DOCSLIB.ORG

Estrogen Receptor Signaling Promotes Dendritic Cell Differentiation by Increasing Expression of the Transcription Factor IRF4

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Estrogen Receptor Signaling Promotes Dendritic Cell Differentiation by Increasing Expression of the Transcription Factor IRF4 From www.bloodjournal.org by guest on March 23, 2015. For personal use only. HEMATOPOIESIS AND STEM CELLS Estrogen receptor signaling promotes dendritic cell differentiation by increasing expression of the transcription factor IRF4 Esther Carreras,1 Sean Turner,1 Mark Barton Frank,1,2 Nicholas Knowlton,1,2 Jeanette Osban,1,2 Michael Centola,1 Chae Gyu Park,3 Amie Simmons,4 Jose´Alberola-Ila,4 and Susan Kovats1 1Arthritis & Immunology Program, and 2Microarray Research Facility, Oklahoma Medical Research Foundation, Oklahoma City; 3Laboratory of Cellular Physiology and Immunology, The Rockefeller University, New York, NY; and 4Immunobiology & Cancer Program, Oklahoma Medical Research Foundation, Oklahoma City During inflammation, elevated granulo- tors (MPs). We now have identified inter- the estradiol/ER␣-dependent DC popula- cyte macrophage–colony-stimulating fac- feron regulatory factor 4 (IRF4), a tran- tion, indicating that an elevated amount tor (GM-CSF) directs the development of scription factor induced by GM-CSF and of IRF4 protein substitutes for ER␣ signal- new dendritic cells (DCs). This pathway is critical for CD11b؉ DC development in ing. Thus at an early stage in the MP influenced by environmental factors, and vivo, as a target of ER␣ signaling during response to GM-CSF, ER␣ signaling in- we previously showed that physiologic this process. In MPs, ER␣ potentiates and duces an elevated amount of IRF4, which levels of estradiol, acting through estro- sustains GM-CSF induction of IRF4. Fur- leads to a developmental program under- .gen receptor alpha (ER␣), promote the thermore, retroviral delivery of the Irf4 lying CD11b؉ DC differentiation. (Blood (GM-CSF–mediated differentiation of a cDNA to undifferentiated ER␣؊/؊ bone 2010;115:238-246 CD11b؉ DC subset from myeloid progeni- marrow cells restored the development of Introduction Dendritic cell (DC) subsets in vivo are distinguished based on several transcription factors, including Irf4, to be crucial for location, surface markers, function, and migratory capacity, and development of specific DC subsets found in lymphoid organs.3 whether they are present in steady-state conditions or develop as a For example, mice deficient in relB, PU.1, or interferon regulatory consequence of inflammation.1 In non–lymphoid tissues such as factor 4 (IRF4) lack splenic CD11bhi CD8␣Ϫ CD4ϩ DCs, whereas dermis and lung, 2 major populations of CD11cϩ MHCIIϩ DCs mice deficient in IRF8 lack splenic CD8␣ϩ CD4Ϫ CD11bϪ DCs have been identified as CD11bhi CD103Ϫ and CD11blo CD103ϩ and plasmacytoid DCs. IRF4 also is necessary for the development ϩ Ϫ Langerin or .2,3 These interstitial DCs derive from monocytes or of MHC class IIϩ DCs during GM-CSF–mediated differentiation blood-borne precursors that seed tissue, while a distinct population from murine bone marrow (BM) or human monocytes in vitro.8-10 of epidermal Langerinϩ DCs (LCs) are replenished slowly from Less is known about transcription factor requirements for tissue local self-renewing precursors. The cytokines that mediate the DCs, and factors directing the development of recently defined development of interstitial DCs during homeostasis are not defined, interstitial CD11bϩ or CD103ϩ Langerinϩ DCs have not been and may include Flt3 ligand or micro amounts of granulocyte reported. Analyses of IRF4Ϫ/Ϫ mice did not include assessments of macrophage–colony-stimulating factor (GM-CSF) or M-CSF tissue DCs.8,9 present in non–lymphoid tissue.3 During inflammation, DC differ- Transcription factor dosage is often important in cell fate entiation from Gr-1hi monocytes is largely mediated by elevated specification. Relevant to our study, quantitatively different levels amounts of GM-CSF.4 This GM-CSF–driven pathway is elevated of IRF4 protein alter B-cell differentiation pathways.11 IRF4 acts in infection and autoimmune disease and leads to the appearance of alone or dimerizes with PU.1 or Spi-B to mediate transcription.12 de novo DC populations in lymphoid organs and tissues.1,5 In Quantitative differences in PU.1 in hematopoietic progenitors also culture models, GM-CSF mediates CD11bϩ DC differentiation lead to alternate myeloid or lymphoid fates.13,14 Thus, IRF4 and from monocytes and myeloid progenitors (MPs), and a subset of PU.1 act as dosage-sensitive regulators to instruct distinct cell the CD11bint DCs express Langerin.6,7 However, it remains unclear differentiation programs, and therefore, factors (eg, hormones or how these DCs relate to Langerinϩ epidermal LCs or populations other transcription factors15,16) that regulate IRF4 expression are of CD11bϩ or Langerinϩ interstitial DCs. likely to alter IRF4-mediated developmental pathways. The lineage fate of hematopoietic progenitor cells is determined Environmental stimuli can influence DC differentiation, and we by ordered expression of transcription factors and receptor tyrosine previously have defined a role for estrogen receptor (ER) signaling kinases such as Flt3, yet the molecular steps involved in the in DC development.17 ERs are ligand-dependent transcription development of specific DC subtypes from common precursors, factors that regulate gene expression by forming complexes with including myeloid and lymphoid progenitors, pro-DCs, and mono- chromatin-modifying coregulators.18 Immune cells and their pro- cytes, are not completely defined. Genetic analyses have identified genitors express ERs, suggesting that ER-mediated responses to Submitted August 4, 2009; accepted October 7, 2009. Prepublished online as payment. Therefore, and solely to indicate this fact, this article is hereby Blood First Edition paper, October 30, 2009; DOI 10.1182/blood-2009-08- marked ‘‘advertisement’’ in accordance with 18 USC section 1734. 236935. The publication costs of this article were defrayed in part by page charge © 2010 by The American Society of Hematology 238 BLOOD, 14 JANUARY 2010 ⅐ VOLUME 115, NUMBER 2 From www.bloodjournal.org by guest on March 23, 2015. For personal use only. BLOOD, 14 JANUARY 2010 ⅐ VOLUME 115, NUMBER 2 ER SIGNALING INCREASES IRF4 EXPRESSION 239 circulating 17-␤-estradiol (E2) regulate cellular differentiation and driven DC differentiation cultures, or DC populations in BM were analyzed function. Indeed, elevated E2 levels decrease lymphopoiesis in directly ex vivo by flow cytometry. vivo by depleting primitive hematopoietic progenitors.19 E2 and ER␣ promote murine and human DC differentiation mediated by Microarrays 20-22 GM-CSF. We demonstrated that E2 specifically promotes the MPs were incubated with 1nM E2 or vehicle for variable time periods ϩ GM-CSF–mediated differentiation of murine CD11c CD11bint between 0 and 72 hours. Biotinylated amplified RNA was produced from Ϫ ϩ Ϫ Ly6C