US008309793B2

(12) United States Patent (10) Patent No.: US 8,309,793 B2 Mullet et al. (45) Date of Patent: Nov. 13, 2012

(54) DISCOVERY AND UTILIZATION OF grasses: lessons from Sroghum.” CropSci., 42: 1791-1799, 2002. SORGHUM GENES (MA5/MA6) Childs et al., “The sorghum photoperiod sensitivity gene, Ma3. encodes a phytochrome B1.” Plant Physiol., 113:611-619, 1997. Crasta et al., “Mapping of post-flowering drought resistance traits in (75) Inventors: John E. Mullet, College Station, TX grain Sorghum: association between QTLS influencing premature (US); William L. Rooney, College senescence and maturity.” Mol. Gen. Genet. 262:579-588, 1999. Station, TX (US); Patricia E. Klein, Craufurd et al., "Adaptation of Sorghum: characterisation of geno College Station, TX (US); Daryl typic flowering responses to temperature and photoperiod. Theor: Morishige, Bryan, TX (US); Rebecca Appl. Genet., 99:900-911, 1999. Murphy, Bryan, TX (US); Jeff A. Feltus et al., “Alignment of genetic maps and QTLS between inter Brady, Stephenville, TX (US) and intraspecific Sorghum populations.” Theor: Appl. Genet. 112:1295-1305, 2006. (73) Assignee: The Texas A&M University System, Hartet al., “Genetic mapping of sorghum bicolor (L.) Moench QTLs College Station, TX (US) that control variation in tillering and other morphological charac ters.” Theor: Appl. Genet., 103: 1232-1242, 2002. Klein et al., “The effect of tropical sorghum conversion and inbred (*) Notice: Subject to any disclaimer, the term of this development on genome diversity as revealed by high-resolution patent is extended or adjusted under 35 genotyping.” Plant Genome, 48(Suppl. 1):S12-S26, 2008. U.S.C. 154(b) by 227 days. Lee et al., “Photoperiod control of gibberellin levels and flowering of sorghum.” Plant Physiol. 1 16:1003-1011, 1998. (21) Appl. No.: 12/507,053 Lin et al., “Comparative analysis of QTLS affecting plant height and maturity across the poaceae, in reference to an interspecific Sorghum. (22) Filed: Jul. 21, 2009 population.” Genetics, 141(1):391-411, 1995. Miller et al., “Effect of tropical photoperiods on the growth of sor (65) Prior Publication Data ghum when grown in 12 monthly plantings.” CropSci., 8:499-509, 1968. US 201O/OO24O65A1 Jan. 28, 2010 Paterson et al., “The weediness of wild plants: molecular analysis of genes influencing dispersal and persistence of johnsongrass, Sor Related U.S. Application Data ghum halepense (L.) Pers.” Proc. Natl. Acad. Sci. USA. 92:6127 6131, 1995. (60) Provisional application No. 61/082,388, filed on Jul. Quinby et al., “Fourth maturity gene locus in Sorghum.” CropSci., 21, 2008. 6(6):516-518, 1966. Quinby et al., “Heterosis in Sorghum resulting from the heterozygous (51) Int. Cl. condition of a single gene that affects duration of growth. Amer: J. of AOIHL/04 (2006.01) Botany, 33:716-721, 1946. (52) U.S. Cl...... 8OO/267 Quinby, “Genetics of Maturity.” In: Sorghum improvement and the (58) Field of Classification Search ...... None genetics of growth, pp. 18-29, Texas A&M Univeristy Press, College See application file for complete search history. Station, Texas, 1974. Rooney et al., “Genetic control of a photoperiod-sensitive response in (56) References Cited shorghum bicolor (L.) Moench.” CropSci., 39:397-400, 1999. U.S. PATENT DOCUMENTS * cited by examiner 6,265,637 B1 7/2001 Coupland et al...... 800,290 Primary Examiner — Stuart F. Baum 6,713,663 B2 3/2004 Weigel et al...... 800,290 7,230,158 B2 6/2007 Johanson et al. ... 800,290 (74) Attorney, Agent, or Firm — SNR Denton US LLP 7,572,953 B2 8/2009 Cheng et al...... 800,298 2002fOO29395 A1 3/2002 Weigel et al...... 800,290 (57) ABSTRACT 2003/00938.35 A1 5/2003 Weigel et al...... 800,290 2006/0059586 A1 3/2006 Cheng et al...... 800,298 Methods and composition for the production of non-flower 2007/0050866 A1 3/2007 Kiyosue et al. . ... 800,290 ing or late flowering Sorghum hybrid. For example, in certain 2008/0066198 A1 3/2008 Nilsson et al...... 800,298 aspects methods for use of molecular markers that constitute the Mas/Mao pathway to modulate photoperiod sensitivity OTHER PUBLICATIONS are described. The invention allows the production of plants Rooney et al (1999, CropScience 39:397-400).* having improved productivity and biomass generation. Crasta et al (1999, Mol. Gen. Genet. 262:579-588).* Morgan et al., “Opportunities to improve adaptability and yield in 2 Claims, 5 Drawing Sheets U.S. Patent Nov. 13, 2012 Sheet 1 of 5 US 8,309,793 B2

FIG. 1A Score = 4187 bits (2177), Expect = 0.0 Identities = 21.85 / 2190 (99%), Gaps = 0/2190 (0%) Strand = Plus/Minus

Query 1 TGTAGTCAGCAACTGGCCACCGTGGACGGGCCTTCCCTCAGAGATGCCACCAGGATGATG 6 O

Sbict 219 O TGTAGTCAGCAACTGGCCACCGTGGACGGGCCTTCCCTCAGAGATGCCACCAGGATGATG 21.31 Query 61 CTTCGGAATAACAACAATAATCTGAGGAGCAATGGCCCATCAGATGGCTTGCTCAGCAGG 120 Sbct 2130 CTTCGGAATAACAACAATAATCTGAGGAGCAATGGCCCATCAGATGGCTTGCTCAGCAGG 2071 Query 121 CCAACCCCTGCAGTACTCCAGGATGATGACGATGGTGGTGATGATGATACGGAAAACCA.G. 18O Sbict 2070 CCAACCCCTGCAGTACTCCAGGATGATGACGATGGTGGTGATGATGATACGGAAAACCAG 2011 Query 181 CAGCAGGAGGCGGTCTACTGGGAGCGCTTCCTCCAGAAGAAGACCATCAACGTCTTGCTC 24 O

Sbict 2010 CAGCAGGAGGCGGTCTACTGGGAGCGCTTCCTCCAGAAGAAGACCATCA ACGTCTTGCTC 1951 Query 241 GTGGAGAGTGACGACTGCACTAGGCGGGTCGTCAGTGCCCTTCTTCGTCACGCATGTAC 3 CO Sbct 1950 GTGGAGAGTGACGACTGCACTAGGCGGGTCGTCAGTGCCCTTCTTCGTCACTGCATGTAC 1891 Query 301 CAAGTATCTCGCTGAAAATCGCCAGCAAGCATGGAATTATCTTGAAGATAAGCAGAAC 36 O Sbict 1890 CAAGTTATCTCTGCTGAAAATGGCCAGCAAGCATGGAATTATCTTGAAGATAAGCAGAAC 1831 Query 3 61 AACATAGATATTG CGATTGAGGTTTTTATGCCCGGTGTGTCTGGAATTTCCTGCTG 42O

Sbjct 1830 AACATAGATATTGTTTTGATTGAGGTTTTTATGCCCGGTGTGTCTGGAATTTCTCTGCTG 1771

Query 421 AGTAGGATCATGAGCCACAATA GCAAGAATATTCCAGTGATTATGATGTCTTCGAA A 8 O

Sbct 1770 AGTAGGATCATGAGCCACAATATTTGCAAGAATATTCCAGTGATTATGATGTCTTCGAAT 1711 Query 481 GATGCTAGGAATACAGTCTTAAATGTTTGTCGAAAGGGCTGIGACT AGICAA 5A O Slict 1710 GATGCTAGGAATACAGTCTTTAAATGTTTGTCGAAAGGTGCTGTTGACTTTTTAGTCAAG 1651 Query 541 CCTATACGTAAGAATGAACTTAAGAATCTTTGGCAGCATGTATGGAGACGGTGTCACAGC 6 GO

Sbict 1650 CCTATACGTAAGAATGAACTTAAGAATCTTTGGCAGCATGTATGGAGACGGTGTCACAGC 1591 Query 6 01 CAAGTGGTAGTGGAAGTGAAAGTGGCATTCAGACGCAGAAGTGTGGCAAATCAAAAGG 66 O Sbct 1590 TCAAGTGGTAGTGGAAGTGAAAGTGGCATTCAGACGCAGAAGTGTGGCAAATCAAAAGGT 1531 Query 661 GGAAAAGAATCGGTAATAATAGTGGTAGCAATGACAGTCACGACAA CGAAGCAGACATG 72O Sbict 1530 GGAAAAGAATCTGGTAATAATAGTGGTAGCAATGACAGTCACGACAACGAAGCAGACATG 1471 Query 721 GGACTTAATGCAAGGGATGACAGTGATAATGGCAGTGGCACTCAAGCGCAGAGCTCATGG 78 O. Sbjct 1470 GGACTTAATGCAAGGGATGACAGTGATAATGGCAGTGGCACTCAAGCGCAGAGCTCATGG 1. 411 Query 781 ACTAAGTGTGCTGTGGAGATGGACAGCCCACAGGCAATGTCTCTGGATCAGTTAGCCGAT 84 O

Sbct 1410 ACTAAGTGTGCTGTGGAGATGGACAGCCCACAGGCAATGTCTCTGGATCACTTAGCCGA 1351 Query 841. TCACCTGATAGCACTTGTGCGCAAGTAATCCACCCAAAGTCAGAGATATGTAGCAACAGA 9 OO Sbct 1350 CCACCTGATAGCACTTGTGCGCAAGTAATCCACCCAAAGTCAGAGATATGTAGCAACAGA. 1291 U.S. Patent Nov. 13, 2012 Sheet 2 of 5 US 8,309,793 B2

FIG. B.

Query 901 CGGCACCAGACGACCAAGGAAAAGGACGGAGATAGGTGGCCCGGAAATTATA 96 O

Sbict. 129 O CGGCTACCAGACGACTTCAAGGAAAAGGACTTGGAGATAGGTGGCCCTGGAAATTTATAT 1231

Query 961 ATAGAT CACCAATCTTCCCCAAATGAGAGGCCTATCAAAGCAACAGATGGACGTTGTGAG 1 O2O

Sbict 1230 ATAGAT CACCAATCTTCCCCAAATGAGAGGCCTATCAAAGCAACAGATGGACGTTGTGAG 1171

Query 1021 TACCCACCAAAAAACAATTCGAAGGAGTCAATGATGCAAAATCTAGAGGACCCAACTG 1 O8 O

Sbict. 117O TACCCACCAAAAAACAATTCGAAGGAGTCAATGATGCAAAATCTAGAGGACCCAACTGTT 1111 Query 1081 CGAGCTGCTGATCTAATTGGTTCAATGGCCAAAAACATGGATACCCAGGAGGCAGCGAGA 1140 Sbict. 1110 CGAGCTGCTGATCTAATTGGTTCAATGGCCAAAAACATGGATACCCAGGAGGCAGCGAGA 1051

Query 1141 GCTGCAGATACCCCTAATCTCCCTTCCAAAGTGCCAGAAGGGAAAGATAAGAACAAGCA 12 OO Sbct 1050 GCTGCAGATACCCCTAATCTCCCTTCCAAAGTGCCAGAAGGGAAAGATAAGAACAAGCAT 991 Query 1201 GACAAAA GCCATCACGAGTGAG GAAGAGGTCGAGATCATGTGGATATGG 126 O

Sbict 990 GACAAAATTTTGCCATCACTTGAGTTGAGTTTGAAGAGGTCGAGATCATGTGGAGATGGT 931

Query 1261 GCCAATACAGTCAAAGCTGATGAACAACAGAATGTATTAAGACAGTCAAATCTCTCAGC 132 O

Sct 93 O GCCAATACAGTCAAAGCTGATGAACAACAGAATGTATTAAGACAGTCAAATCTCTCAGCT 871 Query 1321 TTTACAAGGTACCATACATCTACGGCTTCCAATCAAGGTGGGACTGGATTAGTAGGGAGC 1380

Sct 87 O TTTACAAGGTACCATACATCTACGGCTTCCAATCAAGGTGGGACTGGATTAGTAGGGAGC 811 Query 1381 TGTTCGCCACATGACAACAGCTCAGAGGCTATGAAAACAGATTCTACTTACAACATGAAG 1440

Sct 81. O TGTTCGCCACATGACAACAGCTCAGAGGCTATGAAAACAGATTCTACTTACAACATGAAG 751.

