A STUDY OF CERTAIN ASPECTS OF HUMAN GENETICS INCLUDING CONSANGUINITY AND GENETIC DISORDERS IN HUMAN POPULATION OF DG KHAN

By

MUHAMMAD AMIN UD DIN

THESIS SUBMITTED TO BAHAUDDIN ZAKARIYA UNIVERSITY

FOR

THE DEGREE OF DOCTOR OF PHILOSOPHY 2007

INSTITUTE OF PURE AND APPLIED BIOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY, MULTAN, PAKISTAN

In the name of Allah The most compassionate The most Merciful, the most Beneficent

Dedicated

To

My parents Contents

S.NO CONTENTS Page NO

1 Acknowledgments I

2 List of Acronyms III

3 List of Tables V

4 List of Figures VII

5 Abstract XV

6 Chapter 1: Introduction

• Preamble 1

• Consanguinity 2

• Genetic Disorders 6

9 • Dera Ghazi Khan 12 • Objectives of the Study 7 Chapter 2: Materials And Methods

15 • Data Collection 15 • Ethnicity 16 • Couple’s Relationship and Marriage Types 16 • Educational Status 16 • Socio-economic Status of Husband 17 • Occupational Status 17 • Pregnancy, Mortality, Morbidity 17 • Consanguinity and Genetic Disorders 17 • Families Studied 18 • Clinical Study 18 • Blood Sampling

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Contents

19 • Genomic DNA Extraction 19 • Polymerase Chain Reaction (PCR) 20 • Horizontal Gel Electrophoresis 20 • Vertical Gel Electrophoresis 20 • Genotyping 21 • Linkage Studies 21 • Mutation analysis 22 • Amplification Refractory Mutation System-PCR 22 • Multiplex ARMS- PCR 23 • Data Analyses 8 Chapter 3: Consanguinity 31 • Introduction 32 • Materials and Methods 32 • Results 32 1. Data Collection 32 2. Marriages 32 2.1. Endogamous and Exogamous Marriages 33 2.2. Distribution of Marriage Types 33 2.3. First Cousin Marriages, Sub-Types 33 2.4. Consanguineous Marriages 34 2.5. Trend of Consanguinity 34 2.6. Mean Inbreeding Coefficient (F) 34 3. Factors Effecting Rate of Consanguinity 35 3.1. Male Education 35 3.1.1. Marriage Types and Male Education

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Contents

36 3.1.2. Consanguinity and Male Education 35 3.2. Female Education 37 3.2.1. Marriage Types and Female Education 37 3.2.2. Consanguinity and Female Education 38 3.3. Male Socioeconomic Status 38 3.3.1. Marriage Types and male Socioeconomic Status 39 3.3.2. Consanguinity and male Socioeconomic Status 40 3.4. Male Occupation 40 3.4.1. Marriage Types and Male Occupation 40 3.4.2. Consanguinity and Male Occupation 41 4. Effects of Consanguinity 41 4.1. Reproductive Outputs 41 4.1.1. Pregnancies 42 4.1.2. Pregnancy loss 43 4.1. 3. Perinatal deaths 44 4.1.4. Infant deaths 44 4.2. Genetic Disorders 46 • Discussion 9 Chapter 4: Skin Disorders

• Introduction 70

• Ectodermal dysplasia 71

• Alopecia 71

• Families Studied 73

• Linkage Studies 77

• Mutation Screening 78

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Contents

• Discussion 78 10 Chapter 5: Non-syndromic Deafness

• Introduction 98

• Families Studied 100

• Linkage Studies 102

• Mutation Screening 103

• Discussion 103 11 Chapter 6: β-Thalassemia

• Introduction 115

• Subjects Studied 116

• Molecular Analysis 117

• Ethnic Distribution of β-Thalassemia Mutations 117

• Distribution of β-Thalassemia mutations in various 118 castes

• Regional Distribution of β- Thalassemia Mutations 118

• Discussion 119 12 Chapter 7: References 129

• Electronic Database Information 151 • Government Documents

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Acknowledgments

ACKNOWLEDGMENTS

It is a pleasure to thank the many people who made this thesis possible. Firstly, I take this opportunity to express my gratitude to my supervisor, Professor Dr. Abdus Salam, Institute of Pure and Applied Biology, Bahauddin Zakariya University Multan, under whose benign supervision and able guidance, this research work was done. His affectionate attitude and great devotion encouraged me at different moments of my studies.

I offer my humble gratefulness to my Co-supervisor Professor Dr. Wasim Ahmad, Chairman Department of Biochemistry, Quaid-i-Azam University Islamabad.Throughout my research and thesis-writing period, he provided sound advice, affable company, lots of good ideas, and provided the laboratory facilities. His continuous encouragement enables me to achieve my goals.

I wish to extend my heartiest thanks to Professor Dr. Javed Iqbal Mirza, Director, Institute of Pure and Applied Biology, Bahauddin Zakariya University Multan, for providence of facilities during present work.

I am highly grateful to venerable Dr, Shahid Mahmood Baig (Principal Scientist), NIBGE, Faisalabad for his unconditional academic and technical support especially in molecular studies of thalassemia. I am deeply indebted to Prof Dr Saqlain Naqvi (Chairman Dept of Biochem, UAAR), Dr Arshad Rafiq (Assist Prof. Comsat IBD), Dr Ansar (Assist Prof.), Peter John (PhD scholar) and Jawad Hassan (PhD scholar) QAU Islamabad, for their great help, valuable suggestions, cooperation and collaboration during this study.

I am thankful to Dr Sajid Malik, Dr Najeeb Haider, Mr. Rab Nawaz Khan Jalabani, and Ghulam Hussain Khosa who took pains in rechecking statistical results and proof reading the thesis. I am also grateful to my research fellows, Mr. Imran Khaliq, Mr. A B Gulshan, Mr.Shazad Jhangir, Mr. Qazi Abdul Ghafoor, Mr.M. Sharif and Mr. Wajahat Ali for their unforgettable cooperation in every event of this study like traveling, collection of families and photography.

I’m also obliged to all the people on whom this research was conducted for their participation and cooperation.

I ------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Acknowledgments

I convey my heartiest and sincerest acknowledgements to my friends, Late Dr. Shaheen Akhter (IBD), Prof. Dr Sardar Nasim Khan (AJKU), Dr Naeem (BZU), Mr. Sayed-ul-Haque (T&R Assistant, QAU), Mr. Abdul Wahab Khan (NWFP) and college colleagues Prof. Fayyaz Ahmad (Principal), Haji Akber Chandia, Mr. M. Anwar, Mr Mustafa Leighari, Mr.Iqbal Shah, Mr. Nasim chandia, Dr Rab Nawaz Monis, Mr. G M A Ghani, and Mr. Khalil Akbar for their pleasant company and valuable help.

I owe my gratitude to my wife, children, and brothers who gave me their maximum cooperation and moral support during this study.

Finally, I wish to thank ‘The Higher Education Commission (HEC)’, Islamabad Pakistan, for providing funds for research work presented in the thesis.

Muhammad Amin ud Din September 2007

II ------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Acronyms

List of Acronyms

AA Alopecia Areata APL Atrichia with Papular Lesions APMR Alopecia with Mental Retardation ARMS-PCR Amplification Refractory Mutation System-PCR bp Base Pair cM CentiMorgans CM Consanguineous Marriage DFC Double First Cousin DGKhan Dera Ghazi Khan dNTP Deoxynucleoside triphosphate DP Dermal Papilla DR Distantly Related DSC Desmocollin DSG Desmoglein EDAR Ectodysplasin 1 Anhidrotic Receptor EDTA Ethylendiamintetraacetic acid EVPL Envoplakin FBD Father’s Brother Daughter FC First Cousin FCOR First Cousin Once Removed FSD Father’s Sister Daughter GJB6 Gap Junction Beta-6 HJMD Hypotrichosis Congenital with Juvenile Macular Dystrophy HR Hairless HTTS Hypotrichosis Simplex of Scalp kb Kilo base LAH Localized Autosomal Recessive Hypotrichosis MBD Mother’s Brother Daughter mg Milligram

------III A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Acronyms

MSD Mother’s Sister Daughter NCM Non Consanguineous Marriage NETH Netherton Syndrome ng Nano Gram NR Non Related rpm Revolution Per Minute SC Second Cousin SCOR Second Cousin Once Removed Taq Thermophillus aquaticus TBE Tris-Borate EDTA TGM Transglutaminase TE Tris-EDTA UV Ultra violet μl Micro liter