Langerin or DCs, a population that may represent in vivo 175 ng of total RNA per sample using an Illumina TotalPrep RNA populations of tissue or inflammatory DCs.7 Estradiol acting via Amplification Kit (Ambion). Amplified RNA was hybridized overnight at ER␣, but not ER␤, was required for the development of this 58°C to Sentrix Mouse-6 Expression BeadChips Version 1.1 (Illumina). CD11bint Ly6CϪ DC population from highly purified MPs (LinϪ These arrays contain 50-mer oligonucleotides coupled to beads that are c-kithi sca-1Ϫ IL-7R␣Ϫ flt3ϩ),17 but the molecular mechanism of mounted on glass slides. Each bead has an approximately 20- to 30-fold ER␣ action was unknown. redundancy. Microarrays were washed under high stringency, labeled with streptavidin-Cy3, and scanned using an Illumina BeadStation 500 scanner. We now report that E2/ER␣ signaling increases Irf4 mRNA and Ϫ To gain statistical power, gene expression response over time was protein expression in differentiating MPs and CD11c precursors, parameterized through a “mixed model”25 according to the following int Ϫ and promotes the development of the CD11c Ly6C DC subset equation: Normalized Fluorescent Units ϭ␣*Time ϩ␤1*Trx ϩ expressing the highest levels of IRF4. Enforced expression of Irf4 ␤2*Trx*Time, where ␣, ␤1, ␤2 are beta coefficients, Trx is Estrogen and Ϫ Ϫ cDNA in differentiating ER␣ / BM cells restored the develop- No Estrogen, and Time is in hours. The Trx*Time interaction P values were ment of the E2/ER␣-dependent CD11bint Ly6CϪ DC population, adjusted with a False Discovery Rate (FDR).26 An FDR of 10% was indicating that sufficiently high levels of IRF4 alleviate the considered statistically significant. A first order autoregressive covariance requirement for ER␣ signaling during GM-CSF–mediated DC matrix was used to account for the correlation structure inherent in the differentiation. Thus, an elevated amount of cellular IRF4 expres- longitudinal measurements of gene expression. All mixed model analysis sion, which can be induced by E2/ER␣ signaling, is required for was performed in the SAS system Version 9.1.3. CD11bϩ and Langerinϩ DC differentiation mediated by GM-CSF. qPCR RNA and cDNA were generated and quantitative real-time reverse transcriptase– polymerase chain reaction (qPCR) was done as described.17 Relative Methods expression of genes was determined using the ⌬⌬Ct method with normaliza- tion to Gapdh expression, which does not change with E2 stimulation. Mice Specific primer sequences were: sense Gapdh 5Ј AGGTCGGTGTGAACG- Female C57BL/6 mice (CD45.2ϩ) and congenic CD45.1ϩ C57BL/6 mice GATTTG 3Ј, antisense Gapdh 5Ј TGTAGACCATGTAGTTGAGGTCA 3Ј; (8 to 12 weeks old) were purchased from the NCI Animal Production sense Irf4 5Ј GCCCAACAAGCTAGAAAG 3Ј, antisense Irf4 5Ј TCTCT- Program. ER␣-deficient (B6.129-Esr1tm1KskN10) mice from JAX were bred GAGGGTCTGGAAACT 3Ј; sense Irf8 5Ј GTTTACCGAATTGTC- at Oklahoma Medical Research Foundation. The Oklahoma Medical CCCGAG 3Ј, antisense Irf8 5Ј CTCCTCTTGGTCATACCCATGTA 3Ј; Research Foundation Institutional Animal Care and Use Committee Sense Pu.1 5Ј ATGTTACAGGCGTGCAAAATGG 3Ј, antisense Pu.1 5Ј approved the studies. TGATCGCTATGGCTTTCTCCA 3Ј. Id2 primers (sequences proprietary) were obtained from QIAGEN. GM-CSF–mediated DC differentiation Retrovirus-mediated gene delivery The GM-CSF–driven culture model for DC differentiation, in which E2 17 The Irf4 cDNA was cloned from murine DCs and inserted in front of the levels or ER signaling are manipulated, was used as described.