Query 1441 TCAAATTCAGATGCTGCTCCAATAAAACAAGGCTCCAACGGAAGTAGCAATAACAATGAC 15 OO

Slict 75 O TCAAATTCAGATGCTGCTCCAATAAAACAAGGCTCCAACGGAAGTAGCAATAACAATGAC 691 Query 1501 ATGGGTTCCACTACAAAGAATGTTGTGACAAAGCCCACTACAAATAATAAGGACAGGGTA 1560

Sct 69 O. ATGGGTTCCACTACAAAGAATGTTGTGACAAAGCCCACTACAAATAATAAGGACAGGGTA 631 Query 1561 ATGTTGCCCTCATCAGCTATTAATAAGGCTAATGGACACACATCAGCATTCCACCCTGTG 1620

Sct 630 ATGTTGCCCTCATCAGCTATTAATAAGGCTAATGGACACACATCAGCATTCCACCCTGTG 571.

Query 1621 CAGCATTGGACGATGGTTCCAGCTAATGCAGCAGGAGGGACAGCGAAGGCTGATGAAGTG 1680 Sbjct 570 CAGCATTGGACGATGGTTCCAGCTAATGCAGCAGGAGGGACAGCGAAGGCTGATGAAGTG 511. Query 1681 GCCAACATTGCAGGTTACCCTTCAGGTGACATGCAGTGTAACCTGATGCAATGGTACCCT 1740 Sbjct 510 GCCAACAITGCAGGTTACCCIICAGGTGACATGCAGTGAACCGAIGCAATGGTACCC 451

Query 1741 CGTCCAACCCTTCATTACGTCCAGTTTGATGGTGCACGGGAGAATGGTGGATCGGGAGCC 1800 Sbjct 450 CGTCCAACCCTTCATTACGTCCAG GATGGTGCACGGGAGAATGGTGGATCGGGAGCC 39 Query 1801 CTGGAATGTGGTTCCTCCAACGTATTTGATCCTCCAGTTGAAGGTCAAGCTACTAACTAT 1860 Sbjct 390 CIGCAAIGIGGICCICCAACGTATTGACCCCAGTTGAAGGICAAGCIACTAACIA 331

Query 1861 GGTGTGAACAGGAGCAACTCAGGCAGTAACAATGCAACCAAGGGGCAGAATGGAAGTAAT 1920 Sbjct 330 GGTGTGAACAGGAGCAACT CAGGCAGTAACAATGCAACCAAGGGGCAGAATGGAAGTAAT 271

U.S. Patent Nov. 13, 2012 Sheet 5 of 5 US 8,309,793 B2

FIG. 3

39 AGCCGCCACGTACGTGCTTGCTTGCTAGCTGCTACAGAAGTGCTGGCGGTGGCGATGTAT 98 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 53 AGCCGCCACGTACGTGCTTGCTTGCTAGCTGCTACAGAAGTGCTGGCGGTGGCGATGTAT 112

99. ATATATGCCATAATGCCGAGCCAATTTCACCTCCTATTTTAGACTATTTAT THATTTAAT 158 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 113 ATATAGCCATAATGCCGAGCCAATTCAC CTCCTATTTTAGAATATTIATTTATTTATT 172

1.59 TAC CTATTAl----- TGCCCAGGGAGCGAGTGTGGTTGGAAATT 197 | | | | | | | | 1 | | | | | | | | | | | | | | | | 73 TAC - - - TATTATATTGCCCACCCAACCAGTGTGGTIGGAAATI 239

198 AA-TIGGCTGCATCCCTACATTTTTACATTACTTGCACA------GGTACTGC 243 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 24 O AAATTGGCTGCAICC-TACATTTTTACATTACATGCACATACGGCACAGCCAGGTACTGC 298

244 TGCCTAGTTAGCIATGAAACAIGCATTGGCTICATIATTCGCCTAACGGTACGAATGG | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 2.99 TGCCTAGTTAGCTATGAAACATGCATTGGCITCATTATTCIGCTCTAACGGTACAAATGG

3 O 4 ATCCTGGTTTCTTAAGGTTGCTTGCTCTTTTTCCCTTTTCGCAGGCCAGGCCACCACCA | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 359 ATTCCTGGTTTCTTAAGCTTGCTIGCTCTTTTTGCCTTTTCGCAGGCCAGGCAACCACCA

364 ACCTCCACTTCCTCCATCCATCCATCCATTTGCTGCTGATTCACCACC TACT ACCACCAC, 423 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 419 ACCTCCACTTCC - - - -ICCATCCATCCATTTGCTGCTGATTCACCACCT ------AG 465

424 CAGCAGCTACACAGACACAGGTATTTTCTCCCGGCCGGCCGGCGTCCT CACTCTCCT 483 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 1 : 1 | | | | | | | | 466 CAGCAGCTACACAG--ACAGGTATTTTCTTCCCGGCCGGCCGGCGT CTCTCT ACTCTCCT 523

484 GCCICCCATTCATICTTCAGAGA--GCACGATTATTAATTTTCCAGAGGGCATGATTTAA | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 524 GCCTCCCATTCATTCTTCAGAGAGGGCACAATTATTAATTTTCCAGAGGGCATGATTTAA 583

542 TGT CAATATCCAAAATGATGCACCCTCTCTCCCAGAGGGCCAGAGATATGATCCIT 6 Ol | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 584 TGT CAATATCT CAAAATGATGCTACCCTCTTTCTCCCAGAGGGACAGAGATTTGATCCTT 643 TA 603 – 6 bp - sequence with no match - 644 TA 645 - 33kop insertion with no match -

TTGTTTTAICTTCCTACCTAGCTATATATAGCGATTCGTTTT GTCATTCACTTTGCAGCA 668 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 67 7 TTGTTTTATCTTCCTACCTAGCTATATATAGCTATTCGTTTT GTCATTCACTTTCCACCA 736

669 ATCACACAGACGAGGTGCCCTTGAAGGCGAACAAGGAGTAATATGCGCCCCAGTGTCTAT 728 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 737 ATCACACTGACGAGGTGCCCTTGAAGGCAAACAAGGAGTAATATGCGCCCCAGTGTCTAT 796

129 TCACTAACCAACGACTTGCCTCGAATCAATCCCACCACTTTCGTCTAC CTCTCGAGTCA 788 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 797 TCACTAACCAACGACTTGCCTCGAATCAATCCCACCACTTTCGTCTAC CTCTTCGAGTCA 856

