Oncogene (1997) 14, 2189 ± 2193  1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00

Infrequency of BRCA2 alterations in head and neck squamous cell carcinoma

Haskell Kirkpatrick1, Pamela Waber1, To Hoa-Thai1, Robert Barnes1, Sherri Osborne-Lawrence1, John Truelson2, Perry Nisen1 and Anne Bowcock1

1Division of Hematology/Oncology, Department of Pediatrics, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75235-8591; 2Department of Otolaryngology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75235-8591, USA

Alterations of BRCA2 result in increased susceptibility chromosome regions 1p, 3p, 7q, 9p, 11q and 17p to breast cancer in both men and women (relative (Cowan et al., 1992; Jin et al., 1993; Maestro et al., lifetime risks of 0.06 and 0.8 respectively). BRCA2 maps 1993; Rowley et al., 1996; Wu et al., 1994; van der Riet to 13q12-q13 and encodes a transcript of 10 157 bp. et al., 1994; Reed et al., 1996; Nawroz et al., 1994). Other cancers that have been described in BRCA2 Loss of heterozygosity (LOH) studies that frequently mutation carriers include those of the larynx. Human reveal the locale of tumor suppressor genes (Ponder, chromosome 13q has been shown previously by LOH 1988) have been performed by us and others and studies to harbor several tumor suppressor genes for head revealed regions on chromosomes 3, 8, 9, 13, 17p12 and neck squamous cell carcinoma (HNSCCs). We and multiple others (Nawroz et al., 1994; Ah-See et al., therefore examined the role of BRCA2 in the develop- 1994; Li et al., 1994). ment of these cancers. Only 6/22 (27%) of the laryngeal With respect to chromosome 13, several regions cancers we examined demonstrated LOH of the BRCA2- have been implicated to harbor alterations in HNSCCs containing region. These and 10 other HNSCCs of on the basis of LOH (Lee et al., 1993, 1994). These di€erent origins that were demonstrated by LOH studies include regions within 13q32-qter, 13q14.2-q14.3 to have lost the region of chromosome 13 containing (Maestro et al., 1996) and 13q14.1-q22 (Yoo et al., BRCA2 were examined for alterations in this gene. 1994). LOH of chromosome 13 loci precedes histolo- SSCP analysis failed to reveal any alterations leading us gical changes in 63% of the tumors, being detected in to conclude that BRCA2 alterations are not frequently histologically normal mucosa adjacent to the tumors involved in the pathogenesis of HNSCCs and that the (Lee et al., 1994). Known candidate tumor suppressor observed LOH of chromosome 13 loci is due to other, as genes on chromosome 13 are the RB1 gene and the yet, unidenti®ed tumor suppressor gene(s). Interestingly recently isolated gene for early-onset breast cancer 2 tumors with LOH in this region (proximal to D13S118) (BRCA2) (Wooster et al., 1995). However, although were far more likely to be derived from women than men. RB1 has been localized to 13q14.2, no signi®cant This is unusual since HNSCCs are usually fourfold more variation in RB1 protein or in expression of RB1 common in men than in women. mRNA has been detected in HNSCCs, suggesting that it is not involved in the development and/or Keywords: head and neck squamous cell carcinoma; progression of these tumors (Maestro et al., 1996; chromosome 13; BRCA2; mutational analysis Yoo et al., 1994) and prompting a search for additional tumor suppressor genes in this vicinity. BRCA2 is the second gene for early onset familial breast cancer to be isolated. BRCA2 maps to human Introduction chromosome 13q12-q13 (Wooster et al., 1994). Like BRCA1, BRCA2 is a large tumor suppressor gene, Over 42 000 new cases of head and neck squamous cell with no homology to any known gene (Wooster et al., carcinomas (HNSCCs) are diagnosed per year in the 1995). BRCA2 alterations are estimated to account for United States and over 11 000 deaths occur as a result approximately 8% of heritable early-onset breast (Boring et al., 1992). Worldwide, more than 500 000 cancer cases, 11% of heritable breast/ovarian cancer new cases are diagnosed per year (Parkin et al., 1988). cases and 25% of male breast cancer cases with a Over 90% of these tumors occur in individuals who family history of breast cancer (Phelan et al., 1996; smoke tobacco and/or ingest alcohol (Muscat and Couch et al., 1996). The population frequency of germ- Wynder, 1992). line BRCA2 mutations is not known, although a Genetic alterations in a variety of oncogenes and mutant gene confers a lifetime risk for development of tumor suppressor genes have been identi®ed in breast cancer that is similar to that for BRCA1 HNSCCs. These include EGFR, c-myc, ras, int-2, (approximately 70% by age 70) (Stratton, 1996). hst-1, bcl-1, prad-1 and E-cadherin (Lee, 1992a,b). In Other cancers that have been described in BRCA2 a small number of cases, infection with human mutation carriers