Load more

Recommended publications
  • Transcription Factor IRF4 Drives Dendritic Cells to Promote Th2 Differentiation
    ARTICLE Received 30 May 2013 | Accepted 21 Nov 2013 | Published 20 Dec 2013 DOI: 10.1038/ncomms3990 Transcription factor IRF4 drives dendritic cells to promote Th2 differentiation Jesse W. Williams1, Melissa Y. Tjota2,3, Bryan S. Clay2, Bryan Vander Lugt4, Hozefa S. Bandukwala2, Cara L. Hrusch5, Donna C. Decker5, Kelly M. Blaine5, Bethany R. Fixsen5, Harinder Singh4, Roger Sciammas6 & Anne I. Sperling1,2,5 Atopic asthma is an inflammatory pulmonary disease associated with Th2 adaptive immune responses triggered by innocuous antigens. While dendritic cells (DCs) are known to shape the adaptive immune response, the mechanisms by which DCs promote Th2 differentiation remain elusive. Herein we demonstrate that Th2-promoting stimuli induce DC expression of IRF4. Mice with conditional deletion of Irf4 in DCs show a dramatic defect in Th2-type lung inflammation, yet retain the ability to elicit pulmonary Th1 antiviral responses. Using loss- and gain-of-function analysis, we demonstrate that Th2 differentiation is dependent on IRF4 expression in DCs. Finally, IRF4 directly targets and activates the Il-10 and Il-33 genes in DCs. Reconstitution with exogenous IL-10 and IL-33 recovers the ability of Irf4-deficient DCs to promote Th2 differentiation. These findings reveal a regulatory module in DCs by which IRF4 modulates IL-10 and IL-33 cytokine production to specifically promote Th2 differentiation and inflammation. 1 Committee on Molecular Pathogenesis and Molecular Medicine, University of Chicago, 924 E. 57th Street, Chicago, Illinois 60637 USA. 2 Committee on Immunology, University of Chicago, 924 E. 57th Street, Chicago, Illinois 60637 USA. 3 Medical Scientist Training Program, University of Chicago, 924 E.
    [Show full text]
  • PU.1 Cooperates with IRF4 and IRF8 to Suppress Pre-B-Cell Leukemia
    Leukemia (2016) 30, 1375–1387 © 2016 Macmillan Publishers Limited All rights reserved 0887-6924/16 www.nature.com/leu ORIGINAL ARTICLE PU.1 cooperates with IRF4 and IRF8 to suppress pre-B-cell leukemia SHM Pang1,2, M Minnich3, P Gangatirkar1,2, Z Zheng1, A Ebert3, G Song4, RA Dickins1,2,5, LM Corcoran1,2, CG Mullighan4, M Busslinger3, ND Huntington1,2, SL Nutt1,2 and S Carotta1,2,6 The Ets family transcription factor PU.1 and the interferon regulatory factor (IRF)4 and IRF8 regulate gene expression by binding to composite DNA sequences known as Ets/interferon consensus elements. Although all three factors are expressed from the onset of B-cell development, single deficiency of these factors in B-cell progenitors only mildly impacts on bone marrow B lymphopoiesis. Here we tested whether PU.1 cooperates with IRF factors in regulating early B-cell development. Lack of PU.1 and IRF4 resulted in a partial block in development the pre-B-cell stage. The combined deletion of PU.1 and IRF8 reduced recirculating B-cell numbers. Strikingly, all PU.1/IRF4 and ~ 50% of PU.1/IRF8 double deficient mice developed pre-B-cell acute lymphoblastic leukemia (B-ALL) associated with reduced expression of the established B-lineage tumor suppressor genes, Ikaros and Spi-B. These genes are directly regulated by PU.1/IRF4/IRF8, and restoration of Ikaros or Spi-B expression inhibited leukemic cell growth. In summary, we demonstrate that PU.1, IRF4 and IRF8 cooperate to regulate early B-cell development and to prevent pre-B-ALL formation.
    [Show full text]
  • Phosphorylation of Microglial IRF5 and IRF4 by IRAK4 Regulates Inflammatory Responses to Ischemia
    cells Article Phosphorylation of Microglial IRF5 and IRF4 by IRAK4 Regulates Inflammatory Responses to Ischemia Conelius Ngwa, Abdullah Al Mamun, Yan Xu, Romana Sharmeen and Fudong Liu * Department of Neurology, McGovern Medical School, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA; [email protected] (C.N.); [email protected] (A.A.M.); [email protected] (Y.X.); [email protected] (R.S.) * Correspondence: [email protected]; Tel.: +1-713-500-7038; Fax: +1-713-500-0660 Abstract: Background: Interferon Regulatory Factor (IRF) 5 and 4 play a determinant role in regu- lating microglial pro- and anti-inflammatory responses to cerebral ischemia. How microglial IRF5 and IRF4 signaling are activated has been elusive. We hypothesized that interleukin-1 receptor associated kinase 4 (IRAK4) phosphorylates and activates IRF5 and IRF4 in ischemic microglia. We aimed to explore the upstream signals of the two IRFs, and to determine how the IRAK4-IRF signaling regulates the expression of inflammatory mediators, and impacts neuropathology. Meth- ods: Spontaneously Immortalized Murine (SIM)-A9 microglial cell line, primary microglia and neurons from C57BL/6 WT mice were cultured and exposed to oxygen-glucose deprivation (OGD), followed by stimulation with LPS or IL-4. An IRAK4 inhibitor (ND2158) was used to examine IRAK40s effects on the phosphorylation of IRF5/IRF4 and the impacts on neuronal morphology by co-immunoprecipitation (Co-IP)/Western blot, ELISA, and immunofluorescence assays. Results: We confirmed that IRAK4 formed a Myddosome with MyD88/IRF5/IRF4, and phosphorylated both IRFs, which subsequently translocated into the nucleus.
