutrition, 13-14 February, 2006, Chennai women and men in eight centres. During the discussion many pertinent issues were brought The Government of India has initiated a network up for necessary action. programme on crop biofortification, involving major crops. Globally there are also ongoing Workshop on mangrove bioshield for NGOs efforts on crop biofortification coordinated by the and Grassroot Level Institutions, 19-21 HarvestPlus programme of CGIAR. In order to January, 2006, Karaikal develop the linkages and also to share the The participants were from NGO’s, CBO’s, and knowledge and material generated in both the Panchayat, fisherman, agriculturists and SHGs programmes, an interactive workshop was

129

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ organized jointly by HarvestPlus and The participants gave the following feedback: Department of Biotechnology, Government of PRIs should create awareness on coastal India at MSSRF. The workshop was attended bioshield among the people. by 49 participants representing international agricultural scientists, ICAR Institute, State PRIs should play an active role in restoring Agricultural Universities and the private sector. coastal degraded areas with community The discussions during the two-day conference participation. related to the nature and extent of micronutrient PRIs should prevent encroachment of deficiency, ongoing interventions, possible coastal areas. initiatives and policy issues in the development and delivery of biofortified crop varieties. A joint Communities should be trained on the action plan was developed for identifying the functions and uses of bio-shield. priority areas of intervention in both major and Communities should be trained in bio-shield neglected crop species to provide an integrated nursery establishments. approach for biofortification programmes. Communities should be trained in bio-shield The meeting also considered the issues related plantation and management. to developing common methodologies and a School children should be made aware of structured collaborative programme between the the importance of bioshield. Department of Biotechnology funded projects of the Govt. of India and the HarvestPlus PRIs should promote integrated livelihood programme. A Memorandum of Understanding options for coastal dependent communities is under development and will provide scope for 5th Pugwash Conference on HIV/AIDS: both the programmes to benefit from each other. Sharing of Experiences, What Works? 7-9 Panchyat Raj Institutions (PRIs) training April, 2006, Chennai workshop on mangrove bioshield, 17-18 In recognition of the global nature of the HIV/ March, 2006, Chidambaram AIDS pandemic, it was decided to bring together Forty participants from PRIs and 8 Commune experts from “first wave” countries where the Special Officers attended a two-day workshop epidemic had struck first and with great intensity at Chidambaram and interacted with experts (e.g. South Africa, Kenya and Uganda) and and rural communities on experiences in coastal those from “second wave” countries where the bioshield establishment and management. The epidemic threatens to spiral out of control (e.g. participants felt the need for adopting methods India which has the second largest population suggested by MSSRF and wanted to have living with HIV) to exchange successful and continued interaction with MSSRF for technical replicable strategies for the prevention, support. management and mitigation of HIV and AIDS.

130

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Hosted by MSSRF, the conference was co- On 8 April the participants went on a field visit sponsored by the UN World Food Programme to HIV projects run by local organizations. (WFP), Bill & Melinda Gates Foundation, the Participants were able to choose among 4 National AIDS Control Organization, the UN projects (2 prevention and 2 care & support) Development Program and the Indian Council run by Voluntary Health Services (the AIDS Prevention and Control Project), the Tamil Nadu of Medical Research. The WFP played an active AIDS Initiative, Tambram Hospital and YRG role as co-organizer. CARE. On Saturday evening, Professor There were 52 participants from 8 countries. Swaminathan, the World Food Program’s Approximately 65 % of the participants were Deputy Executive Director and the WFP’s Representative and Country Director for India from India and 35 % were from other countries released a short film about WFP’s activities in (i.e. South Africa, Kenya, Uganda, the US, the India to an audience of journalists and UK, Italy and France). Participants represented conference participants. a wide variety of fields (e.g. clinical medicine, nutrition, social science, and ecology) and Annual Dialogue on the theme Hunger Free institutional affiliations (e.g. universities & India: Mission 2007, 20-22 April, 2006, research institutions, civil society organizations, Chennai hospitals and government). This year’s Annual Dialogue, on Food Security, coordinated by the TRC, was held in April at The conference comprised 8 plenary sessions MSSRF, Chennai. The focal theme of the that focused on the following themes: policy Dialogue was Mission 2007: Hunger Free and state responses to HIV/AIDS; access and India. The theme was a follow up of chapter adherence to ART; nutrition and food security two of the second report of the National for people infected and affected by HIV and AIDS; Commission on Farmers (NCF) titled, ‘Serving preventing infections among young people, Farmers And Saving Farming: From Crisis to especially young women; behaviour change; Confidence’. sexual violence and the social construction of Around 50 invitees, comprising academics, male and female sexuality; preventing paediatric lawyers, social activists and journalists as well HIV; and controlling HIV within the defence as civil servants involved in policy services. In each session, presenters shared implementation took part in the Dialogue. The experiences from both Africa and India. outcome of the dialogue was a set of recommendations, the major points of which The Hindu Media Resource Centre organized a are outlined below. The recommendations were public forum on the evening of 7 April, for released at a press conference held at the community members and the media to learn conclusion of the Dialogue, with a view to wider about the HIV epidemic and the state’s dissemination. The following are the response in South Africa, Uganda and India. recommendations

131

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Enhancing Production and Profitability of Small simultaneously address protein energy holdings malnutrition. Synergy and convergence should be ensured in nutrition intervention Reverse the disastrous decline in rural programmes. A life-cycle approach that development expenditure and step up public emphasizes all nutrients and dietary plans investment in irrigation and rural for the community as a whole at the local infrastructure. level are important. Carry out land reforms through acquisition The quality of service delivery, monitoring and of ceiling surplus land and redistribution. supervision needs to be improved. The ICDS Implement the NCF recommendations for is a very critical intervention programme and the “Year of Agricultural Renewal”, with the anganwadi worker plays a key role in respect to soil health cards for small farmers the convergence of services for the mother and other issues. and the child under six years of age. She Developing a Food Guarantee Bill should be recognized as a regular full time employee with specific skills and her Following up on the NREGA and recognising remuneration should be revised accordingly. that the right to food and the right to livelihood are intimately related, we need to move Rural Livelihoods towards a comprehensive “Food and The Dialogue recommends that the policies Employment Guarantee Act”. of indiscriminate liberalisation (such as the Community Food Security Systems drastically low levels of import duty on cotton), which have contributed a great deal Universal PDS with uniform prices affordable to the rural and agrarian crisis, should be to the poor should be maintained and critically reconsidered. strengthened. There is also a role for community based food security systems, The economic policies should be reoriented such as community grain banks, in specific to provide adequate support for India’s situations. agriculture and its vast rural population. In particular, policies must provide adequate Reform of the delivery system rural infrastructure, including power, and The overall approach of the delivery system promote employment, besides ensuring should be life-cycle based and involve credit facilities and remunerative prices for appropriate supplementation programmes. the produce.

Hidden Hunger Fourth Commonwealth-India Small Business Competitiveness Development Programme, Food security is a pre requisite for nutrition 23-28, April 2006, Chennai and Pondicherry security. Hence steps taken for mitigation of micronutrient malnutrition should also The Commonwealth Secretariat, Export-Import

132

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Bank of India (EXIM Bank), MSSRF and Livelihood Rehabilitation Programme: Government of India’s Ministry of Small Scale selected widows and children of farmers who Industries and Agro & Rural Industries jointly have committed suicide and who have at hosted a six-day capacity building programme least class VIII level education, are being on Small and Medium Enterprise Development. given training to become managers of Sixty participants from 34 commonwealth VKCs/ Gyan Chaupals. The VKC movement countries across the six continents participated, is to be expanded with VRCs to be setup in 34 of them were women participants. In the Amravati, Yawatmal and Washim in the workshop, the participants discussed SMEs coming months. Training in spinning is also and poverty alleviation; SMEs and economic being provided to widows and children of development; comparative roles of institutions; some of the affected farm families at the SME development – the role of SHGs and NGOs Waifad VRC, under an agreement with in India; SME development – the role of Mahila Seva Mandal, Sewagram, which will indigenous business, agro & rural industries and also buy back the yarn. SME financing. Functional Literacy programme: Tata Consultancy Services (TCS) and the Launch of Education and Livelihood Amravati district administration have tied up Rehabilitation Programme in Vidarbha, to explore introduction of the functional 1 May, 2006, Nagpur literacy package of TCS at NREG worksites The following initiatives were launched at a in Amravati district on a pilot basis, in order function held at the College of Agriculture, to enable the labourers at the site to acquire Nagpur and chaired by Professor M S literacy skills. Swaminathan, on 1 May 2006, Maharashtra The Panjabrao Deshmukh Krishi Vidyapith Day: and Rashtriyasant Tukdoji Maharaj Nagpur University, at Professor Swaminathan’s Education Support Programme for children suggestion, announced the launch of Hope of farm families where there have been Generation Teams of students and teachers suicides: a pilot launched in Wardha district, to go to distress hotspots to address the the programme will enable boys and girls problems of farmers. from families affected by suicides to pursue their education from the primary school level Mission 2007 Technology Partners Meeting, to the plus two level. About 70 children will 4 May, 2006, Chennai, benefit under this scheme. A local level Under Mission 2007: Every Village a Knowledge coordination committee headed by Mr J L Centre, MSRF and International Development Salway, Chairman, Wardha District Land Research Center organized a one-day brain- Development Bank, has been formed for storming session at MSSRF, Chennai. The main implementing the programme. aim of the meeting was to decide how

133

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ technology partners could support the capacity (hazard + vulnerability = disaster) preparedness building training for VKC workers, rural children, module for tsunami rehabilitation area (bio- rural youth, panchyat raj members; shield, livelihood, VRC/VKCs, agronomic and development of e-learning packages for rural children education) staff. communities; software development for domestic needs, especially in panchyats, rural Two experts from SEEDS acted as resource schools, hospitals, markets, etc.; setting up of persons and covered aspects such as tsunami urban to rural call centers, setting up of rural to impact, the next disaster, risk reduction, urban e-marketing facilities, etc. Some of the community-based action and community based major decisions of the meeting are as follows: disaster preparedness strategies. The participants were divided into six thematic Mission 2007 partners should attempt groups (Bioshield, Livelihood, Health, Shelter, developing a common minimum framework Education and VRC/VKC) for in-depth for service standards to help the Government discussion on the above issues. Experts also implement the Gyan Choupals. shared the Hyogo Framework for Action 2005- A framework should be developed for Mission 2015: Building the Resilience of Nations and 2007 technology partners to collectively Communities to Disasters to the participants. engage and contribute one or two common Officials from ISRO also participated in this programmes. meeting and discussed several government initiatives in disaster management (including Service charges levied against rural service guidelines to state governments, national providers should be withdrawn for Gyan disaster management framework, disaster Choupals. prevention and mitigation, etc.). This meeting Media Lab Asia tools would be made also included lectures on “Integrating Disaster available to all Mission 2007 partners. Management with Sustainable Management” TCS would adopt Community Knowledge and “Satellite Remote Sensing and Disaster management Toolbox as their contribution Susceptibility Appraisal”. to Mission 2007. Workshop on Creating and Networking of Mission 2007 Secretariat would aim to map Village Knowledge Centres, 6-7 June, 2006, all the VKCs operating in each and every Pondicherry village, block, district and state. Since 1997 MSSRF has been setting up VRCs Interaction meeting on development of and VKCs. On 6 and 7 June 2006, it shared its community-based disaster preparedness experiences with NGOs in the form of an modules, 26 May, 2006, Chennai interaction workshop. Fifty three participants MSSRF conducted an interaction meeting on from 41 NGOs, one Farmers club and one how to develop a community-based disaster Panchayat leader participated.

134

INFORMATION, EDUCATION AND COMMUNICATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

The following aspects were discussed in the Significant issues and needs in the area of workshop operation

Concept and activities of VRCs and VKCs Possible collaborations for establishing and operating VKCs – role of NGOs and MSSRF Steps and process involved in VRC and VKC establishment Mission 2007: Every Village a Knowledge Centre Importance of 5Cs (Connectivity, Content, Capacity Building, Care and Management Networking exercise and Coordination) State level sharing of forums, setting up of Opportunities and constraints for NGOs in Tamil Nadu Mission 2007 NGO Chapter establishing VKCs

135

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Sub Programme Area 700

Special Projects

The study on measuring the impact of science and technology on agriculture and rural development has made significant progress and the report will be finalized shortly. Initiatives taken for medium and long-term rehabilitation programmes in the tsunami affected areas have made good progress. A detailed situational analyzis has been carried out to identify the areas of intervention in the V&A project sites.

