The Comparative Study on the Rapid Decolorization of Azo, Anthraquinone and Triphenylmethane Dyes by Anaerobic Sludge

International Journal of Environmental Research and Public Health

Article The Comparative Study on the Rapid Decolorization of Azo, Anthraquinone and Triphenylmethane Dyes by Anaerobic Sludge

Daizong Cui †, Hao Zhang †, Rubao He and Min Zhao * College of Life Science, Northeast Forestry University, Harbin 150040, China; [email protected] (D.C.); [email protected] (H.Z.); [email protected] (R.H.) * Correspondence: [email protected]; Tel./Fax: +86-451-8219-1513 † These authors contribute equally to this work.

Academic Editor: Miklas Scholz Received: 20 August 2016; Accepted: 21 October 2016; Published: 28 October 2016 Abstract: An anaerobic sludge (AS), capable of decolorizing a variety of synthetic dyes, was acclimated and is reported here. The sludge presented a much better dye decolorizing ability than that of different individual strains. A broad spectrum of dyes could be decolorized by the sludge. Continuous decolorization tests showed that the sludge exhibited the ability to decolorize repeated additions of dye. The chemical oxygen demand (COD) removal rate of the dye wastewater reached 52% after 12 h of incubation. Polymerase chain reaction and denaturing gradient gel electrophoresis (PCR-DGGE) profiles revealed that the microbial community changed as a result of varying initial concentrations of dyes. Phylogenetic analysis indicated that microbial populations in the sludge belonged to the phyla Acidobacteria, Firmicutes, Bacteroidetes, Chloroflexi and Proteobacteria. The degradation products of the three types of dye were identified. For azo dyes, the anaerobic sludge converted Methyl Orange to N,N-dimethylbenzene-1,4-diamine and 4-aminobenzenesulfonic acid; for triphenylmethane dyes, after Malachite Green was decolorized, the analyzed products were found to be a mixture of N,N-dimethylbenzenamine, 3-dimethyl-aminophenol and 4-dimethylaminobenzophenone; for anthraquinone dyes, two products (acetophenone and 2-methylbenzoic acid) were observed after Reactive Blue 19 decolorization. Together, these results suggest that the anaerobic sludge has promising potential for use in the treatment of industrial wastewater containing various types of dyes.

Keywords: anaerobic sludge; synthetic dyes; decolorization; biodegradation; microbial community; intermediates

1. Introduction Synthetic dyes, classiﬁed on the basis of their chromophores as azo, anthraquinone, triphenylmethane and heterocyclic dyes, have been extensively used in the textile, printing, paper, cosmetics and food industries. Annually, approximately 2.8 × 105 t of textile wastewater with dyes is discharged into the environment worldwide [1]. These dyes are considered to be relatively persistent pollutants because they are extremely stable when exposed to light and aerobic conditions. Moreover, most dyes are toxic, and their transformation products are carcinogenic and mutagenic [2]. Thus, dye wastes must be treated before they are released into the environment. Decolorization of industrial dyes can be achieved through physico-chemical methods, such as adsorption, coagulation, precipitation and chemical oxidation. However, these methods have not been widely applied because of their low efﬁciency, high cost and intensive energy requirements. In recent years, many new processes for dye decolorization have been developed. One promising strategy is to use microbes to decolorize dyes. The biodegradation of dyes is considered to be an environmentally friendly and cost-effective option [3].

Int. J. Environ. Res. Public Health 2016, 13, 1053; doi:10.3390/ijerph13111053 www.mdpi.com/journal/ijerph Int. J. Environ. Res. Public Health 2016, 13, 1053 2 of 18

Int. J. Environ. Res. Public 2016, 13, 1053 2 of 19 Int. J. Environ. Res. Public 2016, 13, 1053 2 of 19 Int. AtJ. Environ. present, Res. aPublic number 2016, 13 of, 1053 studies have focused on the utilization of bacteria to decolorize synthetic2 of 19 strategy is to use microbes to decolorize dyes. The biodegradation of dyes is considered to be an dyes.strategy Bacteria is to use are microbes capable to of decolorize reducing dyes. azo dyesThe biodegradation under both anaerobic of dyes is and considered aerobic to conditions; be an environmentallystrategy is to use friendly microbes and to cost-effective decolorize dyes. option The [3]. biodegradation of dyes is considered to be an suchenvironmentally bacteria, include friendly obligate and cost-effective anaerobes option such as [3].Clostridium sp. [4], facultative anaerobes such environmentallyAt present, friendlya number and of cost-effective studies have option focused [3]. on the utilization of bacteria to decolorize as EnterobacterAt present,sp. a and numberEscherichia of studiessp. [5 ,have6] and focused some aerobeson the utilization such as Pseudomonas of bacteria sp.to decolorize [7]. Similarly, syntheticAt present, dyes. Bacteriaa number are of capable studies ofhave reducing focused azo on dyes the utilizationunder both of anaerobicbacteria toand decolorize aerobic severalsynthetic phylogenetically dyes. Bacteria diverse are capable bacteria, of suchreducing as Shewanella azo dyessp., underCitrobacter both anaerobicsp. and Staphylococcus and aerobic sp., conditions;synthetic dyes. such Bacteria bacteria, are incl capableude obligate of reducing anaerobes azo dyessuch underas Clostridium both anaerobic sp. [4], and facultative aerobic canconditions; decolorize such anthraquinone bacteria, incl orude triphenylmethane obligate anaerobes dyes such [8– 10as]. Clostridium Although syntheticsp. [4], facultative dyes can be anaerobesconditions; such such as bacteria,Enterobacter incl sp.ude and obligate Escherichia anaerobes sp. [5,6] andsuch some as Clostridiumaerobes such sp. as Pseudomonas[4], facultative sp. anaerobes such as Enterobacter sp. and Escherichia sp. [5,6] and some aerobes such as Pseudomonas sp. decolorized[7].anaerobes Similarly, bysuch differentseveral as Enterobacter phylogenetically microorganisms, sp. and Escherichia diverse there isbacteria, sp. little [5,6] information suchand someas Shewanella aerobes about a suchsp., single Citrobacteras stainPseudomonas that sp. is and ablesp. to [7]. Similarly, several phylogenetically diverse bacteria, such as Shewanella sp., Citrobacter sp. and reduceStaphylococcus[7]. Similarly, a broad rangeseveralsp., can of phylogeneticallydyes. decolorize Thus, theanthraquinone diverse use of abacteria, specific or trsuch strainiphenylmethane as on Shewanella dye decolorization dyes sp., Citrobacter[8–10]. is Although not sp. practical and Staphylococcus sp., can decolorize anthraquinone or triphenylmethane dyes [8–10]. Although insyntheticStaphylococcus treating textiledyes cansp., wastewater. becan decolorize decolorize Itd has by anthraquinone beendifferent reported microorganisms, or that triphenylmethane treatment there systemsis little dyes information with [8–10]. mixed Although about microbial a synthetic dyes can be decolorized by different microorganisms, there is little information about a populationssinglesynthetic stain dyes arethat can more is ablebe effectivedecolorize to reduce ind a decolorizationby broad different range microorganisms, ofof dyes. different Thus, dyesthethere use thanis of little a those specific information with strain single abouton dye strains. a single stain that is able to reduce a broad range of dyes. Thus, the use of a specific strain on dye Afterdecolorizationsingle acclimatization, stain that is isnot able thepractical to mixed reduce in cultures, treatinga broad which textilerange areofwastewater. dyes. composed Thus, It ofthehas stable usebeen ofmicrobial reporteda specific pellets,that strain treatment on may dye have decolorization is not practical in treating textile wastewater. It has been reported that treatment a strongsystemsdecolorization ability with to mixedis decolorize not microbialpractical synthetic inpopulations treating dyes. textileMoreover, are more wastewater. theeffective high It microbialin has decolorization been diversity reported of and thatdifferent the treatment synergistic dyes systems with mixed microbial populations are more effective in decolorization of different dyes metabolicthansystems those activitieswith with mixed single of themicrobial strains. mixed Afterpopulations consortia acclimatization, promote are more a highertheeffective mixed degree in cultures, decolorization of dye which decolorization. ofare different composed Therefore, dyes of than those with single strains. After acclimatization, the mixed cultures, which are composed of stablethan those microbial with pellets,single strains.may have After a strong acclimatization, ability to decolorize the mixed synthetic cultures, dyes. which Moreover, are composed the high of anstable acclimated microbial microbial pellets, community may have a is strong a more ability appropriate to decolorize and efficient synthetic approach dyes. Moreover, to the decolorization the high microbialstable microbial diversity pellets, and themay synergistic have a strong metabolic ability ac totivities decolorize of the synthetic mixed consortia dyes. Moreover, promote athe higher high ofmicrobial different typesdiversity of dyes.and the synergistic metabolic activities of the mixed consortia promote a higher degreemicrobial of dyediversity decolorization. and the synergistic Therefore, metabolic an acclimated activities microbial of the mixedcommunity consortia is a morepromote appropriate a higher degreeIn this of dye study, decolorization. we report the Therefore, investigation an acclimated of a novel microbial anaerobic community sludge is capable a more ofappropriate decolorizing anddegree efficient of dye approach decolorization. to the decolori Therefore,zation an ofacclimated different microbialtypes of dyes. community is a more appropriate severaland efficient classes approach of textile to dyes. the decolori To obtainzation more of different details types about of thedyes. anaerobic decolorization process, and efficientIn this study, approach we reportto the decolorithe investigationzation of different of a novel types anaerobic of dyes. sludge capable of decolorizing the decolorizationIn this study, characteristics we report the were investigation studied. Theof a dynamicnovel anaerobic composition sludge of capable the microbial of decolorizing community severalIn classesthis study, of textile we report dyes. theTo obtaininvestigation more deta of ilsa novel about anaerobic the anaerobic sludge decolorization capable of decolorizing process, the ofseveral the anaerobic classes sludgeof textile was dyes. assessed To obtain by PCR-DGGE. more details Gasabout chromatography-mass the anaerobic decolorization spectrometry process, (GC-MS) the decolorizationseveral classes ofcharacteristics textile dyes. wereTo obtain studied. more The deta dynamicils about composition the anaerobic of decolorization the microbial process,community the anddecolorization liquid chromatography-mass characteristics were spectrometry studied. The dynamic (LC-MS) composition were used toof determinethe microbial the community intermediate ofdecolorization the anaerobic characteristics sludge was wereassessed studied. by PCR-DGGE.The dynamic Gas composition chromatography-mass of the microbial spectrometry community productsof the anaerobic after dye decolorization.sludge was assessed All the by results PCR-DGGE. showed thatGas thechromatography-mass anaerobic sludge has spectrometry a high ability to (GC-MS)of the anaerobic and liquid sludge chromatography-mass was assessed by PCR-DGGE. spectrometry Gas (LC-MS) chromatography-mass were used to determine spectrometry the (GC-MS) and liquid chromatography-mass spectrometry (LC-MS) were used to determine the decolorizeintermediate(GC-MS) azo,and products anthraquinoneliquid chromatography-massafter dye and de triphenylmethanecolorization. spectrometry All the dyes results and(LC-MS) showed has a favorablewere that theused anaerobic potential to determine sludge for treatment hasthe intermediate products after dye decolorization. All the results showed that the anaerobic sludge has ofaintermediate textile high wastewater.ability products to decolorize after dye azo, de anthraquinonecolorization. All and the triphenylmethaneresults showed that dyes the anaerobicand has a sludge favorable has a high ability to decolorize azo, anthraquinone and triphenylmethane dyes and has a favorable potentiala high ability for treatment to decolorize of textile azo, wastewater. anthraquinone and triphenylmethane dyes and has a favorable 2.potential Materials for and treatment Methods of textile wastewater. potential for treatment of textile wastewater. 2. Materials and Methods 2.1.2. DyesMaterials and Chemicals and Methods 2. Materials and Methods 2.1. Dyes and Chemicals 2.1.Three Dyes and typical Chemicals synthetic dyes (Methyl Orange, Reactive Blue 19 and Malachite Green) were used 2.1. Dyes and Chemicals for theThree anaerobic typical sludge synthetic acclimation. dyes (Methyl Fifteen Orange, dyes Reactive (containing Blue 19 five and each Malachite of azo, Green) anthraquinone were used and Three typical synthetic dyes (Methyl Orange, Reactive Blue 19 and Malachite Green) were used triphenylmethanefor theThree anaerobic typical dyes)sludge synthetic were acclimation. dyes used (Methyl to monitorFifteen Orange, dyes the Reactive decolorization(containing Blue five 19 abilities andeach Malachite of ofazo, the anthraquinone developedGreen) were anaerobic used and for the anaerobic sludge acclimation. Fifteen dyes (containing five each of azo, anthraquinone and sludge.triphenylmethanefor the All anaerobic of thedyes sludgedyes) were acclimation.were procured used Fifteento from monitor thedyes Guangfu (containingthe decolorization Fine five Chemical each abilities of Researchazo, anthraquinoneof the Institute developed (Tianjin,and triphenylmethane dyes) were used to monitor the decolorization abilities of the developed China).anaerobictriphenylmethane The sludge. specifications Alldyes) of the ofwere eachdyes dyeusedwere are procuredto given monitor in fr Tableom the the1 .decolorization TheGuangfu rTaq DNAFine Chemicalabilities polymerase, of Research the PCR developed purificationInstitute anaerobic sludge. All of the dyes were procured from the Guangfu Fine Chemical Research Institute kit,(Tianjin,anaerobic pMD-18T China). sludge. vector The All and ofspecifications E.the coli dyesJM109 were of were procuredeach purchaseddye frareom given the from Guangfu in TaKaRaTable Fine 1. Biotechnology The Chemical rTaq DNA Research Co., polymerase, Ltd. Institute (Dalian, (Tianjin, China). The specifications of each dye are given in Table 1. The rTaq DNA polymerase, China).PCR(Tianjin, purification All China). other chemicals kit,The pMD-18T specifications were vector of analyticalof and each E. dyecoli grade JM109are given or were the in highest purchased Table quality.1. Thefrom rTaq TaKaRa DNA Biotechnology polymerase, PCR purification kit, pMD-18T vector and E. coli JM109 were purchased from TaKaRa Biotechnology Co.,PCR Ltd. purification (Dalian, China).kit, pMD-18T All other vector chemicals and E. were coli ofJM109 analytical were gradepurchased or the from highest TaKaRa quality. Biotechnology Co., Ltd. (Dalian, China). All other chemicals were of analytical grade or the highest quality. Co., Ltd. (Dalian,Table China). 1. Azo, All other anthraquinone chemicals and were triphenylmethane of analytical grade dyes or the used highest in this quality. study. Table 1.Azo, anthraquinone and triphenylmethane dyes used in this study. Table 1.Azo, anthraquinone and triphenylmethane dyes used in this study. DyesTable 1.Azo, anthraquinone Chemical Structureand triphenylmethane dyes Tapes used of Dye in this study.λmax Solubility Dyes Chemical Structure Tapes of Dye λmax Solubility Dyes Chemical Structure Tapes of Dye λmax Solubility Dyes Chemical Structure Tapes of Dye λmax Solubility MethylMethyl Orange Orange AzoAzo 464 464 Water Water soluble soluble Methyl Orange Azo 464 Water soluble Methyl Orange Azo 464 Water soluble