789 GGCTGAGATATGCGAGGTGTCTGTAGTCAGCAACGGCCA 828 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 857 GGCTGAGATATGCGAGGTGTCTGTA GT CAGCAACTGGCCA 896 US 8,309,793 B2 1. 2 DISCOVERY AND UTILIZATION OF Ma? allele with a second sorghum plant homozygous reces SORGHUM GENES (MA5/MA6) sive for at least the Maš or Mao allele. In certain embodiments, the first or second early flowering This application claims priority to U.S. Provisional Appli Sorghum plant may be produced by a) crossing a late flower cation No. 61/082,388, filed on Jul. 21, 2008. The foregoing ing or non-flowering Sorghum plant homozygous dominant application is incorporated herein by reference in its entirety. for Maš and Ma? comprising Superior bioenergy properties This invention was made with government Support under with an early flowering Sorghum plant homozygous recessive grant number DBI-0321578 awarded by the U.S. National for a Mas or Mao allele; b) inbreeding a F progeny; and c) Science Foundation and grant number DE-FG02 selecting for an early flowering sorghum F, plant homozy 10 gous recessive for Mas or Ma? but not homozygous recessive 06ER64306 awarded by the U.S. Department of Energy. The for the same Masor Mað allele and comprising said superior United States government has certain rights in the invention. bioenergy properties. In another embodiment, the first or second early flowering BACKGROUND OF THE INVENTION Sorghum plant may be produced by mutagenizing a late flow 15 ering or non-flowering sorghum plant to produce early flow 1. Field of the Invention ering progeny comprising an inactive gene in a photoperiod The present invention relates generally to the field of plant sensing pathway. The gene in a photoperiod sensing pathway genetics and molecular biology. More particularly, it con is selected from the group consisting of Ma3, Mas, Ma? and cerns producing high biomass sorghum hybrids by utilizing Ma7, in certain embodiments. For instance, the Ma3 gene molecular markers. may comprise a nucleic acid encoding PhyB, the Maš gene 2. Description of Related Art may comprise a nucleic acid encoding a COP9FUS5 Biomass yield is one of the most important attributes of a homolog or a Myb-transcription factor, the Mao gene may biomass or bioenergy crop designed for ligno-cellulosic con comprise a nucleic acid encoding sorghum Prr37, and the version to biofuels or bioenergy. Growth duration is a primary Ma7 gene may comprise a nucleic acid encoding a polypep determinant of biomass yield, therefore late or non-flowering 25 tide selected from the group consisting of PhyC, a MADS plants accumulate the most biomass assuming environmental box 14 protein and AP1. conditions allow yield potential to be expressed. In some embodiments, the first or second early flowering Once grain sorghum initiates flowering, growth of the Veg Sorghum is selected from the group consisting of ATX623. etative plant (stem, leaves) stops so that carbon and nitrogen EBA-3 and RO7007. compounds to be used for grain production. As a conse 30 In certain embodiments the invention provides a method of quence, biomass accumulation overall decreases to some selecting for a progeny plant of the cross according to the extent during the reproductive phase and ceases once grain invention comprising marker-assisted selection comprising at filling has been completed (unless ratooning follows grain least a first genetic marker genetically linked to a MaS or Ma? production). allele. For instance, in one embodiment, the genetic marker In contrast, a late or non-flowering bioenergy sorghum 35 genetically linked to the Maš allele may comprises a nucleic crop grown for biomass production will continue to accumu acid encoding a polypeptide selected from the group consist late biomass by building larger vegetative plants until frost or ing of COP9FUS5 homolog and a Myb-transcription factor adverse environmental conditions inhibit photosynthesis and in another embodiment, the genetic marker genetically (e.g., drought, cold). It is estimated that late/non-flowering liked to the Mao allele comprises a nucleic acid encoding a biomass sorghum will generate more than two times the bio 40 sorghum Prr37. The sorghum Prr37 polypeptide may com mass accumulated by grain sorghum per acre assuming rea prises alysine at position 166 or may be encoded by a nucleic sonable growth conditions throughout the growing season. acid molecule comprising SEQ ID NO:1, in particular Therefore, there is a need for producing late or non-flowering embodiments of the invention. Sorghum. In further embodiments, genetic markers in accordance 45 with the invention may be linked to a quantitative trait locus SUMMARY OF THE INVENTION (QTL). In some embodiments, the QTL is selected from the group consisting of FlrAvgB1, FlrAvgD1, FlrFstG1, FltOTL The present invention overcomes a major deficiency in the DFG, FltOTL-DFB, QMa50.txs-A, QMa50.txs-C, art in producing high biomass sorghum hybrid by using QMa50.txs-F1, QMa50.txs-F2, QMa50.txs-H, QMa50.txs-I, molecular markers for selection. 50 QMa1.uga-G, QMa1.uga-D, and QMa5.uga-D. In one aspect the invention provides a method for produc In still further embodiments, genetic markers in accor ing a late flowering or non-flowering hybrid sorghum plant dance with the invention may be selected from the group comprising crossing a first early flowering sorghum plant consisting of sequence variants revealed by direct sequence with a second early flowering sorghum plant, wherein each of analysis, restriction fragment length polymorphisms (RFLP), the first and second early flowering Sorghum plants is 55 isozyme markers, allele specific hybridization (ASH), ampli homozygous recessive for at least one allele contributing to fied variable sequences of plant genome, self-sustained an early flowering phenotype, and wherein the first and sec sequence replication, simple sequence repeat (SSR) and arbi ond early flowering sorghum plants are not homozygous trary fragment length polymorphisms (AFLP). recessive for the same allele contributing to an early flowering Another aspect of the invention provides harvesting a prog phenotype. In one embodiment, the hybrid progeny plant 60 eny hybrid plant of the invention to produce biomass, bioen comprises a dominant Ma7 or Ma3 allele. ergy, bioproducts or Sugar/starch. In yet another aspect, the In a further aspect, the invention provides crossing a first invention provides a late flowering or non-flowering sorghum Sorghum plant heterozygous dominant for at least a Maš or hybrid seed produced in accordance with the invention and Ma? allele with a second sorghum plant homozygous reces Sorghum hybrid plants grown from the seed. sive for at least the Maš or Mao allele. 65 In a further aspect, the invention provides a method of In yet a further aspect the invention provides crossing a first producing an inbred early flowering sorghum plant compris Sorghum plant homozygous dominant for at least a Maš or ing: a) crossing a late flowering or non-flowering sorghum US 8,309,793 B2 3 4 plant homozygous dominant for Maš and Mað with an early the present invention. The invention may be better understood flowering sorghum plant homozygous recessive for a Maš or by reference to one or more of these drawings in combination Ma? allele; b) inbreeding the F progeny; and c) selecting for with the detailed description of specific embodiments pre an early flowering sorghum F plant homozygous recessive sented herein. for Mas or Ma? but not homozygous recessive for the same FIGS. 1A-C: Alignment of EBA3 and RTx436 SbPRR37 Mas or Mao allele. In certain embodiments, the late flowering cDNA sequences showing DNA sequence differences or non-flowering sorghum plant comprises Superior bioen (bolded) (SEQID NOS:1 and 2). ergy properties. In further embodiments, the selected early FIG. 2: Comparison of protein sequences of Prr37 proteins flowering sorghum F, plant comprises said Superior bioen encoded by EBA-3 and RTx436 derived from cDNA ergy properties. 10 sequences. 2.1 corresponds to the Sorghum Prr37 protein In yet a further aspect, the invention provides an inbreed encoded by EBA-3 (Mao) (SEQ ID NO:3) and 2.2 corre early flowering sorghum seed produced in accordance with sponds to the sorghum Prr37 protein encoded by RTX436 the invention and inbreed sorghum plants grown from the (mao) (SEQID NO:4). An amino acid difference in the Prr37 seed. protein putative dimerization domain is bolded and under In certain aspects, the invention provides a method of iden 15 lined; (K (lysine) in EBA-3, N (asparagine) in RTX436. Three tifying the genotype of a sorghum plant for a Mas or Ma? additional differences in amino acid sequence are bolded. allele comprising: a) obtaining a sorghum plant; and b) assay FIG. 3: Alignment of partial promoter sequences of ing the sorghum plant for a genetic marker genetically linked SbPRR37 derived from EBA-3 and RTx436. Query refers to to the Mas or Mao allele. In one embodiment, the genetic EBA3 and Subject refers to BTX623 (SEQID NOS:6-9). marker genetically linked to the Masallele may be a nucleic acid encoding a polypeptide selected from the group consist DESCRIPTION OF ILLUSTRATIVE ing of COP9FUS5 homolog and a Myb-transcription factor. EMBODIMENTS In another embodiment, the genetic marker genetically linked to an Mao allele may be a nucleic acid encoding a sorghum I. The Present Invention Prr37 polypeptide. In certain embodiments, the sorghum 25 Prr37 polypeptide may comprise a lysine at position 166 or The instant invention overcomes several major problems may be encoded by a nucleic acid molecule comprising SEQ with current sorghum production technologies in producing ID NO:1. Sorghum hybrids that have long duration of vegetative growth Embodiments discussed in the context of methods and/or due to late flowering or lack of flowering, from inbreds that compositions of the invention may be employed with respect 30 will flower sufficiently early in regions optimal for hybrid to any other method or composition described herein. Thus, seed production, by manipulation of several QTL and the an embodiment pertaining to one method or composition may corresponding genes/alleles that constitute the MaS/Maé be applied to other methods and compositions of the inven pathway that regulates photoperiod sensitivity and flowering tion as well. time in sorghum. Further embodiments and advantages of the As used herein the terms “encode' or “encoding with 35 invention are described below. reference to a nucleic acid are used to make the invention readily understandable by the skilled artisan however these II. Sorghum terms may be used interchangeably with “comprise' or “com prising respectively. Increased demands on the agricultural and forestry indus As used herein the specification, “a” or “an may mean one 40 tries due to world population growth, especially recenturgent or more. As used herein in the claim(s), when used in con need in biofuels production, have resulted in efforts to junction with the word “comprising, the words “a” or “an increase plant production and/or size. Sorghum has been an may mean one or more than one. excellent biomass source with its high yield potential, high The use of the term 'or' in the claims is used to mean water use efficiency, and established production systems. “and/or unless explicitly indicated to refer to alternatives 45 Certain embodiments of the present invention disclose meth only or the alternatives are mutually exclusive, although the ods to generate sorghum genotypes with the genetic potential disclosure Supports a definition that refers to only alternatives for improved biomass production. and “and/or.” As used herein “another may mean at least a Sorghum is a genus of numerous species of grasses, some second or more. of which are raised for grain and many of which are used as Throughout this application, the term “about is used to 50 fodder plants either cultivated or as part of pasture. The plants indicate that a value includes the inherent variation of error are cultivated in warmer climates worldwide. Species are for the device, the method being employed to determine the native to tropical and Subtropical regions of all continents in value, or the variation that exists among the study subjects. addition to Oceania and Australasia. Sorghum is in the Sub Other objects, features and advantages of the present family Panicoideae and the tribe Andropogoneae (the tribe of invention will become apparent from the following detailed 55 big bluestem and Sugar cane). Sorghum is known as great description. It should be understood, however, that the millet and guinea corn in West Africa, kafir corn in South detailed description and the specific examples, while indicat Africa, dura in Sudan, mtama in eastern Africa, jowar in India ing preferred embodiments of the invention, are given by way and kaoliang in China. of illustration only, since various changes and modifications Sorghum is well adapted to growth in hot, arid or semi-arid within the spirit and scope of the invention will become 60 areas. The many Subspecies are divided into four groups— apparent to those skilled in the art from this detailed descrip grain sorghums (such as milo), grass sorghums (for pasture tion. and hay), Sweet Sorghums (formerly called "Guinea corn”. used to produce sorghum syrups), and broom corn (for BRIEF DESCRIPTION OF THE DRAWINGS brooms and brushes). The name “sweet sorghum ' is used to 65 identify varieties of Sorghum bicolor that are sweet and juicy. The following drawings form part of the present specifica High biomass Sorghum as a source of biofuels has also drawn tion and are included to further demonstrate certain aspects of a lot of attention recently. US 8,309,793 B2 5 6 Sorghum species contemplated in this invention include, when crossed generate high biomass or bioenergy sorghum but are not limited to, Sorghum almum, Sorghum amplum, hybrid seed that can be planted at any time of the year suitable Sorghum angustum, Sorghum arundinaceum, Sorghum for production, where the hybrid plants will have long growth bicolor (primary cultivated species), Sorghum brachypodum, duration (i.e., late flowering or non-flowering) at all latitudes Sorghum bulbosum, Sorghum burmahicum, Sorghum contro- 5 from ~40 degrees N/S to the equator (40N-the upper mid versum, Sorghum drummondii, Sorghum ecarinatum, Sor west where sorghum growth is limited by cold). In another ghum existians, Sorghum grande, Sorghum halepense, Sor aspect, this same flowering control system can also be used to ghum interjectum, Sorghum intrans, Sorghum laxiflorum, design Sweet Sorghum hybrids that grow for a specified num Sorghum leiocladun, Sorghum macrospermum, Sorghum ber of days prior to flowering at different latitudes from early matarankense, Sorghum miliaceum, Sorghum nigrum, Sor- 10 flowering inbreds suitable for hybrid seed production. ghum nitidum, Sorghum plumosum, Sorghum propinquum, Table 1 below describes the relationship between latitude Sorghum purpureosericeum, Sorghum Stipoideum, Sorghum and daylength at planting and harvest for biomass/bioenergy timorense, Sorghum trichocladun, Sorghum versicolor, Sor production regions from ~40 degrees N/S to the equator. At ghum virgatum, and Sorghum vulgare. higher latitudes, planting date is later in the year and harvest 15 ing occurs earlier due to longer duration of winter and low III. Photoperiod Sensitivity temperatures (shorter season). At lower latitudes, planting can be done earlier in the year or virtually any time in some The present invention relates to methods of modulating locations and harvesting later in the year or multiple times photoperiod sensitivity and flowering time in Sorghum for during the year, including times of the year when daylength is high biomass production. Photoperiod sensitivity refers to the 20 less than 12 hours (Table 1). fact that some plants will not flower until they are exposed to day lengths that are less than a critical photoperiod (short day TABLE 1 plants) or greater thana critical photoperiod (long day plants). Long day (LD) and short day (SD) plant designations refer to Relationship between latitude of crop production and daylength the day length required to induce flowering. Facultative LD or 25 Planting Daylength Harvest Daylength SD plants are those that show accelerated flowering in LD or City Latitude date hours date hours SD but will eventually flower regardless of photoperiod. Most DesMoines, IA 41.35 N 15-May 14.3 1-Oct 11.6 plants including sorghum must pass through a juvenile stage New York, NY 40.42 N 30-May 14.6 1-Oct 11.6 (lasting ~14-21 days for sorghum) before they become sen Amarillo, TX 35.05 N 15-May 13.8 15-Oct 11.1 sitive to photoperiod. 30 College Station, TX 30.37 N 20-Mar 11.7 15-Now 10.4 Sorghum is a facultative SD plant where long days inhibit Beaumont, TX 3O.OSN 20-Mar 11.8 15-Now 1O.S Weslaco, TX 26.09N 20-Mar 11.8 1-Dec 1O.S flowering and short days accelerate flowering. The degree of Puerto Rico 18.57 N monthly 10.8-13.2 monthly 10.8-13.2 photoperiod sensitivity in sorghum refers to the length of the Panama City O8.57 N monthly 11.4-12.6 monthly 11.4-12.6 short days that are required to induce flowering. A highly Equator O monthly 12 monthly 12 photoperiod sensitive sorghum will require photoperiods less 35 Brazilia, Brazil 16.12 S monthly 11.1-12.9 monthly 11.1-12.9 than ~12 hours before flowering occurs whereas plants with Brisbane, AU 27.30 S 20-Sep 11.9 15-Mar 12.2 low photoperiod sensitivity only require day lengths less than ~14 hours to induce flowering. Different sorghum genotypes Sorghum is insensitive to photoperiod during the juvenile vary in their degree of photoperiod sensitivity. Sorghum phase which lasts for ~14-21 days post planting depending on inbreds have been identified with photoperiod sensitivity 40 genotype. Therefore, bioenergy sorghum hybrids need to ranging from ~10.5 to ~14 hours and still others that are have sufficient photoperiod sensitivity to prevent flowering at nearly completely insensitive to photoperiod. For example, in the daylengths that occur ~14-21 days post-planting at all College Station, Tex., photoperiod insensitive sorghum latitudes used for bioenergy crop production. In addition, planted in April will flower in approximately 48-55 days. In bioenergy sorghum hybrids that are planted in long days that contrast, highly photoperiod sensitive sorghum hybrids with 45 block flowering may also require increased photoperiod sen the Mas/Mao genotype flower in mid to late September in sitivity in order to block flowering prior to frost or harvest if College Station, Tex. (~175-180 days). daylengths decrease significantly during the growing season. For example, “early flowering sorghum ' may be a plant Certain aspects of the present invention involves the iden that flowers in 50 to 120 days after planting between April 1 tification of allelic combinations of Maš/Maé and other genes and April 19 in College Station, Tex.; a “late or non-flowering 50 that repress flowering that work in hybrid combination to sorghum 'maybe a plant that flowers 150 to 200 or more days block flowering at daylengths as short as 11-10.5 hours. The after planting or does not flower under these conditions The early flowering inbreds used to produce late/non-flowering number of days to flowering will depend on the planting date hybrid seed are designed to flower early due to different and latitude where a sorghum genotype is planted because recessive genes that control flowering time. Therefore, when these factors determine when the plants are exposed to days 55 these inbreds are crossed, the F1 hybrids contain dominant that are sufficiently short to induce flowering. In general, late genes at all loci involved thereby delaying flowering until flowering photoperiod sensitive plants such as sorghum with plants are exposed to very short photoperiods. the genotype Mas Mao will not flower until day lengths are Certain embodiments of the present invention providesor less than 12.2 hrs, whereas less photoperiod sensitive early ghum genotypes that contain versions of Maš and Ma? that in flowering sorghum with recessive forms of Mas, and Ma? 60 combination delay flowering until day lengths are less than 12 (and potentially Ma 7, Ma3, Mal, etc.) will flower when hr 20 min (Rooney and Aydin, 1999). There is evidence that exposed to day lengths (photoperiods) of ~12.4-14 hr or additional genes such as Mal-Ma4 enhance sorghum photo longer depending on genotype. period sensitivity. In addition, it is likely that different alleles A. Utility of the Maš/Mað System for Bioenergy Sorghum of Maš and Mað exist that can be used to make bioenergy Hybrid Production 65 Sorghum hybrids even more photoperiod sensitive (less than Certain aspects of this invention involve the use of the 12hr) increasing their utility for growing regions closer to the Maš/Mao system to produce early flowering inbreds that equator where bioenergy sorghum will be planted and grown US 8,309,793 B2 7 8 in day lengths shorter than 12 hours (Table 1). For example, a The increase in yield attributed to hybrid vigor in sorghum is study by Miller et al. (1968) identified five groups of sorghum typically ~20% to ~50%. Photoperiod sensitive bioenergy that had short day requirements for flowering that ranged sorghum hybrids that flower late or that do not flower are from ~13 hr to ~ 11.1 hr. This genetic material, and other important for bioenergy production for several reasons: long genotypes identified in accordance with the present inven duration of vegetative growth associated with late/non-flow tion, flower late when growing at low latitudes in places Such ering genotypes increases biomass yield per acre, high levels as Puerto Rico. In another study, Craufurd et al. (1999) iden of photoperiod sensitivity will allow nearly year round plant tified sorghum genotypes with critical photoperiods between ing of bioenergy sorghum hybrids at lower latitudes, and 10.2 and 11 hrs. In certain aspects of the invention, these plants growing vegetatively (non-flowering) are more materials have been investigated to identify genes with simi 10 drought tolerant than plants that are in the reproductive phase laraction to Ma5/Maé and alleles of Ma5 and Mað that would of development; this is an important attribute of bioenergy be useful for breeding PS hybrids for use over the entire range Sorghum. of latitudes from 40N/S to the equator. A. Breeding Material and Methods B. Genetic Pathway of Photoperiod Sensitivity and Uses In further aspects of the present invention, naturally occur Thereof 15 ring alleles of Maš and Ma? as well as other maturity genes Photoperiod sensitivity and late flowering is mediated in (e.g., PHYB, PHYC) that are involved in the photoperiod Sorghum and rice by genes that repress activation of FT (flow sensing pathway can be used to construct early flowering ering locus T) and AP1 and the transition of the apex from inbreds that can be crossed to produce late flowering hybrids. Vegetative growth to forming reproductive structures. The In one embodiment, sorghum line R.07007 or EBA-3 is a repressors of flowering in sorghum act in a dominant fashion. primary source of both ma5 (recessive form) and Mað (domi The repressors are inactivated or less active under short pho nant form), although other versions of Mao derived from toperiods (and thermal periods). The vegetative or non-flow photoperiod sensitive sorghum accessions may also be uti ering state is maintained in part by light mediated signaling lized. In another embodiment, dominant forms of Ma5 are through PhyB and PhyC and possibly from other sources derived from grain sorghum female lines that may be used for (PhyA, etc.) and partly by output from a circadian clock. The 25 hybrid seed production. light signaling pathway involves a series of steps and genes, In addition to working with naturally occurring genetic some of which may act directly to repress FT, and others of variants, certain embodiments of the present invention com which act downstream from the circadian clock through prise mutagenizing any group of PS genotypes and identify PI modulation of homologs of GI, CO, and other genes that lines derived from the parental lines that contain an inactive modulate repression of FT. 30 gene in the pathway that represses flowering. Crossing pho The repressing pathway can be inactivated by disrupting toperiod insensitive early flowering genotypes that contain the function of any of the genes that are in the signaling differentinactive genes in the pathway that controls flowering pathway (PHYB, PHYC, or a gene between the photorecep time will generate photoperiod sensitive late flowering tors and FT, and genes involved in clock function or input/ hybrids. output). The disruption of a gene in the flower repression 35 An exemplary approach involves screening photoperiod pathway converts a photoperiod sensitive genotype into a less sensitive (late flowering) Sorghum germplasm for accessions photoperiod sensitive genotype or photoperiod insensitive that express Superior bioenergy traits. These accessions (most genotype that will flower early or at longer day lengths. If likely Ma5/Maé) are then crossed to R.07007 or EBA-3 genotypes that are photoperiod insensitive due to inactivation (masma5ma7ma7 MaðMað). F2 progency from these crosses of different genes in the flowering repression pathway are 40 that flower early (masma5) but that retain MaoMao are crossed, then the hybrid will be photoperiod sensitive and selected by phenotyping and marker-assisted selection. The later flowering because active alleles contributed by the resulting early flowering inbreds (masma5 MaðMao) can gametes from each line complement inactive alleles present then be crossed with elite grain female A-lines that have the in the gametes/genome of the other parental inbred line. genotype (Ma5MašMa7Ma7ma6ma6), to produce bioenergy 45 hybrids that are Mas Ma7 Ma6 that will flower late. IV. Production of Photoperiod Sensitive Hybrid B. Sorghum Mutagenesis Using Maš/Mao System In another aspect of the invention, mutagenesis of late flowering sorghum genotypes to create early flowering geno In certain aspects of the present invention, early flowering types could be carried out in the following exemplary manner. inbred sorghum genotypes with the proper allelic combina 50 The seed from a late flowering sorghum inbred would be tions of Maš and Mao can be crossed to produce photoperiod germinated and treated with a mutagen Such as EMS (ethyl sensitive late-flowering sorghum hybrids (Ma5 Mao ) ideal methanesulphonate) or ENU (1-ethyl-1-nitrosourea) or using for biomass/bioenergy production with the use of molecular X-rays or neutron bombardment to induce changes in DNA markers. In one embodiment, the early flowering photoperiod sequence throughout the sorghum genomes of thousands of insensitive sorghum inbreds contain complementary pairs of 55 seedlings. The M1 seedlings (M1 refers to the first generation dominant/recessive Mas/Mað genes (Mašma6 and ma5 Mao of plants that were exposed to a mutagen) Surviving the treat respectively). ment would be grown to maturity and self-pollinated. M2 One advantage of the Mas/Mao system is the ability of this seed derived from a large number of M1 plants would be system to produce sorghum hybrids that have long duration of grown out and screened for M2 plants that flower early under Vegetative growth due to late flowering or lack of flowering, 60 conditions where the parental inbred flowers late. An early from inbreds that will flower sufficiently early in regions flowering phenotype would be consistent with mutation in a optimal for hybrid seed production (such as high plains of gene that represses flowering such as Mas or Ma?. Texas). C. Molecular Markers The production of bioenergy sorghum hybrids is also a. Marker Assisted Selection important because hybrids are preferred commercially due to 65 Marker assisted selection or marker aided selection (MAS) hybrid vigor that generates greater yield, and the ability to is a process whereby a marker (morphological, biochemical better control seed stocks through hybrid seed production. or one based on DNA/RNA variation) is used for indirect US 8,309,793 B2 10 selection of a genetic determinant or determinants of a trait of pendently of one another. Thus, the percent of recombination interest (e.g., productivity, disease resistance, abiotic stress observed between the loci per generation will be less than tolerance, and/or quality). This process has been used in plant 50%. In particular embodiments of the invention, markers breeding. may be used located less than about 45,35, 25, 15, 10, 5, 4, 3, Considerable developments in biotechnology have led 2, or 1 or less cMapart on a chromosome. plant breeders to develop DNA marker aided selection sys The gene of interest is directly related with production of tems to augment traditional phenotypic-pedigree-based protein(s) or RNAs (e.g., miRNA) that produce certain phe selection systems. Marker assisted selection (MAS) is an notypes whereas markers should not influence the trait of indirect selection process where a trait of interest is selected interest but are genetically linked to an allelic form of a gene not based on the trait itself but on a marker linked to the gene 10 that modifies a trait (and so the marker and gene remain (allele) that controls expression of the trait. For example if together during segregation of gametes due to the physical MAS is being used to select individuals with disease resis linkage between marker and gene, and a reduction in homolo tance, then a marker allele which is linked to the gene con gous recombination between the marker and gene of interest ferring disease resistance is scored or selected for rather than due to their close proximity on a strand of DNA). In many disease resistance per se. The assumption is that the marker 15 traits genes are discovered and can be directly assayed for allele is associated with the gene and/or quantitative trait their presence with a high level of confidence. However, if a locus (QTL) of interest that confers the trait under selection. gene is not isolated, marker's help is taken to tag a gene of MAS can be useful to select for traits that are difficult to interest. In Such case there may be some false positive results measure, exhibit low heritability, and/or are expressed late in due to recombination between marker of interest and gene (or development. QTL). A preferred marker that corresponds to or detects the In certain embodiments, a marker may be: difference in DNA sequence causing the desired phenotype or Morphological First marker loci available that have trait would elicit no false positive results. obvious impact on morphology of plant. Genes that affect In MAS, generally the first step is to map the gene or form, coloration, male sterility or resistance among others quantitative trait locus (QTL) of interest first by using one or have been analyzed in many plant species. Examples of this 25 more genetic mapping techniques and then use this informa type of marker may include the presence or absence of awn, tion to identify DNA markers linked to and flanking the QTL leaf sheath coloration, height, grain color, aroma, etc. useful for marker-assisted selection. Generally, the markers Biochemical—A gene that encodes a protein that can be to be used should be close to the gene of interest (<5 recom extracted and observed; for example, isozymes and storage bination unit or cM) in order to ensure that only a minor proteins. 30 fraction of the selected individuals will have a recombination Cytological—The chromosomal banding produced by dif between the DNA marker and target gene following any given ferent stains; for example, Gbanding. cross or meiosis (specifically the DNA sequence variation Biological—Different pathogen races or insect biotypes within the target gene that causes the desired trait). Generally, based on host pathogen or host parasite interaction can be not only a single marker but rather two markers are used that used as a marker since the genetic constitution of an organism 35 flank the target gene or QTL as closely as possible in order to can affect its Susceptibility to pathogens or parasites. reduce the chances of an error due to homologous recombi DNA-based and/or molecular A unique (DNA nation. sequence), occurring in proximity to or within the gene or In plants QTL mapping is generally achieved using bi locus of interest, can be identified by a range of molecular parental cross populations involving two parents that have a techniques such as direct sequencing, RFLPs, RAPDs, AFLP, 40 contrasting phenotype for the trait of interest. Commonly DAF, SCARs, microsatellites, etc. DNA markers detect varia used populations are recombinant inbred lines (RILS), tion in DNA sequence, or DNA polymorphisms, that distin doubled haploids (DH), back cross and F2. Linkage between guish individuals. DNA polymorphisms include differences the phenotype and markers that have already been mapped is in single nucleotide sequences (SNPs), simple sequence tested in these populations in order to determine the position repeats (SSRs), inversions or deletions (INDELS). DNA 45 of the QTL on the overall genetic map. Such techniques are markers are designed to identify DNA sequence differences based on linkage and are therefore referred to as “linkage by one of several methods including, direct sequence analy mapping. sis, electrophoretic separation of DNA fragmentsizes follow In contrast to two-step QTL mapping and MAS, a single ing digestion of genomic DNA with restriction enzymes step method for breeding typical plant populations has been (RFLP) or after DNA amplification using PCR (AFLP, 50 developed (Rosyara et al., 2007). In such an approach, in the SSRs), or based on differences in amplification or probe first few breeding cycles, markers linked to the trait of interest hybridization (microarrays, Taqman probes, etc.). are identified by QTL mapping and later the same informa As used herein, an “inherited genetic marker' is an allele at tion in used in the same population. In this approach, pedigree a single locus. A locus is a position on a chromosome, and structure is created from families that are created by crossing allele refers to conditions of genes; that is, different nucle 55 a number of parents (in three-way or four way crosses). Phe otide sequences, at those loci. The markerallelic composition notyping is carried out and genotyping is done using molecu of each locus can be either homozygous or heterozygous. lar markers mapped the possible location of QTL of interest. Coinheritance, or 'genetic linkage of aparticular trait and This will identify markers and their favorable alleles. Once a marker Suggests that they are physically close together on these favorable marker alleles are identified, the frequency of the chromosome. Linkage is determined by analyzing the 60 Such alleles will be increased and response to marker-assisted pattern of inheritance of a gene and a marker in a cross. The selection is estimated. Marker allele(s) with desirable effect unit of recombination is the centimorgan (cM). Two markers will be further used in next selection cycle or other experi are one centimorgan apart if they recombine in meiosis once mentS. in every 100 opportunities that they have to do so. The cen Recently high-throughput genotyping techniques are timorgan is a genetic measure, not a physical one. Those 65 developed which allows marker aided screening of many markers located less then 50 cM from a second locus are said genotypes. This will help breeders in shifting traditional to be genetically linked, because they are not inherited inde breeding to marker-aided selection. One example of Such US 8,309,793 B2 11 automation is using DNA isolation robots and pipetting TABLE 2 robots. A recent example of a high throughput DNA sequencer is the Illumina SGAII or ABI SOLID System. Sorghum maturity (Ma) genes Locus Map location Gene Reference Genetic markers and QTLs used in certain embodiments of 5 the invention have been disclosed below. Ma1 SBIO6, -11-21cM Unknown Klein et al., 2008 In certain embodiments of the invention, molecular mark Ma2 Unknown Ma3 SBIO1, -166cM PHYB Childs et al., 1998 ers are developed that are polymorphic in parental lines of a Ma4 Unknown cross or population, and linked to and flank the MaS and Mao Mas SBIO2, -145-148cM QTL targeted for marker assisted selection (MAS). The 10 Maf SBIO1, -23-26cM molecular markers in Some cases can correspond to and detect Ma6 SBIO6, -11-19cM specific DNA sequence variants causing dominant or reces sive gene action. In certain aspects, DNA may be extracted b. Sorghum Flowering Time QTL from the parental sorghum lines and progeny of a cross (F1, QTL (cquantitative trait loci), quantitative trait inheritance F2, backcross, testcross, RIL., etc.) and analyzed with 15 or polygenic inheritance refers to the inheritance of a trait or molecular markers for the presence or absence of marker phenotype that varies in degree of trait expression due to the alleles linked to and flanking regions of the genome encoding interactions between two or more genes and the environment. dominant or recessive forms of Maš and/or Mao. While any QTL are genetic loci that span regions of a genome that molecular marker assay technology could be used, biallelic encode genes that contribute to quantitative inheritance of a (or multiallelic) marker assays Such as SSRS, or assays Such trait. The contributions of allelic forms of genes that contrib as direct sequencing that detect SNPS/indels are preferred. ute to quantitative traits and the genetic map locations of QTL b. Ma Genes can be characterized by analysis of populations derived by crossing parental lines that contain different allelic forms of There are six classic maturity genes in sorghum that control genes that contribute to quantitative trait inheritance. flowering time termed Ma1-Mað. Ma1, Ma2, Ma3 and Ma4 25 were identified by Quinby and his colleagues (Quinby and QTL mapping involves the genetic study of inheritance of Karper, 1946; Quinby, 1966; Quinby, 1974). These loci/genes alleles that occur in two or more loci and the phenotypes are part of a pathway that inhibits flowering. Therefore in (physical forms or traits) that they produce. Because most general, Sorghum plants with recessive Mal-Mao genes (with traits of interest are governed by more than one gene, defining 30 and studying the entire Suite of genes and their alleles that low or no activity) flower earlier than plants with dominant or modulate a trait provides an understanding of what effect the active Mal-Mao genes that repress flowering. Sorghum genotype of an individual has on the phenotype of that indi plants that are Mal Ma2Ma3Ma4but recessive at either MaS vidual. or Mao will flower in ~74 days in College Station, Tex. when Genetic analysis involving statistical assessment is planted on April 19 (Rooney and Aydin, 1999) or in -85 days 35 required to analyze the interaction of genes and to determine when planted on June 1 in Plainview, Tex. (Quinby, 1974). whether they produce a significant effect on the phenotype. Plants with recessive genes at Mal-Ma4 (and recessive at QTL identify regions of the genome as containing allelic Mas or Mao) will flower in ~48-55 days post planting in these variation for one or more genes (or regulatory elements) that same locations. Maš and Mað are an additional pair of matu modulate the trait being assayed or measured. They are shown rity loci that delay flowering whensorghum is planted ~April 40 as intervals spanning a region of a chromosome, genetic map. 19 in College Station, Tex. for ~175 days (mid-late September or DNA sequence, where the probability of association is when photoperiods decrease below 12h 20 min) (Rooney and plotted for each marker used in the mapping experiment. Aydin, 1999). Based on information described in more detail The QTL techniques were developed in the late 1980s and below, it is predicted that late flowering MaS/Mao plants also can be performed on populations of any species. To begin, a require an active PHYB gene (Ma3) 45 set of genetic markers must be developed for the species in question. A marker is an identifiable region of variable DNA If an active form of PHYB (or Ma3) is required for Maš/ sequence (single nucleotide or repeat variation, or inversions/ Ma? genotypes to express photoperiod sensitivity and flower deletions). Biologists are interested in understanding the late, then complementary dominant/recessive forms of Ma3 genetic basis of phenotypes (i.e., physical traits). The aim is to could also be used to modulate differential flowering time in 50 find a marker that is significantly more likely to co-occur certain types of inbreds and hybrids. In this case, an early (co-segregate following a cross) with the trait than expected flowering inbred sorghum line that has the genotype by chance, that is, a marker that has a statistically significant ma3ma3Ma5MašMaðMað could be crossed to a second early association with the trait. It is ideal to identify the specific flowering inbred sorghum genotype that has the genotype gene or genes that modulate the trait in question, but this often Ma3Ma3MašMa5ma6ma6 in order to produce late flowering 55 requires a great deal of time and effort. Instead, they can more Sorghum hybrids with the genotype readily find regions of DNA that are very close to the genes in Ma3ma3MašMa5Ma6ma6. question. When a QTL is mapped, it identifies a region of the Table 2 shows that information about the genetic map genome that spans the actual gene underlying the phenotypic location of Ma1 and Ma3 has been published (Klein et al., trait although the region identified may also encode many 2008: Childs et al., 1997). Ma3 encodes the red light photo 60 genes that do not modulate the target trait. receptor phytochrome B that is known to mediate repression For organisms whose genomes are known, one might now of flowering in short day and long day plants (Childs et al., try to exclude genes in the identified region whose function is 1998). In addition, the inventors have collected information known with some certainty not to be connected with the trait over the past several years on the genetic map locations of in question. If the genome is not available, it may be an option Maš and Ma7, loci required in combination with Mao to 65 to sequence the identified region and determine the putative delay flowering ~175 days in College Station. Mao has also functions of genes by their similarity to genes with known been mapped, as well as a modifier of Mao activity. function, usually in other genomes. US 8,309,793 B2 13 14 Another interest of statistical geneticists using QTL map Data in Lin et al. (1995) show that QMa1.ugalD maps to the ping is to determine the complexity of the genetic architecture same location as QMa5.ugalD (Feltus et al., 2006). underlying a phenotypic trait. For example, they may be interested in knowing whether a phenotype is modulated by V. Examples many independent loci, or by a few loci, and do those loci 5 interact. This can provide information on how expression of the phenotype is regulated. The following examples are included to demonstrate pre Numerous QTL that modulate flowering time in sorghum ferred embodiments of the invention. It should be appreciated have been identified in various studies (e.g., Lin et al., 1995, by those of skill in the art that the techniques disclosed in the Paterson et al., 1995, Crasta et al., 1999, Hart et al., 2001; examples which follow represent techniques discovered by Feltus et al., 2006). The correspondence between QTL that 10 the inventor to function well in the practice of the invention, modulate flowering time identified in genetic mapping stud and thus can be considered to constitute preferred modes for ies and Mal-Mao is not entirely clear because the location of its practice. However, those of skill in the art should, in light Ma2 and Ma4 on the sorghum genetic map is not known. of the present disclosure, appreciate that many changes can be Information on various QTL for flowering time in Sorghum is made in the specific embodiments which are disclosed and listed in Table 3. 15 still obtain a like or similar result without departing from the spirit and scope of the invention. TABLE 3 Sorghum flowering time QTL Example 1 Lin et al., 1995, Paterson et al., 1995; BTX623 x S. propinquium Methods for using Marker-Assisted Selection of Sorghum Inbreds that for Production of Photoperiod Locus Map location Marker Sensitive Late or Non-Flowering Sorghum Hybrids FlrAvgB1 SBIO2, -102-119.cM UMC5, UMC139 FIrAvgD1 SBIO6, -9-21cM 25 In one non-limiting embodiment of the invention, molecu FrFStG1 SBIO9, -129-150cM UMC132 lar markers may be used to help convert a photoperiod sensi Crasta et al., 1999; B35 x RTx430 tive (PS) late flowering inbred sorghum (A) that has the geno type MašMa5MaoMao into a photoperiod insensitive (PI) Locus Map location Gene early flowering inbred that can be used (crossed) in temperate FltOTL-DFG SBI10, -70-74cM UMC21 30 regions to produce sorghum hybrid seed and hybrids that FltOTL-DFB SBIO1, -45cM UMC27, -10cM from PHYA flower late. This can be done as follows: Hart et al., 2001 (see map positions in Feltus et al., 2006 below) a. Cross PS sorghum (A) with the genotype Feltus et al., 2006; summary of QTL from MašMa5MaoMao to a PI sorghum (B) with the genotype BTx623/IS3620C: BTx623/S. propinquium ma5mas MaoMao to generate an F1 plant. 35 b. Self the F1 plant and grow out F2 progeny. Locus Map location Marker c. Use DNA markers to identify progeny (C) that have the QMa50.txs-A SBIO1, ~182-186cM Xgap36 genotype ma5 ma5MaoMao. QMaSO.txs-C SBIO3, -140cM Xumcl6-XtxSA-22 d. The ma5 ma5 alleles in (C) will be derived from (B). QMaSO.txs-F1 SBIO9, -143cM Xcdo,393 e. The Mao Mao alleles in (C) may be derived from either QMaSO.txs-F2 SBIO9, -143cM Xcdo,393 QMaSO.txs-H SBIO8, -130-136cM Xtxplo5-Xtxs|294 40 (A) or (B). Selection for the source of Mao allele may be QMaSO.txs-I SBIO6, -10-36cM XumcI9-Xcdo718 important depending on the relative activity of the Mao alleles derived from (A) and (B). Lin et al. (1995), Paterson et al. (1995) f. Cross progeny with the genotype ma5 ma5 MaéMao (C) Locus Map location Marker to an elite PI early flowering sorghum (D) with the genotype 45 MašMa5 maéma6 to produce F1 seed. Qma1.uga-G SBIO9, -129-150cM Xumcl32-pSB445 g. F1 hybrid plants derived from this cross will be photo Qma1.uga-D SBIO6, -31-59cM data requires further analysis period sensitive and late or non-flowering with the genotype QMa5.uga-D SBIO6, -8-20cM tiller flowering Masma5Ma6ma6. In another aspect, the method described above that starts The relationship between Maé and Ma1 is uncertain at this 50 with PS late flowering plants with the genotype time. The impact of Ma1 and Mað is quite different, but both Ma5Ma5 MaðMaé could involve several alternatives: QTL map to a similar region on SBIO6 making it formally a. PI sorghum (B) used above could have the genotype possible that Ma1 and Mað are different alleles of the same ma5 ma5 ma6ma6. gene or different genes that reside in the same region of the In this case, progeny (C) identified by markers with the genome. 55 genotype ma5 ma5MaoMao would have derived ma5 alleles Feltus et al. (2006) reported a flowering time QTL from (B) and Mað alleles from (A). (QMa5.uga-D) that controls tiller flowering time that over b. PS sorghum (B) could have the genotype laps the region spanned by Ma1 and Mað. It is formally ma5 ma5 ma7ma7 Ma6Mað. possible that QMa5.ugalD corresponds to a different allele of i. This is a case where recessive alleles in two different Ma1 or Mað or a different flowering time gene. 60 genes with Maš-like action are needed to make progeny Lin et al. (1995) mapped a flowering time QTL (C) PI, early flowering, and useful for the generation of (FlrAvgD1 =QMa1.ugalD) on SBIO6 (31-59 cM) and sug PS sorghum hybrids. gested that this QTL could correspond to Ma1. Klein et al. ii. In this case, DNA markers would be used to identify (2008) using genotypes known to segregate for Mal showed progeny (C) that have the genotype that Mal mapped to an adjacent region on SBIO6 (-11-21 65 ma5 ma5 ma7ma7 Ma6Ma6. cM). The data in Lin et al. (1995) are inconsistent with the iii. In this case, PI progeny (C) with the genotype assigned map location of QMa1.ugalD in Feltus et al. (2006). ma5 ma5 ma7ma7 MaðMaé could be crossed to an elite US 8,309,793 B2 15 16 PI line (D) with the genotype and flowering phenotypes was used to map a second locus Ma5Ma5Ma7 Ma7ma6ma6 to produce PS late or non with Mas like action to LG-01. This locus was designated flowering sorghum hybrid seed/plants with the genotype Ma7. The gene for Ma7 was further fine mapped to a region Masma5MaTma/Ma6ma6. spanning ~400,000 bp. Portions of the sorghum genome In a further aspects, inventors may want to convert a PI 5 sequence released by DOE to each of these regions and iden early flowering plant that is not suitable for use in the produc tified putative genes encoded by these regions based on tion of PS late or non-flowering sorghum hybrids into a PI BLAST analysis and comparison to the colinear region of the early flowering plant that can be used for this purpose. This rice genome were identified and aligned. can be done as follows: The Maš and Ma7 loci were examined and candidate genes a. Cross a PI early flowering genotype (E) with the geno- 10 in these regions were identified that could explain the type ma5maiSma6ma6 or MaSMa5maoma6 with a PI early observed regulation of flowering time. In the Mas locus, a flowering genotype (F) with the genotype mašma5MaéMao. gene homologous to COP9FUS5 was identified as a candi b. Self the resulting F1 plants and use molecular markers to date gene. COP9FUS5 is a subunit of a large signalasome identify progeny (G) with the following genotype; complex (CSN complex) that was initially identified in Ara maSma5Ma6Ma6. 15 bidopsis as involved in the repression of photomorphogenesis c. The mašma5 alleles could be derived from (E) or (F) and a range of other activities. This complex acts by targeting depending on the cross involved, whereas the MaðMao alle transcription factors for degradation that mediate light acti les will be derived from (F). vated events (such as de-etiolation, light activated gene d. Cross progeny (G) to an elite sorghum with the genotype expression). Therefore, it was reasoned that variation in the MašMa5ma6ma6 to generate F1 seed/hybrid plants that are 20 activity of COP9FUS5 could modulate flowering time in PS late or non-flowering. Sorghum by modulating light dependent repression of flow ering mediated by the PhyB and PhyC photoreceptors, or by Example 2 modulating light dependent output from the circadian clock. A gene encoding a Myb-transcription factor that could be Genetic Map Analysis of Mas 25 involved in flowering time was also identified in the MaS fine mapping interval. Myb-transcription factors such as CCA1/ The location of Mas, Ma7 and Mað on the sorghum genetic LHY (Arabidopsis) are a central part of the circadian clock map was determined as described below thus enabling the and allelic variation in this type of gene can modulate flow development of DNA markers flanking these loci for use in ering time. marker-assisted breeding. The coordinates of Maš, Ma7 and 30 Several candidate genes were identified in the Ma7 locus Ma? on the TAMU sorghum genetic map (cM) and on the including PhyC, a MADS-box 14 gene and a MADS-box DOE sorghum genome sequence (bp) are listed below: (i) gene corresponding to AP1. AP1 activates meristem identity Ma5 QTL coordinates on SBI-02: From 59L10, 67923811 genes that are involved in the production offloral organs. AP1 bp, 146.1-148.9 cM to txp428, 68393290 bp, 148.9-152.1 is activated by FT in the apex. FT encodes a transmissible cM; (ii) Ma7 QTL coordinates on SBI-01: From txp208, 35 protein that travels from the leaf to the apex when photoperiod 6545866 bp, 23.4 c.M to txp523, 8017655 bp, 26.5-29.5 cM. and other requirements are met Such that FT expression is Populations segregating for Maš/mas were constructed by activated. MADS-box 14 is involved in flowering time con crossing EBA-3 (masma5 MaðMaé) to A3RTx436 trol in rice so it is also a candidate gene for Ma7. PhyC is also (MasMasma6ma6) creating an F1 hybrid that was back a reasonable candidate for Ma7 because in rice, and presum crossed to EBA-3 to create a BC1F1 mapping population that 40 ably sorghum, inactivation of PhyC decreases repression of was expected to segregate 1:1 for alleles at the Mas locus flowering in long days resulting in early flowering (as (Masma5Mao ; ma5 ma5Mao ). Phenotypic analysis of observed in EBA-3). flowering time of BC1F1 progeny was performed from this COSS. Example 3 A large population of ~4200 BC1F1 plants was grown at 45 two locations in College Station, Tex. and was assayed for Genetic Map Location and Molecular Description of days to flowering at approximately weekly intervals. The Ma6 parents of this population flowered between 60-90 days, and the F1 flowered at ~170-180 days. Data on time to flowering Ma? was mapped in a BC1F1 population created by cross was collected from 2915 plants, whereas the remaining plants 50 ing EBA-3 (masma5Maé Mað) tO ATX623 either died during growth (a small number of plants) or had (MasMasma6ma6), where the F1 derived from this cross was not flowered by November when frost terminated their devel backcrossed to ATX623. Progeny from the BC1F1 population opment. Approximately 28% of the population flowered early were expected to segregate for the Mao locus in a 1:1 ratio (before August 7) and there was a period from 105-148 days (Mas maoma6 vs. Maš Ma6ma6). Late flowering plants post planting where fewer plants flowered before a second 55 from this population were expected to contain the EBA-3 large cohort of plants initiated flowering. Approximately 72% dominant version of Mað. Genetic mapping initially located of the plants flowered after August 7, with many plants flow Ma? to an interval on SBIO6 spanning from ~8 cM to ~21 cM ering well after F1 hybrids flowered at approximately 175 (Mao QTL coordinates on LG-06: txp658, 39379760 bp, days (more than 220 days). This result indicated that more 8.0-9.9 cM to txp434, 42610705 bp, 17.4-20.7 cM; bp coor than one gene with Maš-like action was segregating in this 60 dinates are derived from the DOE pseudomolecule population based on deviation from 1:1 segregation of PI:PS sequence). Further fine mapping narrowed the Mao locus to a phenotypes and transgressive segregation for late flowering. region spanning from Xtxp598 to a DNA polymorphism A form of bulk segregant analysis and SSR and AFLP present in a DNA binding protein upstream from Mað. There markers were used to map the location of one locus with MaS are approximately ~20 annotated genes (excluding genes action to a ~10 cM region on LG-02. This locus was desig- 65 associated with transposons) in this delimited region. nated Maš. The location of Maš was further refined to a A sorghum gene encoding a homolog of Arabidopsis PRR7 region ~250,000 bp. Information on the segregation of MaS (and rice OspRR37) was present among the -20 genes in the US 8,309,793 B2 17 18 delimited Mað locus. The PRR7/PRR37 gene homologs are -continued known to modulate flowering time in several plant species (Arabidopsis, rice, barley) Suggesting that the sorghum Rice Prr7 protein features: Location Qualifiers PRR7/37 gene homolog in the Mao locus is likely to be the recently identified in eukaroytes ETR1 Arabidopsis gene causing differences in flowering time in sorghum. thaliana; this domain receives the signal from the sensor Therefore, cDNA derived from this gene was sequenced from partner in a two-component systems; contains; coloO156