701 Measures of Impact of Science and Technology: Agriculture and Rural Development. .. 137

702 Tsunami Rehabilitation Measures ...... 138

703 Vulnerability Assessment And Enhancing The Adaptive Capacity To Climate Change In Semi-Arid India - SDC (V & A) Project ...... 148

136

SPECIAL PROJECTS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

indicators such as level of production, yield per Sub Programme Area 701 hectare, per capita output and value of output per hectare are analysed with regard to some Measures of Impact of Science selected crops over a fifty-year period since and Technology: Agriculture and 1950-51. While changes with regard to many Rural Development indicators are discussed, ‘value of output per hectare’ is chosen as a summary measure of technological achievement in the agricultural The study on measuring the impact of science sector. In the animal husbandry sector, the and technology on agriculture and rural study concentrates on cattle, poultry and small development, was commissioned by the Office ruminants. In the dairy sector, ‘artificial of the Principal Scientific Adviser to the insemination with improved germplasm’ is Government of India in March 2004. It has been identified as the catalytic technology and ‘value conceived primarily in the context of of milk per milch animal’ is used as an indicator assessments made by UNDP’s Human to measure technological achievement. Development Report of 2001 concerning the Introduction of ‘hybrid layers’ in the poultry technological achievement of various countries sector and ‘intensive health coverage including India. The main focus is to measure programme’ among small ruminants have been the significant contributions of technological strategic technological interventions. As regards interventions across the major sectors of rural fisheries, the development of ‘composite fish economy such as agriculture, animal culture’ is identified as the catalytic technology husbandry, fisheries, forestry, energy, irrigation in the growth of freshwater aquaculture and carp and water resources and health in post- production is used as an indicator to measure independent India. It concentrates on a few achievement in this field since the year 1986. significant technological interventions that have In forestry, technological interventions in the been catalytic in bringing about rapid spheres of conservation, restoration, transformation in a particular sector and has a production, protection and wildlife are analysed. detailed analytical description of the With reference to irrigation, technologies that development of catalytic technologies as well have been instrumental in improving the as a quantitative analyzis of technological coverage of irrigation in the country, in particular, achievement across the various sectors under technologies related to canal irrigation and high- consideration. speed drilling in sub-surface irrigation, are The study has identified ‘varietal improvement analysed. Regarding energy, the study programme’ as the catalytic technological discusses technological interventions that intervention in post-independent India in the helped augment the supply of various sources agricultural sector. To understand the changes of energy such as thermal, hydro, nuclear and triggered by the varietal improvement renewable as well as the progress of energy programme in the sphere of production, several consumption in rural areas over time. In the area

137

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ of rural health, the national level programmes centres. Attempts have been made to develop that were initiated to combat major diseases in bioshields (see SPA 102.2 - 4), rebuild the country and the impact these programmes livelihoods, establish the VKCs (see SPA 601) have had on the incidence of diseases are and reclaim soil in the tsunami affected analysed. The technical aspects of the health agricultural fields in Cuddalore, Nagapattinam, programmes specifically dealing with Kancheepuram and Kanyakumari districts in the communicable diseases, non-communicable state of TN and Karaikal and Pondicherry regions diseases, vaccine preventable diseases and of Pondicherry. Process mode has been major nutritional deficiencies are discussed. Life adopted to facilitate the activities. Effective expectancy at birth over the last three decades coordination was ensured with the fishermen, is used as an indicator to compute technology the agricultural communities, other NGOs and achievement in the health sector. government departments involved in similar activities in the Tsunami affected villages. The The first draft of the study report is now ready village development councils (with the and consultations are being held in different representation of village leaders, traditional and places to receive comments from experts. A elected panchayat, SHG leaders, etc) are Reality Check Workshop was held on 19 April, playing a very crucial role in identifying the 2006 at the Acharya N G Ranga Agricultural concerns and planning, implementing and University, Secunderabad. Two more monitoring the rehabilitation activities. Several consultations were held on 16 May and 6 June individual and institutional donors have at Anand Agricultural University and at Forest supported the implementation and rehabilitation Research Institute, Dehradun, respectively. The activities. research report will be finalized shortly. 702.1 Reviving and Strengthening the Livelihood through Catalytic Interventions

Sub Programme Area 702 MSSRF extended support in three villages viz Tsunami Rehabilitation Measures Samiyarpettai, Muzukuthurai (Cuddalore district) and Madavamedu (Nagapattinam Initiatives were taken for medium and long term district) to buy new nets and repair boats and rehabilitation programmes based on the engines. The village level committee played a framework suggested by Prof MS crucial role in pooling and distributing the Swaminathan, Chairman MSSRF ‘Beyond resources received from MSSRF and other Tsunami: An agenda for action’ focusing on (i) NGOs to the local people without any internal strengthening the ecological foundations of conflict. When the other NGOs supplied the sustainable human security, (ii) rehabilitating boats, MSSRF helped to buy yarn for net livelihoods and fostering sustainable livelihood making and gap filling, which helped the security and (iii) putting in place knowledge fishermen to resume fishing. The support

138

SPECIAL PROJECTS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ extended by MSSRF to these three villages is borrowers. In these villages, 325 women used helping around 700 fishermen to engage in the money for fish vending; 125 were involved in fishing activities. This helped the fishermen dry fish business and 25 women started small households to earn an average income of Rs. business. 250 per day during regular fishing seasons. Backyard Poultry and Mushroom Training on need based skill development: Poduction and Marketing Mechanics to repair the engine and boats are At Sadraskuppam in Kancheepuram district, generally not available in all coastal villages, two enterprises, viz. poultry farming (broiler and the local fishermen hire them from outside. birds) and mushroom (oyster) production were Imparting the skill to repair engines and boats initiated. Two women SHGs are being involved was identified as one of the important needs of in poultry management. After 40 days, around the fishermen in the post-tsunami context. A 4,300 birds were sold and the net profit made hands - on training programme was organized by the SHGs was around Rs 25,000. The for a week in a workshop at Cuddalore. Twelve technical and business support extended by youths from the above mentioned three project Venkateshwara Hatcheries included the market villages received training on Lombardini engines. buy back. The members of the mushroom The youths reported that the training they have production group were taken for an exposure undergone on engine and boat repairing is now visit to another SHG in Pondicherry, producing helping them to manage the problem on their mushroom. The group members started selling own, without the help of mechanics from the product in the local market. Similarly, in outside. Pattinamcherry of Karaikal region, around 35 Micro Credit and Women’s Enterprise women SHG members are producing activities mushroom and selling it to supermarkets in Karaikal town. The quality and the timely supply The fisher women of Samiyarpettai, would ensure market tieup in both the cases. Muzukuthurai, and Madavamedu have revived fish vending, and other small business. The Diversification of Livelihoods through revolving fund has helped them to avoid entering Coastal Aquaculture into a debt trap of the middlemen. The women Transecting was done in the backwaters near in these 3 villages said that the support extended Madavamedu, Pazhayar and Muzhukuthurai (in in the form of ‘revolving fund’ for SHGs was the Pichavaram region) to establish the very useful. It is helping them to have a feasibility and suitability for culture fisheries with continuous access to credit with low interest. the help of experts from Periyar Integrated Fish In the 3 villages, the women have stopped taking Farm, Chennai, MSSRF staff and the loans from the moneylenders and the capital community members. The team traversed the has gone up with an additional amount of backwaters of the region and found that the (Rs.25,000) from the interest collected from the

139

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ estuaries near the villages could be used for making fish and prawn pickle and fish masala crab fattening (through pen culture and cage and iv) economics of each of the value added methods), and the open back waters for other items. The participants were involved in the activities like mud crab fattening, grooper, sea preparation process. Three items, fish and prawn bass fish in floating cage culture and oyster pickle and fish masala were prepared through and green wood culture. During the visit practical demonstration. A practical manual discussions were held with the fisherfolk on prepared in Tamil was also given to the water availability (seasonal) in the backwaters participants. The product has the advantages and mangrove canal and ownership details. An of multiple level marketing viz. within the village, exploratory survey was conducted to assess in neighbouring villages, in the nearby towns the availability of water crabs in the three landing and urban supermarkets. spots which shows that around 7.5 % of the Production and Marketing of Arbuscular landing crabs are water crabs; hence there is a Mycorhyzae (VAM) and Vermicompost by possibility to introduce crab fattening as one of Landless Labourers the income generating activities in the village. In Madavamedu, the process of crab fattening By looking at the cropping pattern in the coastal by the cage method in an area of 100 sq.feet region, which is rich in agro forestry resources was initiated and managed by the village and to promote employment opportunities in the community on an experimental basis. The group tsunami-affected farming village of members have planned to expand the area and Vettaikaraniruppu in Nagapattinam district, the number of cages. Discussion to design other members of a women SHG, belonging to activities like pen culturing of grooper, sea bass landless labourer households, were trained by etc is in progress. the scientists from TNAU, Coimbatore on the production and marketing of VAM. The group Value Addition to Fish Based Products: Fish planned and produced around 400 kg in the first and Prawn Pickle and Fish Masala cycle. The test result showed the quality of the To generate more employment and income for product is good (with 98 % spore colonization). women in the coastal villages, with the available A business tie up has been developed with resources, a three-day, intensive, hands - on Nithya Bio Products, Villupuram for marketing. training programme was conducted at The company promised to enter into an Chidambaram with the support of resource agreement and the group has planned to persons from Fisheries College and Research upscale the production in the future. Around 60 Institute, Thoothukudi. Around 50 women from women members of SHGs from landless three villages participated in the programme in households in Vettaikaraniruppu in which the following major aspects were covered: Nagapattinam and Keezhavanjoor, Karaikal are i) grading and sorting of quality fish ii) hygienic producing vermicompost. Discussions are going handling of fish iii) value addition methods like on with Nithya Bio Products for market linkages.

140

SPECIAL PROJECTS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

702.2 Agronomic Rehabilitation growers poultry estates, cashew processing, production of biofertilizers and biopesticides with In response to the great damage caused by appropriate backward, lateral and forward the tsunami waves in agricultural fields, MSSRF linkages. This would promote multiple livelihood attempted to understand the ground situation opportunities not only to the majority of small and develop strategies for effective agronomic and marginal farmers but also to the landless rehabilitation, involving the local farming labourers who form a sizable part of the local communities and other stakeholders. population and who had lost their livelihood opportunities. The recommendations were Travelling workshop on Agronomic gathered in a Report, both in Tamil and English Rehabilitation of Tsunami Ravaged Lands and disseminated to farmers, civil organizations, To understand the multi-dimensional nature of district coordination committees and the problem and to develop a scientific soil health government officials. They were also rehabilitation package, MSSRF organized a immediately uploaded in the MSSRF web site travelling workshop for three days with and disseminated through VKCs promoted by multidisciplinary experts from different parts of MSSRF functioning in Nagapattinam and the country. The participants visited the 9 Cuddalore districts and at village meetings. tsunami hit villages of Pushpavanam, Participatory Field Demonstration Vellapallam, Manikapanku, Kumarakudi, Kalamanallur, Neithavasal,Vellapallam, Based on the issues identified by the travelling Thirumullaivasal and T S Pettai. Spot workshop and on the basis of the intensity and measurements for pH and EC were conducted type of the damage, five participatory field in 18 fields and discussions were held with demonstrations were carried out in collaboration farmers. It was followed by a one-day interactive with the farmers in the following identified discussion at Chennai to consolidate the villages: Vellapallam (Rice), Vettaikaranirruppu observations and evolve recommendations. In (Groundnut and Casuarinas), Anaikovil (Rice), general, three kinds of damage to agricultural Neithavasal (Rice and groundnut) and TS Pettai land had been caused by the tsunami waves: (Groundnut). The total area covered under agronomic rehabilitation is around 23.97 ha and Deposition of slushy grayish brown clay 67 farmers are involved in the activity. The Deposition of sandy soils and intervention focused on capacity development of the farmers through participation, diagnoses, Seawater intrusion, which receded leaving analyzis and evaluation of results and helped salt in the field. to develop local resource persons to share the The team suggested the promotion of on-farm results with other farmers in the region, promote and non-farm enterprises like coconut based grassroot farmers’ organizations, and develop value added products, apiculture, dairy, small a model for farmer-led extension.

141

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Soil Reclamation Process of the fields, water drainage systems were blocked with debris and sediments, which Field specific soil reclamation practices were were removed and clear drainage was followed in each of the villages. In Vellapallam reestablished. and Vettaikaranirruppu, slushy clay material which had a high organic matter content had Sowing and in situ ploughing of green manure been deposited. Heavy metal analyzis of the species: In almost all the paddy fields deposited material indicated the concentration irrespective of the paddy cultivation method of chromium, lead, zinc, copper, nickel, Sesbania aculeate was grown and cadmium and mercury within the permissible incorporated in the field at the time of limits and thus the deposited clay could be flowering. On an average nearly 12.5 tonnes incorporated into the fields. In Anaikovil, per ha of green manure was ploughed into Neithavasal and TS Pettai villages, sandy layers the soil. had been deposited in groundnut fields and Leaching: Leaching was carried out in the seawater had intruded and stagnated in the fields wherever seawater had intruded and paddy fields. The following measures were stagnated, leading to an increase in the taken in collaboration with the local farmers in concentration of soluble salts. an integrated manner to tackle the issues: Application of Farm Yard Manure (FYM) and Deep ploughing and land smoothening: In Biofertilizers: On an average 5 t of FYM was all the selected fields, deep ploughing was applied before last ploughing. In addition, salt carried out using rotavator before sowing; tolerant strains of Phosphobacteria and field bunds were reformed/strengthened Azosprillum were applied @ 2 kg per ha. wherever necessary and land leveling was and Pseudomonas species @ 2.5 litre per carried out. ha.