Methyl Red Azo 430 Alcohol soluble MethylMethyl Red Red AzoAzo 430 430 Alcohol Alcohol soluble soluble Methyl Red Azo 430 Alcohol soluble

Ponceau S Azo 515 Water soluble Ponceau S Azo 515 Water soluble PonceauPonceau S S AzoAzo 515 515 Water Water soluble soluble

Int. J. Environ. Res. Public Health 2016, 13, 1053 3 of 18

Int. J. Environ. Res. Public 2016, 13, 1053 3 of 19 Table 1. Cont.

Int. J. Environ. Res. Public 2016, 13, 1053 3 of 19 Dyes Chemical Structure Tapes of Dye λmax Solubility Int. J. Environ. Res. Public 2016, 13, 1053 3 of 19 Acid red 27 Azo 521 Water soluble Int.Int. J. Environ. J. Environ. Res. Res. Public Public 2016 2016, 13, 13, ,1053 1053 3 of 319 of 19

AcidAcidInt. redJ. red Environ. 27 27 Res. Public 2016, 13, 1053 AzoAzo 521 521 3 ofWater 19 Water soluble soluble Acid red 27 Azo 521 Water soluble Acid red 27 Azo 521 Water soluble Acid red 27 Azo 521 Water soluble Acid red 27 Azo 521 Water soluble

Chromotrope 2R Azo 508 Water soluble

ChromotropeChromotropeChromotrope 2R 2R 2R AzoAzoAzo 508 508 508Water Water soluble Water soluble soluble Chromotrope 2R Azo 508 Water soluble ChromotropeChromotrope 2R 2R AzoAzo 508 508Water Watersoluble soluble

Disperse Red 11 Anthraquinone 564 Water soluble

Disperse Red 11 Anthraquinone 564 Water soluble DisperseDisperse Red 11 Red 11 AnthraquinoneAnthraquinone 564 Water 564 soluble Water soluble DisperseDisperse Red 11 Red 11 AnthraquinoneAnthraquinone 564 Water564 soluble Water soluble Disperse Red 11 Anthraquinone 564 Water soluble

Disperse Blue 14 Anthraquinone 650 Alcohol soluble DisperseDisperseDisperse BlueDisperse Blue 14 Blue Blue 14 14 14 AnthraquinoneAnthraquinoneAnthraquinoneAnthraquinone 650 650 650 Alcohol Alcohol 650Alcohol soluble soluble Alcoholsoluble soluble

DisperseDisperse Blue Blue 14 14 AnthraquinoneAnthraquinone 650 650Alcohol Alcohol soluble soluble

AlizarinAlizarin Red Red S S AnthraquinoneAnthraquinone 520520 WaterWater soluble soluble AlizarinAlizarinAlizarin Red Red Red S S S AnthraquinoneAnthraquinoneAnthraquinone 520 520 520Water Water soluble Water soluble soluble

Alizarin Red S Anthraquinone 520 Water soluble Alizarin Red S Anthraquinone 520 Water soluble

Reactive Blue 19 Anthraquinone 592 Water soluble Reactive Blue 19 Anthraquinone 592 Water soluble Reactive Blue 19 Anthraquinone 592 Water soluble ReactiveReactive Blue Blue 19 19 AnthraquinoneAnthraquinone 592 592 Water Water soluble soluble Reactive Blue 19 Anthraquinone 592 Water soluble

Reactive Blue 19 Anthraquinone 592 Water soluble Bromoamine Acid Anthraquinone 492 Water soluble Bromoamine Acid Anthraquinone 492 Water soluble Bromoamine Acid Anthraquinone 492 Water soluble

BromoamineBromoamineBromoamine Acid Acid Acid AnthraquinoneAnthraquinoneAnthraquinone 492 492 492Water Water soluble Water soluble soluble

Bromoamine Acid Anthraquinone 492 Water soluble

Int. J. Environ. Res. Public Health 2016, 13, 1053 4 of 18

Table 1. Cont.