------IV A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Tables

List of Tables

Page Table No Title No

1.1 Population Stratification of Dera Ghazi Khan District 14

2.1 List of microsatellite markers used to test linkage to candidate 24 gene loci in families F and G

2.2 List of autosomal recessive nonsyndromic deafness loci tested for 26 linkage in the present study

2.3 Sequences of the primers used for PCR amplification of exons 2- 28 19 of the human hairless (HR) gene

2.4 Primers for PCR amplification of GJB2 gene exon 2 29

2.5 Oligonucleotide sequences of ARMS primers 30

3.1 Data summary on basis of Ethnicity and Tehsils 51

3.2 The comparison of Endogamous and Exogamous marriages 51 between Baloch, Migrant and Native couples from Dera Ghazi Khan Population

3.3 Distribution of marriage types in Baloch, Migrant and Native 52

3.4 Distribution of various types of first cousin marriages among 52 Baloch, Migrant and Native samples

3.5 Comparison of consanguineous and non-consanguineous 53 marriages in Baloch, Migrant and Native

3.6 Distribution of consanguineous and non-consanguineous 53 marriages among Baloch, Migrant and Native over the time

3.7 The comparison of inbreeding coefficient in Dera Ghazi Khan 54

------V A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Tables

with various other Pakistani populations

3.8 Distribution of marriage types with respect to the husband’s 55 educational level at time of marriage

3.9 Mean inbreeding coefficient (F), consanguineous and non- 57 consanguineous marriages with respect to husband’s education

3.10 Distribution of marriage types with respect to the female’s 58 educational level at time of marriage

3.11 Mean inbreeding coefficient (F), consanguineous and non- 60 consanguineous marriages with respect to husband’s education

3.12 Distribution of various marriage types with respect to the 61 husband’s socioeconomic status at the time of marriage

3.13 Mean inbreeding coefficient (F), consanguineous and non- 63 consanguineous marriages with respect to socioeconomic status

3.14 Distribution of marriage types with respect to the husband’s 64 occupational groups

3.15 Mean inbreeding coefficient (F), consanguineous and non- 66 consanguineous marriages with respect to husband’s occupational group

3.16 Distribution of mean pregnancies, pregnancy loss, perinatal and 67 infant death among consanguineous and non-consanguineous couple in Baloch, Migrants and Natives

3.17 Data Collection Summary of Afflicted Couples 68

3.18 Distribution of endogamous and exogamous marriages among 68 afflicted couples with respect to the disorder

------VI A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Tables

3.19 Distribution of Consanguineous and Non-consanguineous 69 marriages and mean (F) values among afflicted couples with respect to the Disorder

3.20 Comparison of Consanguineous and Non-consanguineous 69 marriages between general couple and afflicted couples of Baloch, Migrant and Native

6.1 Ethnic distribution of families affected with thalassemia disorder 122 in Dera Ghazi Khan

6.2 Frequency of -thalassemia mutations in the population (164 124 Alleles)

6.3 Frequency of -thalassemia mutations in the patients 124

6.4 Frequency of β-thalassemia Mutations in ethnic groups 125

6.5 Representation of various mutation/s in different castes and sub- 126 tribes

6.6 Geographical distribution of β-thalassemia Mutations 127

6.7 Regional comparison of Frequency of β-thalassemia Mutations 128

------VII A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Figures

List of Figures

Page Figure No Title No

1.1 Map of Dera Ghazi Khan District 13

3.1 Distribution of marriage types with respect to husband’s 56 education

3.2 Husband’s education vs. consanguinity and Mean (F) 56

3.3 Distribution of marriage types with respect to female education 59

3.4 Female’s education vs. consanguinity and Mean (F) 59

3.5 Distribution of marriage types with respect to husband’s 62 socioeconomic status

3.6 Husband’s socioeconomic status vs. consanguinity and Mean (F) 62

3.7 Distribution of marriage types with respect to husband’s 65 occupational groups

3.8 Husband’s occupational group vs. consanguinity and Mean (F) 65

4.1 Pedigree of family A with ectodermal dysplasia showing 81 autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals

4.2 Clinical findings in an affected individual (IV-5) of family A. 82 Anonychia of toenails (a) dystrophic fingernails (b)

4.3 Pedigree of family B with ectodermal dysplasia showing 83 autosomal recessive mode of inheritance. Circles represent

------VIII A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Figures

females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

4.4 Clinical findings in an affected individual (IV-2) of family B. 84 Dystrophic fingernails (a) toenails showing anonychia (b).

4.5 Pedigree of family C with ectodermal dysplasia showing 85 autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals.

4.6 Clinical findings in an affected individual (V-4) of family C. 86 Dystrophic fingernails (a) and toenails (b).

4.7 Pedigree of family D with ectodermal dysplasia showing 87 autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

4.8 Clinical findings in an affected individual (VI-8) of family D. 88 Severely dystrophic fingernails (a) and anonychia in toenails (c). Thumb image of an affected individual (V-5) (b) finger print missing (d).

4.9 Pedigree of family E with ectodermal dysplasia showing 89 autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals.

4.10 Clinical findings in an affected individual (IV-3) of family E. 90 Severely dystrophic fingernails (a) and toenails showing anonychia (b), along with severely stretched skin (a, b).

------IX A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Figures

Palmoplanter is visible in the lower panel (c).

4.11 Pedigree of family F with congenital alopecia showing autosomal 91 recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

4.12 Clinical findings in congenital atrichia. Phenotypic appearance of 92 an affected individual (V-7) of family F at 10 years of age, with complete scalp atrichia and absence of eyebrows and eyelashes. Few skin colored papules are present on face and scalp.

4.13 Pedigree of family G with congenital alopecia showing autosomal 93 recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

4.14 Clinical findings in congenital alopecia. Phenotypic appearance 94 of an affected male (V-2) in family G at 25 years of age. Note the complete absence of scalp hair with sparse eye brows and eye lashes and beard hair.

4.15 Representative chromatograms generated by Big Dye terminator 95 sequencing of exon 2 of the hairless gene from controls individual (A), a heterozygous carrier (B), and a homozygous (affected) individuals (C). The arrow indicates a homozygous deletion of a nucleotide C at position 431, resulting in frame shift premature termination codon 68 bp downstream in the same exon.

4.16 Pedigree of family G. Haplotypes for the STS markers tightly 96 linked to known ectodermal dysplasia and alopecias loci. The

------X A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Figures

alleles are denoted 1-2 according to their sizes.

4.17 Pedigree of family G. Haplotypes for the STS markers tightly 97 linked to known ectodermal dysplasia and alopecias loci. The alleles are denoted 1-3 according to their sizes.

5.1 Pedigree of the family H with non-syndromic autosomal 107 recessive hearing loss. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

5.2 Pedigree of the family I with non-syndromic autosomal recessive 107 hearing loss. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

5.3 Pedigree of the family J with non-syndromic autosomal recessive 108 hearing loss. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

5.4 Electropherogram of the ethidium bromide stained 8% non- 109 denaturing polyacrylamide gel showing allele pattern obtained with marker D14S43, and linked to DFNB35 locus on chromosome 14. All the affected individuals (IV-1, IV-2, IV-4, V-1) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

5.5 Electropherogram of the ethidium bromide stained 8% non- 109 denaturing polyacrylamide gel showing allele pattern obtained with marker D14S77, and linked to DFNB35 locus on chromosome 14. All the affected individuals (IV-1, IV-2, IV-4, V-1) are homozygous for the common allele. The Roman with

------XI A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Figures

Arabic numerals refers to the individuals in the pedigree.

5.6 Electropherogram of the ethidium bromide stained 8% non- 110 denaturing polyacrylamide gel showing allele pattern obtained with marker D14S588, and linked to DFNB35 locus on chromosome 14. All the affected individuals (IV-1, IV-2, IV-4, V-1) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

5.7 Electropherogram of the ethidium bromide stained 8% non- 110 denaturing polyacrylamide gel showing allele pattern obtained with marker D7S1818, and linked to DFNB44 locus on chromosome 7. All the affected individuals (V-1, V-2, V-3, V-5) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

5.8 Electropherogram of the ethidium bromide stained 8% non- 111 denaturing polyacrylamide gel showing allele pattern obtained with marker D7S2469, and linked to DFNB44 locus on chromosome 7. All the affected individuals (V-1, V-2, V-3, V-5) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

5.9 Electropherogram of the ethidium bromide stained 8% non- 111 denaturing polyacrylamide gel showing allele pattern obtained with marker D7S2209, and linked to DFNB44 locus on chromosome 7. All the affected individuals (V-1, V-2, V-3, V-5) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

5.10 Electropherogram of the ethidium bromide stained 8% non- 112 denaturing polyacrylamide gel showing allele pattern obtained with marker D13S143, and linked to DFNB1 locus on

------XII A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Figures

chromosome 13. All the affected individuals (V-1, V-2, V-3) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

5.11 Electropherogram of the ethidium bromide stained 8% non- 112 denaturing polyacrylamide gel showing allele pattern obtained with marker D13S143, and linked to DFNB1 locus on chromosome 13. All the affected individuals (V-1, V-2, V-3) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

5.12 Electropherogram of the ethidium bromide stained 8% non- 113 denaturing polyacrylamide gel showing allele pattern obtained with marker D13S115, and linked to DFNB1 locus on chromosome 13. All the affected individuals (V-1, V-2, V-3) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree

5.13 Representative chromatograms generated by Big Dye Terminator 114 sequencing of coding exon of GJB2 gene from homozygous affected individuals (Panel A), a control normal individual (Panel B) and heterozygous carrier (Panel C) of family C. The arrow in panel A indicates a G-to-A substitution at nucleotide position 71, resulting in a premature stop codon (W24X). A double arrow in panel C is indicative of heterozygous sequence in carrier.

