Anti-Guanylate Cyclase Beta Antibody (ARG10821)
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Purinergic Receptor Transactivation by the Β2-Adrenergic Receptor Increases Intracellular Ca2+ in Non-Excitable Cells
Molecular Pharmacology Fast Forward. Published on March 9, 2017 as DOI: 10.1124/mol.116.106419 This article has not been copyedited and formatted. The final version may differ from this version. MOLPHARM/2016/106419 Title page: Purinergic receptor transactivation by the β2-adrenergic receptor increases intracellular Ca2+ in non-excitable cells. Wayne Stallaert, Emma T van der Westhuizen, Anne-Marie Schönegge, Bianca Plouffe, Mireille Downloaded from Hogue, Viktoria Lukashova, Asuka Inoue, Satoru Ishida, Junken Aoki, Christian Le Gouill & Michel Bouvier. molpharm.aspetjournals.org Department of Biochemistry, Université de Montréal, Montréal, QC, Canada (WS, ETvdW, A- MS, BP, MB). Institute for Research in Immunology and Cancer, Université de Montréal, Montréal, QC, Canada (WS, ETvdW, A-MS, BP, MH, VL, CLG, MB). Monash Institute for at ASPET Journals on September 30, 2021 Pharmaceutical Sciences, Monash University, Parkville, Victoria, Australia (ETvdW). Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Miyagi, Japan (AI, SI, JA). Japan Science and Technology Agency (JST), Precursory Research for Embryonic Science and Technology (PRESTO), Kawaguchi, Saitama, Japan (AI). Japan Agency for Medical Research and Development, Core Research for Evolutional Science and Technology (AMED-CREST), Chiyoda-ku, Tokyo, Japan (JA). 1 Molecular Pharmacology Fast Forward. Published on March 9, 2017 as DOI: 10.1124/mol.116.106419 This article has not been copyedited and formatted. The final version may differ from this version. MOLPHARM/2016/106419 Running title page: a) Running title: β2AR transactivation of purinergic receptors b) Corresponding author: Michel Bouvier, IRIC - Université de Montréal, P.O. Box 6128 Succursale Centre-Ville, Montréal, Qc. Canada, H3C 3J7. Tel: +1-514-343-6319. -
Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in -
Supplementary Table 1
Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7 -
Cardiovascular and Pharmacological Implications of Haem-Deficient NO
ARTICLE Received 27 Feb 2015 | Accepted 27 Aug 2015 | Published 7 Oct 2015 DOI: 10.1038/ncomms9482 OPEN Cardiovascular and pharmacological implications of haem-deficient NO-unresponsive soluble guanylate cyclase knock-in mice Robrecht Thoonen1,2,w, Anje Cauwels1,2, Kelly Decaluwe3, Sandra Geschka4, Robert E. Tainsh5, Joris Delanghe6, Tino Hochepied1,2, Lode De Cauwer1,2, Elke Rogge1,2, Sofie Voet1,2, Patrick Sips1,2, Richard H. Karas7, Kenneth D. Bloch5, Marnik Vuylsteke8,9, Johannes-Peter Stasch4,10, Johan Van de Voorde3, Emmanuel S. Buys5,* & Peter Brouckaert1,2,* Oxidative stress, a central mediator of cardiovascular disease, results in loss of the prosthetic haem group of soluble guanylate cyclase (sGC), preventing its activation by nitric oxide (NO). Here we introduce Apo-sGC mice expressing haem-free sGC. Apo-sGC mice are viable and develop hypertension. The haemodynamic effects of NO are abolished, but those of the sGC activator cinaciguat are enhanced in apo-sGC mice, suggesting that the effects of NO on smooth muscle relaxation, blood pressure regulation and inhibition of platelet aggregation require sGC activation by NO. Tumour necrosis factor (TNF)-induced hypotension and mortality are preserved in apo-sGC mice, indicating that pathways other than sGC signalling mediate the cardiovascular collapse in shock. Apo-sGC mice allow for differentiation between sGC-dependent and -independent NO effects and between haem-dependent and -independent sGC effects. Apo-sGC mice represent a unique experimental platform to study the in vivo consequences of sGC oxidation and the therapeutic potential of sGC activators. 1 Laboratory for Molecular Pathology and Experimental Therapy, Inflammation Research Center, VIB, B-9052 Ghent, Belgium. -
Antagonism of Forkhead Box Subclass O Transcription Factors Elicits Loss of Soluble Guanylyl Cyclase Expression S