Int. J. Environ. Res. Public 2016,, 13,, 10531053 4 of 19 Int. J. Environ.Dyes Res. Public 2016, 13, 1053 Chemical Structure Tapes of Dye λmax Solubility4 of 19

Int. J. Environ. Res. Public 2016, 13, 1053 4 of 19 Int. J. Environ. Res. Public 2016, 13, 1053 4 of 19

MalachiteMalachite Green Green TriphenylmethaneTriphenylmethane 618618 Water Water soluble soluble Malachite Green Triphenylmethane 618 Water soluble

Malachite Green Triphenylmethane 618 Water soluble Malachite Green Triphenylmethane 618 Water soluble

Coomassie Brilliant Blue Triphenylmethane 553 Water soluble CoomassieCoomassie Brilliant Brilliant Blue Blue TriphenylmethaneTriphenylmethane 553553 Water Water soluble soluble Coomassie Brilliant Blue Triphenylmethane 553 Water soluble Coomassie Brilliant Blue Triphenylmethane 553 Water soluble

Methyl Violet Triphenylmethane 580 Water soluble MethylMethylMethyl Violet Violet Violet TriphenylmethaneTriphenylmethaneTriphenylmethane 580 580580 Water Water soluble Water soluble soluble Methyl Violet Triphenylmethane 580 Water soluble

Basic Violet 14 Triphenylmethane 547 Water soluble BasicBasicBasic Violet Violet Violet 14 14 14 TriphenylmethaneTriphenylmethaneTriphenylmethane 547 547547 Water Water soluble Water soluble soluble Basic Violet 14 Triphenylmethane 547 Water soluble

Fast Green FCF Triphenylmethane 625 Water soluble Fast Green FCF Triphenylmethane 625 Water soluble FastFast Green Green FCF FCF TriphenylmethaneTriphenylmethane 625625 Water Water soluble soluble Fast Green FCF Triphenylmethane 625 Water soluble

2.2. Inoculum, Basal Medium Characteristics and the Anaerobic Reactor 2.2. Inoculum, Basal Medium Characteristics and the Anaerobic Reactor Anaerobic sludge was collected from an anaerobic digester located at the Wenchang Anaerobic sludge was collected from an anaerobic digester located at the Wenchang 2.2. Inoculum,wastewater Basal treatment Medium plant Charac in Harbinteristics (Heilongjiang and the Anaerobic Province, Reactor China). The sludge was originally 2.2.2.2. Inoculum, Inoculum,wastewater Basal Basal treatment Medium Medium plant CharacteristicsCharac in Harbinteristics (Heilongjiang and and the the Anaerobic Anaerobic Province, Reactor Reactor China). The sludge was originally developed for treatment of a largely domestic effluent. A basal medium of the following developedAnaerobic for sludge treatment was ofcollected a largely fromdomestic an anaerobiceffluent. A digesterbasal medium located of atthe thefollowing Wenchang AnaerobiccompositionAnaerobic sludge wassludge used: was was5 collectedg·L −1collected glucose, from 2 g·Lfrom an−1 NH anaerobic an4Cl, anaerobic1.5 g·L digester−1 Na 2HPOdigester located4, 1 g·L located−1 at MgSO the 4 Wenchang·7Hat 2O,the 0.5 Wenchang g·L wastewater−1 wastewatercomposition treatment was used: plant 5 g·L in−1 glucose,Harbin 2 (Heilongjiangg·L−1 NH4Cl, 1.5 Province,g·L−1 Na2HPO China).4, 1 g·L −The1 MgSO sludge4·7H2O, was 0.5 g·Loriginally−1 wastewaterKCl. The treatmentanaerobic reactorplant inused Harbin in this (Heilongjiangstudy was a PVC Province, vessel with China). a capacity The sludgeof 10 L, wasequipped originally treatmentdevelopedKCl. The plant for anaerobic intreatment Harbin reactor (Heilongjiangof used a largelyin this study domestic Province, was a PVCeffluent. China). vessel A Thewith basal sludgea capacity medium was of 10 originallyof L, equippedthe following developed developedwith a mechanicalfor treatment stirrer ofto providea largely a stabledomestic mixture effluent. of substrate A basaland sludge. medium The initialof the sludge following with a mechanical stirrer to−1 provide a stable−1 mixture of substrate−1 and sludge.− 1 The initial sludge −1 forcomposition treatment was of a used: largely 5 g·L domesticglucose, efﬂuent. 2 g·L NH A4Cl, basal 1.5 g·L mediumNa2HPO of4 the, 1 g·L followingMgSO4·7H composition2O, 0.5 g·L was compositionconcentration−1 was wasused: 5 g5 mixed g·L−−1 glucose, 1liquor suspended 2 g·L−1 NH solids−4Cl,1 (MLSS)1.5 g·L −per1 Na liter.2HPO The−4, 11 temperature g·L−1 MgSO was4·7H kept2O, 0.5at g·L−1−1 used:KCl.concentration 5The g·L anaerobicglucose, was reactor 5 g 2 mixed g· Lused liquorNH in 4this suspendedCl, study 1.5 g· Lwassolids Naa (MLSS) PVC2HPO vessel per4, liter. 1 with g· LThe a temperature MgSOcapacity4· 7Hof was 210O, L,kept 0.5 equipped at g· L KCl. KCl. The anaerobic reactor used in this study was a PVC vessel with a capacity of 10 L, equipped with a mechanical stirrer to provide a stable mixture of substrate and sludge. The initial sludge with a mechanical stirrer to provide a stable mixture of substrate and sludge. The initial sludge concentration was 5 g mixed liquor suspended solids (MLSS) per liter. The temperature was kept at concentration was 5 g mixed liquor suspended solids (MLSS) per liter. The temperature was kept at

Int. J. Environ. Res. Public Health 2016, 13, 1053 5 of 18

The anaerobic reactor used in this study was a PVC vessel with a capacity of 10 L, equipped with a mechanical stirrer to provide a stable mixture of substrate and sludge. The initial sludge concentration was 5 g mixed liquor suspended solids (MLSS) per liter. The temperature was kept at 25 ◦C and the pH was maintained at 7.0. During the operation process, the dissolved oxygen concentration (DO) was controlled to between 0–0.3 mg·L−1.

2.3. Experimental Setup and Operation The anaerobic reactors was operated in successive 24 h cycles consisted of a ﬁlling phase of 30 min, a reaction phase of 21.5 h, a settling phase of 1 h, a draw phase of 45 min and an idle time of 15 min. To acclimatize the sludge, the reactor was initially operated with dye-free medium for one month. Then during ten days, medium containing fresh dye was added into the reactor (containing 50 mg·L−1 Methyl Orange, Reactive Blue 19 and Malachite Green, respectively). During the next ﬁfty days, the dye concentration was gradually increased to 300 mg·L−1 for the three dyes mentioned above (increasing 50 mg·L−1 of each dye for every ten days). After the stabilization of the feed solution, the reactors were operated for 30 days. Sludge samples were collected at the last operation day for each dye concentrations (0–300 mg·L−1). The pellets were washed twice with 50 mmol·L−1 phosphate buffer (pH 7.0) and stored at −20 ◦C for molecular analysis.

2.4. Semi-Continuous Study After sludge acclimatization, a semi-continuous decolorization test was conducted to indicate whether long-term degradation of dyes could be stably attained. The system was operated at a hydraulic retention time (HRT) of 24 h which we mentioned above. The anaerobic system was fed with 100 mg·L−1 of Methyl Orange, Reactive Blue 19 and Malachite Green for ten days, respectively. The decolorization rate for each dye was measured. During the treatment process, wastewater containing 100 mg·L−1 Methyl Orange, Reactive Blue 19 and Malachite Green was incubated with the sludge to detect the COD removal rate.

2.5. Batch Assays

2.5.1. Decolorization of Different Dyes by the Anaerobic Sludge Batch tests were conducted to determine if the anaerobic sludge had the ability to decolorize synthetic dyes with different chemical structures. Serum bottles (70 mL) were ﬁlled with 50 mL of distilled water with the a dye concentration of 100 mg·L−1. The bottles were ﬂushed with nitrogen gas for 10 min to remove oxygen and sealed with rubber stoppers. Each bottle was inoculated with 150 mg (cell dry weight) of anaerobic sludge. The bottles were incubated in a temperature-controlled cabinet maintained at 37 ◦C. Decolorization assays were carried out after a 12 h incubation. All assays were performed in triplicate.

2.5.2. Individual Strains vs. Anaerobic Sludge Three individual strains (Escherichia coli CD-2, Klebsiella pneumoniae Y3 and Bacillus subtilis WD23) and their mixtures were used for the decolorization comparison with the anaerobic sludge. Methyl Orange, Reactive Blue 19 and Malachite Green were chosen as model dyes for azo, anthraquinone and triphenylmethane dyes, respectively. All three strains were isolated by us from environmental samples and were proven in our previous studies to have the ability to decolorize dyes with different structures [11–13]. The three pure cultures were grown aerobically until the OD600 reached 1.2. Cells were harvested by centrifugation (10,000 g, 3 min), washed twice with sodium phosphate buffer (50 mmol·L−1, pH 7.0), transferred to serum bottles and resuspended in 50 mL distilled water to 3 g·L−1 (cell dry weight). Moreover, the three strains were mixed equally to make a microbial consortium. Bottles which were inoculated with 3 g·L−1 mixed culture and anaerobic sludge are also used in the decolorization Int. J. Environ. Res. Public Health 2016, 13, 1053 6 of 18 tests. Decolorization studies were started by addition of 100 mg·L−1 different dyes under anaerobic conditions. Decolorization assays were carried out after a 12 h incubation. All assays were performed in triplicate.

2.6. Analytical Methods The developed sludge was used to monitor the decolorization of different types of dyes under anaerobic conditions. Samples were taken at different time intervals and analyzed for dye decolorization. The dye decolorization rate was estimated by measuring the absorbance at the respective λmax of the different dyes with a UV-vis spectrophotometer (UV-2800, Unico Instruments Co., Ltd., Shanghai, China). The decolorizing activity was calculated using the following equation:

(Ai − A f ) Decolorization rate (%) = × 100% (1) Ai where Ai = initial absorbance of dyes, Af = absorbance of dyes after decolorization. COD and MLSS analyses were carried out according to the methods outlined in the Standard Methods for Examination of Water and Wastewater [14].

2.7. Enzymatic Assay The sludge sample was washed twice with 50 mmol·L−1 phosphate buffer (pH 7.0). The sample was resuspended in 10 mL of the same buffer. Cells were disrupted by sonication at 4 ◦C (5 s, 80% output, 50×). Cell debris was removed by centrifugation for 20 min at 10,000 g. The supernatant was used as the crude enzyme. The azoreductase activity assay system comprised 50 mmol·L−1 phosphate buffer (pH 7.0), 100 µmol·L−1 NADH, 50 µmol·L−1 Methyl Orange, and a suitable amount of crude enzyme. The reaction was initiated by the addition of NADH. Azoreductase activity was detected by following the disappearance of Methyl Orange at its maximum wavelength.

2.8. PCR-DGGE Analysis

2.8.1. DNA Extraction and PCR Amplification of the 16S rDNA V3 Region Sludge samples that acclimated at different periods were collected by centrifugation at 6000 g·min−1 for 10 min. Genomic DNA was extracted according to the method described by Lakay et al. [15]. PCR amplification was performed using the forward primer F357-GC(50-CGCCCGCC GCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG-30) and reverse primer R518 (50-ATTACCGCGGCTGCTGG-30). The PCR amplification included initial denaturation at 94 ◦C for 5 min; 10 cycles of 94 ◦C for 1 min; 60 ◦C for 1 min and 1 min at 72 ◦C and 20 cycles of 1 min at 94 ◦C; 1 min at 50 ◦C and 1 min at 72 ◦C followed by a final extension of 10 min at 72 ◦C. The amplified PCR products were visualized using 1% (w/v) agarose gel-electrophoresis.