EBA-3 (Ma6) and RTX436 (ma6) and compared (FIGS. e forderos... Reis Eii.oy, s s 144,s 163.16.s 167) 1A-C: SEQID NOs: 1 and 2). The alignment of the cDNA isite type="active' sequences revealed 5 sequence polymorphisms (FIGS. fob xref=“CDD:29071 1A-C). One of these sequence differences (a G (EBA3) to T 10 Site 114 (RTx436) substitution) caused amino acid 166 to change site type phosphorylation fromm a lysinely (EBA3) to an asparagirasparagine in RTX436 (FIG. 2) Site fob.order(117. Xref="CDD:29071 ... 118, 120... 122) This amino acid change is conservative (no charge change) isite type="other but occurs in a three amino acid sequence of the Prr protein /note="intermolecular recognition site' predicted to be involved in dimerization. Therefore it is pos- 15 fob. Xref="CDD:29071 S1)ible thatal this change9. in amino acid sequenceC alters pprotein- Site isite166 ...type="other 168 protein interaction required for normal function of the fnote='dimerization interface SbPrr37 protein. fob xref=“CDD:29071 The protein encoded by sorghum PRR37 (Mao) is homolo- Region S. ... 718 "CCT" region name= gous to and similar 1 a1O acid Sequence to the protein 2O fnote="CCT motif. This short motif is found in a number of encoded by rice PRR37. The rice Prr37 protein sequence is plant proteins. It is rich in basic amino acids and has shown below, where the putative signal receiver domain is been called a CCT motif after Co, Col and Toc1; pfam()6203 shown in bold and the putative dimerization domain (amino CDS by CDD:87043 acids 166-168) is shown 1. bold and underlined (amino acid /gene="OsPRR37 sequence KPI (lysine-proline-isoleucine). The sorghum 25 /coded by="AB189039.1:1 ... 2229 Prr37 putative dimerization domain of EBA-3 (Mao) has the sequence KPI (SEQIDNO:3) identical to rice Prr37 (SEQID NO:5) (KPI at positions 166-168), whereas the putative A difference in the expression (gene regulation) of PRR37 dimerization domain of Prr37 from RTx436 (mao) (SEQ ID in EBA-3 and RTX436 could cause a difference in gene activ NO:4) has the sequence NPI. ity corresponding to Mao vs. mao. Preliminary assays showed