include those of the larynx (Stratton papillomavirus (serotypes 16 and 33) has also been et al., 1996). ascribed as a causative agent (Somers et al., 1992). Alterations in several tumor suppressor genes that are Cytogenetic analyses have revealed deletions in responsible for familial cancers can also cause sporadic cancers. For example, approximately 10% of ovarian Correspondence: A Bowcock tumors have been shown to harbor non-germline Received 21 January 1997; accepted 21 January 1997 BRCA1 alterations (Merajver et al., 1995; Hosking et Infrequency of BRCA2 alterations in HNSCCs H Kirkpatrick et al 2190 al., 1995). In both cases, loss of the wild-type allele was D13S267). We found that 16 of these tumors had observed following the classic paradigm for dominantly undergone LOH at one or both of these loci and were inherited tumor suppressor genes in which a point therefore candidates for harboring BRCA2 mutations mutation in the coding region of one allele, inherited as (Table 1). These were subjected to SSCP analysis of the a germ-line lesion, occurs in conjunction with alteration entire BRCA2 gene with primers/restriction endonu- or loss of the other allele (Ponder, 1988). cleases shown in Table 2. No variants were detected in Since laryngeal cancers are over-represented in any tumor sample, suggesting that alterations in BRCA2 mutation carriers, a role for this gene in BRCA2 are not commonly found in HNSCCs. their development has been suggested (Stratton, 1996). Three sporadic breast tumors out of a total of 281 We therefore decided to investigate if BRCA2 is altered primary cancers have been reported to harbor non- in sporadic HNSCCs. We ®rst examined an initial set germ-line BRCA2 alterations; one of these was a of 72 HNSCCs for allele loss at polymorphic truncating mutation (Weber, 1996) the other two were microsatellite loci on chromosome 13 and identi®ed mis-sense mutations (Miki et al., 1996; Lancaster et al., 16 which exhibited LOH of the BRCA2 region. Six of 1996). These studies indicate that somatic BRCA2 these were tumors of the larynx. These 16 tumors were alterations may be involved in a minor subset of then screened for alterations within BRCA2 by SSCP sporadic breast cancers. In the study described here we analysis. This failed to reveal any detectable alterations were not able to detect BRCA2 mutations in 16 indicating that BRCA2 is not frequently involved in HNSCCs that included six laryngeal cancers, despite the pathogenesis of HNSCCs. the fact that LOH of this region was observed in these 16 tumors. This suggests that alterations in a gene other than BRCA2 or RB1 is involved in the Results and discussion pathogenesis of HNSCCs. However, since SSCP will not detect all variants, it is not possible to conclusively BRCA2 lies on chromosome 13q between D13S260 say that there are no BRCA2 alterations within the set and D13S267. The order of loci used in this study was: of 16 tumors that we examined. Also, there is 13-cen, D13S115, D13S120, D13S260, D13S267, speculation that some alterations in genes such as D13S127, D13S118 and D13S126. We typed initially BRCA2 are not detected because they lie outside their 70 matched tumor/normal pairs for polymorphic coding regions. markers at loci that included D13S115, D13S120, One interesting observation we made during the D13S127, D13S126 and D13S118 (Lee et al., 1994) course of this study relates to the region of and demonstrated that there is increased allelic loss at chromosome 13 that was lost and the ratio of men/ multiple regions of chromosome 13. From this set of women with the cancer. Overall, 19 women and 53 men 70 tumors we identi®ed 23 that had undergone LOH of were ascertained for this study. Eleven women (58% of at least one locus on chromosome 13q proximal to and those ascertained) and 15 men (28% of those including D13S118, a locus that lies distal to BRCA2. ascertained) had LOH at or above D13S118. The This set of 23 paired samples, plus an additional two remainder (eight women and 38 men) had no LOH of others, were examined for LOH of the region chromosome 13 (four women and 25 men) or had containing BRCA2 (i.e. between D13S260 and LOH at loci below D13S118 (four women and 13

Table 1 Characteristics of HNSCCs and their LOH around BRCA2 T B Age Sex Site D13S115 D13S120 D13S260 D13S267 D13S127 D13S118 D13S126 504 510 78 F OC 553 554 66 F HP 567 568 51 F OP 569 571 69 M n.d. n.d. n.d. n.d. 593 594 76 M GL 607 609 61 F OC 617 619 69 M OC 625 623 69 M GL 655 657 69 M OC n.d. 684 686 57 M HP n.d. 687 689 47 F GL 703 705 66 M SGL 707 709 59 F OP 726 719 73 M OC 758 761 69 F OC n.d. 850 852 47 F HP 859 861 63 M OC 869 871 76 M SGL 921 923 61 M SGL n.d. 924 926 62 M GL n.d. 927 929 53 M SGL 1021 1020 40 M OP 1031 1032 43 F n.d. n.d. n.d. n.d. 1033 1035 46 F SGL n.d. 1040 1042 52 F HP n.d.