2.8.2. DGGE Analysis DGGE was performed using a Dcode universal mutation detection system (Bio-Rad Inc., Hercules, CA, USA). Samples containing approximately equal amounts of PCR amplification products were loaded on a 10% poly-acrylamide gel in TAE buffer with a denaturing gradient ranging from 30% to 60% of the denaturant (denaturation of 100% corresponded to 7 mol·L−1 urea and 40% (v/v) formamide). DGGE was performed at 60 ◦C with a constant voltage of 160 V for 6 h, by using a gradient delivery system (Model 475, Bio-Rad Inc., Hercules, CA, USA. The gel was then stained by AgNO3 and the images of the gel were captured by a bio-image system (Bio-Rad). DGGE profiles were analyzed using the software Quantity One 4.6.2 (Bio-Rad Inc., Hercules, CA, USA). Dendrograms relating band pattern similarities were automatically calculated using the unweighted pair group method with the arithmetic average (UPGMA) clustering algorithm. UPGMA employs a sequential clustering algorithm, in which local topological relationships are identified in Int. J. Environ. Res. Public Health 2016, 13, 1053 7 of 18 order of similarity, and the phylogenetic tree is built in a stepwise manner. Relative band densities, which were necessary to determine the Shannon diversity index (SDI), were quantified, and the statistical data were exported for further SDI analyses.

2.8.3. Sequencing and Phylogenetic Analysis Bands of interest were cut out from the DGGE gel, mixed with 20 mL of deionized water, and incubated at 50 ◦C for 1 h. After centrifugation at 7000 g for 3 min, the supernatant was collected and used as a PCR template. The DNA fragment was reamplified using the primers R518 and F357 without GC-clamps. The amplification process was as follows: initial denaturation at 94 ◦C for 3 min and 30 cycles of denaturation at 94 ◦C for 30 s, annealing at 54 ◦C for 1 min and extension at 72 ◦C for 30 s, followed by a final extension at 72 ◦C for 10 min. The PCR products were purified with a gel extraction kit and cloned into E. coli plasmids for sequencing with a PMD 18-T cloning kit, per the manufacturer’s instructions. The DNA sequences were determined using the chain-termination method with an ABI 3730 DNA sequencer by a commercial service provided by Shanghai Shangon Biological Technology Company (Shanghai, China). Analysis of the sequences consisted of BLAST searches that were used to identify the closest related species within the database.

2.9. Analysis of Metabolites Formed after Decolorization of Three Types of Dye

2.9.1. Samples Preparation One hundred mg·L−1 of Methyl Orange, Reactive Blue 19 and Malachite Green were incubated with the anaerobic sludge for 24 h, respectively. After decolorization, the degradation mixtures of three types of dye were centrifuged at 6000 g for 10 min. The metabolites in the supernatants were extracted with an equal volume of ethyl acetate, dried over anhydrous Na2SO4 and evaporated to dryness in a rotary evaporator. The ﬁnal extracts were dissolved in a small volume of methyl alcohol and then ﬁltered through a 0.22 µm membrane.

2.9.2. GC-MS Analysis GC-MS analysis of metabolites was performed using an HP-5MS column on a GC/MS system (7800A-7900B; Agilent Technologies Inc., Santa Clara, CA, USA). Helium was used as the carrier gas at a ﬂow rate of 1 mL·min−1. The injector temperature was maintained at 280 ◦C with oven conditions as follows: 60 ◦C kept constant for 2 min, increased up to 280 ◦C at 10 ◦C min−1. The compounds were identiﬁed on the basis of mass spectra and the NIST library.

2.9.3. LC-MS Analysis LC-MS analysis was performed using a Thermo LC-MS system (Thermo Fisher Scientific, Waltham, MA, USA). A capillary column Terra C-18 (5 µm × 100 mm length) was used for separation of product intermediates. The mobile phase was a mixture of methyl alcohol and water (50:50, v/v) filtered through a Millipore syringe filter of 0.22 µm. The flow rate of eluent was 0.8 mL·min−1, and the injection volume was 20 µL. MS analysis was performed on a mass spectrometer, and the parameters were as follows: spray voltage, 3.5 kV; capillary temperature, 325 ◦C; capillary voltage, 50 V, tube lens 120 V. The mass range was 50–600 m/z.

3. Results

3.1. Decolorization Studies

3.1.1. Decolorization of Different Dyes by the Anaerobic Sludge Decolorization of various azo, anthraquinone and triphenylmethane dyes by the anaerobic sludge is shown in Figure1. The sludge showed a higher decolorization rate for azo dyes, compared with Int. J. Environ. Res. Public Health 2016, 13, 1053 8 of 18 anthraquinone and triphenylmethane dyes. In the case of the azo dyes tested, the sludge exhibited the highest decolorization rate against Methyl Orange. More than 90% of Methyl Orange was decolorized afterInt. J. Environ. an 8 h incubation,Res. Public 2016 and, 13, 1053 the dye was nearly completely decolorized within 12 h. 8 of 19

−1 Figure 1. Decolorization ofof differentdifferent azo,azo, anthraquinoneanthraquinone andand triphenylmethane triphenylmethane dyes dyes (100 (100 mg mg·L·L−1) by thethe anaerobicanaerobic sludge.sludge. ((A)) azoazo dyes;dyes; ((B)) anthraquinoneanthraquinone dyes;dyes; ((CC)): triphenylmethane triphenylmethane dyes. dyes.

All other azo dyes were also decolorized effectively by the anaerobic sludge. However, when All other azo dyes were also decolorized effectively by the anaerobic sludge. However, when we we used Methyl Orange as the electron acceptor substrate, none of azoreductase activity could be used Methyl Orange as the electron acceptor substrate, none of azoreductase activity could be detected detected in the cytoplasmic extracts. The ability of the sludge to decolorize anthraquinone and in the cytoplasmic extracts. The ability of the sludge to decolorize anthraquinone and triphenylmethane triphenylmethane dyes was also tested. The results showed that the maximum percentage of dyes was also tested. The results showed that the maximum percentage of decolorization and the decolorization and the decolorization time varied among the different dyes. For anthraquinone decolorization time varied among the different dyes. For anthraquinone dyes, almost 100% of dyes, almost 100% of Disperse Red 11 was decolorized during incubation, and over 80% of Disperse Disperse Red 11 was decolorized during incubation, and over 80% of Disperse Blue 14, Alizarin Blue 14, Alizarin Red S and Reactive Blue 19 were decolorized within 12 h. However, only 30% of Red S and Reactive Blue 19 were decolorized within 12 h. However, only 30% of Bromamine Acid was Bromamine Acid was decolorized within 12 h. For triphenylmethane dyes, the anaerobic sludge decolorized within 12 h. For triphenylmethane dyes, the anaerobic sludge decolorized most of the decolorized most of the Malachite Green, Coomassie Brilliant Blue, Methyl Violet and Basic Violet Malachite Green, Coomassie Brilliant Blue, Methyl Violet and Basic Violet 14 in a short time. However, 14 in a short time. However, Fast Green FCF was resistant to biodegradation, and only a 15% Fast Green FCF was resistant to biodegradation, and only a 15% decolorization rate was achieved after decolorization rate was achieved after a 12 h incubation. a 12 h incubation. 3.1.2. Individual Strains vs. the Anaerobic Sludge 3.1.2. Individual Strains vs. the Anaerobic Sludge Decolorization of model dyes with individual strains and mixed cultures as well as with Decolorization of model dyes with individual strains and mixed cultures as well as with anaerobic anaerobic sludge was studied and the results are reported in Figure 2. After a 12 h of incubation, the sludge was studied and the results are reported in Figure2. After a 12 h of incubation, the sludge sludge effective decolorized the three dyes, and the decolorization rates for Methyl Orange, effective decolorized the three dyes, and the decolorization rates for Methyl Orange, Reactive Blue 19 Reactive Blue 19 and Malachite Green were 99%, 80% and 92%, respectively. K. pneumoniae Y3 and and Malachite Green were 99%, 80% and 92%, respectively. K. pneumoniae Y3 and E. coli CD-2 had E. coli CD-2 had poor ability to decolorize Methyl Orange in a short time; only 25% and 5% of the poor ability to decolorize Methyl Orange in a short time; only 25% and 5% of the dye, respectively, dye, respectively, was decolorized during the incubation time. B. subtilis WD23 decolorized 75% of was decolorized during the incubation time. B. subtilis WD23 decolorized 75% of the Malachite Green the Malachite Green within 12 h. However, less than 50% of the Methyl Orange and Reactive Blue within 12 h. However, less than 50% of the Methyl Orange and Reactive Blue 19 were decolorized 19 were decolorized during the treatment process. In this study, the three strains were mixed during the treatment process. In this study, the three strains were mixed equally to make a microbial equally to make a microbial consortium. However, the decolorization rate of the mixed culture was consortium. However, the decolorization rate of the mixed culture was not significantly higher by not significantly higher by comparison with the three individual strains. We observed that 61% of comparison with the three individual strains. We observed that 61% of Malachite Green could be Malachite Green could be decolorized within 12 h by the mixed culture. However, for Methyl decolorized within 12 h by the mixed culture. However, for Methyl Orange and Reactive Blue 19, Orange and Reactive Blue 19, only 29% and 34% decolorization rate was attained within 12 h, only 29% and 34% decolorization rate was attained within 12 h, respectively. The results proved that respectively. The results proved that the anaerobic sludge exhibited a high decolorization efficiency the anaerobic sludge exhibited a high decolorization efficiency to the three types of dye. After the to the three types of dye. After the incubation, all the test dyes could be decolorized over 80%. incubation, all the test dyes could be decolorized over 80%. However, none of the individual strains However, none of the individual strains or the microbial consortium had a high decolorization or the microbial consortium had a high decolorization efficiency for all three dyes. These results efficiency for all three dyes. These results showed that the dye decolorization ability of the showed that the dye decolorization ability of the anaerobic sludge was much better than that of the anaerobic sludge was much better than that of the individual strains. individual strains.