Rice Prr 7 Sequence: mmgtahhnqt agsalgvgvg dandavpgag giggysopdgg pisgvgrppo vicwerfickk 61 tikvillwdsd distrov vsal lirhcmyevip aenggigawty ledmonsidl wiltevvmpgv 121 sgislls rim nhnicknipv imms sndamg twifkclskga vidflvkpirk nelknlwghvi 181 Wirrchs sisgs gses giqtok calksksgdes nnnng snddd dddgwimgln ardgs dingsg 241 toads switkr aveidspolam spooladppd stcaqvihlk scic Snrwlp ct Snkinskko 301. ketinddfkgk dileigsprinl ntayqs spine rsikpt drrn eyplginnske aamenleess 361 viraadlig sm aknmdaqqaa raanapncss kVpegkdknr dinimpslels likr Sir stgdg 421 analiqeeqrn vlrrisdilsaf tryhtpvasin qdgtgfmgsc silhdns seam kitosaynmks 481 insdaapikgg Sngs Snnndm gsttknvvtk pstinkervms psavkanght safhpadhwt 541 spanttgkek toevannaak Iraqpgevoisin livchproilh yvhfovsren gigsgapocqs 601 snvfoppveg haanygvings insgsningsng qngsttavda erpnmeiang tinksgpggg 661 ngsgsgsgnd mylkrftgre hrvaavikfir qkrkernfgk kvrydisrkirl aeqrprvirgo 721 fivrgavadqq qqgg greaaa dr