Spreading and incorporation of sand/clay Selection of salt tolerant varieties: Salt deposit: In some of the fields, farmers tolerant paddy varieties like TRY 2, CO 43, scraped the deposited top layer and heaped MDU 5, ADT 43 and traditional landraces it in the field with the help of some NGOs. like kuzhivedichan were grown, and wherever With the consent of the farmers, it was possible, the transplantation method of spread evenly and incorporated into the soil cultivation was followed. through deep ploughing. Gravity drip system to enhance water use Removal of cyperus and other weed species: efficiency: Due to the increase in the salinity, The growth of cyperus weed was abundant pond water cultivation of second crops like especially in the clay deposited fields; it was vegetables was affected. To overcome the uprooted and ploughed into the fields. problem, frequent irrigation of the crop and Providing proper drainage facilities: In many increase in water use efficiency, including

142

SPECIAL PROJECTS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

simple techniques like mulching and by continuous rain and flood during panicle application of coir pith compost, were initiation stage. Stagnation of water in the field introduced. affected the yield and reduced nearly 40-80 % of the crop across the demonstration sites. The Soil Quality Status groundnut pod yield was comparable with that Periodical soil tests were carried out in the of the previous year. In Neithavasal village, rice benchmark sites as well as in the participating grown during the second season immediately farmers fields in collaboration with Agricultural after the monsoon recorded a good grain yield College and Research Institute, Trichy. The (2.5 t /ha whereas the normal average yield is results indicate that both pH and EC levels are around 2 to 2.2 t/ha). It is learnt that in this normal and the soil is suitable for crop vulnerable coastal system, attention should be cultivation. given to select varieties which have the Water Quality of Farm Ponds characteristics of salinity tolerance and flood resistance. Also, the planting method should In the villages of Anakovil, Vettaikaranirruppu be direct sowing instead of transplanting to and Vellapallam the pH measured 8.40, 8.50 to reduce the crop duration and help to overcome 8.88 and 8.01 to 8.63 respectively, while the the flood hazards during the NEM. EC was 2.60, 3.7 to 14 and 2.29 to 6.93. Soil Fertility Management The water quality in the farm ponds indicates medium to high salinity levels that cause crop To improve the soil conditions, it was planned loss in the second crop. Future efforts will focus to increase the addition of organic matter in all on reducing the water salinity. the demonstration fields, covering about 60 acres, belonging to 67 farmers in five villages. It Crop Performance was done through a combination of methods Rice and groundnut from the demonstration like in situ incorporation of green manures and fields were harvested, though the rice yield in application of FYM @ 5 t /ha. It was also the tsunami affected areas was further reduced planned to introduce allied enterprises/

Changes in the soil quality of the bench marked sites Village Jan 05 April 05 July 05 Oct 05 Dec 05 Jan 06

pH EC pH EC pH EC pH EC pH EC pH EC Anaikovil 7.1 8.3 6.99 0.48 6.85 1.9 8.1 1.1 7.8 1.1 6.9 0.14 Neithavasal 7.3 15.5 7.86 5.89 7.60 5.7 6.8 1.2 6.8 1.2 6.57 0.16 Vettaikaranirruppu 8.2 2.3 8.34 1.76 - - 7.0 0.6 7.7 0.6 - - Vellapallam 7.8 15.0 8.96 0.13 8.60 4.9 7.1 1.5 8.0 1.5 6.85 0.02 EC – Electrical Conductivity dsm-1

143

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ activities, which would help to strengthen the to increase the water use efficiency. Hence it local agro ecosystem and generate employment was decided to introduce Gravity Drip Irrigation, and additional income to farm/labourers families. coupled with pedal pump lifting technology. The initial survey to instal the unit was completed Decentralized vermicompost: Considering the in two villages (Vellapallam and fast decomposition rate of the added organic Vettaikaranirruppu) covering an area of 400 and matter, the availability of cow dung and other 200 M2 for vegetables and coconut respectively. agro wastes and soil texture, vermicomposting technology was demonstrated to the local Contingency Cropping farmers in four villages. Thirty farmers were Owing to heavy flooding during the north-east trained in the production process with hands- monsoon and the frequent cyclones, farmers on experience and exposure visits to the incurred heavy losses of nearly 40-70 % in their commercial production unit managed by a standing paddy crop. Small scale planting of farmer. The local production cost is around Rs sweet potato was undertaken as a life-saving 0.85 per kg and the cost benefit ratio is 1: 2.09. crop with the support of CTCRI, Water Management Tiruvanathapuram. Five thousand cuttings of three different varieties viz. Kanjangad, Sree Farm ponds play a vital role in providing Rathna and Sree Arun were distributed to 37 irrigation to the second crop. The major activities farmers in six villages. Sree Rathna and Sree carried out were removal of salt water and Arun (spreading type) are of 90 to 100 days desilting of farm ponds, followed by duration whereas Kanjangad is semi- spreading strengthening the pond bunds through the with a duration of 120 days. The results planting of fodder crops. indicated that the harvested quantity was To provide an alternative to the traditional 12 tonnes per ha for Sree Rathna, 18 tonnes methods of lifting of water, pedal pump per ha for Sree Arun and 19 tonnes per ha for technology, which has the capacity to deliver Kanjangad. In future, it is essential to develop 60- 80 liters of water per minute, was a contingency crop plan for each of the villages and develop linkages to get the seeds or demonstrated in two villages with the support planting materials. of the organization ‘Water for Third World’. According to the farmers, the technology is Training and Capacity Building affordable and replicable. ‘Water for Third World’ In each of the villages the farmers were has shown an interest in training the local people mobilized and need-based training and capacity on the production of pumps and helping the building programmes were organised. Several farmers to replicate it in their fields. technical and academic institutions were Where the soil is of a sandy texture, the use of involved in the training programme. Training and pedal pumps or direct irrigation is not needed capacity building programmes were organised

144

SPECIAL PROJECTS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ on soil reclamation, IPM in paddy and seed 702.3 ICT based Village Knowledge Centres treatment techniques using biofungicides and for Strengthening the Ecological and biofertilizers, water saving irrigation methods, Livelihood Security of Coastal Communities high value multipurpose tree crops and fodder VKCs located in the coastal areas of crops, livestock management, especially the Pondicherry played a major role immediately small ruminants, vermicomposting and effective after the first tsunami attack and in post-tsunami microorganism usage and improved agronomic relief. The public address network in these VKCs practices for groundnut cultivation. Totally around helped to distribute the tsunami relief materials 747 trainee days were completed. These to the affected community in an effective way. farmers are slowly emerging as local resource Ten VKCs were established in the tsunami persons. affected coastal districts of Kancheepuram, In order to enhance the awareness among the Cuddalore, Nagapattinam and Kanyakumari farmers on biofertilizers, ‘Biofertilizer day’ was districts of TN with the support extended by organized at Vettaikaranirruppu village, with the several donors. support of the Department of Microbiology, Villagers in the tsunami affected areas were TNAU, Coimbatore, Agricultural department and desirous of establishing VKCs in their villages. TRRI, Aduthurai in which about 120 women and VKCs were established and are functioning in 60 men participated. Exhibits of the different the tsunami affected villages. types of biofertilizers were arranged. Capacity Building for the VKC Workers Strengthening Livestock Resources Training and capacity building was organized Apart from agriculture, the activity that for the VKC workers in the tsunami affected supplements the income of the farm households villages. Under this programme many skills and is goat and cattle rearing. Healthy feeding methodologies for the dissemination of content systems and animal health care received were covered. attention. In order to strengthen the resources, NVA Fellows – SHGs Members Interaction exposure visits were organized to Livestock Meeting at Kovalam Research Institution, Kattupakkam, and Chennai. The visits helped the farmers to realize A meeting between the Jamsetji Tata National the importance of animal health care and Virtual Academy fellows and local SHGs was nutritional management. Based on the farmers’ organized at Kovalam, in Kancheepuram District. The NVA Fellows shared their requirement, slips of CO 3 variety of Cumbu experiences with SHG members. The Fellows Napier grass were supplied and steps were explained how VKCs could help in meeting the taken to introduce protein rich green forage like local information needs. They could supply agathi, soundal, Lucerne etc. information about the developmental schemes

145

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ promoted by different agencies and facilitate Satellite Connectivity linkages with these agencies. They also Under the joint ISRO-MSSRF Village Resource explained how the knowledge obtained from the Centre programme, ISRO has expanded the VKCs has added value to their personal life. VRC programme with satellite connectivity to The other topic they discussed was the the tsunami affected villages in Pondicherry, accounts software, which would help the SHGs Nagapattinam, Chidambaram and to keep their accounts in order. Since the Kanyakumari. These centers are facilitating accounts are computerized, it paves the path teleconferences between farm and fishing for accountability, transparency and trust families at these locations and MSSRF building among the group members. VKCs could also provide a database on local doctors, scientists as well as with leading experts in lawyers and other professionals. the area of health, education, agriculture, fisheries, marketing and disaster management. Computer Aided Learning Programme The Nagapattinam VRC has been connected In Nagapattinam the Computer Aided Learning to National NVA Hub in Chennai with the Programme is being conducted in two VKCs at technical (satellite connectivity) support of Akkarapettai and Prathabaramapuram. This ISRO. Video conferences with farm and fisher programme is being conducted for the past six families of Nagapattinam district were organized. months. Children from the age group of 7 to 18 702.4 Human Development and youth up to 24 years of age are participating in the programme. Children from government Long term Educational and Nutritional and private schools and school dropouts (from Support for Children Orphaned by the fifth to ninth standard) are regular visitors. The Tsunami Knowledge Workers assist the children to run MSSRF has been implementing a programme the CDs and guide them to get through the in association with Bharat Soka Gakkai to programme. extend necessary support for the education and Early Warning System nutritional security of children orphaned by the An early warning system has been set up with tsunami in Nagapattinam district of TN. Details the support of Indira Gandhi Centre for Atomic about the orphaned children were gathered from Research (IGCAR) for disseminating disaster the district social welfare department and related information as an experiment in the VKC DRDA. NGOs which are actively working in the at Sadraskuppam, Kancheepuram district. The tsunami affected villages were consulted. Finally information on any natural disaster can reach a survey was conducted to identify the most the community within an hour. The transmit needy children in the four fishermen villages of activator can reach the siren located on top of Keelamoovarkarai (9 children), Madathukuppam the VKC from any point within a 500 meter (19 children), Naickerkuppam (9 Children) and radius. Thoduvai (10 children) in Sirkazhi and Kollidam

146

SPECIAL PROJECTS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ blocks of Nagapattinam district, where no other Psychological Rehabilitation organization is taking care of the education and Back to Normalcy: The play The New Wave nutritional needs of orphaned children. was organized by MSSRF in collaboration with MSSRF has identified three tsunami orphaned Nalamdana, a Chennai-based NGO, towards children who need financial support to continue psychological rehabilitation at Muzhkuthurai, their studies in Kanyakumari district with the Madavamedu and Sadraskuppam for tsunami support of the District educational officer and victims, with the support of the local village Social Welfare department. MSSRF and the Panchayats. People from other hamlets also District Educational Office have prepared a plan witnessed the play. The play focused on helping to support the children up to 12th standard. the fishing community to overcome the fear of the sea, the tsunami, and some social problems Confidence and Capacity Building for like alchoholism and domestic violence, Tsunami Widows breaking social relationships and institutions in With the support of The Kanyakumari the post-tsunami context. The importance of mangrove forests was also covered. During the Rehabilitation Resource Centre (KRRC) the feedback the village youths promised that they district level NGOs coordination committee, would not demand a dowry. Nagercoil, KODI Trust, an NGO working in the coastal areas of Kanyakumari district agreed 702.5 Training and Capacity Building for to collaborate and execute the programme. With NGOs and PRIs the help of KODI Trust, widows who are members of SHGs were identified. A training programme The toolkits on Coastal Biovillages, Bioshield on dry fish processing was organized. and VKC meant for field level workers and Experienced persons in the field were hired as project managers engaged in the development resource persons and 25 women from five SHGs work have been published. These toolkits were participated in the training programme. translated into Tamil and distributed to all Government and Non Government partnering The MSSRF field centre at Koodangulam is institutions. Training programmes on the conducting entrepreneurial training programmes development of coastal bioshields and coastal for tsunami victims in collaboration with the biovillages were organized for NGOs actively DRDA. The programme has been conducted in involved in rehabilitaion activities (see Vijapathy panchayat for women SHG members. programme area 101). The number of women covered was around 2,275 Training on Coastal Biovillages (2066 backward class, 147 schedule caste and 62 handicapped). The training programme MSSRF organized workshops on ‘Coastal Bio- includes skill building for enterprise villages’ for the representatives of around 60 development, production of fish-based, value- NGOs working in the tsunami affected villages added products and exposure visits. to revive and strengthen livelihoods. Each

147

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ training programme was organized for 3 days. During the first 2 days the following aspects Sub Programme 703 were discussed in detail: the steps involved in developing a biovillage; natural resource Vulnerability Assessment and management and livelihood opportunities in Enhancing the Adaptive Capacity aquaculture (both in capture and culture to Climate Change in Semi-Arid fisheries) and agriculture; agronomic rehabilitation of the tsunami affected agricultural India - SDC (V & A) Project fields; development of ecoenterprises and promotion of employment opportunities; and the The overall goal of the V & A programme is to role of grassroot institutions like biocouncils, secure the livelihoods of the rural poor and fisher and farmers associations in village vulnerable communities by (i) promoting development. During the first workshop the field adaptation measures that build and enhance visit was organized to Kodathur, Pondicherry, their capacity to cope with the adverse impacts to discuss some of the ongoing livelihood of climate change and (ii) improving their activities with effective forward and backward disaster preparedness. linkages with the support of banks, technical The focus of the programme is on optimising institutions, government departments and a and integrating climate-change related marketing company. During the second knowledge in existing service delivery systems workshop a field visit was organized to an in the two Indian States of AP and Rajasthan. aquaculture based IFS and a meeting was Another important aim of the V & A programme organized with the IFS practising farmers. is to catalyse and enhance communication and policy dialogue on climate change issues at An awareness programme was organized on different decision levels. the MPEDA schemes and subsidies at Nagapattinam with the support of a resource During the inception stage of the project, a person form MPEDA. Around 126 fishermen detailed situational analyzis was carried out, from five villages participated in the programme. which helped in identifying two mandals namely Also, through them, an onboard training Kondurg and Midjil in Mehbubnagar district in programme on hygienic handling of marine AP and Jhadol and Kundai blocks in Udaipur products was arranged. district of Rajasthan, for project implementation.