Supplemental material to this article can be found at: http://molpharm.aspetjournals.org/content/suppl/2019/04/15/mol.118.115386.DC1 1521-0111/95/6/629–637$35.00 https://doi.org/10.1124/mol.118.115386 MOLECULAR PHARMACOLOGY Mol Pharmacol 95:629–637, June 2019 Copyright ª 2019 by The Author(s) This is an open access article distributed under the CC BY-NC Attribution 4.0 International license. Antagonism of Forkhead Box Subclass O Transcription Factors Elicits Loss of Soluble Guanylyl Cyclase Expression s Joseph C. Galley, Brittany G. Durgin, Megan P. Miller, Scott A. Hahn, Shuai Yuan, Katherine C. Wood, and Adam C. Straub Heart, Lung, Blood and Vascular Medicine Institute (J.C.G., B.G.D., M.P.M., S.A.H., S.Y., K.C.W., A.C.S.) and Department of Pharmacology and Chemical Biology (J.C.G., A.C.S.), University of Pittsburgh, Pittsburgh, Pennsylvania Received November 29, 2018; accepted March 31, 2019 Downloaded from ABSTRACT Nitric oxide (NO) stimulates soluble guanylyl cyclase (sGC) protein expression showed a concentration-dependent down- activity, leading to elevated intracellular cyclic guano- regulation. Consistent with the loss of sGC a and b mRNA and sine 39,59-monophosphate (cGMP) and subsequent vascular protein expression, pretreatment of vascular smooth muscle smooth muscle relaxation. It is known that downregulation of cells with the FoxO inhibitor decreased sGC activity mea- sGC expression attenuates vascular dilation and contributes to sured by cGMP production following stimulation with an NO molpharm.aspetjournals.org the pathogenesis of cardiovascular disease. However, it is not donor. -
A Rare Variant of ANK3 Is Associated with Intracranial Aneurysm
ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fneur.2021.672570 A Rare Variant of ANK3 Is Associated With Intracranial Aneurysm Junyu Liu 1, Xin Liao 2,3, Jilin Zhou 1, Bingyang Li 2, Lu Xu 1, Songlin Liu 1, Yifeng Li 1, Dun Yuan 1, Chongyu Hu 4, Weixi Jiang 1* and Junxia Yan 2,5* 1 Department of Neurosurgery, Xiangya Hospital, Central South University, Changsha, China, 2 Department of Epidemiology and Health Statistics, Xiangya School of Public Health, Central South University, Changsha, China, 3 The People’s Hospital of Guangxi Zhuang Autonomous Region, Nanning, China, 4 Department of Neurology, Hunan People’s Hospital, Changsha, China, 5 Hunan Provincial Key Laboratory of Clinical Epidemiology, Xiangya School of Public Health, Central South University, Changsha, China Intracranial aneurysm (IA) is a cerebrovascular disorder in which abnormal dilation of a blood vessel results from weakening of the blood vessel wall. The aneurysm may rupture, leading to subarachnoid hemorrhage with severe outcomes. This study was conducted to identify the genetic factors involved in the etiology of IA. Whole-exome sequencing was performed in three IA-aggregate families to identify candidate variants. Further association studies of candidate variants were performed among sporadic cases Edited by: and controls. Bioinformatic analysis was used to predict the functions of candidate Osama O. Zaidat, genes and variants. Twenty variants were identified after whole-exome sequencing, Northeast Ohio Medical University, among which eight were selected for replicative association studies. ANK3 c.4403G>A United States (p.R1468H) was significantly associated with IA (odds ratio 4.77; 95% confidence interval Reviewed by: Basil Erwin Grüter, 1.94–11.67; p-value = 0.00019). -
GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574