55 that PRR37 was expressed differently in EBA-3 and RTx436. Therefore, -800 bp of the promoter regions of PRR37 from Rice Prr7 protein features: Location Qualifiers EBA-3 and RTX436 was sequenced and aligned (FIG.3). This SOUCC 1... 742 revealed many sequence differences including several large forganism="Oryza Saiva Japonica Group deletions/insertions in the promoter regions of PRR37 in fcultivar="Nipponbare 60 RTx436 compared to EBA-3 (FIG. 3). These differences in idb Xref="taxon:39947' sequence may alter the expression of the PRR37 alleles and Protein . d “pseud s contribute to a difference in flowering phenotype. Region g uspseu o-response regulator 37 All of the methods disclosed and claimed herein can be fregion iname="REC made and executed without undue experimentation in light of inote='"Signal receiver domain; originally thought to be 65 the present disclosure. While the compositions and methods unique to bacteria (Chey, OmpR, NtrC, and PhoB), now of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that US 8,309,793 B2 19 20 variations may be applied to the methods and in the steps or in Hart et al., Theor: Appl. Genet., 103: 1222–1242, 2001 the sequence of steps of the method described herein without Ishikawa et al., Plant Cell, 17(12):3326-3336, 2005. departing from the concept, spirit and scope of the invention. Kaczorowski and Quail, Plant Cell, 15(11):2654-2665, 2003. More specifically, it will be apparent that certain agents which Klein et al., Plant Genome, 48: S12-22, 2008 are both chemically and physiologically related may be sub- 5 Linet al., Genetics, 141(1):391-411, 1995. stituted for the agents described herein while the same or McClung, Proc. Natl. Acad. Sci. USA, 103(32): 11819-11820, similar results would beachieved. All such similar substitutes 2006 s site print to those kills in the s E. Miller et al., CropScience, 8:499-502, 1968. E. tO R t spirit, Film concept of the Nakamichi et al. Plant Cell Physiol, 48(6):822-832, 2007. 1V1O aS Cl y une appa CC Ca1S. Paterson et al., Proc. Natl. Acad. Sci. USA, 92(13):6127 REFERENCES 6131, 1995. Quinby and Karper, Amer: J. Botany, 33 (9):716-721, 1946. The following references, to the extent that they provide Quinby, J. R., CropScience 6:516-518, 1966 exemplary procedural or other details supplementary to those is Quinby, J. R. (1974) Sorghum Impr.ovement and the Genetics set forth herein, are specifically incorporated herein by refer- of Growth. Texas A&M University Press. CCC. Rooney and Aydin, CropScience, 39; 397-400, 1999. Childs et al., Plant Physiol., 116(3):1003-1011, 1998. Rosyara et al., In: Family-based mapping of FHB resistance Childs et al., Plant Physiol., 113:611-619, 1997. OTLS in hexaploid wheat, Proc. Natl. Fusarium Head Crasta et al., Mol. Gen. Genet., 262(3):579-588, 1999. 20 Blight Forum, Kansas City, Mo., 2007. Craufurd et al., Theor: Appl. Genet., 99:900-911, 1999. Takano et al., Plant Cell, 17(12):3311-3325, 2005. Feltus et al., Theor. Appl. Genet., 112(7): 1295-1305, 2006. Turner et al., Science, 310(5750): 1031-1034, 2005.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 9