T: Tumor; B: Blood; Disease site: (OC) oral cavity, (GL) glottic larynx, (HP) hypopharynx, (OP) oropharynx, (SGL) supraglottic larynx, (PAR), parotid; no LOH; LOH in tumor; not informative; n.d., sample not tested for that particular marker Infrequency of BRCA2 alterations in HNSCCs H Kirkpatrick et al 2191 men). When the proportion of men/women with loss at mutation (a 14 bp deletion of codons 287 ± 292) that or above D13S118 versus men/women with no loss or was seen in 17/80 HNSCCs where 13 of the 17 cases loss below D13S118 were compared, results were were from women (Nylander et al., 1996). signi®cant (Chi square, 1 d.f.=5.3, P50.05). This sex-bias is tantalizing, because in general HNSCCs are approximately four times more common in men Materials and methods than in women and this di€erence may re¯ect a di€erent etiology for HNSCCs in these di€erent sub- Clinical specimens groups. In a study from Sweden a similar sex bias was Paired HNSCC tumor tissue and blood specimens were observed with respect to the presence of a speci®c p53 obtained as part of a protocol approved by the University

Table 2 PCR primers and restriction enzymes for SSCP analysis of the BRCA2 gene Exon PCR Enzyme for size prod. SSCP Fragment Exon (bp) Forward primer (5'-43') Reverse primer (5'-43') size analysis lengths (bp) 2 67 1F: CAAGCATTGGAGGAATATCGT 1R: AGCAACACTGTGACGTACTG 189 7 3 249 2F: CCATAGTCAAGATCTTAAGCAT 2R: CAGTCTACCATATTGCATTACT 383 HinfI 186, 197 4 109 3F: CCAGAGTATATACATTCTCACT 3R: TCTACCAGGCTCTTAGCCAA 265 MboI 98, 167 5/6 50/41 4/5F: GTGAGTACATATGTGTTGGCA 4/5R: GGCAAAGGTATAACGCTATTG 461 RsaI+SspI 5 (nc), 120, 171, 65 7 115 6F: CCTCATACAGGCAATTCAGTA 6R: TCAACCTCATCTCCTCTTTCT 275 BamHI 160, 115 8 50 7F: ATTCACTGTGTTGATTGACCTT 7R: TTCAACAGTCTAATCAATGTCAT 258 MboII 195, 63 9 112 8F: CTACTATATGTGCATTGAGAGT 8R: TAGTTCAACTAAACAGAGGACT 194 7 10 1116 #1F/9F: TCTATGAGAAAGGTTGTGAGAA #1R/9R: ACACAGAAGGAATCGTCATCT 1262 EcoRI+ 100 (nc), 276 MboI 240, 247, 131, 268 11 4932 10AF: AGTGAATGTGATTGATGGTACT 10AR: TTGTTCTCCTCTGCAAGAACA 1012 HinfI 96, 169, 247, 43, 223, 234 10BF: TGTCCACTATTTGTTCGTTGG 10B2R: ATGAAACAGACTTGACTTGTGT 974 HinfI 99, 98, 165 HaeIII, 210, 223, StyI 189 10CF:TGTTTCTACTGAAGCTCTGCA 10CR: CTTTACAGGCCTCTCTGTAC 1040 MboII, 90, 158, SpeI 226, 219, 130, 152, 65 *10DF: GGTACTAGTGAAATCACCAGT 10DR: GTGAATGCGTGCTACATTCAT 1099 AccI, SspI, 210, 227, EcoRV 194, 170, 298 10EF: GCATTGGATGATTCAGAGGAT 214.5BR: CTGAAGAACCACCTTCAACAT 1192 HphI, DraI, 159, 159, HindIII 182, 226, 61, 115, 144, 146 214.5BF,CCAGAGCACTGTGTAAACTC 7a8r#1R,GATTGGCAACACGAAAGGTA 537 HphI, 209, 154, HindIII 174 7a8r#1F,CAAGTCATGCCACACATTCT 7a8r#1R,GATTGGCAACACGAAAGGTA 141 7 12 96 7e8r#2F: GGTCACTATTTGTTGTAAGTAT 7a8r#2R:CCTATAGAGGGAGAACAGAT 279 7 13 70 7e8r#3F:CAGTAACATGGATATTCTCTTA 7a8r#3R: CGAGACTTTTCTCATACTGTA 178 7 14 428 13F:CTGCAACAAAGGCATATTCCT 