In addition to the above activities, MSSRF is Climate data for the past 30 years (1961 – 1990) facilitating the fisher and farming families in 3 was analysed. Employing tools like moving tsunami affected villages to get the multiple use average, probability analyzis, water balance, solar powered lights with the support of the rainfall stability period analyzis and moisture Barrett Foundation. The light would be useful index, both monthly and yearly data was for the family members in different ways. analysed for the respective regions. The

148

SPECIAL PROJECTS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ analyzis indicated that there was only climate annual rainfall. The length of growing period was variability in both the districts during the studied only 96 days. period. Both the sites are similar in terms of Based on interactions with the community and occurrence of water deficit in all twelve months of the year and both come under semi-arid the NGOs working in the respective areas, climate with high risk. In the case of possible interventions (relating to agricultural Mehbubnagar, over 30 years of the study period, practices, use of water and energy) that suit the distribution was 22 years of normal rainfall, the needs of the local communities in adapting while the district was under excess rainfall for to the climate induced stresses were identified. 3 years and with deficit rainfall for 2 years. The The activities planned for 2006 include ratio for excess to deficit was 3:1. The trend facilitation of Participatory Technology analyzis indicated that there was a deficit period Development (PTD) in agriculture, water and of 8 years, followed by 6 years of increase. Thus, energy for selected farmers and community the study on yearly and monthly rainfall data groups, demonstration of the use of certain indicated only variability rather than any change. selected local specific best practices, and Focusing on the number of rainy days, the study building capacities of extension officers at revealed that between the first year of the study various levels (local, block and district level) and the terminal year, there was a 32 % through curriculum development and training on reduction in the number of rainy days in total. assessment tools and adaptation measures. However, within the study period, only variability Besides development of information packages, was seen. With respect to maximum and education and communication materials, a minimum temperatures, no change was variety of awareness-raising campaigns using observed, except annual variability. The 50 % local theatres and folk arts have been initiated. initial probability was around annual mean rainfall. The Length of Growing Period (LGP) The Steering Committee of the V&A project met was 169 days between May and October. during the year and approved the Yearly Plan of Operation (YPO) and the budget. Other In case of Udaipur, during the same period of significant meetings that took place this year time, the district was under excess rainfall for include an in-house capacity building workshop 4 years, with 18 years of normal rainfall, and 8 for programme partners, a knowledge sharing years of deficit rainfall. The trend analyzis on workshop among the various agencies working monthly and yearly data set indicated only on climate change in India and a high level variability. With respect to the number of rainy Project Review Committee meeting. Project days there was an increase in rainy days during the terminal year in comparison with the first partners participated in the Conference of Party year of the study period. The analyzis of Meeting (COP 11) of the United Nations maximum and minimum temperatures Framework Convention on Climate Change indicated only variability. The 50 % initial (UNFCCC) held in Montreal, Canada in probability rainfall was only 50 % of the mean December 2005.

149

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Publications Pondicherry: An Anthropological Perspective. Monograph no. 19. MSSRF, Chennai. 56pp. Books/Monographs/Manuals Mathew, Elsy. 2005. Jaivavaividhya Act 2002 Athreya, V. B. 2005. Dr. Ambedkar and India’s and Jaivavaividhya Chattangal 2004. Neoliberal Reforms. Dr. Ambedkar Memorial (Malayalam). Manual no.28. M. S. Lecture. Dr. Ambedkar Centre for Economic Swaminathan Research Foundation, Wayanad. Studies, University of Madras, Chennai. 20pp. 80pp

Bala Ravi, S., N. Anil Kumar and T. Raveendran. Sujaya, C. P. 2006. Climbing a Long Road: 2005. Karshakaruda Avakashangal - Manual Women in Agriculture in India – Ten Years After on Farmers’ Rights. (Malayalam). Manual Beijing. Monograph no.20. MSSRF, Chennai. no.27. M. S. Swaminathan Research 132pp. Foundation, Wayanad. 55pp Thamizoli, P., A. Gopalakrishnan, R. Chadha. K. L. and Swaminathan, M. S. (eds.). Rengalakshmi and Vishwanath Palled. 2005. 2006. Environment and Agriculture. Malhotra Uyiriyal Graamangal = Coastal Biovillage Publishing House, Delhi. 900pp Toolkit. (Tamil). Manual no.29. M. S. Swaminathan Research Foundation, Chennai. M. S. Swaminathan Research Foundation. 54pp. 2005. Crop Diversity and Tribal Empowerment: Policy Makers’ Workshop and Panel Thesis Discussion. Proceedings no.60. MSSRF and Swadeshi Science Movement, Kerala. 47pp. Balaji, P. 2005. Assessing the Lichen Diversity and its Distribution Pattern for Prospecting the M. S. Swaminathan Research Foundation. Ecological and Economic Potential of Lichens 2005. Commemoration of the Tenth Anniversary within Bolampatti II Forest Range (Siruvani of the Scarascia Mugnozza Community Genetic Hills), Western Ghats, India. Doctorate Resource Centre and Gene Bank. Proceedings Awarded. no.61. MSSRF, Chennai. 24pp. Jithesh, M. N. 2005. Isolation and M. S. Swaminathan Research Foundation. Characterization of cDNA Isoforms for Catalase 2005. Reaching the Unreached Gene from Avicennia Marina (Forsk.) Vierh. and and Voicing the Voiceless: A Study on the its Expression in Transgenic System. Doctorate Impact of Namma Ooru Seidhi, A Community Awarded. Newsletter in Pondicherry. Monograph no.18. MSSRF, Chennai. 120pp. King, E. D. Israel Oliver. 2006. Sacred Forests of Kolli Hills, Tamil Nadu, India: A Study on M. S. Swaminathan Research Foundation. Botany, Ecology and Community Interactions. 2005. Village Knowledge Centres in Doctorate Awarded.

150

PUBLICATIONS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Malarvannan, S. 2005. Studies on Biocontrol Bala Ravi, S. 2006. Infirmities and of Helicoverpa Armigera using Traditional Plants. Inconsistencies of Indian Legislations on Access Doctorate Awarded. and Benefit Sharing. Current Science. 90(1): 15-19. Nageswaran, M. 2005. A Study on Integrated Intensive Farming System. Thesis submitted Balaji, P. and G. N. Hariharan. 2005. Annotated to the Bharathidasan University in partial Checklist of the Lichens of Chennai, Tamil fulfilment of requirements for the degree of Nadu, India. Phytotaxonomy. 5: 2-8. Doctor of Philosophy. Balaji, P., P. Bharath, R. S. Satyan and G. N. Prashanth, S. R. 2005. Characterization of Hariharan. 2006. In vitro Antimicrobial Activity Copper Zinc Superoxide Dismutase Gene from of Roccella montagnei thallus Extracts. Journal Mangrove Plant Avicennia marina (Forsk.) of Tropical Medicinal Plants. (in press). Vierh. and Transformation into Rice for Salinity Bhanumathi, K. 2005. Role of Media in Disaster Tolerance. Doctorate Awarded. Management: Need for Purpose over Technique. Subramanian, H. M. SR. 2006. Studies on Media and Disaster – Experts’ Views on the Role Sodium Chloride Tolerance of Sesuvium of Media during Disasters. (ed.) R. Sreedher. portulacastrum. Thesis submitted to the Educational Multimedia Research Centre, Anna University of Madras in partial fulfilment of University, Chennai. 49-54. requirements for the degree of Doctor of Danielson, F., M. K. Sorensen, M. F. Olwig, V. Philosophy. Selvam, P. Faizal, N. D. Burgess, T. Hirashi, V. Articles in Journals/Books M. Karunagaran, M. S. Rasmussen, L. B. Hansen, A. Quarto and N. Suryadiputra. 2005. Anil Kumar, N. and M. K. Ratheesh Narayanan. The Asian Tsunami: A Protective Role for Coastal 2005. Nutritious Weeds in Wayanad, Kerala. Vegetation. Science. 310(5748): 643. Down To Earth. 6(4): 45. Eganathan, P., H. M. SR Subramanian, R. Latha Arunachalam, V. 2005. Plant Breeding: and C. Srinivasa Rao. 2006. Oil Analyzis in Translation, Transgression or Transformation? Seeds of Salicornia Brachiata. Industrial Crops Perspectives of Agricultural Research and and Products. 23(2): 177-179. Development. (eds.) C. Ramasamy, S. Ramanathan and M. Dhakshinamoorthy. Tamil George, Suja, S. R. Prashanth and Ajay Parida. Nadu Agricultural University, Coimbatore. 675. 2005. Species and Genetic Relationships in Pennisetum Species. Journal of Biochemistry Arunachalam, V., Shefali Verma, V. Sujatha and and Biotechnology. 14: 141-147. K. V. Prabhu. 2005. Marker-aided Genetic Divergence Analyzis in Brassica. Journal of Hariharan, G. N. and P. Balaji. 2005. Use of Genetics. 84(2): 123-130. Lichens in Bird Nest Construction: Observations

151

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○ from Bolampatti Range, Tamil Nadu, Western Parasuraman, N. 2006. PROFILE – Dr. M. S. Ghats. Journal Bombay Natural History Society. Swaminathan: The Apostle of Global Peace, 102(1): 121-123. Nutrition, and Food Security. One India, One People. 9(6): 40-42. Jithesh, M. N., S. R. Prashanth, K. R. Sivaprakash and Ajay Parida. 2006. Monitoring Parida, Ajay, S. R. Prashanth, M. N. Jithesh, Expression Profiles of Antioxidant Genes to and K. R. Sivaprakash. 2006. Transformation Salinity, Iron, Oxidative, Light and Hyperosmotic of the Three Antioxidant Genes from a Highly Stresses in the Highly Salt Tolerant Grey Salt Tolerant Gray Mangrove, Avicennia Marina Mangrove, Avicenia Marina (Forsk.) Vierh. by Forsk. (vierh.) in Indica Rice. Proceedings of nd mRNA Analyzis. Plant Cell Reports. DOI: 10. the 2 National Plant Breeding Congress. 1007/s00299-006-0127-4. TNAU, Coimbatore. 23.

Kesavan, P. C. 2005. Oxygen Effect in Radiation Paul, Diby, N. Dineshkumar and Sudha Nair. 2006. Proteomics of a Plant Growth Promoting Biology: Caffeine and Serendipity. Current Rhizobacteria, Pseudomonas Fluorescens Science. 89(2): 318-334. MSP-393 subjected to Salt Shock. World Kesavan, P. C. and A. T. Natarajan. 2005. Journal of Microbiology and Biotechnology. 22 Cytogenetics for Dosimetry in Cases of (4): 369-374. Radiation Accidents and Assessing Safety of Paul, Diby, S. Bharathkumar and Sudha Nair. Irradiation Food Materials. Current Science. 2005. Osmotolerance in Biocontrol Strain of 89(2): 360-365. Pseudomonas Pseudoalcaligenes MSP-538: A Kesavan, P. C. and M. S. Swaminathan. 2005. Study using Osmolyte, Protein and Gene Ethical, Social, Environmental and Economic Expression Profiling. Annals of Microbiology. Issues in Animal Agriculture. Applications of 55(4): 245-250. Gene-Based Technologies for Improving Animal Selvam, V. 2006. Reflections of Recent Tsunami Production and Health in Developing Countries. on Mangrove Ecosystem, Cuddalore Coast, (eds.) H. P. S. Makkar and G. J. Viljoen. India. Geomatics in Tsunami. (eds.) S. M. Springer, The Hague. 447-462. Ramasamy, C. J. Kumanan, R. Sivakumar and Nanayakkara, C., K. Bombuwela, S. B. Singh. New India Publishing Agency, New Delhi. 179-190. Kathirgamanathar, N. K. B. Adikaram, D. S. A. Wijesundara, G. N. Hariharan, P. Wolseley and Senthilkumar, P., M. N. Jithesh, M. Parani, S. V. Karunaratne. 2005. Effect of some Lichen Rajalakshmi, K. Praseetha and Ajay Parida. Extracts from Sri Lanka on Larvae of Aedes 2005. Salt stress effects on the Accumulation aegypti and the Fungus Cladosporium of Vacuolar H+ -ATPase subunit c transcripts cladosporioides. J. Natn. Sci. Foundation Sri in wild rice, Porteresia Coarctate (Roxb.) Lanka. 33(2): 147-149. Tateoke. Current Science. 89(8). 1386-1392.