    [Show full text]
  • Differential Expression of IFN Regulatory Factor 4 Gene in Human Monocyte-Derived Dendritic Cells and Macrophages
    Differential Expression of IFN Regulatory Factor 4 Gene in Human Monocyte-Derived Dendritic Cells and Macrophages This information is current as Anne Lehtonen, Ville Veckman, Tuomas Nikula, Riitta of September 27, 2021. Lahesmaa, Leena Kinnunen, Sampsa Matikainen and Ilkka Julkunen J Immunol 2005; 175:6570-6579; ; doi: 10.4049/jimmunol.175.10.6570 http://www.jimmunol.org/content/175/10/6570 Downloaded from References This article cites 79 articles, 45 of which you can access for free at: http://www.jimmunol.org/content/175/10/6570.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Differential Expression of IFN Regulatory Factor 4 Gene in Human Monocyte-Derived Dendritic Cells and Macrophages1 Anne Lehtonen,2* Ville Veckman,* Tuomas Nikula,‡ Riitta Lahesmaa,‡ Leena Kinnunen,† Sampsa Matikainen,* and Ilkka Julkunen* In vitro human monocyte differentiation to macrophages or dendritic cells (DCs) is driven by GM-CSF or GM-CSF and IL-4, respectively.
    [Show full text]
  • The Molecular Choreography of IRF4 and IRF8 with Immune System Partners
    The Molecular Choreography of IRF4 and IRF8 with Immune System Partners 1,2,4 1,3 1 HARINDER SINGH, ELKE GLASMACHER, ABRAHAM B. CHANG, 1 AND BRYAN VANDER LUGT 1Department of Discovery Immunology, Genentech Inc., South San Francisco, California 94080 4Correspondence: [email protected] The transcription factors IRF4 and IRF8 represent immune-specific members of the interferon regulatory family. They play major roles in controlling the development and functioning of innate and adaptive cells. Genes encoding these factors appear to have been coopted by the immune system via gene duplication and divergence of regulatory and protein coding sequences to enable the acquisition of unique molecular properties and functions. Unlike other members of the IRF family, IRF4 and IRF8 do not activate transcription of Type 1 interferon genes or positively regulate interferon-induced gene expression. Instead, they bind to unusual composite Ets-IRF or AP-1-IRF elements with specific Ets or AP-1 family transcription factors, respectively, and regulate the expression of diverse sets of immune response genes in innate as well as adaptive cells. The molecular cloning of interferon regulatory factor et al. 2012). Strikingly, this involves cooperative assembly 8 (IRF8) as interferon consensus sequence-binding pro- of IRF4 with AP-1 heterodimers containing a basic leucine tein (ICSBP) led to the realization that it bound inter- zipper transcription factor, AFT-like (BATF) subunit. feron response sequence elements (ISRE), albeit with This molecular property is shared by IRF8 but not by other low affinity, and antagonized ISRE-mediated gene acti- IRF family members, reminiscent of the molecular specif- vation (Driggers et al.