6.1 Photograph of agarose gel showing the analysis for IVS-I-5 (G-C) 123 mutation. Lane 1: control homozygote; lane 2: heterozygote; lane 3: control normal for this mutation; lanes 4, 9, and 12 samples are heterozygote; lanes 6 and 7 samples are homozygous while lanes 5, 10, and 11 are negative for IVS-I-5 mutation.

------XIII A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

List of Figures

6.2 Photograph showing Multiplex ARMS–PCR and gel 123 electrophoresis analysis for the most common mutations IVS -I - 5, FSC-8/9 (+G) and FSC-41/42 mutations. lane 1: control Homozygous for IVS I-5, Lane 2: compound heterozygote for IVS I-5 and FSC-8/9; lane 3: control compound heterozygote for FSC-8/9 and FSC-41/42 ; lanes 4: homozygous for IVS I-5; 6 & 10 are heterozygous for FSC-8/9 ; 7 is compound heterozygous sample for FSC-8/9 and FSC-41/42; 9 & 12 are heterozygous for IVS- I-5; while 5, 8 & 11 samples are negative for these mutations.

------XIV A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Abstract

ABSTRACT

The consanguineous marriages are strongly favored in many human populations but their prevalence and structure vary depending on culture, religion, and socioeconomic conditions of respective population. These marriages are reported as the leading cause of enhancing the prevalence of autosomal recessive genetic disorders.

The challenge of genetic disorders’ burden in the population calls for the development of prevention programs. But the strategies for their implementation require the information about types and prevalence of genetic disorders and family system in population. These achievements are possible by thorough understanding of the determinants of human population genetic structure that is mainly determined by the marriage pattern. Furthermore, the pattern of close marriages in population along with other factors leads to develop the isolated groups having typically confined, well- documented, extended and multigenerational pedigrees. The extended pedigrees with rare disorders are used by geneticists for their linkage studies. Present study focuses on consanguinity and genetic disorders in the population of District Dera Ghazi Khan, Punjab, Pakistan because of its unique geographical location and population structure.

The district Dera Ghazi Khan is situated in the center of Pakistan, bounded on the North by Dera Ismail Khan District of N.W.F.P; on the West by Musa Khel and Barkhan districts of Baluchistan, on the South by Rajan Pur, and on the East by river Indus that separates it from all other districts of Punjab province. The population of Dera Ghazi Khan is mainly a tri-ethnic mixture of Baloch, Natives (Non-Baloch) and Indian Migrants (Muhajirs). Social and cultural activities vary in the area but marriages are mostly endogamous within caste or tribes. The harsh and adverse environmental condition restricts the movement of people that result in development of extended families /founder population.

The present study showed 70.52% endogamous marriages in the general population and 71.62%, 69.62%, and 70.42% in Baloch, Migrant, and Native populations, respectively. Furthermore high rate of consanguinity (53.57%) with 0.0301 mean coefficient of inbreeding was observed in general population. The first-cousin marriages were found more prevalent. The results were also discussed on the bases of educational status, occupation, and socioeconomic condition and a strong link with these factors was

XV ------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Abstract

observed. Furthermore, statistically significant effect of consanguinity on pregnancy loss (miscarriages, abortions, prenatal deaths), and perinatal deaths (still births, birth of dead child and early neonatal deaths) were found. In addition, the effect of marriage types on specific group of genetic disorders like skin disorders (Albinism, EDs, Alopecia, Aposthia, etc), non-syndromic deafness, and thalassemia were also studied.

Five families (A, B, C, D, and E) clinically showed the presence of abnormal nails and skin. In the affected individuals, nychodystrophy of fingernails and toenails started at the same time but differentially lead to anonychia on toenails and onycholysis on fingernails. The skin was abnormal, which bruises and blisters easily. The affected individuals of these skin families showed abnormally high sweating, missing finger-prints and palmoplantar keratoderma. Two families (F, G) exhibited typical features of congenital alopecia including absence of hair on the scalp, axillae, pubic, and other parts of the body. In Family F, linkage was established to hair loss locus on chromosome 8p21. Sequence analysis of HR gene revealed a single base pair deletion mutation at position 431(431delC) in exon 2, leading to frameshifts and premature termination codon 68 bp downstream in the same exon. In family G, genotyping with microsatellite markers failed to detect linkage to any of the known alopecia / ED locus.

In three families (H, I, J) affected individuals had pre-lingual, severe to profound hearing loss, with no associated abnormality. The mode of inheritance of the hearing loss was autosomal recessive. Analysis of the genotypes revealed the linkage of the family H to the DFNB35 on chromosome 14, family I, to the locus DFNB44 on chromosome 7, and family J to the DFNB1 locus on chromosome 13. In family J, sequence analysis of the coding exon of GJB2 gene led to the identification of a G-to-A substitution at nucleotide position 71, resulting in a premature stop codon (W24X).

For studying the spectrum of β-thalassemia mutations in the population, 164 β- thalassemia chromosomes obtained from 82 different families were analyzed and nine different mutations [IVS I-5, FSC8/9, FSC-5 (-CT), IVS-I-1(G-T), CD41/42 (-TTCT), IVS-II-848 (C-A) and CD 15 (G-A), CD16 (-C) and CD30 (G-C)] in the β-globin gene were detected. Interestingly, frequencies of these mutations vary among different ethnic groups as well as castes/ tribes.

XVI ------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 1 Introduction

INTRODUCTION

Preamble

Human population is characterized by a number of parameters including anthropometric polymorphisms, mating types (assortative or consanguineous marriages), birth rate, morbidity, frequencies of genetic disorders, mortality, socioeconomic diversity, migration, and geographical situations mostly interlinked with each other (Bassi and Freire-Maia, 1985).

Among these population parameters, consanguineous marriages are customary in various human societies that lead to an increased prevalence of severe genetic disorders (Modell and Darr, 2002). Hence, consanguinity and genetic disorders, being related to serious health problems, are always considered most important in genetic studies (Shami et al., 1989; Bittles, 2002).

Genetic disorders are found almost in every human population though their nature, prevalence and distribution vary in different regions of the world (El-Hazmi, 1999). These disorders are one of the leading causes of infant mortality in certain countries like Saudi Arabia, United Arab Emirates, Bahrain, Kuwait, Oman and Qatar (Hamamy and Alwan, 1997). Consequently, the genetic disorders impose a heavy medical, financial and emotional burden on the affected individuals, their families and societies, as well as on the country (Abdel-Meguid et al., 2000).

The magnitude of impact of the genetic disorders in human populations is attributed to various factors like high birth rate, large family size, and advance parental ages. Additionally, the lack of public health measures, the dearth of genetic counseling services and inadequate health care prior to and during pregnancy, are playing major role in increasing the genetic disorders in the populations (Al-Ghazali et al., 2006).

Therefore, the challenge of genetic disorder’s burden in these populations calls for the development of prevention programs. But the strategies for their implementation primarily require epidemiological surveys, including the information about types and prevalence of genetic disorders, family history and genetic risks estimate within the population (Alwan and Modell, 1997; Al-Arrayed, 1999). These achievements are possible by thorough understanding of the determinants of human population genetic structure (Bittles, 2005).

------1 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction

Genetic structure of human population does not remain stable for longer time because it is mainly determined by geography, history and culture. The marriage patterns translate the effect of these factors in the biological phenomenon through times (Burchard et al., 2003). Furthermore the consanguineous marriages have significant implication for increased rate of recessive genetic disorders (Bittles, 2005; Al-Gazali, 2005). In addition high rate of consanguinity in population along with other factors such as religion, ethnicity, language, geography etc, usually lead to create genetically isolated groups in which typically confined, well-documented, extended and multigenerational pedigrees with several cases of rare disease are expected (Peltonen et al., 2000; Bittles, 2001).