152

PUBLICATIONS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Sivaprakash, K. R., S. Krishnan, S. K. Datta Vulnerable Sections. Chronic Poverty and and Ajay Parida. 2006. Tissue Specific Development Policy in India. (eds.) Aasha Kapur Histochemical Localization of Iron and Mehta and Andrew Shepherd. Sage, New Delhi. Immunoblot Analyzis of Ferritin Gene 337-371. Expression in Transgenic Indica Rice Pusa Basmati (Oryza sativa L.). Journal of Genetics. Swaminathan, M. S. 2006. Towards An (in Press) Evergreen Revolution in Agriculture. Indian Journal of Fertilisers. 1(10): 15-23. Suryanarayanan, T. S., N. Thirunavukkarasu, G. N. Hariharan and P. Balaji. 2005. Occurrence Thamizoli, P., R. Rengalakshmi, R. of Non-obligate Microfungi inside Lichen thalli. Senthilkumar, T. Selvaraju and Sudha Nair. Sydowia. 57: 119-129. 2005. Post Tsunami Agronomic Rehabilitation in Nagappattinam and Cuddalore Districts, Swaminathan, M. S. 2005. Agricultural Tamil Nadu. Proceedings of the National Research and Education: 100 Years Later. Seminar on Strategies for Improved Farming Perspectives of Agricultural Research and and Ecological Security of Coastal Region. Development. (eds.) C. Ramasamy, S. (eds.) D. Burman, C. Karpagam, B. K. Ramanathan and M. Dhakshinamoorthy. Tamil Bandyopadhyay, A. R. Bal and Sitangshu Nadu Agricultural University, Coimbatore. 1-11. Sarkar. Indian Society of Coastal Agricultural Swaminathan, M. S. 2005. Science and Research, West Bengal. 103. Shaping our Agricultural Future. 43rd All India Convention on Oilseeds, Oils Trade and Industry Velayutham, M. 2006. Soils. Handbook of 2005: Souvenir. The Soybean Processors Agriculture. ICAR, New Delhi. 154-182. Association of India (SOPA), Indore. 1-21. Vepa, Swarna S. 2005. Feminisation of Swaminathan, M. S. 2006. Science and Agriculture and Marginalisation of their Technology for Sustainable Food Security. Economic Stake. Economic and Political Indian Agriculture in the New Millennium: Weekly. 40(25): 2563-2568. Changing Perceptions and Development Policy. Papers Presented in Conferences/Symposia Volume 2. (eds.) N. A. Mujumdar and Uma Kapila. Academic Foundation, New Delhi. 169- Athreya, V. B. 2006. Indian Agriculture in the 191. Era of Globalization. UGC National Seminar on Swaminathan, M. S. 2006. Serving Farmers and Inclusive Versus Exclusive Growth. NSS Saving Farming: Draft National Policy for College, Palakkad, Kerala. March 20-21. Farmers. Kisan World. 33(6): 6-7. Athreya, V. B. 2006. Food Security in South Swaminathan, M. S. 2006. Technological Asia. Invited Lecture. Central University of Change in Food Production: Implications for Hyderabad, Hyderabad. April 24.

153

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Athreya, V. B. 2006. Food Sovereignty and Science, Development and Media Studies Globalization in South Asia. Seminar on (CSDMS), New Delhi. October 17-19. Globalization and Food Sovereignty. South Asia Chandrasekaran, A. 2005. Achieving Millennium Network for Social and Agricultural Development Development Goals and Grass Roots (SANSAD), New Delhi. April 25. Development. Third International Conference on Athreya, V. B. 2006. Food Security and Rural India. Bhoovigyan Vikas Foundation, Globalization. Millennium Guest Lecture. S. V. Hyderabad. November 10-12. Agricultural College, N. G. Ranga Agricultural Chandrasekaran, A. and K. G. Mani. 2005. University, Tirupati. April 28. Concept of IPNS and its Components. Training Bala Ravi, S. 2006. Harmonizing Indian Soil Scientists. Department of Agriculture, Tamil Agricultural Science and Technology Transfer Nadu Government, Chennai. October 17-19. Management with IPR Regime. National Chandrasekaran, A. and K. G. Mani. 2005. Seminar. TAAS and IARI, New Delhi. January Creating Awareness on IPNS Concepts. Training 7-8. Soil Scientists. Department of Agriculture, Tamil Bala Ravi, S. 2006. Biotechnology and Indian Nadu Government, Chennai. October 17-19. Agriculture. Symposium on the Culture of Innovation in Science and Technology in India. Chandrasekaran, A. and K. G. Mani. 2006. Hyderabad Central University, Hyderabad. Participatory Water Management under Dry January 19-21. Land Agriculture. Conference on Tamil Nadu Agricon 2006. Confederation of Indian Industry, Balaji, P., P. Bharath, R. Valarmathi, M. Trupti Trichy. February 11-12. and G. N. Hariharan. 2006. Snap Shot of Diversity and Distribution Pattern of Lichens in Chandrasekaran, A. and K. G. Mani. 2006. Dry Deciduous Forest from Bolampatti II Forest Production and Marketing of Trichogramma Range, Western Ghats. National Seminar on Parasitoid. Conference on Tamil Nadu Agricon Advances in Plant Sciences. Bharathidasan 2006. Confederation of Indian Industry, Trichy. University, Trichy. February 24-25. February 11-12.

Balasubramanian, T. N. 2006. Vulnerability Dineshkumar, N., Diby Paul and Sudha Nair. Assessment and Enhancing Coping 2005. Studies on Osmotolerance in Mechanism against Climate Change. Bi-Monthly Pseudomonas Florescens MSP-393, a Plant Workshop of Indian Meteorological Society. Growth Promoting Rhizobacteria from Coastal Indian Meteorological Society, Chennai. May Agri-Ecosystem. National Symposium on 16. Microbial Technology for Productive Agriculture. Bhanumathi. K. 2005. The Needs, the State and Tamilnadu Agriculture University, Coimbatore. E-Governance. Conflux 2005. Centre for October 7-8.

154

PUBLICATIONS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Eganathan, P. 2005. Medicinal Plants – Past, Reconciling Human Security and Environmental Present and Future. Invited Special Lecture for Protection. Workshop on Crossroads for Planet Sciencillations 2005. Sri Akilandeswari Earth. Foundation for the Future, Bellevue, USA. Women’s College, Wandiwash. September 23. April 6-8.

Gnanappazham, L. 2005. Application of Remote King, E. D. Israel Oliver, L. R. Gopinath and D. Sensing and GIS in Rural Development. National Sengotuvel. 2006. Role of Sacred Forests in Seminar on GIS for Rural Development. Conservation of Plant Genetic Resources – A National Institute for Rural Development (NIRD), Case from Kolli Hills. National Conference on Hyderabad. September 26-28. Agrobiodiversity. National Biodiversity Authority, Chennai. February 12-15. Gnanappazham, L. 2005. Impact of Tsunami and Importance of Mangroves. Invited Lecture. Palled, Vishwanath. 2005. Development of Bio- Science Club, Chennai. December 3. Villages and Banking Interventions: MSSRF Experience. Training Programme for Senior Gnanappazham, L. 2005. Remote Sensing Level Bank Officers. Indian Bank Management Applications in Mangrove Management. ISRO Academy (IMAGE). June 10. Workshop. Department of Geology, Anna University, Chennai. December 14. Palled, Vishwanath. 2005. Micro Credit and Self-Help Groups Linkage: Exploration Towards Gopinath, L. R., E. D. Israel Oliver King and D. an Effective Alternative. National Seminar on Sengotuvel. 2006. Enhancing Contribution of Self-Help Initiatives – India and Canadian Agrobiodiversity for Conservation and Experiences. Shastri Applied Research Project Community Development. National Conference and Project on Third Sector Governance. on Agrobiodiversity. National Biodiversity Mysore University, Mysore. December 23. Authority, Chennai. February 12-15. Palled, Vishwanath. 2005. Promotion of Self- Kesavan, P. C. 2005. Designing Community- Help Groups and Banking Interventions. MSSRF Centered Disaster Management Systems: Experience. Training Programme for Senior Research Issues at the Sri Lanka Consultation. Level Bank Officers. Indian Bank Management Workshop on Post-Tsunami Research Needs Academy (IMAGE). September 1. and Opportunities. IDRC and ITDG – South Asia, Colombo. June 22. Palled, Vishwanath. 2005. Role of Development Organizations in Promotion of Market Driven Kesavan, P. C. 2005. Managing Extreme Natural Microenterprises for Livelihood Security. Disasters in Coastal Areas. Meeting on Extreme Workshop on Self-Help Groups and Bank Natural Disasters. The Royal Society, London. Linkage. ICRISAT and IDS, Dharwad. July 28. October 26-28. Parasuraman, N. 2006. Every Child A Scientist Kesavan. P. C. 2006. Crossroads for Planet Programme. 93rd Indian Science Congress. Earth: Harnessing Science and Technology for Rajendranagar, Hyderabad. January 3-7.

155

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Parasuraman, N. 2006. M. S. Swaminathan – Region, Western Ghats, Tamil Nadu, India: Its The Appostle of Global Peace, Food and Correlation to the Disturbance Regime. Botany Nutritional Security. ISYP Workshop on New 2005: Learning From Plants. Austin, Texas. Challenges to Human Security. Wageningen, August. 13-17. Netherland. June 14-16. Senthilkumaran, S. 2005. Indian Experience of Parida, Ajay. 2005. Rice Biofortification through E-Community Centres and K-Agrinet. Genetic Modification. Rice Crop Group Meeting Conference on Indian Experience of E- for the Global Efforts on Biofortification. IRRI, Community Centers and K-Agrinet. Development Academy of the Philippines (DAP), Philippines. November 8-10. Philippines. October 26-28. Parida, Ajay. 2006. Biotechnology and Water Senthilkumaran, S. 2005. Sharing Indian Security. Panel Discussion on Biophysical and Experience of Village Knowledge Centres: A Socio-Economic Dimensions of Food Security Similar Concept to Vidatha. Conference on in the Developing Countries. Indian Science Sharing Indian Experience of Village Knowledge Congress, Hyderabad. January 6. Centers: A Similar Concept to Vidatha. National Parida, Ajay. 2006. Science and Technology for Science Foundation, Colombo. July 1-5. Rural Renaissance. Plenary Session on Senthilkumaran, S. 2006. WFUNA Task Force Science and Technology for Rural on WSIS – Where To Go From Tunis? Development. Indian Science Congress, Conference on WFUNA Task Force on WSIS Hyderabad. January 7. – Where To Go From Tunis? Danish United Nations Association, Copenhagen, Denmark. Parida, Ajay. 2006. Biotechnology for Agriculture February 21-22. and Nutrition Security. Symposium on Frontiers of New Biology. Indian Institute of Advanced Sivaprakash, K. R. and Ajay Parida. 2006. Studies, Ahmedabad. April 28-29. Fortification of Iron in Indica Rice Seed by Endosperm Specific Expression of Iron Storage Paul, Diby and Sudha Nair. 2005. Salt Protein Ferritin Gene. National Conference on Adaptation in the Biocontrol Bacterium, Gene Constructs. Indian Institute of Horticultural Pseudomonas Fluorescens MSP-393: A Study Research, Bangalore. May 17-18. using Proteomic and Genomic Tools. International Workshop on Plant Microbe Subbiah, Vijay R. 2005. Prospects of Organic Interactions. University of Madras, Chennai. Food. Seminar on Indian Food Processing December 7-9. Industry – Issues and Prospects. Indo- American Chamber of Commerce, South India Prithiviraj, Bharath and G. N. Hariharan. 2005. Council and Federation of Indian Export Lichen Diversity and Distribution Pattern in the Organisations Southern Region, Chennai. Dry Deciduous Forests of Walayar-Madukkarai August 18.

156

PUBLICATIONS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Subbiah, Vijay R. 2005. Site Specific Farming Sharing. TERI, Winrock and NATCOM, New Approaches in the Context of Ecological Delhi. August 30. Farming. Training on Farming for the Future – Arivudai Nambi, A. 2005. Incountry Consultation Ecological and Economic Issues and Review Meeting on ADB’s Water Policy. Asian Strategies. Centre for Advanced Studies, Development Bank, New Delhi. September 28-29. Department of Agronomy, Tamil Nadu Agricultural University, Coimbatore. November 12. Arivudai Nambi, A. 2005. United Nations Subbiah, Vijay R. 2006. Partnering for Self Framework on Convention on Climate Change Sufficiency in Sustainable Agricultural (UNFCCC) CoP-11 Meeting. Montreal, Canada. Practices. 6th Annual Workshop of Sesame and November 27- December 15. Niger Research Workers – 2006. All India Arivudai Nambi, A. 2005. Workshop on Rural Coordinated Research Project, Kayamkulam Energy Management. Energy Management Centre, Amrithapuri. April 18-19. Institute, Cochin. September 9-11. Thamizoli, P. 2005. Post Tsunami Rehabilitation Arivudai Nambi, A. 2006. 93rd Indian Science – Efforts by M. S. Swaminathan Research Congress. Acharya N. G. Ranga Agricultural Foundation. Seminar on Tsunami Rehabilitation University, Hyderabad. January 2-6. Mediated. Asian College of Journalism, Chennai. September 3-4. Arivudai Nambi, A. 2006. GEF National Dialogue Meeting. Global Environment Facility (GEF), Thamizoli, P., R. Rengalakshmi, R. Mussoorie, Dehra Dun. January 15-16. Senthilkumar, T. Selvaraju and Sudha Nair. 2005. Post Tsunami Agronomic Rehabilitation Arivudai Nambi, V. 2006. Workshop on Benefit in Nagappattinam and Cuddalore Districts, Sharing Mechanism for Production of Tamil Nadu. National Seminar on Strategies Environmental Services. Capitalisation of for Improved Farming and Ecological Security Livestock Initiatives in India (CALPI), NAAS, of Coastal Region. Central Tuber Crops New Delhi. January 23-25. Research Institute, Thiruvananthapuram, Kerala, December 21-24. Arivudai Nambi, V. 2006. National Conference on Agrobiodiversity. National Biodiversity Participation in Training Programmes/ Authority (NBA). National Institute of Ocean Workshops Technology (NIOT), Chennai. February 12-15. Arivudai Nambi, A. 2005. NATCOM Consultative Arivudai Nambi, V. 2006. Asia-Pacific Policy Meeting on Land Use, Land Use Change and Forum on Traditional Knowledge and Traditional Forestry, Natural Ecosystem, Energy and Cultural Expressions. World Intellectual Infrastructure. Indian Institute of Science, Property Organization (WIPO), School of Legal Bangalore. July 27. Studies and University of Science and Arivudai Nambi, A. 2005. Meeting on Knowledge Technology, Cochin. April 4-6.