    [Show full text]
  • Deletion of Irf4 in T Cells Suppressed Autoimmune Uveitis and Dysregulated Transcriptional Programs Linked to CD4+ T Cell Differentiation and Metabolism
    International Journal of Molecular Sciences Article Deletion of Irf4 in T Cells Suppressed Autoimmune Uveitis and Dysregulated Transcriptional Programs Linked to CD4+ T Cell Differentiation and Metabolism Minkyung Kang 1,†, Hyun-Su Lee 1,†, Jin Kyeong Choi 1,2, Cheng-Rong Yu 1 and Charles E. Egwuagu 1,* 1 Molecular Immunology Section, Laboratory of Immunology, National Eye Institute (NEI), National Institute of Health, Bethesda, MD 20892, USA; [email protected] (M.K.); [email protected] (H.-S.L.); [email protected] (J.K.C.); [email protected] (C.-R.Y.) 2 Department of Immunology, Jeonbuk National University Medical School, Jeonju, Jeonbuk 54907, Korea * Correspondence: [email protected]; Tel.: +301-496-0049; Fax: +301-480-3914 † These authors contributed equally. Abstract: Interferon regulatory factor-4 (IRF4) and IRF8 regulate differentiation, growth and functions of lymphoid and myeloid cells. Targeted deletion of irf8 in T cells (CD4-IRF8KO) has been shown to exacerbate colitis and experimental autoimmune uveitis (EAU), a mouse model of human uveitis. We therefore generated mice lacking irf4 in T cells (CD4-IRF4KO) and investigated whether expression of IRF4 by T cells is also required for regulating T cells that suppress autoimmune diseases. Surprisingly, we found that CD4-IRF4KO mice are resistant to EAU. Suppression of EAU derived in part from inhibiting pathogenic responses of Th17 cells while inducing expansion of regulatory lymphocytes that secrete IL-10 and/or IL-35 in the eye and peripheral lymphoid tissues. Furthermore, CD4- IRF4KO T cells exhibit alterations in cell metabolism and are defective in the expression of two Citation: Kang, M.; Lee, H.-S.; Choi, Ikaros zinc-finger (IKZF) transcription factors (Ikaros, Aiolos) that are required for lymphocyte J.K.; Yu, C.-R.; Egwuagu, C.E.
    [Show full text]
  • Estrogen Receptor-Dependent Regulation of Dendritic Cell Development and Function
    REVIEW published: 10 February 2017 doi: 10.3389/fimmu.2017.00108 Estrogen Receptor-Dependent Regulation of Dendritic Cell Development and Function Sophie Laffont1*, Cyril Seillet2,3 and Jean-Charles Guéry1* 1 Centre de Physiopathologie de Toulouse Purpan (CPTP), Université de Toulouse, INSERM, CNRS, UPS, Toulouse, France, 2 Division of Molecular Immunology, The Walter and Eliza Hall Institute of Medical Research, Melbourne, VIC, Australia, 3 Department of Medical Biology, University of Melbourne, Melbourne, VIC, Australia Autoimmunity, infectious diseases and cancer affect women and men differently. Because they tend to develop more vigorous adaptive immune responses than men, women are less susceptible to some infectious diseases but also at higher risk of autoimmunity. The regulation of immune responses by sex-dependent factors probably involves several non-redundant mechanisms. A privileged area of study, however, concerns the role of sex steroid hormones in the biology of innate immune cells, especially dendritic cells (DCs). In recent years, our understanding of the lineage origin of DC populations has expanded, Edited by: and the lineage-committing transcription factors shaping peripheral DC subsets have Manfred B. Lutz, been identified. Both progenitor cells and mature DC subsets express estrogen receptors University of Würzburg, Germany (ERs), which are ligand-dependent transcription factors. This suggests that estrogens Reviewed by: may contribute to the reported sex differences in immunity by regulating DC biology. Meredith O’Keeffe, Monash University, Australia Here, we review the recent literature and highlight evidence that estrogen-dependent Pieter J. M. Leenen, activation of ERα regulates the development or the functional responses of particular DC Erasmus University Rotterdam, + Netherlands subsets.