Figure S1. Boxplots of normalized samples in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. The x‑axes indicate samples, and the y‑axes represent the expression of genes. Figure S2. Volanco plots of DEGs in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. Red nodes represent upregulated DEGs and green nodes indicate downregulated DEGs. Cut‑off criteria were P<0.05 and |log2 FC|>1. DEGs, differentially expressed genes; FC, fold change; adj.P.Val, adjusted P‑value. Figure S3. Transcription factor‑gene regulatory network constructed using the Cytoscape iRegulion plug‑in. Table SI. Primer sequences for reverse transcription‑quantitative polymerase chain reaction. Genes Sequences hsa‑miR‑124 F: 5'‑ACACTCCAGCTGGGCAGCAGCAATTCATGTTT‑3' R: 5'‑CTCAACTGGTGTCGTGGA‑3' hsa‑miR‑330‑3p F: 5'‑CATGAATTCACTCTCCCCGTTTCTCCCTCTGC‑3' R: 5'‑CCTGCGGCCGCGAGCCGCCCTGTTTGTCTGAG‑3' hsa‑miR‑34a‑5p F: 5'‑TGGCAGTGTCTTAGCTGGTTGT‑3' R: 5'‑GCGAGCACAGAATTAATACGAC‑3' hsa‑miR‑449a F: 5'‑TGCGGTGGCAGTGTATTGTTAGC‑3' R: 5'‑CCAGTGCAGGGTCCGAGGT‑3' CD44 F: 5'‑CGGACACCATGGACAAGTTT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' PCNA F: 5'‑GAACTGGTTCATTCATCTCTATGG‑3' F: 5'‑TGTCACAGACAAGTAATGTCGATAAA‑3' SYT1 F: 5'‑CAATAGCCATAGTCGCAGTCCT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' U6 F: 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' R: 5'‑CGCTTCACGAATTTGCGTGTCAT‑3' GAPDH F: 5'‑GGAAAGCTGTGGCGTGAT‑3' R: 5'‑AAGGTGGAAGAATGGGAGTT‑3' hsa, homo sapiens; miR, microRNA; CD44, CD44 molecule (Indian blood group); PCNA, proliferating cell nuclear antigen; -
Characterisation of the Potential of Probiotics Or Their Extracts As Therapy for Skin
Characterisation of the potential of probiotics or their extracts as therapy for skin A thesis submitted to the University of Manchester for the Degree of Doctor of Philosophy in the Faculty of Medical and Human Sciences 2014 Walaa Mohammedsaeed, Master of Science (MSc) School of Medicine Table of Contents Contents Table of Contents .............................................................................................................. 2 Table of Figures ................................................................................................................ 5 List of Tables .................................................................................................................... 8 List of Abbreviations ........................................................................................................ 9 1 Abstract ....................................................................................................................... 11 2 Declaration .................................................................................................................. 12 3 Copyright Statement .................................................................................................... 13 4 Acknowledgements ...................................................................................................... 14 5 The author ................................................................................................................... 15 6 Publications arising from this Thesis ........................................................................... -
ADAMTS12 Acts As a Tumor Microenvironment Related Cancer Promoter in Gastric Cancer Yangming Hou1, Yingjuan Xu2 & Dequan Wu1*
www.nature.com/scientificreports OPEN ADAMTS12 acts as a tumor microenvironment related cancer promoter in gastric cancer Yangming Hou1, Yingjuan Xu2 & Dequan Wu1* The infltration degree of immune and stromal cells has been shown clinically signifcant in tumor microenvironment (TME). However, the utility of stromal and immune components in Gastric cancer (GC) has not been investigated in detail. In the present study, ESTIMATE and CIBERSORT algorithms were applied to calculate the immune/stromal scores and the proportion of tumor-infltrating immune cell (TIC) in GC cohort, including 415 cases from The Cancer Genome Atlas (TCGA) database. The diferentially expressed genes (DEGs) were screened by Cox proportional hazard regression analysis and protein–protein interaction (PPI) network construction. Then ADAMTS12 was regarded as one of the most predictive factors. Further analysis showed that ADAMTS12 expression was signifcantly higher in tumor samples and correlated with poor prognosis. Gene Set Enrichment Analysis (GSEA) indicated that in high ADAMTS12 expression group gene sets were mainly enriched in cancer and immune-related activities. In the low ADAMTS12 expression group, the genes were enriched in the oxidative phosphorylation pathway. CIBERSORT analysis for the proportion of TICs revealed that ADAMTS12 expression was positively correlated with Macrophages M0/M1/M2 and negatively correlated with T cells follicular helper. Therefore, ADAMTS12 might be a tumor promoter and responsible for TME status and tumor energy metabolic conversion. According to the latest global cancer epidemic statistics (GLOBOCAN), gastric cancer (GC) is the third lead- ing cause of cancer related death worldwide1,2. GC patients are frequently diagnosed at advanced stage with the fve-year survival rate less than 20%3. -