Int. J. Environ. Res. Public Health 2016, 13, 1053 9 of 18 Int. J. Environ. Res. Public 2016, 13, 1053 9 of 19

Figure 2. DecolorizationDecolorization performance performance of of Methyl Methyl Oran Orange,ge, Reactive Reactive Blue Blue 19 19 and Malachite Green −1 (100 mg·L mg·L−1) )using using pure pure strains, strains, mixed mixed culture culture and and the the anaerobic anaerobic sludge. sludge.

3.1.3. Decolorization Decolorization of Dyes by the Anaerobic Sludge under Semi-Continuous Conditions

In this study, thethe anaerobicanaerobic reactorreactor waswas fedfed 100100 mg mg·L·L−-11 ofof Methyl Methyl Orange, Orange, Reactive Reactive Blue Blue 19 and Malachite Green for ten days, respectively. The deco decolorizationlorization rate rate of of the three dyes was detected during the the entire entire operation operation process, process, and and the the result resultss are are shown shown in Table in Table 2. 2The. The results results indicated indicated that itthat was it wasfeasible feasible to achieve to achieve highly highly efficient efﬁcient co continuousntinuous decolorization decolorization of of Methyl Methyl Orange Orange and Malachite Green by decolorization with the anaerobicanaerobic sludge. The The decolorization decolorization rates rates of of the two dyes were maintained at up to 95% and 89%, resp respectively.ectively. Moreover, no marked differences in the decolorization efficiency efﬁciency were found during the entire operationoperation process. Despite showing minor instability,instability, the anaerobic sludge decolorized more more than 60% of Reactive Blue 19 in every treatment cycle. TheThe anaerobicanaerobic sludge sludge exhibited exhibited an abilityan ability to decolorize to decolorize repeated repeated additions additions of dye, thusof dye, showing thus showingthat it can that be usedit can in be multiple used in cyclesmultiple of decolorization.cycles of decolorization.

TableTable 2. Decolorization of three types of dye by the anaerobic sludge under continuous conditions.

Decolorization Rate (%) Dyes Decolorization Rate (%) Dyes 1 Day 2 Day 3 Day 4 Day 5 Day Methyl Orange1 Day 99.29 ± 0.67 98.16 2 Day ± 1.17 98.06 3± Day1.22 96.87 ± 0.49 4 Day 97.96 ± 1.12 5 Day Malachite Green 93.78 ± 1.72 93.38 ± 0.85 91.57 ± 0.93 90.86 ± 1.14 92.45 ± 1.62 Methyl Orange 99.29 ± 0.67 98.16 ± 1.17 98.06 ± 1.22 96.87 ± 0.49 97.96 ± 1.12 Reactive Blue 19 82.15 ± 1.43 78.51 ± 0.83 79.28 ± 0.19 80.42 ± 0.74 65.23 ± 1.62 Malachite Green 93.78 ± 1.72 93.38 ± 0.85 91.57 ± 0.93 90.86 ± 1.14 92.45 ± 1.62 6 Day 7 Day 8 Day 9 Day 10 Day Reactive Blue 19 82.15 ± 1.43 78.51 ± 0.83 79.28 ± 0.19 80.42 ± 0.74 65.23 ± 1.62 Methyl Orange 95.26 ± 0.48 96.36 ± 1.89 96.13 ± 0.63 97.02 ± 0.71 97.36 ± 0.70 Malachite Green6 Day 90.21 ± 1.32 92.45 7 Day ± 0.86 91.78 8± Day1.00 90.54 ± 0.83 9 Day 89.03 ± 0.96 10 Day Methyl OrangeReactive Blue 95.26 19 ± 68.960.48 ± 0.75 96.36 78.34± ±1.89 1.87 77.54 96.13 ± 1.92± 0.63 72.67 ± 97.02 1.00 ± 74.210.71 ± 1.59 97.36 ± 0.70 Malachite Green 90.21 ± 1.32 92.45 ± 0.86 91.78 ± 1.00 90.54 ± 0.83 89.03 ± 0.96 TheReactive COD Blue removal 19 rate 68.96 was± 0.75 detected 78.34 during± 1.87 the 77.54wastewater± 1.92 treatment 72.67 ± 1.00 process. 74.21 As ±shown1.59 in Figure 3, the COD removal efficiency was high at the beginning of the reaction. After 6 h, the COD −1 decreasedThe COD from removal 1150 to rate618 wasmg·L detected, and the during removal the wastewaterrate was approximately treatment process. 46%. However, As shown the in −1 CODFigure was3, the nearly COD unchanged removal efﬁciency in the second was high6 h incubation. at the beginning Finally, of the the COD reaction. decreased After 6to h, 555 the mg·L COD afterdecreased a 12 h from incubation, 1150 to 618and mga longer·L−1, andtreatment the removal process rate did was not approximately produce further 46%. COD However, reduction. the COD was nearly unchanged in the second 6 h incubation. Finally, the COD decreased to 555 mg·L−1 after a 12 h incubation, and a longer treatment process did not produce further COD reduction.

Int. J. Environ. Res. Public Health 2016, 13, 1053 10 of 18 Int. J. Environ. Res. Public 2016, 13, 1053 10 of 19

Figure 3. Change of COD during the decolorizat decolorizationion of dyes by the anaerobic sludge.

3.2. Dye Decolorization Microbial Community During the sludge acclimation process, the composition of the microbial community was expected to change because some species would be enriched under the new conditionsconditions containing different dyes that might be toxic or inhibitory to originally dominant species [16]. [16]. In In our our study, study, PCR-DGGE analysis of the anaerobic sludge was performed to provide further insight into the microbial diversity. diversity. The The DGGE DGGE fingerprints fingerprints are are show shownn in Figure in Figure 4A.4 A.Different Different band band patterns patterns in each in eachlane lanewerewere observed observed from from the thefingerprints, fingerprints, thus thus revealing revealing that that the the microbial microbial composition composition was changed duringduring thethe acclimationacclimation process. process. With With increasing increasing dye dye concentration, concentratio somen, some bands bands (AS-17, (AS-17, -18, -19,-18, -20,-19, etc.)-20, etc.) that that were were initially initially present present in the in the medium medium faded faded away, away, whereas whereas some some bands bands (AS-3, (AS-3, -7, -13,-7, -13, -14, -14, etc.) etc.) appeared appeared in all in the all samples.the samples. Moreover, Moreover, some some bands bands emerged emerged andeven and becameeven became more prominentmore prominent (AS-6, (AS-6, -8, etc.). -8, etc.). The UPGMA clustering analysis was used to analyze the community similarity after exposure different initial dye dye concentrations. concentrations. As As shown shown in inFigure Figure 4B,4 B,populations populations in sludge in sludge with with different different dye dyeconcentrations concentrations were werecategorized categorized into two into separate two separate groups. groups. The first The group first represented group represented the sample the I sample(with no I (withdye addition) no dye addition) and the andsamples the samples which whichwere acclimated were acclimated by three by threetypes typesof dye of with dye withlow − lowconcentrations concentrations (lower (lower than than 200 200mg·L mg−1· Lof 1eachof each dye, dye, sample sample II IIto tosample sample V). V). The The second second group − represented the sludge sludge were were acclimated acclimated by by high high concentrations concentrations of of dye dye (higher (higher than than 250 250 mg·L mg·−L1 of1 ofeach each dye, dye, sample sample VI VIto tosample sample VII). VII). The The results results indicated indicated that that the the addition addition of of dyes imposed selective pressurepressure on on the the microbial microbial community. community With. theWith increased the increased dye concentrations, dye concentrations, the community the compositionscommunity compositions were also altered. were However, also altered. the microbial However, community the microbial reached communi a relativelyty stablereached stage a − whenrelatively the dyestable concentration stage when reachedthe dye 250concentration mg·L 1, as reached indicated 250 by mg·L the− high1, as similarityindicated ofby microbialthe high communitysimilarity of structures microbial between community the last structures two lanes, between thus suggesting the last tw thato lanes, the anaerobic thus suggesting sludge ultimately that the adaptedanaerobic to sludge the dye ultimately containing adapted environment, to the and dye the co structurentaining ofenvironment, the bacterial populationsand the structure in the sludgeof the wasbacterial maintained. populations in the sludge was maintained. The fingerprintsfingerprints were also analyzed using the SDI which describes the change in the species dominance of a bacterial co community.mmunity. The SDI for lane I and VII decreaseddecreased from 3.00 to 2.75, a result suggesting thatthat some some microorganisms microorganisms did notdid adapt not to adapt the environment to the environment containing high containing concentrations high ofconcentrations dyes, and they of dyes, gradually and they disappeared gradually from disappeared the sludge, from and the thus, sludge, the and diversity thus, ofthe the diversity bacterial of communitythe bacterialdecreased. community decreased.

Int. J. Environ. Res. Public Health 2016, 13, 1053 11 of 18 Int. J. Environ. Res. Public 2016, 13, 1053 11 of 19

Figure 4. DGGE fingerprints ﬁngerprints of microbial communities ( A)) and cluster analysis analysis based based on on “UPGMA” “UPGMA” method ( B) in in the the samples samples at at different different stages stages of of the the an anaerobicaerobic system system running. running. Lane Lane designations: designations: I: I:original original microbial microbial community; community; II: microbial II: microbial samples samples for forcontinuously continuously decolorizing decolorizing 50 mg·L 50 mg−1 of·L −three1 of threemodel model dyes dyes(Methyl (Methyl Orange, Orange, Reactive Reactive Blue Blue 19 19and and Malachite Malachite Green) Green) after after 10 10 days; days; III: III: microbial samples for continuouslycontinuously decolorizing 100 mgmg·L·L−1 1ofof three three model model dyes dyes after after 10 10 days; IV: microbial samples for continuouslycontinuously decolorizingdecolorizing 150 mgmg·L·L−11 ofof three three model model dyes dyes after after 10 10 days; V: microbial samples for continuouslycontinuously decolorizingdecolorizing 200200 mgmg·L·L−11 ofof three three model model dyes dyes after after 10 days; VI: microbial samples for continuouslycontinuously decolorizingdecolorizing 250250 mgmg·L·L−11 ofof three three model model dyes dyes after after 10 days; VII: microbial samples for continuously decolorizing 300300 mgmg·L·L−11 ofof three three model model dyes dyes after after 10 10 days. days.