    [Show full text]
  • Structural Basis of STAT2 Recognition by IRF9 Reveals Molecular Insights Into
    bioRxiv preprint doi: https://doi.org/10.1101/131714; this version posted April 28, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Structural basis of STAT2 recognition by IRF9 reveals molecular insights into 2 ISGF3 function 3 Srinivasan Rengachari1, Silvia Groiss1, Juliette, Devos1, Elise Caron2, Nathalie Grandvaux2,3, 4 Daniel Panne1* 5 1European Molecular Biology Laboratory, 38042 Grenoble, France 6 2 CRCHUM - Research center, Centre Hospitalier de l'Université de Montréal, Montréal, 7 H2X0A9, Québec, Canada 8 3 Department of Biochemistry and Molecular Medicine, Université de Montréal; Faculty of 9 Medicine, Université de Montréal, Montréal, H3C 3J7, Qc, Canada 10 *Corresponding author: email– [email protected], tel: +33–476207925 11 12 13 1 bioRxiv preprint doi: https://doi.org/10.1101/131714; this version posted April 28, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 14 15 Summary 16 Cytokine signalling is mediated by the activation of distinct sets of structurally homologous JAK 17 and STAT signalling molecules, which control nuclear gene expression and cell fate. A 18 significant expansion in the gene regulatory repertoire controlled by JAK/STAT signalling has 19 arisen by the selective interaction of STATs with IRF transcription factors.
    [Show full text]
  • 1 1 EBNA3 Proteins Regulate EBNA2 Binding to Distinct RBPJ Genomic
    JVI Accepted Manuscript Posted Online 30 December 2015 J. Virol. doi:10.1128/JVI.02737-15 Copyright © 2015, American Society for Microbiology. All Rights Reserved. 1 2 EBNA3 proteins regulate EBNA2 binding to distinct RBPJ genomic sites 3 4 Anqi Wang1, Rene Welch2, Bo Zhao3, Tram Ta2, Sündüz Keleș2,4 and Eric Johannsen1, * 5 6 7 1 Department of Medicine and Oncology, McArdle Laboratory For Cancer Research, University of 8 Wisconsin, Madison, WI 53715, USA 9 2 Department of Statistics, University of Wisconsin, Madison, WI 53715, USA 10 3 The Channing Laboratory, Department of Medicine, Brigham and Women's Hospital, Harvard 11 Medical School, Boston, MA 02115, USA. 12 4 Department of Biostatistics and Medical Informatics, University of Wisconsin, Madison, WI 53715, 13 USA 14 * Corresponding author mailing address: Department of Medicine, University of Wisconsin, 1111 15 Highland Avenue, Madison, WI 53705. Phone: (608) 262-9952. E-mail: 16 [email protected] 17 18 19 Running Title: Genome-wide analysis of EBNA3 DNA binding 20 Keywords: EBNA3, EBNA2, Notch signaling, RBPJ, IRF4, transformation, 21 Word Count Abstract: 250 1 22 ABSTRACT 23 Latent infection of B lymphocytes by Epstein-Barr virus (EBV) in vitro results in their immortalization 24 into lymphoblastoid cell lines (LCLs); this latency program is controlled by the EBNA2 viral 25 transcriptional activator that targets promoters via RBPJ, a DNA binding protein in the Notch signaling 26 pathway. Three other EBNA3 proteins (EBNA3A, EBNA3B, and EBNA3C) interact with RBPJ to 27 regulate cell gene expression. The mechanism by which EBNAs regulate different genes via RBPJ 28 remains unclear.
    [Show full text]
  • IRF4 and IRF8 Act in Cd11c+ Cells to Regulate Terminal Differentiation of Lung Tissue Dendritic Cells
    IRF4 and IRF8 Act in CD11c+ Cells To Regulate Terminal Differentiation of Lung Tissue Dendritic Cells This information is current as Sandra Bajaña, Sean Turner, Jinny Paul, Erola of September 29, 2021. Ainsua-Enrich and Susan Kovats J Immunol 2016; 196:1666-1677; Prepublished online 8 January 2016; doi: 10.4049/jimmunol.1501870 http://www.jimmunol.org/content/196/4/1666 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2016/01/07/jimmunol.150187 Material 0.DCSupplemental http://www.jimmunol.org/ References This article cites 49 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/196/4/1666.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 29, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology IRF4 and IRF8 Act in CD11c+ Cells To Regulate Terminal Differentiation of Lung Tissue Dendritic Cells Sandra Bajan˜a, Sean Turner, Jinny Paul, Erola Ainsua-Enrich, and Susan Kovats Dendritic cells (DCs) initiate immune responses in barrier tissues including lung and skin.