The extended pedigrees were readily used by geneticists for their linkage studies and have proved it a successful approach in mapping many monogenic autosomal recessive disorders. In this regard, various isolated populations such as the Finnish, Amish, Hutterite, Sardinian, and certain Jewish communities have played prominent role in identifying the novel mutations in monogenic recessive disorders (Peltonen et al., 2000). Nowadays, such type of the isolated populations are the interest of various gene mapping consortia and biotechnology companies.

The huge population of Indian sub-continent (Pakistan, India and Bangladesh) also provides an opportunity for studies of genetic disorders (Gadgil et al., 1998). But the population of Pakistan (over 140 million) is the goldmine for these studies due to its unique geography and history. In addition, it is an admixture of diverse ethnicities with unique familial and social characteristics (Mehdi et al., 1999).

The present study intends to explain the association of consanguinity and genetic disorders with reference to population of Dera Ghazi Khan District in the Punjab province of Pakistan.

Consanguinity

The consanguineous marriages are strongly favored in many human populations, belonging to various parts of North and sub-Saharan Africa, the Middle East, and West, Central and South Asia while less than 0.5% consanguinity is reported in Europe, North America and Australasia (Bittles, 1998).

Variation in consanguinity rates (11 to 58%) were observed by different studies in Muslim and neighboring countries of Pakistan, while the highest rate of consanguinity (61.3%) was reported in Pakistan (Al-Nassar et al., 1989; Bittles et al., 1991; Banerjee

------2 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction and Roy, 1996; Hussain and Bittles, 1998; Jurdi and Saxena, 2003; Nath et al., 2004; Kushki and Zeyghani, 2005). Furthermore, like other muslim countries, first cousin unions were found the most abundant among the various types of consanguineous marriages in Pakistan (Hussain and Bittles, 1998).

In addition, among first cousin union, the specific pattern based on marriage of a man with his: father’s brother daughter (FBD), mother’s brother daughter (MBD), father’s sister daughter (FSD), and mother’s sister daughter (MSD), is variously favored. For example, in Muslims, FBD is preferred in Arabs (Bittles, 1991) while FBD and FSD are considered incestuous in Bosnia and Sudan, respectively (Lockwood, 1972). Among other populations as Dravidian Hindus of South India (Rao and Inbaraj, 1977) and Han Chinese (Cooper and Zhang, 1993), MBD marriages were commonly reported. However in North India, MBD and FSD marriages were favored by Hindus (Hussain and Bittles, 1998). Overall, the patrilateral first cousin marriages were found the most prevalent among Muslims as compared to Hindus (Teebi, 1994; Hussain and Bittles, 1998).

In Pakistan, patrilateral first cousin marriages were found in common (Hussain and Bittles, 1998). But a few regional reports also vary e.g. (FBD) > (FSD) > (MBD) > (MSD) in Rawalpindi (Shami and Siddiqui, 1984) and (MSD) > (FBD) > (MBD) > (FSD) in Karachi, (Hussain and Bittles, 1998).

Furthermore, variation in rate of consanguinity with passage of time was reported by a number of studies. Mostly a declining trend is observed (Bouazzaoui, 1994; Gonzalez-Martin 2002) but increasing trend was also recorded in United Arab Emirates (AL-Gazali et al., 1997) while no appreciable change in this regard was observed in Pakistan over the past four decades (Hussain and Bittles, 1998).

In addition, various studies have found the mean inbreeding coefficient (F) more informative in population and molecular genetic studies (Leutenegger et al., 2002). Therefore, researchers have estimated its value in different populations, such as less than 0.002 F in European, American, Turkish and Japanese populations (Hosoda et al., 1983; Bittles, 1998) and more than 0.02 F in Kuwait were estimated (Al- Awadi et al., 1985). However in Pakistan, mean inbreeding coefficient (F) was estimated 0.0331 (Hussain and Bittles, 1998).

In literature, various factors have been reported that would give a population a reason to practice inbreeding at a large scale. Among these, religion exerts a major

------3 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction influence on consanguinity (Bittles, 2001). The Buddh and Sikh religions sanction marriage between first cousins, as does the Zoroastrian / Parsi tradition (Lindholm, 1986; Bittles et al., 2001). However, the difference in the attitude within religion towards consanguinity is also observed. In early Christianity, cousin marriages were reported in practice but now the Orthodox prohibits these marriages; the Roman Catholic requires Diocesan permission and the Protestant denominations permit these marriages (Bittles et al., 2001). Similarly in Hinduism, the Aryans prohibit the marriages between kins (Kapadia, 1958), while Dravidian strongly favors these marriages even between uncle and niece (Rao and Inbaraj, 1979; Bittles et al., 1992).

In Muslim, regulations on marriage according to Koran (Al- Koran, Surah Al-Nisa 4:22-24) are generally parallel to the Judaic pattern detailed in Leviticus 18: 7-18. However in contrast to Judaism, uncle-niece unions are forbidden in Islam. Furthermore there is no specific guidance in Islam that could be interpreted as encouraging consanguinity (Hussain, 1999).

Socioeconomic conditions were also found the influencing factor and these can be summarized as: a strong family tradition of consanguineous unions; the maintenance of family structure and property; strengthening of family ties; financial advantages relating to dowry or bride wealth payments; the ease of marital arrangements and a closer relationship between the wife and her in-laws; and greater marriage stability (Al-Gazali et al., 1997; Hussain, 1999).

In addition, illiteracy, and rural residence are also considered as responsible factors of high rates of consanguineous marriages (Kir et al., 2005). In some populations a high prevalence of consanguinity was also reported among land-owning families, and in traditional ruling groups and the highest socioeconomic strata (Freundich and Hino, 1984; Al-Thakeb, 1985; Bittles, 1995). In addition, certain studies indicated that the preference of consanguinity was cultural and extended across religious and socioeconomic boundaries (Bittles, 2001).

The relationship between in breeding and its adverse effects on the human health has long been a subject of major interest in medical genetics (Banerjee and Roy, 2002). Usually the consequences of consanguinity are quantified in terms of following parameters:

------4 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction

i. Reproductive Behavior: In general, higher fertility has been reported for consanguineous marriages (Freir-Maia and Azvedo, 1971; Bittles, 1995). In a study, cases of sterility among consanguineous couples were found more frequent as compared to their outbreed counterparts (Ali and Hussain, 1976). However other studies showed that consanguinity as a whole did not influence fertility (Verma et al., 1992; Bittles et al., 2002).

Furthermore studies have also shown that consanguinity is associated with the increase of pregnancy losses, i.e. spontaneous abortion, intrauterine loss and stillbirth (Shami and Minhas, 1984; Al-Awadi et al., 1986). Conversely, some other workers did not observe significant difference between consanguineous and non-consanguineous marriages in this regard (Lindelius, 1980; Shami, 1983).

ii. Morbidity and Mortality: A number of studies have focused on an increased level of morbidity and mortality among the offspring of consanguineous parents (Khoury and Massad, 2000; Tamim et al., 2003). Studies have reported that total live births are low among consanguineous marriages than in non- consanguineous marriages (Bundey and Alam, 1993; Bittles and Neel, 1994). In addition, consanguinity-associated deaths were largely concentrated during the first year of life. Multiple deaths were also reported in specific consanguineous families in proportion to their level of parental relatedness (Bittles et al., 1993; Hussain et al., 2001).

In this regard, various studies have indicated that consanguinity is associated with loss of biological fitness due to increase of genetic load ascribable to homozygosity. Hence consanguinity is considered to be the single most important cause of genetically- related mortality (Guo, 1993). On the other hand, some other studies have failed to demonstrate any positive association between consanguinity and offspring mortality (Azevedo et al., 1980; Mian and Mushtaq, 1994).

Some investigators believed that long-term practice of inbreeding can actually benefit a population and its health by reducing deleterious or harmful genes (Al- Abdulkareen, 1998). The reduction of these harmful genes is thought to be a result of an increased frequency of the deleterious gene's presence which can make it more vulnerable to selection. Therefore, selection could eliminate the harmful gene if it is given ample time to "act" on it (Hedrick, 1991).

------5 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction

iii. Congenital Defects: Various studies have revealed that inbreeding resulting from consanguinity contributes to elevated mortality levels of offspring through congenital defects and recessive genetic disorders (Tamim et al., 2003; Schulpen et al., 2006). It is found that the closer the relationship between parents, the more severe the effect on offspring (Seemanova, 1971).