To provideprovide furtherfurther insightinsight into the microbialmicrobial diversity, dominantdominant bands were excised and sequenced (Table3 3).). TheThe identifiedidentified sequencessequences havehave beenbeen depositeddeposited inin GenBankGenBank underunder accessionaccession numbers KR066383-KR066398. The The results results of of 16S rDNA gene sequencing revealed the presence of an ampleample diversitydiversity of of phylotypes. phylotypes The. The population population of the of anaerobicthe anaerobi sludgec sludge was assigned was assigned to five groups,to five comprisinggroups, comprising Acidobacteria, Acidob Firmicutesacteria, Firmicutes (Lactococcus (Lactococcussp., Clostridium sp., sp.Clostridium and Bacillus sp. sp.),and BacteroidetesBacillus sp.), (BacteroidetesPrevotella sp. and(PrevotellaBacteroides sp. sp.),and ChloroflexiBacteroides (Longilineasp.), Chloroflexisp.) and (Longilinea Proteobacteria sp.) (andKlebsiella Proteobacteriasp.). (KlebsiellaIn the sp.). Firmicutes group, three bacteria clones (AS-3, -5, -6) belonged to Lactococcus sp. Moreover, the bacteriaIn the clonesFirmicutes AS-8 andgroup, AS-14 three presented bacteria high clones sequence (AS-3, similarity -5, -6) to Clostridiumbelonged sp.to Lactococcus and Bacillus sp.,sp. respectively.Moreover, the In bacteria the Bacteroidetes clones AS-8 group, and clone AS-1 AS-74 presented had 98% high sequence sequence similarity similarity to Prevotella to Clostridium paludivivens sp.. Theand cloneBacillus AS-12 sp., respectively. had the highest In the similarity Bacteroidetes to Bacteroides group,. Theclone clone AS-7 AS-4 had had98% the sequence closest similarity relationship to withPrevotellaLongilinea paludivivens, which. The are clone filamentous AS-12 had strict the anaerobes highest similarity that ferment to Bacteroides carbohydrates.. The clone It belongs AS-4 had to the classclosest Anaerolineae relationship and with is usually Longilinea isolated, which from are thermophilic filamentous or mesophilicstrict anaerobes sludge. that Clone ferment AS-9 belongedcarbohydrates. to Klebsiella It belongs, which to the is a class genus Anaerolineae of Gram-negative, and is facultativelyusually isolated anaerobic from thermophilic bacteria of theor familymesophilic Enterobacteriaceae. sludge. Clone AS-9 belonged to Klebsiella, which is a genus of Gram-negative, facultativelyAccording anaerobic to the relative bacteria intensities of the family of bands Enterobacteriaceae on DGGE gel,. the dominant band on the line VII were AS-3, -5, -6, -7, -8, -13, -14, -16. The relative intensity for each band was 7.67%, 7.61%, 7.37%, Table 3. 16S rDNA sequence analysis and species identification of selected dominant DGGE bands 7.00%, 13.86%, 8.19%, 8.18% and 5.17%, respectively. Among them, three clones (AS-3, -5, -6) belonged for the anaerobic sludge. to Lactococcus sp.; the clone AS-7 had close relationship with Prevotella sp.; the clone AS-8 had the Band GenBank Sequence Length Closest Sequences Similarity highest similarity to Clostridium sp.; the clone AS-14Closest belonged Sequences to Bacillus sp. No. No. (bp) GenBank No. (%) Uncultured Acidobacteria AS-1 KR066383 196 KC442469 100 bacterium clone 3E6 Uncultured bacterium AS-2 KR066384 194 KF269782 99 clone KPA8-96

Int. J. Environ. Res. Public Health 2016, 13, 1053 12 of 18

Table 3. 16S rDNA sequence analysis and species identiﬁcation of selected dominant DGGE bands for the anaerobic sludge.

Sequence Closest Sequences Band No. GenBank No. Closest Sequences Similarity (%) Length (bp) GenBank No. Uncultured Acidobacteria AS-1 KR066383 196 KC442469 100 bacterium clone 3E6 Uncultured bacterium AS-2 KR066384 194 KF269782 99 clone KPA8-96 Lactococcus chungangensis AS-3 KR066385 195 NR_044357 98 strain CAU 28 Longilinea arvoryzae AS-4 KR066386 170 NR_041355 99 strain KOME-1 AS-5 KR066387 195 Lactococcus sp. R.M17 HG937722 100 Lactococcus chungangensis AS-6 KR066388 195 KF193937 100 strain W1MRS32c Prevotella paludivivens AS-7 KR066389 189 NR_113122 98 strain JCM 13650 Clostridium ghonii strain AS-8 KR066390 168 NR_119036 98 NCIMB 10636 AS-9 KR066391 193 Klebsiella sp. H11 JN049599 99 Uncultured Bacteroides sp. AS-12 KR066394 189 GQ332238 99 clone L26 Uncultured bacterium AS-13 KR066395 169 AY675970 100 clone A1-3-2 Bacillus cohnii strain AS-14 KR066396 193 NR_113776 99 NBRC 15565 Uncultured bacterium AS-15 KR066397 194 AM418664 100 clone K119 Uncultured bacterium AS-16 KR066398 169 GU171141 97 clone D5Day21bio2cold

3.3. Monitoring of Intermediates through Anaerobic Degradation

3.3.1. Monitoring of Intermediates after Methyl Orange Degradation The reduction products of Methyl Orange were collected for GC-MS analysis. As it shown in Figure5A, the compound at retention time 19.17 min was identiﬁed as N,N-dimethylbenzene- 1,4-diamine. However, the boiling point of 4-aminobenzenesulfonic acid exceeded the temperature limit of the GC-MS, therefore only N,N-dimethylbenzene-1,4-diamine of the products was detected in the GC chromatogram. To test whether 4-aminobenzenesulfonic acid was present in the degradation mixture, LC-MS was used for further analysis. As shown in Figure5B, 4-aminobenzenesulfonic acid was identiﬁed as one of the Methyl Orange reduction products.

3.3.2. Monitoring of Intermediates after Malachite GreenDegradation When the extracted metabolites of Malachite Green were injected into the GC-MS, the mass spectrum identified three products with retention times 18.73, 19.06 and 37.71 min and m/z ratios of 121, 137 and 225, respectively (Figure6A–C). After comparison with the available standards from the GC-MS NIST library data, intermediate 1 was identified as N,N-dimethyl-benzenamine, intermediate 2 was identified as 3-dimethylamino-phenol, and intermediate 3 was identified as 4-dimethylaminobenzophenone. Int. J. Environ. Res. Public Health 2016, 13, 1053 13 of 18 Int. J. Environ. Res. Public 2016, 13, 1053 13 of 19

Figure 5. Identification of metabolites of Methyl Orange by GC-MS (A) and LC-MS (B) analysis. FigureInt. J. 5. Environ.Identiﬁcation Res. Public 2016 of, 13 metabolites, 1053 of Methyl Orange by GC-MS (A) and LC-MS (B14) analysis.of 19 3.3.2. Monitoring of Intermediates after Malachite GreenDegradation When the extracted metabolites of Malachite Green were injected into the GC-MS, the mass spectrum identified three products with retention times 18.73, 19.06 and 37.71 min and m/z ratios of 121, 137 and 225, respectively (Figure 6A–C). After comparison with the available standards from the GC-MS NIST library data, intermediate 1 was identified as N,N-dimethyl-benzenamine, intermediate 2 was identified as 3-dimethylamino-phenol, and intermediate 3 was identified as 4-dimethylaminobenzophenone.

Figure 6. IdentiﬁcationFigure 6. Identification of metabolites of metabolites of Malachite of Malachite Green Green by GC-MS by GC-MS analysis. analysis. (A) N(A,N) -dimethyl- N,N-dimethyl-benzenamine (retention time 18.73 min); (B) 3-dimethylamino-phenol (retention time benzenamine19.06 (retentionmin); (C) 4-dimethylaminobenzophenone time 18.73 min); (B) 3-dimethylamino-phenol (retention time 37.71 min). (retention time 19.06 min); (C) 4-dimethylaminobenzophenone (retention time 37.71 min). 3.3.3. Monitoring of Intermediates after Reactive Blue 19 Degradation The products of Reactive Blue 19 after biodegradation were assessed by GC-MS. Two products with retention times 10.98 and 16.21 were identified. After comparison with the available standards from the GC-MS NIST library data, intermediate 1 was identified as acetophenone, and intermediate 2 was identified as 2-methylbenzoic acid (Figure 7A,B). These results indicated that the anaerobic sludge is able to clave the anthraquinone ring. Notably, several other chromatographic peaks were also found but could not be positively identified. Because no additional useful intermediate could be identified, the specific pathway for Reactive Blue 19 degradation is still unclear and requires further study.

Int. J. Environ. Res. Public Health 2016, 13, 1053 14 of 18

3.3.3. Monitoring of Intermediates after Reactive Blue 19 Degradation The products of Reactive Blue 19 after biodegradation were assessed by GC-MS. Two products with retention times 10.98 and 16.21 were identified. After comparison with the available standards from the GC-MS NIST library data, intermediate 1 was identified as acetophenone, and intermediate 2 was identified as 2-methylbenzoic acid (Figure7A,B). These results indicated that the anaerobic sludge is able to clave the anthraquinone ring. Notably, several other chromatographic peaks were also found but could not be positively identified. Because no additional useful intermediate could be identified, Int. J. Environ. Res. Public 2016, 13, 1053 15 of 19 the specific pathway for Reactive Blue 19 degradation is still unclear and requires further study.

Figure 7. Identiﬁcation of metabolites of Reactive Blue 19 by GC-MS analysis. (A) acetophenone Figure 7. Identification of metabolites of Reactive Blue 19 by GC-MS analysis. (A) acetophenone (retention time 10.98 min); (B) 2-methylbenzoic acid (retention time 16.21 min). (retention time 10.98 min); (B) 2-methylbenzoic acid (retention time 16.21 min).