<21 Os SEQ ID NO 1 &211s LENGTH: 21.90 &212s. TYPE: DNA <213> ORGANISM: Sorghum bicolor <4 OOs SEQUENCE: 1 tgtag to agc aactggccac cqtggacggg cctt Cocto a gagatgccac Caggatgatg 60 Ctt.cggaata acaacaataa totgaggagc aatggcc cat Cagatggctt gcticagdagg 12O cca accc.ctg cagtact coa ggatgatgac gatggtggtg atgatgatac ggaaaaccag 18O

cagcaggagg cqgtctact g ggagcgcttic ct coagaaga agaC catcala C9tcttgctic 24 O

gtggaga.gtg acgactgcac taggcgggit C gt cagtgcCC ttct tcgt.ca citgcatgitac 3 OO Caagttatct ctgctgaaaa tigc.ca.gcaa gCatggaatt at Cttgaaga talagcagaac 360

aacatagata ttgttittgat tdaggtttitt atgc.ccggtg tdtctggaat ttct citgctg 42O agtaggat.ca tdagccacaa tatttgcaag aatatt coag tdattatgat gt ctitcgaat 48O

gatgctagga at acagt ctt taaatgtttgtcgaaaggtg Ctgttgactt tttagt caag 54 O

Cct at acgta agaatgaact talagaat Ctt togcagcatg tatggagacg gtgtcacagc 6 OO tdaagtggta gtggaagtga aagtggcatt Cagacgcaga agtgtggcaa at Caaaaggt 660

ggaaaagaat ctggtaataa tagtggtagc aatgacagtic acgacaacga agcaga catg 72O ggact taatg caagggatga cagtgataat ggcagtggca ct caag.cgca gagct catgg 78O

actaagttgttg ctgtggagat ggacagcc.ca caggcaatgt Ctctggat.ca cittagc.cgat 84 O

to acctgata gcacttgtgc gcaagtaatc. cacccaaagt cagagatatg tagcaacaga 9 OO

cggctaccag acgacttcaa ggaaaaggac ttggagatag gtggcc ctgg aaattitat at 96.O atagat Cacc aatct tcc.cc aaatgagagg cct atcaaag caacagatgg acgttgtgag 102O

tacccaccala aaaacaattic galaggagtca atgatgcaaa atctagagga cc caactgtt 108O cgagctgctg at Ctaattgg ttcaatggcc aaaaacatgg at acccagga ggcagcgaga 114 O

gctgcagata cc cctaatct coctitccaaa gtgccagaag ggaaagataa gaacaa.gcat 12 OO

US 8,309,793 B2 23 24 - Continued gctgcagata CCCCtaat Ct CCCtt CCaaa. gtgcc agaag ggaaagataa gaacaag cat 2OO gacaaaattit tgc cat cact tgagttgagt ttgaagaggit cgagat catg tggatatggit 26 O gccalatacag tcaaagctga tgaacaacag aatgt attaa gacagtcaaa t ct ct cagot 32O tttacaaggt accatacatc. tacggct tcc aat Caaggtg ggactggatt agtagggagc tgttcgc.cac atgaca acag Ctcagaggct atgaaaacag att Ctactta Calacatgaag 44 O tcaaatticag atgctgct co aataaaacaa. ggctic caacg gaagtagcaa. taacaatgac SOO atgggttc.ca ctacaaagaa tgttgttgaca aagcc cacta Caaataataa. ggaCagggit a 560 atgttgcc ct catcagctat taataaggct aatggacaca catcago att ccaccctgtg

Cagcattgga cgatggitt CC agctaatgca gCaggaggga Cagcgaaggc tgatgaagtg gccaac attg caggttaccc ttcaggtgac atgcagtgta acctgatgca atggtaccct 74 O cgt.cca accc tt cattacgt. c cagtttgat ggtgcacggg agaatggtgg atcgggagcc

Ctggaatgtg gttcct coaa cg tatttgat cct coagttg alaggt caagc tactalactat 86 O ggtgttgaaca ggagcaactic aggcagtaac aatgcaacca agggg.ca.gala tggaagtaat 92 O acagttggtg Caagcatggc tggtccaaat gcaaatgcaa. atggtaatgc tggacgaaca 98 O alacatggaga ttgctaatga ggt catcgac aaaagtggac atgcaggagg tggcaatggg agtggcagtg gcagtggcaa. tgacacatat gtcaaacggc ttgcagoggg cittgacacca 21OO cgacaa.gcac aactaaagaa atatagagag aaaaagaaag atcgaaactt tgggaaaaag 216 O gtag cctitt ttcaattgca tgtttgttggit 219 O

SEQ ID NO 3 LENGTH: 73 O TYPE : PRT ORGANISM: Sorghum bicolor FEATURE: NAME/KEY: UNSURE LOCATION: (723) . (723) OTHER INFORMATION: Xala is any natural amino acid

<4 OOs, SEQUENCE: 3

Cys Ser Glin Glin Leu Ala Thir Wall Asp Gly Pro Ser Lell Arg Asp Ala 1. 5 1O 15

Thir Arg Met Met Lieu. Arg Asn. Asn Asn Asn ASn Lell Arg Ser Asin Gly 25

Pro Ser Asp Gly Lieu Lleu Ser Arg Pro Thir Pro Ala Wall Luell Glin Asp 35 4 O 45

Asp Asp Asp Gly Gly Asp Asp Asp Thir Glu ASn Glin Glin Glin Glu Ala SO 55 6 O

Wall Trp Glu Arg Phe Lieu. Glin Thir Ile Asn Wall Lieu. Luell 65 70 8O

Wall Glu Ser Asp Asp Cys Thr Arg Arg Wall Wall Ser Ala Luell Lieu. Arg 85 90 95

His Met Tyr Glin Val Ile Ser Ala Glu ASn Gly Glin Glin Ala Trp 105 11 O

Asn Luell Glu Asp Llys Glin Asn Asn Ile Asp Ile Wall Luell Ile Glu 115 12 O 125

Wall Phe Met Pro Gly Val Ser Gly Ile Ser Luell Lell Ser Arg Ile Met 13 O 135 14 O

Ser His Asn Ile Cys Lys Asn. Ile Pro Wall Ile Met Met Ser Ser Asn 145 150 155 160

Asp Ala Arg Asn Thr Val Phe Lys Luell Ser Gly Ala Val Asp 1.65 17O 17s US 8,309,793 B2 25 26 - Continued

Phe Luell Wall Lys Pro Ile Arg Asn Glu Luell Lys Asn Lieu. Trip Glin 18O 185 19 O

His Wall Trp Arg Arg His Ser Ser Ser Gly Ser Gly Ser Glu Ser 195

Gly Ile Glin Thir Glin Cys Gly Ser Lys Gly Gly Lys Glu Ser 21 O 215 22O

Gly Asn Asn Ser Gly Ser Asn Asp Ser His Asp Asn Glu Ala Asp Met 225 23 O 235 24 O

Gly Luell Asn Ala Arg Asp Asp Ser Asp Asn Gly Ser Gly Thir Glin Ala 245 250 255

Glin Ser Ser Trp Thir Ala Wall Glu Met Asp Ser Pro Glin Ala 26 O 265 27 O

Met Ser Luell Asp His Lell Ala Asp Ser Pro Asp Ser Thir Ala Glin 285

Wall Ile His Pro Ser Glu Ile Ser ASn Arg Arg Luell Pro Asp 29 O 295 3 OO

Asp Phe Glu Asp Lell Glu Ile Gly Gly Pro Gly Asn Luell Tyr 3. OS 310 315

Ile Asp His Glin Ser Ser Pro Asn Glu Arg Pro Ile Ala Thir Asp 3.25 330 335

Gly Arg Glu Tyr Pro Pro Asn Asn Ser Glu Ser Met Met 34 O 345 35. O

Glin Asn Luell Glu Asp Pro Thir Wall Arg Ala Ala Asp Lell Ile Gly Ser 355 360 365

Met Ala Asn Met Asp Thir Glin Glu Ala Ala Arg Ala Ala Asp Thir 37 O 375 38O

Pro Asn Luell Pro Ser Lys Wall Pro Glu Gly Lys Asp Asn His 385 390 395 4 OO

Asp Ile Luell Pro Ser Lell Glu Luell Ser Luell Arg Ser Arg Ser 4 OS 415

Gly Asp Gly Ala Asn Thir Wall Lys Ala Asp Glu Glin Glin Asn Wall 425 43 O

Lell Arg Glin Ser Asn Lell Ser Ala Phe Thir Arg His Thir Ser Thir 435 44 O 445

Ala Ser Asn Glin Gly Gly Thir Gly Luell Wall Gly Ser Ser Pro His 450 45.5 460

Asp Asn Ser Ser Glu Ala Met Thir Asp Ser Thir Asn Met Lys 465 470

Ser Asn Ser Asp Ala Ala Pro Ile Glin Gly Ser Asn Gly Ser Ser 485 490 495

Asn Asn Asn Asp Met Gly Ser Thir Thir ASn Wall Wall Thir Pro SOO 505

Thir Thir Asn Asn Asp Arg Wall Met Luell Pro Ser Ser Ala Ile Asn 515 525

Ala Asn Gly His Thir Ser Ala Phe His Pro Wall Glin His Trp Thir 53 O 535 54 O

Met Wall Pro Ala Asn Ala Ala Gly Gly Thir Ala Ala Asp Glu Wall 5.45 550 555 560

Ala Asn Ile Ala Gly Pro Ser Gly Asp Met Glin Asn Luell Met 565 st O sts

Glin Trp Pro Arg Pro Thir Luell His Tyr Wall Glin Phe Asp Gly Ala 58O 585 59 O

Arg Glu Asn Gly Gly Ser Gly Ala Luell Glin Cys Gly Ser Ser Asn Wall US 8,309,793 B2 27 28 - Continued

595 6OO 605 Phe Asp Pro Pro Val Glu Gly Glin Ala Thr Asn Tyr Gly Val Asn Arg 610 615 62O Ser Asn. Ser Gly Ser Asn. Asn Ala Thir Lys Gly Glin Asn Gly Ser Asn 625 630 635 64 O Thr Val Gly Ala Ser Met Ala Gly Pro Asn Ala Asn Ala Asn Gly Asn 645 650 655 Ala Gly Arg Thr Asn Met Glu Ile Ala Asn. Glu Val Ile Asp Llys Ser 660 665 67 O Gly His Ala Gly Gly Gly Asn Gly Ser Gly Ser Gly Ser Gly Asn Asp 675 68O 685 Thir Tyr Val Lys Arg Lieu Ala Ala Gly Lieu. Thr Pro Arg Glin Ala Glin 69 O. 695 7 OO Lieu Lys Llys Tyr Arg Glu Lys Llys Lys Asp Arg Asn. Phe Gly Lys Llys 7 Os 71O 71s 72O Val Ala Xala Phe Ser Ile Ala Cys Lieu. Trip 72 73 O