157

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Athreya, V. B. 2006. UNDP-IDEAS International Nageswaran, M. 2006. Workshop on Clean Conference on Post-Liberalisation Constraints on Development Mechanism (CDM). National Macroeconomic Policy. Chennai. January 27. Safety Council and Eco-Securities India, Cochin. May 23. Balasubramanian, T. N. 2005. Stakeholder Workshop on Managing Climate Risk. Climate Nair, Sudha. 2006. Review Meeting on Progress, South-Asia Programme, ICRISAT, Hyderabad. Prospects, Achievements and Challenges in November 9-11. Gender Equity through S&T in South East Asia and the Pacific. UNESCO, Jakarta Cebu Eganathan, P. 2006. Experts Group Discussion Islands, Philippines. May 30-31. on Non-Edible Grade Vegetable Oils as a Source of Decentralized Power Production. Narayanan, M. K. Ratheesh. 2005. National Ministry of Non Conventional Energy Resources Seminar on Emerging Trends in Plant (GOI), Regional Circle, Chennai. April 24. Taxonomy. Nagpur University, Nagpur. October 20-21. Girigan, G., and T. Raveendran. 2005. Training on Watershed Development. Watershed Narayanan, M. K. Ratheesh. 2005. Seminar on Organisation Trust, Ahmedabad, Pune. June 7-10. Guidelines for Translocation of Threatened Plants of India. National Botanical Research Gnanappazham, L. 2005. Application of Remote Institute, Lucknow. (Pune). September 24-27. Sensing and GIS in Agriculture and Rural Development through Village Resource Palled, Vishwanath. 2005. National Seminar on Centres. Indo-US Science and Technology Self Help Initiatives: Indian and Canadian Forum, New Delhi. November 4-5. Experiences. Shastri Applied Research Project Gnanappazham, L. 2006. RS and GIS (SHARP) and Project on Third Sector Applications for Coastal Zone Studies. Space Governance, Mysore University, Mysore. Application Centre, Ahmedabad. February 15-16. December 23.

Gnanappazham, L. 2006. Impact Analyzis of Parasuraman, N. 2005. Programme on Youth Watershed Development Programme and Affairs and Environment. Central Polytechnic Application of GIS in WDP. WOTR, College, Chennai. November 7. Ahmednagar. January 16-21. Parasuraman, N. 2005. Social Awareness King, E. D. Israel Oliver. 2006. National Programme on Global Warming. Dwaraka Doss Conference on Agrobiodiversity. National Goverdhan Doss Vaishnav College, Chennai. Biodiversity Authority, Chennai. February 12-15. October 7-8.

King, E. D. Israel Oliver. 2006. Women Parasuraman, N. 2005. State Level Workshop Development: Role of NGO’s and CBO’s. on Traditional Rain Water Harvesting Systems National Institute of Rural Development. (NIRD), in Tamil Nadu. TWARD Board, Coimbatore. Hyderabad. March 13-18. December 7-9.

158

PUBLICATIONS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Parasuraman, N. 2005. Technology Symposium Ramasubramanian, R. 2006. International on Disaster Management and Mitigation Training of Trainers on Wetland Management Technologies. The Canadian Consulate, Facilitating Multistakeholders Process and Chennai. September 26. Curriculum Development. Wageningen International, Netherlands. May 26. Parasuraman, N. 2006. 18th Ship for World Youth Programme. Japan Consulate, Chennai. Sengottuvel, D. 2005. Organic Farming Training January 30. Programme. KVK, Gandhigram. August 7-13.

rd Parasuraman, N. 2006. 93 Indian Science Senthilkumaran, S. 2006. Outcome Mapping Congress. ANGRAU, Rajendranagar, Training. International Development Research Hyderabad. January 3-7. Center (IDRC), Colombo, Sri Lanka. March 27-31.

th Parida, Ajay. 2005. 5 International Rice Subbiah, Vijay R. 2006. National Seminar on Genetic Symposium. IRRI, Manila, Philipines. Contract Farming and Crop Insurance. Tamil November 22-24. Nadu Agricultural University, Michigan State Parida, Ajay. 2005. Conference on Foods University, Anna Institute of Management, derived from Genetically Modified Crops: Issues Chennai. April 12-13. for Consumers, Regulators and Scientists. Usha, B. 2006. Hands-On Training Programme ICMR, New Delhi. September 26-28. on Micro-Array and RT-PCR. Cancer Institute, Parida, Ajay. 2005. Harvest Plus Project Chennai. April 5-15. Advisory Committee Meeting. CIAT, Cali, Awards/Honours Columbia. November 8-9. Parida, Ajay. 2005. B. M. Birla Science Prize Parida, Ajay. 2005. Joint Working Group Meeting of the MSSRF-Wageningen Agriculture in Biology. Birla Science Foundation, University. Wageningen, Netherlands. October Hyderabad. 20-22. Nair, Sudha. 2006. B. D. Tilak Award. Indian Parida, Ajay. 2006. Harvest - Plus Project National Science Acadamy. Advisory Committee Meeting. IFPRI, Parida, Ajay. 2006. Member, Advisory Board. Washington. June 8-9. International Biosafety Network, UNIDO, Parida, Ajay. 2006. Indo-Pak-USA Initiative on Geneva. Biotechnology. NAAS, New Delhi. March 23-24. Swaminathan, M. S. 2006. Ordre Du Merite Parida, Ajay. 2006. Task Force Meeting on Agricole (Commander of the Agricol Merit). Priorities for Agriculture and Animal Husbandry France. In Honour of his Eminent Service to Sector. Government of Rajasthan, Jaipur. April Agriculture and particularly to its Development 17-18. in France and throughout the World.

159

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

About the Foundation

M S Swaminathan Research Foundation (MSSRF) was registered in 1988 as a non-profit Trust, recognized by the Government of India, Department of Scientific and Industrial Research, New Delhi, and by the Director General of Income Tax Exemptions, for the purpose of exemption of contributions from Income Tax under Section 80G and sections 35(1)(ii) of Income Tax Act, 1961, read with Rule 6 of Income Tax Rules, 1962. The Ministry of Home Affairs, Government of India, has recognized the Foundation for receiving funds from sources abroad under the provisions of Foreign Contribution (Regulation) Act, 1976.

Board of Trustees

Prof M S Swaminathan Dr T Ramasami Chairman, MSSRF Secretary to Government of India Department of Science and Technology Mr R M Lala New Delhi Former Director Sir Dorabji Tata Trust, Mumbai Dr Suman Sahai Director, Gene Campaign, New Delhi Dr Anuradha J Desai Chairperson Dr Madhura Swaminathan Venkateshwara Hatcheries Pvt. Ltd., Pune Professor, Indian Statistical Institute, Kolkata

Dr Usha Barwale Zehr Mr V. Namasivayam Joint Director (Research) Executive Director, Maharashtra Hybrid Seeds Co Ltd., Jalna Pricewaterhouse Cooper, Bangalore

Dr Soumya Swaminathan Mr N Ram Deputy Director Editor-in-Chief, The Hindu Chennai Tuberculosis Research Centre, Chennai

Secretary to the Board of Trustees Dr M Velayutham Executive Director, MSSRF

160

ABOUT THE FOUNDATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Centre for Research on Sustainable Institute, Flat 6 “Dwaraka”, 42, (Old No. 22) Agricultural and Rural Development Kamdar Nagar, Nungambakkam, Chennai 34 (CRSARD) Dr. M. Anandakrishnan Prof. M.S. Swaminathan Chairman, Madras Institute of Development President Studies, Chennai 20 11, Ratna Nagar, Chennai 18 Mr. A.M. Mahmood Hussain, IFS (Retd.) Prof. P.C. Kesavan 29, 1st Main Road, Kapaleeswarar Nagar DAE Homi Bhabha Chair & Neelankarai, Chennai 41 Distinguished Fellow, MSSRF, Chennai 113 Mr. G. Venkataramani Dr. M. Velayutham 51, Journalists Colony, Srinivasapuram Executive Director Thiruvanmiyur, Chennai 41 MSSRF, Chennai 113

Ms. Mina Swaminathan Rtn. S.S. Rajasekhar Adviser (Education, Communication and ‘River View’, Kotturpuram, Chennai 85 Gender) MSSRF, Chennai 113 Dr. C. Ramasamy Dr. S. Rajagopalan Vice Chancellor Secretary – CRSARD Tamil Nadu Agricultural University 1 Jeth Nagar, 2nd Cross Street Coimbatore 641 003 R A Puram, Chennai 28 Dr. N. Balaraman Mr. B.S. Raghavan, IAS (Retd.) Vice Chancellor Ex-Policy Adviser to Tamil Nadu Tamil Nadu Veterinary & Animal Sciences No. 4, Second Street, Nehru Nagar, University(TANVAS)Madhavaram, Chennai 51 Adyar, Chennai 20 Dr. S.P. Thiyagarajan Ms. Malavika Vinod Kumar Vice Chancellor Technical Director University of Madras, Chepauk, Chennai 5 M/s. Sundar Chemicals (P) Ltd No. 560-562, 6-G, Century Flyover Dr. D. Viswanathan Teynampet, Chennai 18 Vice Chancellor, Anna University, Chennai 25

Dr. K.V. Raman Prof. S. Jayaraj Apartment 3-A, ‘Shrayas’, 39, A.G.S. Colony, Velacherry, Chennai 42 4th Seaward Road, Valmiki Nagar, Ms. Sumitra Ravichandran Thiruvanmiyur, Chennai 41 Partner, M/s. N.C. Rajagopalan & Co Dr. T.N. Ananthakrishnan No.22, Krishnaswamy Avenue, Former Director, Entomology Research Mylapore, Chennai 4

161

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Auditors Members

M/s. N.C. Rajagopalan & Company, Chennai Ms Sudha Bhave IAS, Joint Secretary (R&D), Project / Management Committees Department of Atomic Energy, Mumbai Advisory Board to THMRC Mr S K Agarwal Mr N Ram Director, NPCIL, Kudankulam Editor-in-Chief, The Hindu, Chennai Dr K B Sainis Mr Sashikumar Menon Associate Director, Biosciences Group, Chairman, Asian College of Journalism, BARC, Mumbai Chennai Prof P C Kesavan Mr B R Kumar DAE – Homi Bhabha Chair, MSSRF, Chennai Station Manager, Gyan Vani, Educational Radio Channel, IGNOU, Chennai Dr Ajay Parida Programme Director – Biotechnology, MSSRF Mr H R Krishnamoorthy (Member-Secretary), Chennai Director, All India Radio, Chennai Committee for Biodiversity Conservation, Prof M S Swaminathan Integrated Natural Resources Management Chairman, MSSRF, Chennai and Poverty Reduction (SDC assisted)

Dr M Velayutham Prof M S Swaminathan Executive Director, MSSRF, Chennai Chairman, MSSRF, Chennai

Ms Mina Swaminathan Ms Lucy Maarse Adviser, (Education, Communication and Deputy Coordinator and Delegate IC, Swiss Gender), MSSRF, Chennai Agency for Development and Cooperation (SDC), New Delhi Dr K Bhanumathi Coordinator, The Hindu Media Resource Dr N R Jagannath Centre, MSSRF,Chennai Programme Officer, Swiss Agency for Development and Cooperation (SDC), Programme Management Committee for New Delhi Department of Atomic Energy Supported Project on Nuclear and Biotechnological Dr Vanaja Ramprasad Tools in Coastal Systems Research Green Foundation, Bangalore

Prof M S Swaminathan Mr Siva Prasad Chairman, MSSRF AFPRO, Hyderabad

162

ABOUT THE FOUNDATION ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Dr M Velayutham Dr M Velayutham Executive Director, MSSRF, Chennai Executive Director, MSSRF

Ms Mina Swaminathan Dr Ajay Parida Adviser, (Education, Communication and Programme Director – Biotechnology, MSSRF Gender), MSSRF, Chennai (Member Secretary)