In various studies, high consanguinity was observed among couples having offspring with malformations, mental retardations, neural tube defects, chromosomal and developmental disorders. Furthermore autosomal recessive disorders like phenylketonurea, deafness, congenital cataract, retinitis pigmentosa, Alopecias, Alzheimer's disease, albinism, etc were also found to be more prevalent in the offspring of consanguineous couples (Vanita et al., 1999; Kaur and Balgir, 2005). However, the common autosomal recessive disorders with high carrier frequency in the population even occur in considerable prevalence among offspring of non- consanguineous couples as well e.g. thalassemia (Puri and Verma, 2004). Furthermore, consanguineous marriages have greater risk of producing the offspring with increased susceptibility for polygenic or multi factorial disease or birth defects (Madhavan and Narayan, 1991; El-Hazmi, 1999).

In a nut shell, consanguineous marriages in human population lead to increase homozygosity of recessive lethal, sublethal and detrimental alleles that might be the risk of early mortality and morbidity.

Genetic Disorders

Genetic studies on humans have played a vital role in the understanding and appreciation of genetic contribution to health and disease (Haan, 2003). Because all the human life processes like embryology, anatomy and physiology mostly depend upon genetic information (Guttmacher and Collins, 2002).

Any mutation in these genetic information leads to various changes in phenotypes. Most of these mutations are harmless and result in polymorphisms, while some mutations alter the gene function to such a degree that clinically the disease is manifested. However, the rate of mutations varies among human populations. Various studies have suggested that every human being has 5-10 mutant genes which may be capable to inherit and become part of the gene pool in certain areas (Lewin, 2000; Miglani, 2002). That is why detection and characterization of mutations in human genes provide insights into the patho-physiology of genetic disorders (Phillips and Hamid, 1999).

------6 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction

In this regard, the geneticists have greatly increased the understanding of genetic disorders by getting considerable genetic information from the analysis of family pedigrees (Levitan and Montagu, 1977). Later on, molecular geneticists identified the gene of genetic disorder by positional cloning which is found extremely useful method in the identification of genes responsible for Mendelian disorders (Zielenski and Tsui 1995). On further advancement in molecular techniques, genomic, and statistical tools, the process of gene identification progressed rapidly. The catalogue by McKusick (1992) reviews thousands of disorders discovered so far, and also lists the responsible genes which have been localized on various chromosomes. Its up-to-date online version provides very recent advances in the field of human molecular and medical genetics (OMIM: http://www.ncbi.nlm.nih.gov/entrez).

Genetic disorder is a large group of diseases which are classified into four major groups i.e. single gene disorders, chromosomal disorders, polygenic disorders, and mitochondrial disorders (Amudha et al., 2005). Among these, single gene disorders are predominant and follow a very clear pedigree pattern of inheritance categorized as: autosomal dominant, autosomal recessive, X-linked dominant, X-linked recessive, and Y- linked (Mckusick, 1994).

In populations with high level of consanguinity, autosomal recessive disorders are most prevalent. Mostly these disorders do not show variable expressivity within the family e.g. thalassemia, etc. Contrastingly polygenic disorders expression are variable but their risk for recurrence is slightly increased in close relatives of the affected person e.g. diabetes mellitus, etc (El-Hazmi, 1999).

Overall, the kinds and prevalence of genetic disorders is variable among different ethnic groups, populations and countries. But, magnitude of the impact of genetic disorders on countries like Pakistan is quite significant, necessitating their control which can be achieved by proper treatment and management of disorders (El-Shanti, 2001).

Mostly genetic disorders are not curable and relatively few are amenable to satisfactory treatment. For instance, disorders like cleft palate, phenylketonuria and hemochromatosis can be treated by surgery, controlled diet, and blood letting, respectively. The conventional management of thalassemia is based on regular blood transfusion and iron chelation. Bone marrow transplantation is the only treatment that can

------7 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction cure the thalassemia. In the future, gene therapy or other molecular methods may be feasible (El-Shanti, 2001; Rund and Rachmilewitz, 2005; Panigrahi and Marwaha, 2006).

In addition the treatment of disorders is expensive and unaffordable usually in developing countries. Therefore, the control of genetic disorders can principally be achieved by preventive management i.e. most effective and least expensive programs (El- Shanti, 2001, Cao and Galanello, 2002). Following are the steps in preventive management of patients/ families/or population with genetic disorders.

i. Genetic Counseling: It provides the information on genetic risk, the nature and consequence of genetic disorders and the means available for the prevention of transmission of defective genes in a family (Phadke, 2004).

ii. Genetic Screening: The screening tests are inexpensive, useful for large population, and capable of identifying a sub-population/caste or ethnic group for whom specific diagnostic tests are indicated (Scriver, 1985).

iii. Prenatal Diagnosis: The couples at high risk in past had choice either taking the risk again or considering other reproductive options like use of contraception, sterilization, pregnancies termination, adaptation, long term fostering and artificial insemination by donor sperm (Lemana et al., 1990). However, now a days prenatal diagnosis i.e. ability to detect abnormalities in an unborn child, is being widely used. Several techniques, such as amniocentesis, chorionic villus sampling, ultrasound, fetoscopy, radiography, and DNA analysis, can be utilized for prenatal diagnosis of hereditary disorders. Among these, DNA analysis is the most accurate which can look for a known specific mutation to a known specific gene.

Clinical and Molecular Studies of Families

Over the last few decades there is tremendous increase in the knowledge about genetic disorders. The clinical characterization and identification of responsible gene, locus or mutation of the genetic disorder found in the family/ population helps in the planning and establishment of preventive program (Phadke, 2004).

In this regard, a number of human geneticists have been searching the genetic bases of genetic disorders all over the world and list of disease genes is increasing at a dizzying pace (Valle, 2004.) Similarly, in Pakistan, a number of loci for various genetic disorders were also identified by using the consanguineous extended families originated from different areas of country.

------8 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction

Several studies on mutation scanning in Pakistan are also available which have reported the new mutations of certain genetic disorders in targeted families. Such as, Ul Haque et al. (2002) found mutation in the cartilage-derived morphogenetic protein-1 (CDMP1) gene in kindred affected with DuPan syndrome. Rafiq et al. (2004) found a mutation in DSG4 gene in three families with autosomal recessive hypotrichosis. Ul Haque et al. (2004) discovered novel mutations in the EXT1 gene in two families affected with osteochondromatosis. Naeem et al. (2005) identified two mutations (G382S and 718delAAAG) in the EDAR gene in two separate families affected with hypohidrotic ectodermal dysplasia. John et al. (2005) studied mutations in hairless (hr) gene in two atrichia families. Recently, Naeem et al. (2006a) found a mutation (KRTHB5) in a family with ectodermal dysplasia of hair and nail type.

In addition, Santos et al. (2005a) screened mutations in the transmembrane inner ear (TMIE) gene in NSHI families. In another study, Santos et al. (2005b) also found several known mutations in the GJB2 gene during screening the NSHI families. Furthermore, β-Thalassemia mutations have also been screened extensively in various populations of country except the population understudy (Ahmad et al., 1996; El-Kalla and Mathews, 1997; Khan and Riazuddin, 1998; Khateeb et al., 2000; Baig et al., 2005, 2006a, b).

The above mentioned studies provide convincing evidence that the population of Pakistan is the most attractive for searching the genetic disorders. In present study, we selected the population of Dera Ghazi Khan District because of its unique geographical location and population structure which offers many advantages for extensive studies of various population parameters especially marriage types and genetic disorders. A review of such characteristics will be helpful to put the present study into a proper context.

Dera Ghazi Khan

The district is named after the headquarters city Dera Ghazi Khan, which was founded some 500 years ago by Ghazi Khan Mirrani. The total area of the district is 11,922 km2, lies between 29’-34° to 31’-20° latitudes and between 69’-53° to 70’-54° East longitudes. It is bounded on the North by Dera Ismail Khan District of N.W.F.P; on the West by Musa Khel and Barkhan districts of Baluchistan, on the South by Rajan Pur, and on the East by Muzaffar Garh and Leiah, separating the later two districts by river Indus (Figure 1.1). District comprises three Tehsils- D G Khan, Taunsa and Tribal area. There is

------9 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction only one municipal committee and one town committee in urban area (DGK Gazetteer,1898; Census, 1998).

Topographically the area is divided into two main parts; the mountainous territory is located in the west and the plain area in the east. The plain area can be subdivided into three natural tracts. First, the piedmont area stretches along the base of the hills. The cultivation in the area depends on the flow of hill torrents. Next, the canal or well irrigated plain area forms the intermediate zone between the piedmont and the riverain area. Lastly, the riverain area lies close to the Indus River (DGK Gazetteer, 1898).