4.4. Discussion Discussion InIn ourour study, study, the the anaerobic anaerobic sludge sludge decolorized decolorized three three types types of dyes, of dyes, and it and presented it presented much higher much decolorizationhigher decolorization ability than ability that than of pure that bacterial of pure strains.bacterial In strains. general, In dye general, treatment dye systemstreatment composed systems ofcomposed mixed microbial of mixed populationsmicrobial populations have a higher have efficiency a higher efficiency of dye decolorization. of dye decolorization. Enhanced Enhanced rates of decolorizationrates of decolorization of various dyesof variou usings mixeddyes using bacterial mixed cultures bacterial have alsocultures been reportedhave also [17 been,18]. Inreported mixed bacterial[17,18]. In systems, mixed bacterial the individual systems, strains the individual may attack strains the dye may molecule attack atthe different dye molecule positions at different or may utilizepositions metabolites or may utilize produced metabolites by the co-existing produced strains by the for co-existing further degradation. strains for Thefurther complementary degradation. roleThe ofcomplementary the different bacterial role of isolatesthe different in the bacterial consortium isol leadsates in to the an increaseconsortium in decolorization leads to an increase efficiency. in Indecolorization recent years, efficiency. the efficacy In recent of various years, anaerobic the efficacy treatment of various applications anaerobic treatment for the decolorization applications for of syntheticthe decolorization dyes had beenof synthetic investigated dyes [had2]. However, been inve moststigated bacteria [2]. However, and mixed most cultures bacteria can decomposeand mixed onlycultures one can type decompose of dyes with only similar one type chemical of dyes structures. with similar There chemical are very structures. few examples There are of very bacteria few possessingexamples theof abilitybacteria to decolorizepossessing all the the azo,ability anthraquinone to decolorize and all triphenylmethane the azo, anthraquinone dyes in a single and triphenylmethane dyes in a single decolorization system. In our study, the decolorization tests indicated that the anaerobic sludge that we acclimated showed non-specificity for different dyes decolorization. Hence, the anaerobic sludge has promising potential for removing recalcitrant dye pollutants from contaminated environments. Several studies had reported a positive relationship between the incubation time and COD removal rate. For example, Işik and Sponza have found that, in an anaerobic dye treatment reactor, the COD removal rate decreased from 79.9% to 29.4% when the incubation time was decreased from 100 to 6 h [19]. However, in our study, the COD was drastically decreased during the first 6 h incubation, and nearly unchanged in the second 6 h incubation. Similar results have also been observed by Ong et al., who found that after a 25 h incubation, the COD of the wastewater

Int. J. Environ. Res. Public Health 2016, 13, 1053 15 of 18 decolorization system. In our study, the decolorization tests indicated that the anaerobic sludge that we acclimated showed non-specificity for different dyes decolorization. Hence, the anaerobic sludge has promising potential for removing recalcitrant dye pollutants from contaminated environments. Several studies had reported a positive relationship between the incubation time and COD removal rate. For example, I¸sikand Sponza have found that, in an anaerobic dye treatment reactor, the COD removal rate decreased from 79.9% to 29.4% when the incubation time was decreased from 100 to 6 h [19]. However, in our study, the COD was drastically decreased during the first 6 h incubation, and nearly unchanged in the second 6 h incubation. Similar results have also been observed by Ong et al., who found that after a 25 h incubation, the COD of the wastewater decreased from 1300 to 600 mg/L, and a longer incubation time did not produce further COD reduction [20]. Phylogenetic analysis indicated that microbial populations in the anaerobic compartment belonged to the genera Lactococcus, Clostridium, Bacillus, Prevotella, Bacteroides, Longilinea and Klebsiella. Lactococcus is Gram-positive bacterium that generates lactic acid during growth. In recent years, the dye decolorization ability of lactic acid bacteria has been reported. You and Teng have developed an anaerobic sequencing batch reactor (SBR) that can effectively treat wastewater containing Reactive Black 5. Isolation and identification of the degrading bacteria showed that five strains belonged to different subspecies of Lactococcus lactis [21]. Moreover, Amani and Ahwany have found that another lactic acid bacterium, Oenococcus oeni ML34, can decolorize three different azo dyes [22]. All these results indicate that lactic acid bacteria have great potential for use in dye decolorization treatments. Some species belonging to the genus Bacillus have been widely reported to have a strong ability to degrade different types of dyes [23,24]. Similarly to Bacillus, Clostridium sp. is wide spread in different types of anaerobic azo dye decolorization systems. Yang et al. have traced the bacteria populations in a full-scale printing and dyeing wastewater treatment system and found that, in spite of variation in the microbial community and composition of the influents, Clostridium sp. could be detected in all the test samples [25]. Fernando et al. have developed an anaerobic mixed culture capable of decolorizing a broad-spectrum of azo dyes. Phylogenetic analysis of 16s rDNA sequences obtained from the anaerobic culture revealed a majority was composed of bacterial species belonging to the genus Clostridium [26]. In addition to azo dyes, Clostridium sp. has proven to be effective for degradation of many triphenylmethane dyes. Kim et al. have isolated a novel strain of Clostridium perfringens that can decolorize a wide range of triphenylmethane dyes with a 27 h anaerobic incubation [27]. Bacillus and Clostridium are all Gram-positive bacteria that belong to the family Bacillaceae. The strong ability of the two genera to decolorize different types of dyes supports their use in the treatment of industrial wastewater containing synthetic dyes. Little information concerning the pure isolates, which belong to Bacteroidetes, supports the potential for dye wastewater treatment. However, Zhang et al. have determined the composition and diversity of the bacterial community present in an anaerobic sequencing batch reactor used for treating dye wastewater. The results demonstrated that Bacteroidetes was the dominant phylum in the anaerobic sludge [28]. In our study, two genera belonging to Bacteroidetes were also detected in the anaerobic sludge, thus indicting that these bacterial species might play important roles in pollutant degradation or sustaining sludge particles. Numerous studies have reported that Klebsiella have the ability to metabolize azo compounds [29,30]. Moreover, in our previous study, we have found that Klebsiella is the dominant genus in both bacterial consortia that was able to decolorize azo dyes under aerobic or anaerobic conditions [31]. In addition, many species belonging to Enterobacteriaceae, such as Shigella, Enterobacter and Escherichia, have proven to have dye decolorization ability [5,6,32].These reports suggest that it is likely that most species in the family Enterobacteriaceae have the potential to decolorize azo dyes. GC-MS and LC-MS analysis demonstrated that the mechanism of microbial degradation of azo dyes by the anaerobic sludge involves the reductive cleavage of azobonds, thereby resulting in the formation of colorless solutions containing potentially aromatic amines. It was widely accepted that the first step in the bacterial degradation of azo dyes, in either anaerobic or aerobic conditions, Int. J. Environ. Res. Public Health 2016, 13, 1053 16 of 18 is the reduction of the N=N bond. However, in different decolorization systems, this reduction may involve different mechanisms, such as enzymes, low molecular weight redox mediators and chemical reduction by biogenic reductants [33]. In this study, the enzyme activities of the crude cell extracts from the anaerobic sludge was studied. However, none of azoreductase activity could be detected in the cytoplasmic extracts. It indicated that the azo dye reduction in this work is not a specific reaction which is performed by azoreductase. Moreover, we observed that in our biodegradation system, the addition of synthetic electron carriers, such as lawsone and menadione, could greatly enhance the decolorization efficiency of the azo dyes. All these results showed that the azo reduction by the anaerobic sludge appeared to be nonspecific. Electrons were shuttled by various redox mediators from the bacteria to azo dyes, which leadsto the reduction of the N=N bond. It has been reported that azo dyes cannot be mineralized completely by bacteria under anaerobic conditions [34]. After decolorization, the corresponding aromatic compounds were stably contained in the degradation system. These compounds are also harmful to the environment and needed to be further treated under aerobic conditions. In our study, three products after Malachite Green decolorization were indentified. Based on the previous studies [35,36], possible metabolic pathway followed by the anaerobic sludge during Malachite Green degradation was proposed. At first, Malachite Green was converted to the leuco form of the dye (Leucomalachite Green). Then the leuco form product was cleaved to N,N-dimethyl- benzenamine and 4-dimethylaminobenzophenone. Then, 4-dimethylaminobenzophenone was degraded to 3-dimethylamino-phenol and benzaldehyde. The metabolic pathway of Malachite Green proposed in this study showed some deviation from the findings of other studies. It has been reported that the first step in the biodegradation of Malachite Green is the reduction the dye to its leuco-form [37]. The Leucomalachite Green then underwent stepwise removal of its methyl groups from a single side or both sides of nitrogen [38,39]. Thus, some demethyl metabolites, such as demethylLeucomalachite Green, 4-aminobenzophenone and aniline, could be detected in the degradation systems. However, in our study, the N-demethylation reaction was not involved in Malachite Green degradation process. The Leucomalachite Green was hydrolyzed and then oxidized to form N,N-dimethyl-benzenamine and 4-dimethylaminobenzophenone. Then, 4-dimethylaminobenzophenone was hydrolyzed to small pieces.

5. Conclusions In our study, we developed an anaerobic sludge for dye decolorization. Our results showed that the sludge decolorized various types of dyes and showed a high efficiency for continuous wastewater treatment. PCR-DGGE analysis revealed that dynamic changes in the microbial communities were occurred in the anaerobic compartments. Sequencing results indicated that the dominant members in the sludge belonged to five different phyla. The results suggested that some of the members are probably efficient degraders of dyes. Some intermediates of the three types of dye were identified, thus indicating that the sludge is able to degrade the dye molecules into smaller fragments through different mechanisms.