Dr Anil Kumar Project Review and Monitoring Committee Barwale Chair, Chennai (PRMC) for project on “Measures of Impact of Science and Technology: Agriculture and Dr Sudha Nair Rural Development”, supported by the Office Programme Director, MSSRF, Chennai of the Principal Scientific Adviser (PSA) to Dr L R Gopinath * the Government of India Senior Scientist and Site Coordinator, Dr V L Chopra, Chair MSSRF, Namakkal President, National Academy of Agricultural Mr Bibhu Prasad Mohanthy * Sciences, New Delhi Senior Scientist and Site Coordinator, MSSRF, Jeypore Members Dr C R Bhatia Dr V Arivudai Nambi Former Director, Biotechnology Group, BARC Principal Scientist and Project Coordinator, MSSRF, (Member Secretary), Chennai Dr Panjab Singh Vice Chancellor, Banaras Hindu University Institutional Bio-safety Committee

Prof M S Swaminathan (Chair) Dr R P Gupta Chairman, MSSRF Scientist E, Office of the PSA to the Govt. of India Members (Member Secretary) Dr K Bhuvaneshwari Management Advisory Committee, CAbC, Professor, TNAU, Coimbatore (DBT Kalpetta of MSSRF Nominee) Shri. A. Ratnam Dr R B Narayanan (Chairman), Kalpetta CBT, Anna University, Chennai Adv. K. Moidu, Kalpetta Dr Ajit Yadav Medical Practitioner, Apollo Hospital, Chennai Shri. M.R. Ganesh, Kalpetta

* Appointment ended with Project ending period 163

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Smt. Thangam Ratnam, Kalpetta Dr. Indira Balachandran Centre for Medicinal Plant Research, KAVS, Dr. M. Velayutham Kottaikal Executive Director, MSSRF, Chennai Dr. Sasidharan Shri. S. Hariharakrishnan Kerala Forest Research Institute, Peechi Manager (P & A), MSSRF Mr. Ratnam Swamy Shri. S. Karthikeyan Chairman, MAC, CAbC, Kalpetta Asst. Manager (B&A), MSSRF Ms. Mina Swaminathan Programme Advisory Committee, CAbC, Adviser (ECG), MSSRF, Chennai Kalpetta of MSSRF Dr. K.U.K. Nampoothiri Prof. M.K. Prasad Project Director, CAbC, MSSRF, Kalpetta (Chairman), Cochin Dr. N. Anil Kumar Dr. K.V. Peter Barwale Chair on Biodiversity, MSSRF, Vice Chancellor, KAU, Trichur Chennai

164

FOUNDATION STAFF ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Chairman

Prof. M.S. SWAMINATHAN Chairman, UNESCO Chair in Ecotechnology and Chairman, National Commission on Farmers

Foundation Staff

Dr. M. Velayutham Executive Director and National Coordinator, Sustainable Management of Natural Resources for Food Security

Programme Area 100 : Coastal Systems Research

Coastal Wetlands Project

Dr. V. Selvam Mr. T. Ravishankar * Programme Director Principal Scientist Ms. L. Gnanapazzham Nuclear and Biotechnological Tools for Scientist Coastal Systems Research

Mr. K.G. Mani Prof. P.C. Kesavan Project Associate DAE Homi Bhabha Chair and Distinguished Ms. M. Navamuniyammal * Fellow Scientist Dr. Ravi Kumar Gupta Mr. V.M. Karunakaran * Scientist Scientist Mr. P.V. David Ms. Evanjalin Jessie Beaula * Technical Assistant Social Worker Mr. R. Kalaimani Andhra Pradesh Technical Assistant

Dr. R. Ramasubramanian Mr. R. Sankar Scientist Field Assistant

* Left during the year

165

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Programme Area 200: Biotechnology Ms. Keerthi Chandana Rebala Junior Research Fellow Molecular Mapping and Genetic Enhancement Mr. G. Ganesan Dr. Ajay Kumar Parida Junior Research Fellow Programme Director Mr. M. Kannan Dr. Gayathri Venkataraman Lab Attendant Principal Scientist Lichen Ecology and Bioprospecting

Dr. K. Kavitha Dr. G.N. Hariharan DBT Post Doctoral Fellow Principal Scientist

Dr. M.N. Jitesh Dr. P. Balaji Research Associate Senior Research Fellow

Dr. Prashanth S. Raghavan Mr. Bharath Prithiviraj Research Associate Senior Research Fellow

Mr. K.R. Sivaprakash Ms. R. Valarmathi Senior Research Fellow Senior Research Fellow

Ms. Preethi Angela Mehta Ms. Trupthi Mohapatra Senior Research Fellow Junior Research Fellow

Ms. Suja George Mr.R. Kathiravan Senior Research Fellow Lab Attendant

Ms. K. Praseetha Bioprospecting, Biopartnership and Senior Research Fellow Micropropagation

Mr. M.S. Vinod Dr. Rajalakshmi Swaminathan Senior Research Fellow Principal Scientist

Mr. V. Sadhasivam Dr. P. Eganathan Junior Research Fellow Senior Scientist

Ms. B. Usha Mr. H.M. Sankararamasubramanian Junior Research Fellow Senior Research Fellow

Ms. C. Rajalakshmi Mr. R.S. Satyan Junior Research Fellow Senior Research Fellow

166

FOUNDATION STAFF ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Mr. Aveek Narayan Dr. V. Arunachalam Junior Research Fellow Distinguished Fellow

Ms. S. Soundarya Dr. N. Anil Kumar Junior Research Fellow Barwale Chair in Biodiversity

Mr. M.M. Saravanan Dr. V. Arivudai Nambi Technical Assistant Principal Scientist

Mr. E. Siva Ms. M. Geetha Rani Lab Attendant Gene Bank Manager

Mr. S. Rajakani Dr. Smita Mishra Technical Assistant Senior Scientist

Ms. K. Vijayalakshmi Mr. D. Munusamy Secretary Research Assistant

Microbiology Ms. A. Uma Secretary Dr. Diby Paul * Senior Scientist Community Biodiversity Programme Kolli Hills, Namakkal Dr. Bharath K. Srinivasan Senior Scientist Dr. L.R. Gopinath *** Site Coordinator Ms. K.S. Sujanitha Junior Research Fellow Dr. E.D. Israel Oliver King Senior Scientist Mr. N. Ramesh Kumar Senior Research Fellow Mr. A. Vedhamoorthy Scientist Mr. N. Dinesh Kumar Junior Research Fellow Ms. K. Chitra *** Scientist Mr. K. Ravikannan Technical Assistant Mr. P. Boopathy *** Technical Assistant Programme Area 300: Biodiversity Mr. D. Sengottuvel *** Dr. S. Bala Ravi Technical Assistant Adviser (Biodiversity)

* Left during the year *** Appointment ended with the Project

167

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Mr. R. Baskar Mr. T. Raveendran Accounts Assistant Field Assistant

Mr. P. Thangavel Mr. P.A. Rasheed Field Assistant Field Assistant

Community Agro-biodiversity Centre Ms. K.N. Shyja Kalpetta, Kerala Computer & Library Assistant

Dr. K.U.K. Nampoothiri Ms. Elsy Mathew Project Director Administrative Assistant

Mr. G. Girigan Mr. P.T. Shajahan Senior Scientist Field Assistant

Mr. M.K. Ratheesh Narayanan Mr. P.M. Salim Scientist Farm Assistant

Mr. V.V. Sivan Ms. K.G. Nisha Project Associate Teacher

Mr. P.M. Nanda Kumar Ms. Alishiya Mathew Project Coordinator Project Coordinator

Mr. P.A. Mohammed Rafeek Mr. Gipson Makil Junior Research Fellow Research Fellow

Mr. V.P. Sajeev Mr. K.J. Biju System Administrator Research Fellow

Ms. S. Yasmin * Ms. K.A. Sujana Project Associate Research Fellow

Ms. D. Archana * Mr. V.B. Sajeev Technical Assistant Field Investigator

Ms. V.P. Sreevidya * Ms. Smita S. Nair Teacher Research Fellow

Ms. C.S. Dhanya * Mr. P. Sujana Pal Research Fellow Research Fellow

* Left during the year

168

FOUNDATION STAFF ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Mr. K. Satheesh Mr. Trilochana Ray Research Fellow Technical Assistant

Ms. P. Asiya Mr. Prasantha Kumar Parida Project Assistant Technical Assistant

Mr. Joseph John Mr. Akshaya Kumar Panda Project Assistant Field Assistant

Ms. P. Manjusha Mr. Nihar Ranjan Parida Field Assistant Technical Assistant

Ms. M.P. Swapna Mr. Suresh Kumar Rath Field Assistant Accountant Cum Office Assistant

Mr. T. Manoj Kumar Mr. Pitabash Gahan Office Assistant Field Assistant

Ms. N. Saraswathy Mr. Lambodar Jena Cook cum Caretaker Field Assistant

Ms. K. Saraswathy Ms. Shantilata Patnayak Cleaner Genome Club Facilitator

Community Agro-biodiversity Programme, Ms. Sudipta Poddar *** Jeypore, Orissa Field Assistant

Dr. P. Das Programme Area 400: Ecotechnology Project Director JRD Tata Ecotechnology Centre

Mr. Bibhu Prasad Mohanty *** Dr. Sudha Nair Site Coordinator Programme Director & Head, Microbiology

Mr. Susanta Sekhar Chaudhury Dr. P. Thamizoli Senior Scientist Coordinator - Tsunami Rehabilitation

Mr. Saujanendra Swain Mr. A. Alphonse Chandrakumar Senior Scientist Coordinator - Micro Credit & Enterprise Development Mr. Tusar Ranjan Nayak Project Associate

*** Appointment ended with the Project

169

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Dr. H.D. Subashini Mr. E. Selvaganapathy Senior Scientist Technical Assistant

Dr. R. Rengalakshmi Mr. K. Chockalingam Senior Scientist Project Associate

Dr. Vijay R. Subbiah Mr. C. Nagaraja Scientist Scientist

Mr. Vishwanath Palled Mr. S. Magendra Kumar Scientist Junior Research Fellow

Dr. S. Malarvannan Thiruchengodu Scientist Ms. Shantha Sheela Mr. M. Ganesan *** Field Assistant Project Associate Kannivadi

Dr. M. Sakthi Vadivel Mr. S. Bose *** CSIR Research Associate Scientist

Ms. Rajam Ashok Mr. S. Murugesan *** Junior Research Fellow Project Associate

Mr. S. Sekar Mr. R. Seenivasan Technical Assistant Scientist

Ms. D. Rojarani Mr. B. Selvamukilan Administrative Assistant Scientist

Mr. S. Karthik Biovillages Programme Lab Assistant Pondicherry

Mr. S. Mohan Mr. D. Rosario Office Attendant Scientist

Chidambaram Ms. G. Meenakshi Social Scientist Dr. A. Gopalakrishnan Senior Scientist Dr. S. Sudarkodi Project Associate

*** Appointment ended with the Project

170

FOUNDATION STAFF ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Mr. P. Kumaran * Chennai Technical Assistant Ms. S. Geetha Mr. M. Babu Secretary Driver Programme Area 500: Food Security Ms. R. Rani BV Rao Centre for Sustainable Food Security Cleaner Dr. V.B. Athreya Ms. Mangayarkarasi Programme Director Cleaner Ms. R.V. Bhavani Mr. V. Pandurangan Principal Scientist Gardener Dr. Rama Narayanan Biovillages Advisor

Orissa Ms. G. Anuradha Mr. Dibakar Sahoo * Senior Scientist Project Coordinator Ms. Deepa Varma Dr. B.K. Maity Project Associate Site Coordinator Ms. Amritha Jairaj Ms. Gitisree Nayak Project Associate Social Worker Mr. A. Sakthivelan Mr. R. Jeeva Secretary Technical Assistant Mr. R. Gopinath Mr. Pradeep Kumar Nayak Research Assistant Administrative Assistant Ford Foundation Chair for Women & Food Sustainable Management of Natural Security Resources for Food Security Dr. Swarna Sadasivam Vepa Pudukkottai Ford Foundation Chair on Women and Dr. A. Chandrasekar Sustainable Food Security Coordinator Ms. N. Kritika Mr. M. Nageswaran Project Associate Scientist

* Left during the year *** Appointment ended with the Project

171

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Mr. B. Anand Kumar Mr. P. Sivakumar Technical Assistant Programmer

Ms. S. Chandra Kala Ms. K. Amudha * Technical Assistant Project Associate

Programme Area 600: Information, Mr. S.M. Shahabuddin * Education, NVA and Communication Project Associate Jamsetji Tata National Virtual Academy for Ms. D. Arasanayaki * Rural Prosperity Technical Assistant Mr. S. Senthilkumaran Programme Director Mr. Selvakumar * Technical Assistant Prof. Subbiah Arunachalam Distinguished Fellow Mr. R. Muthuveeran Project Associate Ms. Tara Gandhi Adviser Mr. K. Rameshwaran Technical Assistant Dr. L. Vedavalli Consultant Mr. P. Balaji Driver Ms. S. Akila * Principal Scientist Dindigul Dr. B.S. Nagarajan Ms. Nancy J Anabel Adviser Programme Coordinator - Capacity Building Ms. A. Rupa Mr. J. Srinath Project Associate Programme Coordinator - Content Ms. R. Nirmala Dr. J.D. Sophia Project Associate Principal Investigator Mr. A. Ananth Mr. S. Manikannan Technical Assistant Project Associate/Network Manager Thanjavur Mr. R. Rajamanikkam Computer Networking Professional Dr. V. Palaniappan Adviser