The record of human activity is extremely rich and varied in Dera Ghazi Khan. The people of Sindhi origin first reached along the Indus west side. In addition, the mountains of Mekran were inhabited by Balochis and those of the Suleman range by Afgans. The plains were occupied by Jats or Indians/Sindhi (Elphinstone´s History, book VI, chapter III). Of the ancient populations, the Mehs (or Mohanas) and the Bhil have survived in areas surrounding the Indus River (DGK Gazetteer,1898).

The population of the area was thin and scattered. Centuries before the first Mohammedan invasion, there were only three towns Harrand, Mari and Asni. With the exception of small area of cultivation attached to these towns, all the remaining area was uninhabited waste. At the time of the invasion by Muhammad-bin-Qasim in AD 711, the district was subject to the Hindu prince - Dahir. After his complete defeat, the country remained subject to the Arabs till AD 750, when they were expelled by Sumra tribes of Rajputs. Later on Sabaktagin of Ghazni, Mahmud of Ghazni, Shahab-ud-din Ghori, Kutb- ud-din Aibak, Khilji, Tughlak, Tumerlane, Langas, Lodhi, Nahars, Mirranis, Mughals, Nadir Shah Kalhora, Nawab of Bahwalpur, Sikh and British ruled in this area and have contributed to the ethnic diversity of area (Census, 1998; Census, 1971).

Now the population of Dera Ghazi Khan is mainly a tri-ethnic mixture of Baloch, Natives (Non-Baloch) and Indian Migrants (Muhajirs). The detail stratification of these ethnic groups is presented in Table 1.1.

The Baloch tribes are believed to have been originated in Aleppo (Syria) and migrated to Pakistan via Iran (Quddus, 1990). Among Native (Non-Baloch), the Jats are a congeries of Mohammedan agricultural tribes without any common origin. Some of the Jats are descendants of the original Hindu inhabitants of the district who were converted to Islam. Others are immigrants the neighboring districts (Census, 1891). Some non-

------10 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction baloch located within the country of Baloch tribes adopted their customs like Hanbis, Kachelas, Manjothas. In the area, Jats and Rajput are not considered separate group like other areas of Punjab. About Pathans, legends claim that they are either a lost tribe of Israel or descendent of soldiers that came with Alexander the Great (Caroe, 1992; Bellow, 1979).

After independence, all Hindu and Sikh families except one, had left the area for India, while Muslims came from Indian Punjab especially Heryana Province. No significant disturbance was observed in population composition after partition as shown that the persons born in district are proportionate to the total population as 97% ((Census, 1911), 97% (Census, 1921), 98% (Census, 1931), and 93% (Census, 1951).

According to 1998 census, the total population of area was 1,643,118 with 3.8% growth rate during 1981-1998. The population density was 138 persons / km2. The total number of life time in-migration was 1.5% of population. The literacy rate was 30.6% (42.1% males and 18.1% females). Disabled population was 1.7% in which crippled, blind, deaf/mute, mentally retarded, multiple disability and insane representing 28.9%, 7.2%, 6.1%, 6.1%, 4.1% and 3.9% respectively. The population is predominantly Muslims (99.56%). With respect to language, Siraiki is representing 80.3% of the population, followed by Balochi 14.3%, Urdu 3.2% and Punjabi 1.3%, while Sindhi, Pushto, Bravi, Dari are minor groups.

Social and cultural activities vary in the area. Near the river Indus, agricultural population predominantly inhabits the houses neighboring water wells, where the proprietors of the wells or their tenants live. Baloch in tribal area, have usually no fixed habitations and they wander about with their flocks and herds as nomad tribes. However, in villages and towns, different occupational groups like goldsmith, ironsmith, shoe- makers and government servants etc, have permanent settlements (DGK Gazetteer,1898).

Marriages are mostly endogamous. Betrothals take place at any age and are usually between cousins. If this can not be managed, then bethrothal takes place between strangers belonging to same tribe. Early and reciprocal marriages are also common. Adultery is very severely punished in the area (DGK Gazetteer). As a result, population stratification is more evident and deeper. Thousands of isolated groups in form of extended families are found in the district.

------11 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction

Objectives of the study

In Pakistan the data on consanguineous marriage and its outcomes especially genetic disorders is fragmented. Only few studies are available in which consanguinity and its impacts have been studied on preliminary levels in big cities and large metropolitan areas. No study has been launched in the remote and under-developed areas. Therefore, in the present study we intend to assess consanguinity and its related parameters in the population of District DERA GHAZI KHAN located in southern region of Punjab, Pakistan.

Additionally, we document the most important and prevalent genetic disorders in different clans/ biradries /castes and tribes. Further more various levels of parental consanguinity in three main ethnic groups are also documented, which might be useful in estimating the frequency of recessive disease genes and genetic heterogeneity. This work would be helpful in the understanding of various genetic, demographic and social aspects of one of the most heterogeneous population groups of Pakistan.

This study may provide base-line information to conduct more comprehensive survey in the future. We expect that this effort would contribute to the health management and population planning in the long run. Therefore, in this context the present study intend to focus on following specific goals:

1. To estimate the rate of consanguinity and inbreeding co-efficient in the population of DG Khan District.

2. To evaluate the impact of various factors, if any, on the incidence of consanguinity.

3. To appreciate the consequences of consanguinity, if any, on reproductive output and the incidence of genetic anomalies.

4. To locate and identify families with hereditary disorders.

5. To work out the mode of inheritance of the hereditary disorders.

6. To study the clinical and diagnostic features of the affected individuals.

7. The cytogenetic/biochemical or molecular study of hereditary disorders.

------12 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction

Figure 1.1: Map of Dera Ghazi Khan District (Source: Map published by survey of Pakistan).

------13 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 1 Introduction

Table 1.1: Population Stratification of Dera Ghazi Khan District

DIVISION Sub-Division Tribes Castes/clans Location

Lashkarani, Rubadan, Waswani, Taunsa, Northern Kasrani Laighari, Budani, Jarwar, Bada, INDIGENOUS INDIGENOUS tribal area Tahuri, Wasmani, etc.

Balalani, Jungail, Jundani, Jiani, Middle tribal area, Khosa Hamlani, Mehrwani, Isiani, Halati, Rural DGK Tehsil. Lashari, Umrani,etc

Aliani, Ramdani, Talpur, Jogiani, Southern tribal Habitani, Ferani, Marzani, Mastoi, Leghari area, Rural DGK Rustmani, Sarkhani, Bijarani, Baloch Tehsil Gurmani,etc

Haidarani, Lundani, Mohammadani, Rural area DGK Lund Gorchani, Ahmadani, Khaliliani, Tehsil Hotwani, Baig, Sariani, Nurkani, etc

Rind Buzdar Tribal area

Nutkani, Chandia, Jatoi, Gishkori, Others Lashari, Khetran, Julebani, Scattered Chingwani etc

More than 160 endogamous groups such as Jat, Rajput,

Pathan, Sayad, Sheikh, Arain, Mughal, Machi, Lohani, Scattered in urban Native Sipal, Bhati, etc. and rural areas

Mostly More than a dozen endogamous groups such as Rajput, SETTLER Migrant concentrated in Pathan, Sayad, Sheikh, Arain, Mughal etc urban areas

Source: Data of table extracted from DGK Gazetteer (1898) and Searchlights on Baloches and Balochistan by Justice Mir Khuda Bakhsh Marri (1974) published by Royal Book Company Karachi.

------14 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

MATERIALS AND METHODS

Data Collection

In order to reveal various aspects of consanguinity and to assess its impacts on the population of Dera Ghazi Khan, a questionnaire was designed to record the relevant parameters during the field survey. The permission was also obtained from the administrative authorities (i.e., Nazims) to conduct field survey in small towns, villages and tribal areas, which in turn proved to be vital to access, contact and communicate with the local communities.

Families/subjects were approached at their homes and were briefed about the purpose, aims and objectives of the study. After the family’s consent , the data was collected from the elders or head of the family available at the spot. The data collection was completed in two years and three months starting from September 2001 to December 2004. The reference date for the study was 05, July, 2003.

During the survey, 1611 families were interviewed for data collection. For the present study, Family (a household) is defined as a collection of subjects related by blood or marriage, sharing the same income source and inhabiting the same housing unit. No criteria of inclusion or exclusion were adopted and all the sampled families were included in the analyses.