    [Show full text]
  • Inhibition of IRF4 in Dendritic Cells by PRR-Independent
    RESEARCH ARTICLE Inhibition of IRF4 in dendritic cells by PRR-independent and -dependent signals inhibit Th2 and promote Th17 responses Jihyung Lee1, Junyan Zhang1,2,3, Young-Jun Chung1,4, Jun Hwan Kim1, Chae Min Kook1, Jose´ M Gonza´ lez-Navajas3,5,6, David S Herdman1, Bernd Nu¨ rnberg7, Paul A Insel1,8, Maripat Corr1, Ji-Hun Mo4, Ailin Tao2,3, Kei Yasuda9, Ian R Rifkin9,10, David H Broide1, Roger Sciammas11, Nicholas JG Webster1,12*, Eyal Raz1,3* 1Department of Medicine, University of California San Diego, San Diego, United States; 2The Second Affiliated Hospital of Guangzhou Medical University (GMU), The State Key Laboratory of Respiratory Disease, Guangdong Provincial Key Laboratory of Allergy & Clinical Immunology, Guangzhou, China; 3Center for Immunology, Inflammation and Immune-mediated disease, GMU, Guangzhou, China; 4Department of Otorhinolaryngology-Head and Neck Surgery, Dankook University College of Medicine, Chungnam, Republic of Korea; 5Alicante Institute for Health and Biomedical Research (ISABIAL - FISABIO), Alicante, Spain; 6Networked Biomedical Research Center for Hepatic and Digestive Diseases (CIBERehd), Institute of Health Carlos III, Madrid, Spain; 7Department of Pharmacology and Experimental Therapy, University of Tu¨ bingen, Tu¨ bingen, Germany; 8Department of Pharmacology, University of California San Diego, San Diego, United States; 9Boston University School of Medicine, Boston, United States; 10VA Boston Healthcare System, Boston, United States; 11Center for Comparative Medicine, University of California, Davis, Davis, United States; 12VA San Diego Healthcare System, San Diego, United States *For correspondence: [email protected] (NJGW); [email protected] (ER) Abstract Cyclic AMP (cAMP) is involved in many biological processes but little is known Competing interests: The regarding its role in shaping immunity.
    [Show full text]
  • Irfs As Competing Pioneers in T-Cell Differentiation
    Cellular & Molecular Immunology (2017) 14, 649–651 & 2017 CSI and USTC All rights reserved 2042-0226/17 $32.00 www.nature.com/cmi RESEARCH HIGHLIGHT IRFs as competing pioneers in T-cell differentiation Andrea Kröger Cellular & Molecular Immunology (2017) 14, 649–651; doi:10.1038/cmi.2017.37; published online 19 June 2017 CD4-expressing T lymphocytes are combination with IL-6 or IL-21 promote engagement of TCRs on naive CD4+ among of the best-characterized immune TH17 development. These cells produce T cells cultured under Tr1 polarizing system cells.1 They develop in the thy- IL-17, IL-21 and IL-22 and express the conditions. Irf1 and Batf mRNA mus and acquire the potential to differ- lineage-specific transcription factor showed a dual wave expression profile entiate into distinct subpopulations. RORγt. Regulatory T cells (nTreg) can with an early peak between 1 and 6 h Upon leaving the thymus, T helper cells develop directly in the thymus; they after activation. Moreover, stimulation further differentiate in the periphery in express FOXP3 and inhibit T effector of naive CD4+ T cells from knockout response to signals from T-cell receptors, cell functions. Tr1 cells are poorly failed to produce Il10 mRNA or differ- cytokines and other ligands in the micro- defined regulatory T cells;2 they are entiation into Tr1 cells. environment. CD4+ T cells have high FOXP3 negative and express high levels IL-27 receptor signaling is known to plasticity and can differentiate into sev- of anti-inflammatory cytokines like induce Tr1 cell differentiation. Further- eral different subtypes.
    [Show full text]