* Left during the year

172

FOUNDATION STAFF ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Mr. S. Suryanarayanan * Mr. K.G. Rajmohan Project Associate Scientist

Mr. M. Muthukumar Mr. J. Gobu * Technical Assistant Scientist

Pudukkottai Ms. Josephine Daisy Parimala Rani Project Associate Mr. M.T. Murugesan Project Associate Mr. B. Karunakaran Project Associate Ms. Rosemeena Amirthanayagam Project Associate Ms. P. Pakkialatchoumy Technical Assistant Mr. S. Gurumurthy Technical Assistant Nagercoil

Nagapattinam Mr. R. Karumalai Kannan Project Associate Ms. S. Velvizhi Project Associate Mr. S. Antony Edward Singh Project Associate Mr. S. Balakumar Project Associate Uttara Devi Resouce Centre for Gender & Development Kovalam Ms. Mina Swaminathan Mr. A. Syed Abuthahir Adviser, Education, Project Associate Communication and Gender Chidambaram Ms. K. Sheela Ms. P. Rani Isabella Senior Secretary Project Associate The Hindu Media Resource Centre Thangachimadam Dr. K. Bhanumathi Ms. R. Sreekirupa Coordinator Project Associate Ms. R. Rekha Pondicherry Programme Associate Dr. A.R. Thiagarajan Consultant * Left during the year

173

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Mr. G. Suresh Kumar Vulnerability & Adaptation to Climate Technical Assistant Change

Mr. N. Santhosh * Dr. A. Arivudai Nambi Technical Assistant Project Director

Mr. P. Balakrishnan Dr. T.N. Balasubramanian Technical Assistant Consultant

Every Child a Scientist (Chennai) Ms. Veena D. Thirupathi Principal Scientist Ms. D.S. Girija Teacher Mr. K. Sunder Vadivelu Administrative Associate Library and Information Services Administration & Finance Ms. Sylvia Snehalatha Manager - Library Service Mr. N. Parasuraman Manager - Estate Mr. M. Kuppuswamy Library Assistant - CDROM Mr. S. Hariharakrishnan Manager (P & A) Mr. B. Murugan Assistant Librarian Mr. C.V. Parthasarathy Executive Secretary Programme Area 700: Special Projects Measures of Impact of Science & Technology Mr. S. Karthikeyan in India: Agriculture & Rural Development Assistant Manager (B & A)

Dr. R. Rukmani Ms. J. Latha Murugesan Principal Scientist Assistant Manager (A & A)

Mr. V. Senthilkumar Ms. T.R. Rajalakshmi Scientist Assistant Manager (HR)

Ms. N. Thenmathi Ms. R. Malathy Scientist Senior Secretary

Ms.Y. Dilhara Begum Secretary

* Left during the year

174

FOUNDATION STAFF ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Ms. R. Jayashree Mr. P. Muthukumar Accounts Assistant Electrician

Ms. G. Padmavathy Mr. B. Sivakumar Administrative Assistant Electrical Assistant

Ms. T. Vijaya Sulochana Mr. S. Gopalakrishnan Administrative Assistant Driver Mr. M. Rajakumaran Mr. T. Samuel Administrative Assistant Gardener Mr. C. Rukmangathan Mr. P. Lakshmanan Accounts Assistant Gardener Mr. M. Raj Kumar Project Assistant Mr. Niyas Office Attendant Mr. K. Suresh Administrative Assistant Ms. Soundari Sundaram Cleaner Ms. Sayeda Habiba Banu Begum Technical Assistant Ms. J. Lakshmi Cleaner Mr. C. Sivaraj Electrical Supervisor Mr. C.H. Venkateswarlu Mr. P. Shanmugam Cleaner Office Attendant Ms. Vijaya Mr. E. Thiruvengadam Cleaner Electrician

175

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

LIST OF DONORS 2005-06 Institutional Donors - National

State Bank of Travancore, Indira Nagar Diana World Travel Pvt. Ltd, Chennai Institutional Donors - International

The Kesselmen Foundation, USA Individual Donors - National

Prof. M.S. Swaminathan, Chennai Dr. M.V. Rama Rao, Tuni

Mr. S. Srinivasan, Chennai Mr. Bhagwan Maniar, Mumbai

Mrs. Amiya Kesavan, Chennai Prof. P.C. Kesavan, Chennai

Dr. S. Bala Ravi, Chennai Mr. T. Parthasarathy, Chennai

Ms. Latha Rangan, Guwahati Individual Donors - International

Dr. Joseph H. Hulse, Canada Prof. Susan B. Chaplin, USA

Mr. Lennart Grebelius, Sweden Dr. Raghuveer & Chandra Polisetty, USA

Mr. Andy Mc Dowell, USA Dr. Clive Evian, South Africa Endowment Funds

Jamsetji Tata Trust, Mumbai

Tata Education Trust, Mumbai

176

LIST OF DONORS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Contribution received for Post-Tsunami Rehabilitation Programme Individual Contributions

Ms. Barbara Kirsop Ms. Shehnaz I. Mansuri

Ms. Adair Linn Nagata Mr. Thomas Brennan

Mr. Ashish Sharma Ms. Usha Chandra

Mr. Balaprakash Kasiviswanathan Mr. Vijay Tandrasistla

Mr. Chethan Gubbi-Yajaman Mr. Vinit Deshpande

Mr. Deepak Seth Ms. Jane G. Schubert

Mr. Douglas Johnson Ms. Eleanor A. Bissell

Mr. Eric Brewer Ms. Ellery M. Mercier

Mr. Girish M. Venkataramanappa Mr. William Sullivan

Ms. Gouri Vaddi Mr. Douglas C. Vest

Mr. Jose Nunez Ms. Mary A. Sullivan

Mr. Mallik Yalamanchili Mr. Chris Olsen

Mr. Milosav Cimel Dr. M.S. Swaminathan

Ms. Stephanie Neustadter Mr. Muthusamy Kunnimalaiyaan

Mr. J. R. Stowers Ms. Nithya Ramkumar

Mr. Nicholas V. S. Mumford Mr. Rahul Kapoor

Ms. Nancy T. Clark Mr. Robert Burkhead

Ms. Georgene T. Keeler Mr. Sai Cunchala

Mr. Karl D. Ruttan Mr. Scott D. Ramsey

Mr. Ayliffe B. Mumford Mr. Alex L. Nellas

177

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

Institutional Contributions

Maharashtra Foundation India, Mumbai Philips Exeter Academy, USA

National Bank for Agriculture and Ramon Magsaysay Foundation, Manila Rural Development, Mumbai

Bharat Soka Gakkai, New Delhi ISOFT, Holland

Microsoft Corporation India Pvt. Ltd, Gurgoan Microsoft, USA

The Barret Foundation, USA

American India Foundation, USA

The Randolf Foundation, New York

Friends of MSSRF – Tokyo Japan Micro-credit Banks

Mr. Pradipta Mullick Mr. Steve Tootell Mr. Paul Klug & Ms. Kathleen O’Brien Ms. Rita Duggal Mr. Krishen Mehta & Dr. Geeta Mehta The Rev. Warren L. Pittman Mr. Neil Kesselman Friends of Swaminathan – Australia (FOSA)

Friends of Swaminathan (FOSA Bank) - 20 Micro credit Banks.

Eco-Tourism Project in Kerela

Ms. Ayliffe Mumford

178

SOURCES OF PROJECT SUPPORT ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

SOURCES OF PROJECT SUPPORT Programme Area 100 : Coastal Systems Research

National International

Department of Atomic Energy, Mumbai Swiss Agency for Development and Cooperation, New Delhi Reliance Industries Limited, Mumbai Canadian International Development Agency, Department of Space, Ahmedabad Canada Bharatiya Nabhikiya Vidut Nigam Ltd, International Development Research Centre, Kalpakkam Canada Department of Forest, Govt. of Andhra Pradesh, Hyderabad

Programme Area 200 : Biotechnology

Council of Scientific & Industrial Research, New Delhi

Directorate of Forest & Wild Life, Govt. of Pondicherry

Department of Biotechnology Government of India

Programme Area 300 : Biodiversity

Centre for Environment Education, New Delhi International Plant Genetic Resources Institute, Rome National Botanical Research Institute, Lucknow International Food Policy Research Institute, USA Sir Dorabji Tata Trust, Mumbai Swiss Agency for Development and National Medicinal Plants Board, Dept. of Cooperation, New Delhi AYUSH, New Delhi

Department of Biotechnology, Govt. of India

179

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

National International

National Commission on Farmers, New Delhi

Department of Science & Technology, New Delhi Programme Area 400 : Ecotechnology

Deparment of Biotechnology, New Delhi Friends of MSSRF, Japan

Planning Commission, New Delhi Friends of Swaminathan, Australia

State Bank of India, Chennai Commonwealth of Learning, Canada

Kaizen Surya Associates, Bangalore Temple University, Japan

Tamil Nadu State Council for Science and United Nations Educational, Scientific and Technology, Chennai Cultural Organisation, Thailand

Council of Scientific & Industrial Research, New Delhi

Sir Dorabji Tata Trust, Mumbai

Council for Advancement of People’s Action and Rura Technology, Hyderabad

V.V. Vanniaperumal & Sons, Virudhunagar

Department of Science & Technology, Govt. of India, New Delhi

Jamsetji Tata Trust, Mumbai

National Bank for Agriculture and Rural Development, Mumbai Programme Area 500: Food Securtiy

World Food Programme, Regional Office for South Asia, New Delhi

United Nations World Food Programme, Cambodia

180

SOURCES OF PROJECT SUPPORT ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

National International

The Micronutrient Initiative, Canada, New Delhi office

Department for International Development, New Delhi office

Programme Area 600 : Information, Education and Communication

Ministry of Health & Family Welfare, New International Food Policy Research Institute, Delhi USA

Jamsetji Tata Trust, Mumbai International Plant Genetic Resources Institute, Italy The India Essential Advocacy Project, New Delhi Institute for International Education, New York

XV International Genetics Congress Trust, International Development Research Centre, New Delhi Canada

Indian Council of Medical Research, New Global Knowledge Partnership Secretariat, Delhi Malaysia

Tamil Nadu Agricultural University Centre for Open Society Institute, Hungary Agricultural and Rural Development Studies, Canadian International Development, Quebec Coimbatore Commonwealth Secretariat, UK Food and Agriculture Organisation of the United Nations, New Delhi United Nations Educational, Scientific and Cultural Organisation, Thailand Knowledge Networking for Rural Development, New Delhi Canadian High Commission, New Delhi

Tata Relief Committee, Chennai One World Online Ltd, United Kingdom

Department of Space, ISRO, Bangalore Swiss Agency for Development and Cooperation, New Delhi Department of Biotechnology, Govt. of India, New Delhi United Nations Educational Scientific and Cultural Organisation, New Delhi National Academy of Agricultural Sciences, New Delhi

181

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

National International

Intel Technology India Pvt. Ltd, Bangalore Syngeta Foundation, Switzerland

The National Academy of Sciences, Canadian International Development Agency, Allahabad Canada

NASSCOM Foundation, New Delhi Gester Consulting, Switzerland

ITC Limited, Secunderabad LOWA Council for International Understanding, USA American Spring & Pressing Works Pvt. Ltd, Mumbai World Food Programme, New Delhi

Tata Social Welfare Trust, Mumbai Ford Foundation, USA

Sir Dorabji Tata Trust, Mumbai

Microsoft Corporation India Pvt. Ltd, Gurgaon

Programme Area 700 : Special Projects

ASPEE Agro Equipments Pvt. Ltd, Mumbai University for Peace, Costa Rica

Office of the Principal Scientific Adviser, New Swiss Agency for Development and Delhi Cooperation, New Delhi

Directorate of Agriculture, Andaman & Nicobar Islands, Port Blair

Department of Biotechnology, Govt. of India, New Delhi

182

LIST OF ACRONYMS ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

List of Acronyms

ADB Asian Development Bank AICTE All India Council for Technical Education APEDA Agriculture and Processed Food Products Export Development Authority CBOs Community Based Organizations CGIAR Consulate Group on International Agricultural Research CIAT International Centre for tropical Agriculture CTCRI Central Tuber Crops Research Institute CIMMYT International Maize and Wheat Improvement Centre CRIDA Centre for Research in Dryland Agriculture DRDA District Rural Development Agency IARI Indian Agricultural Research Institute ICAR Indian Council for Agricultural Research ICRISAT International Crop Research Institute for Semi Arid Tropics IDRC International Development Research Centre IGCAR Indira Gandhi Centre for Atomic Research IGNOU Indira Gandhi National Open University IITA International Institute of Tropical Agriculture ISRO Indian Space Research Organization KVK Krishi Vigyan Kendra KKNPP Kudankulam Nuclear Power Plant MPEDA Marine Products Export Development Authority NABARD National Bank for Agriculture and Rural Development NEM North East Monsoon NSS National Sample Survey NPCIL Nuclear Power Corporation of India Ltd RBD Random Block Design RCGM Review Committee on Genetic Manipulation

183

ANNUAL REPORT 2005 -2006 ○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○○

RDA Recommended Daily Allowance SWMRI Soil and Water Management Research Institute TANVAS Tamil Nadu University for Animal Sciences TRRI Tirur Rice Research Institute UNDP United Nations Development Programme

184