The body of the data collected encompasses the following areas of demography and consanguinity: information about locality, ethnicity, marriage types, year of marriage, socioeconomic status of husband, educational levels of spouses before marriage, and occupational group of husband before marriage. The specific detail of various parameters is given below:

Ethnicity

Ethnicity means a group that people belong to because of shared characteristics, including ancestral and geographical origins, cultural traditions, and languages. So population is divided in to three main ethnic groups i.e. Native, Siraiki speaking, Baloch; Balochi speaking or tribal origin; and Migrant or Muhajir, Urdu speaking.

------15 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

Couple’s Relationship and Marriage Types

The exact relationship between the husband and wife prior to marriage were recorded. All the marriage types and parental relationships were identified that include: marriage between double first cousins (DF), first cousin (FC), first cousin once removed (FCOR), second cousin (SC), second cousin once removed (SCOR), Bradari or distantly related (DR), and marriages between non-related (NR).Depending upon the type of relationship, the FC marriages are further categorized as father’s brother’s daughter (FBD), mother’s sister’s daughter (MSD), father’s sister’s daughter (FSD), mother’s brother’s daughter (MBD). Bradari or distant related couples belong to the same caste/tribe but the precise relationships between the couples could not be established. Non-related unions were derived from different ancestors belonging to two separate castes /tribes.

The prevalence and pattern of consanguinity was estimated from type of marriage unions. The marriage type’s double first cousin (DFC), first cousin (FC), first cousin once removed (FCOR) and second cousin (SC) marriages were considered as consanguineous marriages because the genetic impact of these marriages is reportedly much more serious than other marriage types. On the other hand, distantly related (DR) and non-related marriages (NR) were considered to be non-consanguineous.

Educational Status

To explore the relationship between educational level and consanguinity, the educational status of both husbands and wives before marriage was recorded. The couples were divided into three categories according to educational levels of husband and wives: Low level (Group-I) in which husbands/wives were either illiterate altogether or had schooling only up to eight years. Middle level (Group-II) in which spouses had conducted 9-14 years of schooling. High level (Group-III) in which spouses was qualified beyond 14 years of school/university education.

Socio-economic Status of Husband

Social and economic parameters are the key constraints defining various behaviors in our society including the marriage pattern. For various reasons, both parameters are interwoven and cannot be uniquely delimited. Therefore, social and economic factors have been integrated as socioeconomic status in the present study. Three categories were defined with respect to husband’s socioeconomic status on the basis of income, type and

------16 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods size of home, ownership of livestock and agricultural land, ownership of vehicles and other life comforts. These categories are: lower, middle and higher levels.

Occupational Status

Similarly, to appreciate the relationship between occupations with consanguinity, the occupational status of husbands before marriages was recorded. The marriages were divided into four categories with regards to the occupational group of husbands. Comparisons amongst different occupational groups were made with respect to the extent of consanguinity. Group 1: Professionals and service man; Group 2: Shopkeepers and tradesman; Group 3: Skilled workers; Group 4: Non-skilled workers.

Pregnancy, Mortality, Morbidity

In order to establish the impacts of consanguineous marriages, a number of variables were recorded for all marriage types, which include: the number of pregnancies, the incidence of miscarriages, perinatal deaths (stillbirths, birth of a dead child who did not show any signs of life by crying, breathing or moving and early neonatal deaths), live births, child mortality (baby death between their first and fifth birthday), their sex ratios and morbidity.

Consanguinity and Genetic Disorders

To study the effect of consanguineous marriages on the specific group of disorder/s , the afflicted couples, having at least two genetically affected offspring or one genetically affected offspring with positive history was identified during the field survey or on information provided by their relatives/neighbors etc. The families were interviewed and information about ethnicity, marriage types, children both normal and affected were collected. On the basis of clearly evident clinical features of affected children, the disorder was identified. The afflicted couples were divided in to 07 groups: skin disorders, deafness, microcephally, muscular dystrophies, mental retardations thalassemia major, and digital abnormalities.

Families Studied

The families were ascertained by identifying proband/s during the survey for consanguinity. Then the families were visited at their places of residence. The elders and relatives of the families were interviewed to obtain information about the genetic disorder and other relevant matters. The case history, number of affected individuals, number of

------17 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods generations involved, the associated defects if any and onset of the genetic disease were carefully recorded. All the information obtained was crosschecked by interviewing different persons.

For genetic inference an extensive pedigree comprising more than three generations was constructed for each family because three-generation pedigree provides a pictorial representation of diseases within a family and is the most efficient way to assess hereditary influences on disease and important to recognize the pattern of inheritance of the disorder (Puri and Verma, 2004; Wattendorf and Hadley, 2005). The standard methods and symbols described by Bennett et al. (1995) were used for drawing pedigree. In addition, Cyrillic version 2.1.3 (Cherwell scientific publishing 1997, www.cherwell.com) - a pedigree drawing software was used for drawing pedigree and calculating the inbreeding co-efficient. Then the pattern of inheritance of hereditary disorders studied was deduced by observing the segregation or transmission of the disorder within family pedigree.

Clinical Study

The maximum number of members, both affected as well as normal, of all the families was physically and clinically examined. The subjects were taken to the district head quarter hospital Dera Ghazi Khan or private clinics for this purpose. Clinical studies /biochemical tests/ biopsy/ audiometery, according to the requirement of disorder were performed on selected individuals to confirm the genetic disorder. In addition, age of disorder on set was also recorded.

Apart from the symptoms of the main disorder, vision, hearing, intelligence and height of the subjects were also recorded. Special care was taken in examining the patients so as not to miss any associated anomaly.

Blood Sampling

Blood samples were drawn from both affected and normal members of the families by the aid of 10 ml Syringes (0.7 X 40 mm, 0.22Gx 1½) and blood vacutainer sets containing EDTA. The blood samples were stored at 4 0C until DNA extraction.

Genomic DNA Extraction

High molecular weight DNA was extracted from leukocytes following the standard method as described by Sambrook et al. (1989). Eight to ten ml blood collected

------18 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods was taken in a 50 ml conical tube. The volume was raised to 45 ml by the addition of solution A (0.32 M Sucrose, 10 mM Tris pH 7.5, 5 mM MgCl2, 1% Triton X-100) and was stored in ice for 30 minutes. After chilling, the centrifugation was carried out at 6,000 rpm for 30 minutes at 40C to separate white blood cells. The supernatant was discarded and the pellet was resuspended in solution A and centrifuged again. The pellet was re- suspended in 3 ml of solution B (10 mM Tris pH 7.5, 400 mM NaCl, 2 mM EDTA pH 8.0) and incubated overnight at 370C by adding 100 μl 20% SDS and 0.5 ml proteinase K (2 mg/ml). On the following day, the tube was vigorously shaken for 15 seconds after the addition of 1.625 ml of saturated solution of sodium chloride (approximately 6 M). The tube was centrifuged twice at 6,000 rpm to acquire a clean supernatant containing genomic DNA. The clear supernatant was transferred to a new falcon tube and DNA was precipitated by the addition of two volumes of absolute ethanol. The precipitated DNA was fished out with micropipette tips, washed in 70% ethanol and was placed in a 1.5 ml reaction tube. After evaporation of residual ethanol, DNA was dissolved in an appropriate amount of Tris-EDTA (TE) buffer (10 mM Tris, 1 mM EDTA) and stored at 40C.

Genomic DNA was quantified by spectrophotomer at OD260, and was diluted to 40ng/ul for amplification by polymerase chain reaction (PCR).

Polymerase Chain Reaction (PCR)

PCR reaction was performed by using 40 ng of the genomic DNA in 25 μl reaction mixture containing, 50 ng per moles of each primer, 2.5 μl of 10X PCR buffer

(MBI Fermentas, UK); 1.5 μl of 25 mM MgCl2 (MBI Fermentas, UK), 0.5 μl of 10 mM dNTPs mixture (MBI Fermentas, UK), 17.9 μl of distilled water and 1 unit of Taq DNA polymerase (MBI Fermentas, UK). The reaction mixture was centrifuged for few seconds for thorough mixing. The thermal cycling conditions used included 5 minutes at 950C, followed by 40 cycles at 950C for 1 minute, 55-57 0C for 1 minute, 72 0C for 1 minute and a final extension at 720C for 10 minutes. PCR was performed by the use of thermal cyclers provided by Perkin Elmer (Gene Amp PCR system 2400 and 2700, Applied Biosystems, USA).

Horizontal Gel Electrophoresis

Amplified PCR products were analyzed on 1-2% agarose gel, which was prepared by melting 1-2 grams of agarose in 100 ml 1X TBE buffer (0.89 M Tris-Borate, 0.025 M EDTA), in a microwave oven for few minutes. Ethidium bromide (final concentration 0.5

------19 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

μg/ml) was added to the gel to facilitate visualization of DNA after electrophoresis. PCR reaction products were mixed with Bromophenol Blue dye (0.25% Bromophenol Blue in 40% sucrose solution) and loaded into the wells. Electrophoresis was performed at 100 volts for half an hour in 1X TBE buffer. Amplified products were detected by placing the gel on UV Transilluminator (Biometra, Germany).