Acknowledgments: This work was supported by the National Natural Science Foundation of China (grant number J1210053); the Fundamental Research Funds for the Central Universities (grant number 2572015BA04). Author Contributions: Daizong Cui and Min Zhao designed the study and drafted the manuscript; Hao Zhang and Rubao He performed the experiments; Daizong Cui analyzed the data. Conﬂicts of Interest: The authors declare no conﬂict of interest. The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

References

1. Jin, X.C.; Liu, G.Q.; Xu, Z.H.; Tao, W.Y. Decolorization of a dye industry efﬂuent by Aspergillus fumigatus XC6. Appl. Microbiol. Biotechnol. 2007, 74, 239–243. [CrossRef][PubMed] Int. J. Environ. Res. Public Health 2016, 13, 1053 17 of 18

2. Robinson, T.; McMullan, G.; Marchant, R.; Nigam, P. Remediation of dyes in textile effluent: A critical review on current treatment technologies with a proposed alternative. Bioresour. Technol. 2001, 77, 247–255. [CrossRef] 3. Li, H.X.; Xu, B.; Tang, L.; Zhang, J.H.; Mao, Z.G. Reductive decolorization of indigo carmine dye with Bacillus sp. MZS10. Int. Biodeterior. Biodegrad. 2015, 103, 30–37. [CrossRef] 4. Joe, M.H.; Lim, S.Y.; Kim, L.D.; Lee, I.S. Decolorization of reactive dyes by Clostridium bifermentans SL186 isolated from contaminated soil. World J. Microbiol. Biotechnol. 2008, 24, 2221–2226. [CrossRef] 5. Moutaouakkil, A.; Zeroual, Y.; Dzayri, F.Z.; Talbi, M.; Lee, K.; Blaghen, M. Purification and partial characterization of azoreductase from Enterobacter agglomerans. Arch. Biochem. Biophys. 2003, 413, 139–146. [CrossRef] 6. Cerboneschi, M.; Corsi, M.; Bianchini, R.; Bonanni, M.; Tegli, S. Decolorization of acid and basic dyes: Understanding the metabolic degradation and cell-induced adsorption/precipitation by Escherichia coli. Appl. Microbiol. Biotechnol. 2015, 99, 8235–8245. [CrossRef][PubMed] 7. Nachiyar, C.V.; Rajkumar, G.S. Purification and characterization of an oxygen insensitive azoreductase from Pseudomonas aeruginosa. Enzyme Microb. Techchnol. 2005, 36, 503–509. [CrossRef] 8. Xu, M.Y.; Guo, J.; Zeng, G.Q.; Zhong, X.Y.; Sun, G.P. Decolorization of anthraquinone dye by Shewanella decolorationis S12. Appl. Microbiol. Biotechnol. 2006, 71, 246–251. [CrossRef][PubMed] 9. Wang, H.; Su, J.Q.; Zheng, X.W.; Tian, Y.; Xiong, X.J.; Zheng, T.L. Bacterial decolorization and degradation of the reactive dye Reactive Red 180 by Citrobacter sp. CK3. Int. Biodeterior. Biodegrad. 2009, 63, 395–399. [CrossRef] 10. Ayed, L.; Chaieb, K.; Cheref, A.; Bakhrouf, A. Biodegradation and decolorization of triphenylmethane dyes by Staphylococcus epidermidis. Desalination 2010, 260, 137–146. [CrossRef] 11. Cui, D.Z.; Li, G.F.; Zhao, D.; Gu, X.X.; Wang, C.L.; Zhao, M. Purification and characterization of an azoreductase from Escherichia coli CD-2 possessing quinone reductase activity. Process Biochem. 2012, 47, 544–549. [CrossRef] 12. Cui, D.Z.; Li, G.F.; Zhao, M.; Han, S. Decolourization of azo dyes by a newly isolated Klebsiella sp. strain Y3, and effects of various factors on biodegradation. Biotechnol. Biotechnol. Equip. 2014, 48, 478–486. [CrossRef] [PubMed] 13. Wang, C.L.; Zhao, M.; Li, D.B.; Cui, D.Z.; Lu, L.; Wei, X.D. Isolation and characterization of a novel Bacillus subtilis WD23 exhibiting laccase activity from forest soil. Afr. J. Biotechnol. 2010, 9, 5496–5502. [CrossRef] 14. American Public Health Association (APHA). Standard Methods for the Examination of Water and Wastewater, 21st ed.; American Public Health Association: Washington, DC, USA, 2005. 15. Lakay, F.M.; Botha, A.; Prior, B.A. Comparative analysis of environmental DNA extraction and purification methods from different humic acid-rich soils. J. Appl. Microbiol. 2007, 102, 265–273. [CrossRef][PubMed] 16. Qu, Y.Y.; Zhou, J.T.; Wang, J.; Song, Z.Y.; Xing, L.L.; Fu, X. Bioaugmentation of bromoamine acid degradation with Sphingomonas xenophaga QYY and DNA fingerprint analysis of augmented systems. Biodegradation 2006, 17, 83–91. [CrossRef][PubMed] 17. Chen, B.Y.; Chang, J.S. Assessment upon species evolution of mixed consortia for azo dye decolorization. J. Chin. Inst. Chem. Eng. 2007, 38, 259–266. [CrossRef] 18. Kumar, M.A.; Kumar, V.V.; Ponnusamy, R.; Daniel, F.P.; Seenuvasan, M.; Anuradha, D.; Sivanesan, S. Concomitant mineralization and detoxification of Acid Red 88 by an indigenous acclimated mixed culture. Environ. Prog. Sustain. 2015, 34, 1455–1466. [CrossRef] 19. Iik, M.; Sponza, D.T. Substrate removal kinetics in an upflow anaerobic sludge blanket reactor decolorising simulated textile wastewater. Process Biochem. 2005, 40, 1189–1198. [CrossRef] 20. Ong, S.A.; Toorisaka, E.; Hirata, M.; Hano, T. Decolorization of Orange II using an anaerobic sequencing batch reactor with and without co-substrates. J. Environ. Sci. 2012, 24, 291–296. [CrossRef] 21. You, S.J.; Teng, J.Y. Anaerobic decolorization bacteria for the treatment of azo dye in a sequential anaerobic and aerobic membrane bioreactor. J. Taiwan Inst. Chem. Eng. 2009, 40, 500–504. [CrossRef] 22. Amani, M.D.; Ahwany, E.I. Decolorization of Fast red by metabolizing cells of Oenococcus oeni ML34. World J. Microb. Biotechnol. 2008, 24, 1521–1527. 23. Deng, D.Y.; Guo, Y.; Zeng, G.Q.; Sun, G.P. Decolorization of anthraquinone, triphenylmethane and azo dyes by a new isolated Bacillus cereus strain DC11. Int. Biodeterior. Biodegrad. 2008, 62, 263–269. [CrossRef] Int. J. Environ. Res. Public Health 2016, 13, 1053 18 of 18

24. Telke, A.A.; Kalyani, C.C.; Dawkar, V.V.; Govindwar, S.P. Influence of organic and inorganic compounds on oxidoreductive decolorization of sulfonated azo dye C.I. Reactive Orange 16. J. Hazard. Mater. 2009, 172, 298–309. [CrossRef][PubMed] 25. Yang, Q.X.; Wang, J.; Wang, H.T.; Chen, X.Y.; Ren, S.W.; Li, X.L.; Xu, Y.; Zhang, H.; Li, X.M. Evolution of the microbial community in a full-scale printing and dyeing wastewater treatment system. Bioresour. Technol. 2012, 117, 155–163. [CrossRef][PubMed] 26. Fernando, E.; Keshavarz, T.; Kyazze, G. Simultaneous co-metabolic decolourisation of azo dye mixtures and bio-electricity generation under thermophillic (50 ◦C) and saline conditions by an adapted anaerobic mixed culture in microbial fuel cells. Bioresour. Technol. 2013, 127, 1–8. [CrossRef][PubMed] 27. Kim, J.D.; An, H.Y.; Yoon, J.H.; Park, Y.H.; Kawai, F.; Jung, C.M.; Kang, K.H. Identification of Clostridium perfringens AB&J and its uptake of Bromophenol Blue. J. Microbiol. Biotechnol. 2002, 12, 544–552. 28. Zhang, L.L.; Sun, Y.H.; Guo, D.L.; Wu, Z.R.; Jiang, D.M. Molecular diversity of bacterial community of dye wastewater in an anaerobic sequencing batch reactor. Afr. J. Microbiol. Res. 2012, 6, 6444–6453. [CrossRef] 29. Wong, P.K.; Yuen, P.Y. Decolorization and biodegradation of Methyl Red by Klebsiella pneumoniae RS-13. Water Res. 1996, 30, 1736–1744. [CrossRef] 30. Franciscon, E.; Zille, A.; Garboggini, F.F.; Silva, I.S.; Paulo, A.C.; Durrant, L.R. Microaerophilic-aerobic sequential decolourization/biodegradation of textile azo dyes by a facultative Klebsiella sp. strain VN-31. Process Biochem. 2009, 44, 446–452. [CrossRef] 31. Cui, D.Z.; Li, G.F.; Zhao, D.; Gu, X.X.; Wang, C.L.; Zhao, M. Microbial community structures in mixed bacterial consortia for azo dye treatment under aerobic and anaerobic conditions. J. Hazard. Mater. 2012, 221–222, 185–192. [CrossRef][PubMed] 32. Ghosh, D.K.; Mandal, A.; Chaudhuri, J. Purification and partial characterization of two azoreductases from Shigella dysenteriae Type 1. FEMS Microbiol. Lett. 1992, 98, 229–234. [CrossRef] 33. Pandey, A.; Singh, P.; Iyengar, L. Bacterial decolorization and degradation of azo dyes. Int. Biodeterior. Biodegrad. 2007, 59, 73–84. [CrossRef] 34. Parshetti, G.K.; Telke, K.K.; Kalyani, D.C.; Govindwar, S.P. Decolorization and detoxification of sulfonated azo dye methyl orange by Kocuria rosea MTCC 1532. J. Hazard. Mater. 2010, 176, 503–509. [CrossRef] [PubMed] 35. Wang, J.A.; Gao, F.; Liu, Z.Z.; Qiao, M.; Niu, X.M.; Zhang, K.Q.; Huang, X.W. Pathway and molecular mechanisms for malachite green biodegradation in Exiguobacterium sp. MG2. PLoS ONE 2012, 7, e51808. [CrossRef][PubMed] 36. Mukherjee, T.; Das, M. Degradation of malachite green by Enterobacter asburiae strain XJUHX-4TM. Clean Soil Air Water 2014, 42, 849–856. [CrossRef] 37. Allison, L.H.; Schmitt, T.C.; Heinze, T.M.; Cerniglia, C.E. Reduction of malachite green to leucomalachite green by intestinal bacteria. Appl. Environ. Microb. 1997, 63, 4099–4101. 38. Chen, C.Y.; Kuo, J.T.; Cheng, C.Y.; Huang, Y.T.; Ho, I.H.; Chung, Y.C. Biological decolorization of dye solution containing malachite green by Pandoraea pulmonicola YC32 using a batch and continuous system. J. Hazard. Mater. 2009, 172, 1439–1445. [CrossRef][PubMed] 39. Kalyani, D.C.; Telke, A.A.; Surwase, S.N.; Jadhav, S.B.; Lee, J.K.; Jadhav, J.P. Effectual decolorization and detoxification of triphenylmethane dye malachite green (MG) by Pseudomonas aeruginosa NCIM 2074 and its enzyme system. Clean Technol. Environ. 2012, 14, 989–1001. [CrossRef]

© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).