<210s, SEQ ID NO 4 &211s LENGTH: 73 O 212. TYPE: PRT <213> ORGANISM: Sorghum bicolor 22 Os. FEATURE: <221s NAME/KEY: UNSURE <222s. LOCATION: (723) . . (723) <223> OTHER INFORMATION: Xaa is any natural amino acid <4 OOs, SEQUENCE: 4 Cys Ser Glin Glin Lieu Ala Thr Val Asp Gly Pro Ser Lieu. Arg Asp Ala 1. 5 1O 15 Thir Arg Met Met Lieu. Arg Asn. Asn. Asn. Asn. Asn Lieu. Arg Ser Asn Gly 2O 25 3O Pro Ser Asp Gly Lieu Lleu Ser Arg Pro Thr Pro Ala Val Lieu. Glin Asp 35 4 O 45 Asp Asp Asp Gly Gly Asp Asp Asp Thr Glu Asn Glin Glin Glin Glu Ala SO 55 6 O Val Tyr Trp Glu Arg Phe Lieu Gln Lys Llys Thir Ile Asin Val Lieu. Lieu 65 70 7s 8O Val Glu Ser Asp Asp Cys Thr Arg Arg Val Val Ser Ala Lieu. Lieu. Arg 85 90 95 His Cys Met Tyr Glin Val Ile Ser Ala Glu Asn Gly Glin Glin Ala Trp 1OO 105 11 O Asn Tyr Lieu. Glu Asp Llys Glin Asn. Asn. Ile Asp Ile Val Lieu. Ile Glu 115 12 O 125 Val Phe Met Pro Gly Val Ser Gly Ile Ser Leu Lleu Ser Arg Ile Met 13 O 135 14 O Ser His Asn Ile Cys Lys Asn Ile Pro Val Ile Met Met Ser Ser Asn 145 150 155 160 Asp Ala Arg Asn Thr Val Phe Lys Cys Lieu. Ser Lys Gly Ala Val Asp 1.65 17O 17s Phe Lieu Val Asn. Pro Ile Arg Lys Asn. Glu Lieu Lys Asn Lieu. Trp Glin 18O 185 19 O His Val Trp Arg Arg Cys His Ser Ser Ser Gly Ser Gly Ser Glu Ser 195 2OO 2O5 Gly Ile Glin Thr Glin Lys Cys Gly Lys Ser Lys Gly Gly Lys Glu Ser 21 O 215 22O US 8,309,793 B2 29 30 - Continued Gly Asn Asn Ser Gly Ser Asn Asp Ser His Asp Asn Glu Ala Asp Met 225 23 O 235 24 O

Gly Luell Asn Ala Arg Asp Asp Ser Asp Asn Gly Ser Gly Thir Glin Ala 245 250 255

Glin Ser Ser Trp Thir Ala Wall Glu Met Asp Ser Pro Glin Ala 26 O 265 27 O

Met Ser Luell Asp Glin Lell Ala Asp Ser Pro Asp Ser Thir Ala Glin 285

Wall Ile His Pro Ser Glu Ile Ser ASn Arg Arg Luell Pro Asp 29 O 295 3 OO

Asp Phe Glu Asp Lell Glu Ile Gly Gly Pro Gly Asn Luell Tyr 3. OS 310 315

Ile Asp His Glin Ser Ser Pro Asn Glu Arg Pro Ile Ala Thir Asp 3.25 330 335

Gly Arg Glu Tyr Pro Pro Asn Asn Ser Glu Ser Met Met 34 O 345 35. O

Glin Asn Luell Glu Asp Pro Thir Wall Arg Ala Ala Asp Lell Ile Gly Ser 355 360 365

Met Ala Asn Met Asp Thir Glin Glu Ala Ala Arg Ala Ala Asp Thir 37 O 375 38O

Pro Asn Luell Pro Ser Lys Wall Pro Glu Gly Lys Asp Asn His 385 390 395 4 OO

Asp Ile Luell Pro Ser Lell Glu Luell Ser Luell Arg Ser Arg Ser 4 OS 415

Gly Tyr Gly Ala Asn Thir Wall Lys Ala Asp Glu Glin Glin Asn Wall 425 43 O

Lell Arg Glin Ser Asn Lell Ser Ala Phe Thir Arg His Thir Ser Thir 435 44 O 445

Ala Ser Asn Glin Gly Gly Thir Gly Luell Wall Gly Ser Ser Pro His 450 45.5 460

Asp Asn Ser Ser Glu Ala Met Thir Asp Ser Thir Asn Met Lys 465 470

Ser Asn Ser Asp Ala Ala Pro Ile Glin Gly Ser Asn Gly Ser Ser 485 490 495

Asn Asn Asn Asp Met Gly Ser Thir Thir ASn Wall Wall Thir Pro SOO 505

Thir Thir Asn Asn Asp Arg Wall Met Luell Pro Ser Ser Ala Ile Asn 515 525

Ala Asn Gly His Thir Ser Ala Phe His Pro Wall Glin His Trp Thir 53 O 535 54 O

Met Wall Pro Ala Asn Ala Ala Gly Gly Thir Ala Ala Asp Glu Wall 5.45 550 555 560

Ala Asn Ile Ala Gly Tyr Pro Ser Gly Asp Met Glin Asn Luell Met 565 st O sts

Glin Trp Pro Arg Pro Thir Luell His Wall Glin Phe Asp Gly Ala 585 59 O

Arg Glu Asn Gly Gly Ser Gly Ala Luell Glu Cys Gly Ser Ser Asn Wall 595 605

Phe Asp Pro Pro Wall Glu Gly Glin Ala Thir ASn Tyr Gly Wall Asn Arg 610 615

Ser Asn Ser Gly Ser Asn Asn Ala Thir Gly Glin Asn Gly Ser Asn 625 630 635 64 O

Thir Wall Gly Ala Ser Met Ala Gly Pro Asn Ala Asn Ala Asn Gly Asn 645 650 655 US 8,309,793 B2 31 32 - Continued

Ala Gly Arg Thir Asn Met Glu Ile Ala Asn Glu Wall Ile Asp Lys Ser 660 665 67 O

Gly His Ala Gly Gly Gly Asn Gly Ser Gly Ser Gly Ser Gly Asn Asp 675 685

Thir Tyr Wall Lell Ala Ala Gly Luell Thir Pro Arg Glin Ala Glin 69 O. 695 7 OO

Lell Glu Lys Asp Arg Asn Phe Gly Lys 7 Os 71O 71s 72O

Wall Ala Xaa Phe Ser Ile Ala Luell Trp 72 73 O

<210s, SEQ ID NO 5 &211s LENGTH: 742 212. TYPE : PRT &213s ORGANISM: Oryza sativa

<4 OOs, SEQUENCE: 5

Met Met Gly Thr Ala His His Asn Glin Thir Ala Gly Ser Ala Luell Gly 1. 15

Wall Gly Wall Gly Asp Ala Asn Asp Ala Wall Pro Gly Ala Gly Gly Gly 2O 25

Gly Tyr Ser Asp Pro Asp Gly Gly Pro Ile Ser Gly Wall Glin Arg Pro 35 4 O 45

Pro Glin Wall Trp Glu Arg Phe Ile Glin Lys Lys Thir Ile Wall SO 55 6 O

Lell Luell Wall Ser Asp Asp Ser Thir Arg Glin Wall Wall Ser Ala Luell 65 70

Lell Arg His Met Glu Wall Ile Pro Ala Glu Asn Gly Glin Glin 85 90 95

Ala Trp Thir Tyr Lell Glu Asp Met Glin Asn Ser Ile Asp Luell Wall Luell 105 11 O

Thir Glu Wall Wall Met Pro Gly Wall Ser Gly Ile Ser Lell Luell Ser Arg 115 12 O 125

Ile Met Asn His Asn Ile Cys Asn Ile Pro Wall Ile Met Met Ser 13 O 135 14 O

Ser Asn Asp Ala Met Gly Thir Wall Phe Cys Lell Ser Gly Ala 145 150 155 160

Wall Asp Phe Luell Wall Pro Ile Arg Lys ASn Glu Lell Asn Luell 1.65 17O 17s

Trp Glin His Wall Trp Arg Arg His Ser Ser Ser Gly Ser Gly Ser 18O 185 19 O

Glu Ser Gly Ile Glin Thir Glin Lys Ala Ser Lys Ser Gly Asp 195 2OO

Glu Ser Asn Asn Asn Asn Gly Ser Asn Asp Asp Asp Asp Asp Asp Gly 21 O 215 22O

Wall Ile Met Gly Lell Asn Ala Arg Asp Gly Ser Asp Asn Gly Ser Gly 225 23 O 235 24 O

Thir Glin Ala Glin Ser Ser Trp Thir Arg Ala Wall Glu Ile Asp Ser 245 250 255

Pro Glin Ala Met Ser Pro Asp Glin Luell Ala Asp Pro Pro Asp Ser Thir 26 O 265 27 O

Ala Glin Wall Ile His Lell Lys Ser Asp Ile Ser Asn Arg Trp 27s 28O 285

Lell Pro Thir Ser Asn Lys Asn Ser Glin Glu Thir Asn 29 O 295 3 OO US 8,309,793 B2 33 34 - Continued

Asp Asp Phe Gly Lys Asp Luell Glu Ile Gly Ser Pro Arg Asn Luell 3. OS 310 315

Asn Thir Ala Glin Ser Ser Pro Asn Glu Arg Ser Ile Lys Pro Thir 3.25 330 335

Asp Arg Arg Asn Glu Tyr Pro Luell Glin Asn ASn Ser Glu Ala Ala 34 O 345 35. O

Met Glu Asn Luell Glu Glu Ser Ser Wall Arg Ala Ala Asp Luell Ile Gly 355 360 365

Ser Met Ala Asn Met Asp Ala Glin Glin Ala Ala Arg Ala Ala Asn 37 O 375 38O

Ala Pro Asn Ser Ser Wall Pro Glu Gly Asp Asn Arg 385 390 395 4 OO

Asp Asn Ile Met Pro Ser Lell Glu Luell Ser Luell Arg Ser Arg Ser 4 OS 415

Thir Gly Asp Gly Ala Asn Ala Ile Glin Glu Glu Glin Arg Asn Wall Luell 425 43 O

Arg Arg Ser Asp Lell Ser Ala Phe Thir Arg Tyr His Thir Pro Wall Ala 435 44 O 445

Ser Asn Glin Gly Gly Thir Gly Phe Met Gly Ser Cys Ser Luell His Asp 450 45.5 460

Asn Ser Ser Glu Ala Met Thir Asp Ser Ala Asn Met Ser 465 470

Asn Ser Asp Ala Ala Pro Ile Glin Gly Ser Asn Gly Ser Ser Asn 485 490 495

Asn Asn Asp Met Gly Ser Thir Thir Lys Asn Wall Wall Thir Lys Pro Ser SOO 505

Thir Asn Lys Glu Arg Wall Met Ser Pro Ser Ala Wall Lys Ala Asn Gly 515 525

His Thir Ser Ala Phe His Pro Ala Glin His Trp Thir Ser Pro Ala Asn 53 O 535 54 O

Thir Thir Gly Glu Lys Thir Asp Glu Wall Ala Asn Asn Ala Ala Lys 5.45 550 555 560

Arg Ala Glin Pro Gly Glu Wall Glin Ser Asn Luell Wall Glin His Pro Arg 565 st O sts

Pro Ile Luell His Tyr Wall His Phe Asp Wall Ser Arg Glu Asn Gly Gly 585 59 O

Ser Gly Ala Pro Glin Gly Ser Ser Asn Wall Phe Asp Pro Pro Wall 595 605

Glu Gly His Ala Ala Asn Tyr Gly Wall Asn Gly Ser Asn Ser Gly Ser 610 615

Asn Asn Gly Ser Asn Gly Glin Asn Gly Ser Thir Thir Ala Wall Asp Ala 625 630 635 64 O

Glu Arg Pro Asn Met Glu Ile Ala Asn Gly Thir Ile Asn Ser Gly 645 650 655

Pro Gly Gly Gly Asn Gly Ser Gly Ser Gly Ser Gly Asn Asp Met Tyr 660 665 67 O

Lell Arg Phe Thir Glin Arg Glu His Arg Wall Ala Ala Wall Ile 675 685

Phe Arg Glin Glu Arg Asn Phe Gly Lys Wall Arg Tyr 69 O. 695 7 OO

Glin Ser Arg Lell Ala Glu Glin Arg Pro Arg Wall Arg Gly Glin 7 Os 71O 71s 72O

Phe Wall Arg Glin Ala Wall Glin Asp Glin Glin Glin Glin Gly Gly Gly Arg

US 8,309,793 B2 37 38 - Continued

&212s. TYPE: DNA <213> ORGANISM: Sorghum bicolor <4 OOs, SEQUENCE: 9 ttgtttitatic titcctaccta gctatatata gctattogitt ttgtcattca ctittgcagoa 6 O atcacactga Caggtgc cc ttgaaggcaa acaaggagta atatgcgc.cc cagtgtctat 12 O t cactalacca acgacttgcc ticgaatcaat cocaccactt togtotacct citt coagtica 18O ggctgagata to gaggtgt Ctgtagt cag caactggc.ca 22 O

What is claimed is: 15 2. The method of claim 1, wherein the genetic marker is selected from the group consisting of sequence variants 1. A method of screening a sorghum plant for a MaSallele revealed by direct sequence analysis, restriction fragment comprising: length polymorphisms (RFLP), isozyme markers, allele spe a) obtaining a Sorghum plant; and cific hybridization (ASH), amplified variable sequences of b) assaying the Sorghum plant for a genetic marker geneti- 20 plant genome, self-sustained sequence replication, simple cally linked to the Masallele, wherein said MaSallele is sequence repeat (SSR) and arbitrary fragment length poly located on chromosome 2 between coordinates morphisms (AFLP). 67923811 to 683932.90 bp. k . . . .