Supplemental Material
Supplemental Table 1. Genes activated by alcohol in cultured cortical neurons, as assessed by micro-array analysis. Gene Description Genbank Acc No Folds of increase Gpnmb glycoprotein (transmembrane) nmb NM_053110 2.58 Lyzs lysozyme NM_017372 2.36 Gpnmb glycoprotein (transmembrane) nmb NM_053110 2.33 Gpnmb glycoprotein (transmembrane) nmb NM_053110 2.27 Gpm6a glycoprotein m6a NM_153581 2.05 Mtap1b microtubule-associated protein 1 B NM_008634 2.00 Gfap glial fibrillary acidic protein NM_010277 1.94 C1qg complement component 1, q subcomponent, C chain NM_007574 1.90 C1qb complement component 1, q subcomponent, beta polypeptide, mRNA NM_009777 1.87 Laptm5 lysosomal-associated protein transmembrane 5 NM_010686 1.82 Apoc1 apolipoprotein C-I NM_007469 1.81 Lgals3 lectin, galactose binding, soluble 3 NM_010705 1.81 Fcer1g Fc receptor, IgE, high affinity I, gamma polypeptide NM_010185 1.81 Cd68 CD68 antigen NM_009853 1.81 Apoe apolipoprotein E NM_009696 1.76 C1qa complement component 1, q subcomponent, alpha polypeptide NM_007572 1.75 Lgmn legumain NM_011175 1.74 Msr2 macrophage scavenger receptor 2 NM_030707 1.72 Trem2 triggering receptor expressed on myeloid cells 2 NM_031254 1.72 Serpina3n serine (or cysteine) peptidase inhibitor, clade A, member 3N NM_009252 1.71 Igf1 insulin-like growth factor 1, transcript variant 1 NM_010512 1.71 Ctsz cathepsin Z NM_022325 1.71 Adfp adipose differentiation related protein NM_007408 1.69 Pdgfra platelet derived growth factor receptor, alpha polypeptide NM_011058 1.67 Mmp12 matrix metallopeptidase 12 NM_008605 -
GUCY1B3 Antibody Cat
GUCY1B3 Antibody Cat. No.: 26-093 GUCY1B3 Antibody Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Dog, Human, Mouse Antibody produced in rabbits immunized with a synthetic peptide corresponding a region IMMUNOGEN: of human GUCY1B3. TESTED APPLICATIONS: ELISA, WB GUCY1B3 antibody can be used for detection of GUCY1B3 by ELISA at 1:12500. GUCY1B3 APPLICATIONS: antibody can be used for detection of GUCY1B3 by western blot at 1 μg/mL, and HRP conjugated secondary antibody should be diluted 1:50,000 - 100,000. POSITIVE CONTROL: 1) 293T Cell Lysate PREDICTED MOLECULAR 70 kDa WEIGHT: Properties PURIFICATION: Antibody is purified by peptide affinity chromatography method. CLONALITY: Polyclonal CONJUGATE: Unconjugated PHYSICAL STATE: Liquid September 25, 2021 1 https://www.prosci-inc.com/gucy1b3-antibody-26-093.html Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% BUFFER: sucrose. CONCENTRATION: batch dependent For short periods of storage (days) store at 4˚C. For longer periods of storage, store STORAGE CONDITIONS: GUCY1B3 antibody at -20˚C. As with any antibody avoid repeat freeze-thaw cycles. Additional Info OFFICIAL SYMBOL: GUCY1B3 ALTERNATE NAMES: GUCY1B3, GC-S-beta-1, GC-SB3, GUC1B3, GUCB3, GUCSB3, GUCY1B1 ACCESSION NO.: NP_000848 PROTEIN GI NO.: 4504215 GENE ID: 2983 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References Soluble guanylate cyclase (sGC), a heterodimeric protein consisting of an alpha subunit and a beta subunit, typically GUCY1B3, catalyzes conversion of GTP to the second messenger cGMP and functions as the main receptor for nitric oxide (NO) and nitrovasodilator drugs (Zabel et al., 1998 [PubMed 9742212]).Soluble guanylate cyclase BACKGROUND: (sGC), a heterodimeric protein consisting of an alpha subunit and a beta subunit, typically GUCY1B3, catalyzes conversion of GTP to the second messenger cGMP and functions as the main receptor for nitric oxide (NO) and nitrovasodilator drugs (Zabel et al., 1998 [PubMed 9742212]).