13R: TTCATCACACAAATTGTCATACA 530 HinfI+DraI 103, 103, 196, 128 15 182 14F: ACAAGTCTTCAGAATGCCAGA 14R: GCCATTTGTAGGATACTAGTTA 258 HinfI 119, 139 16 188 15F: GTAGTGAAGATTCTAGTAGTTAA 15R: GTTCGAGAGACAGTTAAGAGA 397 HinfI 9 (nc), 177, 211 17 171 16F: TTCAGTATCATCCTATGTGGTT 16R: ATACTGCCGTATATGATTACGT 268 MboII 199, 69 18 355 17F: CAGTGGAATTCTAGAGTCACA 17R: ATTGAGCATCCTTAGTAAGCAT 510 PvuII+DdeI 124, 164, 207, 15(nc) 19 156 18F: AAGGCAGTTCTAGAAGAATGAA 18R: TGGTAAGTTTCAAGAATACATCA 278 HinfI 144, 134 20 145 19F2: CATCATGTTGGTCAGGCTGAT 19R2: TTACAAATGGCTTAGACCTGAT 406 HaeII+ 27(nc), 155 DdeI 148, 116 21 122 20F: ACCATATTTACCATCACGTGC 20R: CTCAAGGTAAGCTGGGTCT 109 none 22 199 21F: CCATCTAGTTACAATAGATGGA 21R: AGCTTACAATACGCAACTTCC 246 AluI 106, 140 23 164 22F: AATCACTTCTTCCATTGCATCT 22R: GAGATTCCATAAACTAACAAGC 268 AluI 111, 157 24 139 23F: GCTTGTTAGTTTATGGAATCTC 23R: CCAACTGGTAGCTCCAACTA 288 MboI 120, 168 25 245 24F: GCACTGTAAGCAACAGGTCA 24R:TCCTTGATACTGGACTGTCAA 493 BfaI 178, 190, 125 26 147 25F: CGGCATGTTTGACAATTGGTA 25R: AGAATATACGATGGCCTCCAT 358 DdeI+ 106, 93, HaeIII 14(nc), 145(nc) 27 609 26F: CCTAACCTATTAGGAGTTAGG 26R: GCAACATAAGTACTAATGTGTG 844 MboII+ 135(nc), EcoRI 171, 137, 84, 105, 75, 137 The exon for which the corresponding primers were designed are listed in the ®rst column. Unless speci®ed the annealing temperature was 558C. The size of each exon is indicated in the second column. The third and fourth columns contain sequences of forward and reverse primers respectively. The ®fth column indicates the size of the PCR product generated with the primers provided. The sixth column indicates the enzyme/s used to generate a smaller product for SSCP and the seventh column indicates the fragment sizes generated by the corresponding enzyme. nc:non-encoding sequence. Infrequency of BRCA2 alterations in HNSCCs H Kirkpatrick et al 2192 of Texas Southwestern Medical Center Human Subjects boundaries. PCR products from these exons were cleaved Review Board (Table 1). The demographic and clinical with restriction endonucleases if they were signi®cantly features of these patients were summarized previously (Lee 4130 bp in order to generate shorter fragments lengths and et al., 1994), with the exception of tumors no. 569/571 and these were then subjected to SSCP analysis. Primer sequences, 1031/1032. 569/571 was obtained from a 60 year old man PCR ampli®cation products, and restriction enzymes used to with laryngeal cancer, 1031/1032 was obtained from a 39 generate smaller products for SSCP are shown in Table 2. year old woman with a tumor of the hypopharynx. All of DNA derived from tumor or matched blood specimens were the patients smoked tobacco and ingested alcohol. Tumors then subjected to SSCP analysis as described by Orita et al. and the bu€y coat from blood were immediately frozen in (1989a,b). liquid nitrogen and stored at 7708C. DNA was prepared from tumor and blood specimens by standard procedures. SSCP analysis PCR of tumor or matched blood DNA was performed in Loss of heterozygosity 20 ml volumes containing 100 ng cDNA or genomic DNA To identify tumors with LOH of the region containing template; 16PCR bu€er (Perkin Elmer); 200 mM each BRCA2, tumors and matched blood specimens were dATP, dGTP, dCTP, dTTP; 10 pmoles each primer as genotyped for polymorphic `CA' dinucleotide repeat showninTable2(GibcoBRL);0.3mCi [32P]dCTP markers at D13S260 and D13S267 as described elsewhere (Amersham); 0.5 U Taq DNA polymerase (Perkin Elmer). (Bowcock et al., 1993). Oligonucleotide primer sequences PCR conditions were 30 cycles of 948C, 30 s; 558C, 30 s; were obtained from the Genome Data Base. LOH studies 728C, 30 s. A ®nal extension reaction at 728Cwas on HNSCCs using polymorphic microsatellites are de- performed for 7 min. Ampli®ed samples were diluted scribed in greater detail elsewhere (Weber et al., 1996). 1 : 10 in formamide bu€er (98% formamide, 10 mM EDTA pH 8.0, 0.05% bromophenol blue, 0.05% xylene cyanol), denatured at 958C for 5 min than cooled rapidly to 48C. Mutational screening for BRCA2 alterations For each sample, 4 ml was loaded onto an SSCP gel and ThecDNAsequenceofBRCA2wasavailablefrom run at 8 W (constant power) for 8 ± 16 h in 0.66TBE at Genbank (Accession No. U43746) and was aligned with room temperature. Gels contained 0.56MDE (AT genomic sequence from this region and available from the Biochem), 0.66TBE, 160 ml 25% ammonium persulphate Sanger Center and Washington University (ftp://ftp/ and 38 ml TEMED. Duplicate gels were prepared with a sanger/ac/uk/pub/human/sequences/13q and ftp://genome/ supplement of 10% glycerol. Gels were subjected to wustl/edu/pub/gscl/brca2). This permitted a design of autoradiography with or without being dried. Film was oligonucleotide primers ¯anking exons/intron boundaries. exposed for 12 ± 24 h with an intensifying screen. Exons 10 and 11 of BRCA2 are large (1116 bp and 4932 bp respectively). They are therefore not directly amenable to SSCP analysis which is more likely to reveal variants if the fragments being tested are in the range of 130 bp. In the case of these exons, primers were designed to Acknowledgements amplify products of approximately 1000 bp. Ampli®ed This work was supported in part by CA60650 (AMB), the products were then digested with several di€erent restriction American Cancer Society (EDT96; PDN) and grants from endonucleases (Table 2) to generate fragments small enough the Children's Cancer Fund of Dallas. We are grateful to to be examined by SSCP analysis. In the case of all other Colleen Campbell and Anne Phung for help in preparation exons, primers were designed that ¯anked exon/intron of the manuscript.

References

Ah-See K, Cooke TG, Pickford IR et al. (1994). Cancer Res., Li X, Lee NK, Ye Y-W, Waber PG, Schweitzer C, Cheng 54, 1617 ± 1621. Q-C and Nisen P. (1994). J. Natl. Cancer Inst., 86, 1524 ± Boring CC, Squires TS and Tong T. (1992). CA Cancer J. 1529. Clin., 42, 19 ± 38. Maestro R, Gasparotto D, Vukosavljevic T, Barzan L, Bowcock AM, Osborne-Lawrence S, Barnes R, Chakravarti Sulfaros S and Boiocchi M. (1993). Cancer Res., 53, 5775 ± A, Washington S and Dunn C. (1993). Genomics, 15, 376 ± 5779. 386. Maestro R, Piccinin S, Doglioni C, Gasparotto D, Couch FJ, Farid LM, DeShano ML, Tavtigian SV, Calzone Vukosavljevic T, Sulfaro S, Barzan L and Boiocchi M. K,CampeauL,PengY,BogdenB,ChenQ,NeuhausehS (1996). Cancer Res., 56, 1146 ± 1150. et al. (1996). Nature Genet., 13, 123 ± 125. Merajver SD, Pham TM, Cadu€ RF, Chen M, Poy EL, Cowan JM, Beckett MA, Ahmed-Swan S et al. (1992). J. Cooney KA, Weber BL, Collins FS, Johnston C and Natl. Cancer Inst., 84, 793 ± 797. Frank TS. (1995). Nature Genet., 9, 439 ± 443. Hosking L, Trowsdale J, Nicolai H, Solomon E, Foulkes W, Miki Y, Katagiri T, Kasumi F, Yoshimoto T and Nakamura Stamp G, Signer E and Je€reys A. (1995). Nature Genet., Y. (1996). Nature Genet., 13, 245 ± 247. 9, 343 ± 344. Nawroz H, van der Riet P, Hruban RH, Koch W, Ruppert Jin Y, Mertens F, Mandahl N et al. (1993). Cancer Res., 52, JM and Sidransky D. (1994). Cancer Res., 54, 1152 ± 1155. 2140 ± 2146. Nylander K, Schildt EB, Eriksson M, Magnusson A, Mehle Lancaster J, Wooster R, Mangion J, Phelan C, Cochran C, C and Roos G. (1996). Br. J. Cancer, 73, 1381 ± 1386. Gumbs C, Seal S, Barfoot R, Collins N, Bignell G et al. Orita M, Suzuki Y, Sekiya T and Hayashi K. (1989a). (1996). Nature Genet., 13, 238 ± 240. Genomics, 5, 874 ± 879. Lee NK. (1992a). Head Neck, 14, 235 ± 242. Orita M, Wahana H, Kanazawa H, Hayashi K and Sekiya T. Lee NK. (1992b). Head Neck, 14, 407 ± 414. (1989b). Proc. Natl. Acad. Sci. USA, 86, 2766 ± 2770. Lee NK, Ye UW, Chen J, Xiaohua L, Waber PG and Nisen Parkin DM, Laara E and Muir CS. (1988). Int. J. Cancer, 41, PD. (1993). Otolaryngology, 119, 1125 ± 1131. 184 ± 197. Infrequency of BRCA2 alterations in HNSCCs H Kirkpatrick et al 2193 Phelan C, Lancaster J, Tonin P, Gumbs C, Cochran C, Weber BHF, Brohm M, Stec I, Backe J and Caer H. (1996). Carter R, Ghadirian P, Perret C, Moslehi R, Dion F et al. Am. J. Hum. Genet., 59, 962 ± 964. (1996). Nature Genet., 13, 120 ± 122. Wooster R, Bignell G, Lancaster J, Swift S, Seal S, Mangion Ponder B. (1988). Nature, 335, 400 ± 402. J, Collins N, Gregory S, Gumbs C, Micklem G et al. Reed AL, Califano J, Cairns P, Westra WH, Jones RM, (1995). Nature, 378, 789 ± 792. Koch W, Ahrendt S, Eby Y, Sewell D, Nawroz H et al. Wooster R, Neuhausen SL, Mangion J, Quirk Y, Ford D, (1996). Cancer Res., 56, 3630 ± 3633. Collins N, Nguyen K, Seal S, Tran T, Averill D et al. Rowley H, Jones A, Spandidos D and Field J. (1996). Arch. (1994). Science, 265, 2088 ± 2090. Otolaryngology, 122, 497 ± 501. Wu C, Sloan P, Read A, Harris R and Thakker N. (1994). Somers KD, Merrick MA, Lopez ME, Incognito L, Cancer Res., 54, 6484 ± 6488. Schechter G and Casey G. (1992). Cancer Res., 52, Yoo GH, Xu HJ, Brennan JA, Westra W, Hruban RH, Koch 5997 ± 6000. W, Benedict WF, Sidransky D. (1994). Cancer Res., 54, Stratton MR. (1996). Hum. Molec. Genet., 5, 1515 ± 1519. 4603 ± 4606. van der Riet P, Nawroz H, Hruban RH, Corio R, Tokino K, Koch W and Sidransky D. (1994). Cancer Res., 54, 1156 ± 1158.