Vertical Gel Electrophoresis

The amplified PCR products were resolved on 8% non-denaturing polyacrylamide gel. Reagents were mixed in a flask and polyacrylamide gel solution was poured between two glass plates held apart by spacers of 1.5 mm thickness. After inserting the comb, gel was allowed to polymerise for 45-60 minutes at room temperature. Amplified products were mixed with the tracking dye (Bromophenol Blue) and loaded into the wells. After about 1-2 hours run at 100 volts, the gel was stained with ethidium bromide (10 mg/ml) solution and visualized on UV transilluminator for photography by Digital Camera DC120 (Kodak, USA).

Chemically 8% Polyacrylamide gel contains 27 ml 30% Acrylamide solution (29 g Acrylamide, 1 g N, N Methylene-bis-acrylamide), 10 ml 10X TBE, 0.7 ml 10% Ammonium persulphate, 35 ul TEMED, and 62.3 ml water.

Genotyping

PCR amplification of polymorphic microsatellite markers was performed by using 40 ng of genomic DNA and resolved on 8% non-denaturing polyacrylamide gels as described above. Microsatellite markers were visualized by placing the ethidium bromide stained gel on UV transilluminator and genotypes were assigned by visual inspection. Microsatellite markers mapped by Cooperative Human Linkage Center (CHLC) were obtained from Research Genetics, Inc. USA. The number of tri and tetra nucleotide repeat sequence polymorphic markers used in the current study was approximately 94%. Average heterozygosity for each marker was above 70%, implying that these markers were highly informative for allelotyping pedigree members. Information about the cytogenetic location of the markers and size of the PCR amplified products was obtained from genome data base (http://www.gdb.org) and Marshfield Medical Center (http://research.marshfieldclinic.org/genetics/).

------20 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

Linkage Studies

Linkage analysis was performed in the selected families including families segregating autosomal recessive alopecia (Family F and G) and nonsyndromic deafness (Families H, I and J). In case of families A to E, only clinical studies were performed.

To elucidate the gene defect in families (F and G), search for linkage was carried out by using polymorphic microsatellite markers mapped within autosomal recessive loci involved in alopecia (Table 2.1). Where as in families (H, I and J) linkage with the known autosomal recessive nonsyndromic deafness loci was searched by using microsatellite markers presented in Table 2.2. Selected markers had an average heterozygosity of more than 70%. Genotyping of these markers was performed as described above.

Mutation analysis

To search for mutations in HR (in family G) and GJB2 (in family J) genes, all exons and splice junctions were PCR amplified from genomic DNA using primers, presented in table 2.3 and 2.4, respectively. Primers of the candidate genes were designed by using software at the Primers Web site (http://frodo.wi.mit.edu/cgi- bin/primer3/primer3_www.cgi).

Amplification was carried out on 100 ng of genomic DNA in a 30 cycle PCR, in which initial 5 minutes denaturation of template DNA at 950C was followed by 30 cycles of 950C for 1 min, 55-600C for 1 min and 720C for 1min in a volume of 50 ul containing

10 mM Tris-HCl, pH8.3, 50 mM KCl, 0.2 mM of each dNTP, 1.5 mM MgCl2, 0.5 uM of each primer and 1.0 unit of Taq DNA polymerase. PCR products were analyzed on 2% agarose gel and purified in Centri-Sep Spin Columns (Marligen Biosciences, USA) to remove the unincorporated primers and nucleotides.

The purified PCR products were subjected to cycle sequencing using Big Dye Terminator V 3.0 ready reaction mix and sequencing buffer (PE Applied Biosystems, USA). The sequencing products were purified to remove unincorporated nucleotides and primers with CentriflexTM Gel Filtration Cartridges (Biosystems, Gaitherburg, MD, USA). The purified products were re-suspended in 10ul of TSR (Template Suppression Reagent) were placed in 0.5 ml septa tubes to be directly sequenced in an ABI Prism 310 Automated Sequencer (PE Applied Biosystems, USA). Chromatograms from normal and affected individuals were compared with the corresponding control gene sequences from

------21 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

NCBI (National Center for Biotechnology Information) database to identify the aberrant nucleotide base pair change (http://www.ncbi.nlm.nih.gov/).

Amplification Refractory Mutation System-PCR (ARMS-PCR)

In case of thalaseamia, ARMS-PCR was used for screening the specific mutations. In ARMS-PCR, a pair of allele-specific primers one of which has its 3´ terminal nucleotide complementary to the point mutation (Mt ARMS primer) and other to the normal DNA sequence (N ARMS primer) was used (Table 2.5). A common primer C is used as complementary primer for both mutant and normal specific ARMS primers. In this system a second pair of primers is also included in the reaction mixture to simultaneously amplify an unrelated DNA sequence, which serves as an internal control for the specific mutation to test the success of ARMS reactions.

The ARMS analysis was performed in a reaction mixture of 20 μl containing 1X Taq polymerse buffer, 50 pmoles of each of four primers, 0.5-1 μg of genomic DNA, 0.2 mM of dNTPs, 1.5 mM MgCl2 and 0.5-1 unit of Taq DNA polymerase. The thermal cycling conditions used included 5 minutes 940C, followed by 33 cycles of 940C for 30 second, 660C for 1 minute, and 720C for 6 minute. The PCR products were then visualized on gel electrophoresis.

Multiplex ARMS- PCR

Multiplex ARMS-PCR is suitable for the detection of more than two point mutations using allele-specific primers in a single tube. Allele-specific primers (Mt ARMS primer and N ARMS primer) are used for the diagnosis of specific point mutation. A common primer C is used as complementary primer for both mutant and normal specific ARMS primers. A second pair of primers is also included in the reaction that amplifies an internal control which serves as a confirmatory test for the success of reactions.

The Multiplex -ARMS analysis was performed in a reaction mixture of 25 μl containing 2X Taq polymerse buffer, 75 p moles of each of three reverse primers and 225 pmoles of common C as forward primer, 1 μg of genomic DNA, 0.3 mM of dNTPs, 2.0 mM MgCl2 and 1.5 unit of Taq DNA polymerase enzyme. The thermal cycling conditions used included 5 minutes 940C, followed by 33 cycles of 940C for 30 second, 660C for 1 minute, and 720C for 6 minute. The PCR products are then visualized on 2.5% agarose.

------22 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

Data Analyses

All information obtained during the field work was treated confidentially and was accessible only to the investigators. PC computer facilities were used to record and store the data. Data was analyzed by SPSS and Excel packages. The statistical analyses were carried out including percentage distribution, mean, variance, standard deviation, standard error. In addition student T-test and Chi-square test and Z-test were used as a test of significance, taking 5% as the level of significance. Mean co-efficient of inbreeding (F) was calculated using the method given by Wright (1922).

------23 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

Table 2.1: List of microsatellite markers used to test linkage to candidate gene loci in families F and G

S.No. Candidate Genes Chromosomal Markers Distance Location (cM)* D1S1660 212.40 Plakophillin1 1 1q32.1-q44 D1S373 214.08 (PKP1) D1S1723 215.17 D1S442 154.74 Loricrin 2 1q21.3 D1S498 155.89 (LOR) D1S305 159.32 ED3 gene D2S1343 115.49 3 ectodysplasin1 D2S1889 120.29 2q11-13 anhidrotic receptor D2S2236 154.48 (EDAR) D2S141 161.26 Alopecia with Mental D3S3578 195.60 4 Retardation 1, 3q26.33-q27.2 D3S3592 198.68 Autosomal Recessive D3S1262 201.14 Hypotrichosis

(APMR1, AH) Corneodesmosin D6S1615 44.96 5 (CDSN) 6p21.33 D6S439 48.26 D6S273 51.31 Hairless D8S560 43.41 6 (HR) 8p21.3 D8S298 43.96 D8S1048 54.28 ED4 gene D11S1998 113.13 7 poliovirus receptor- 11q23.3 D11S4129 115.53 like 1 D11S1299 115.53 (PVRL1) D12S368 66.03 Keratin Type II 8 12q13 D12S398 68.16 (KRT1) D12S90 71.68 ED2 gene D13S633 3.36 9 gap junction 13q12.11 D13S250 3.46 protein b-6 D13S787 8.87 (GJB6) D14S50 12.46 Transglutaminase 1 10 14q11.2 D14S1040 21.74 (TGM 1) D14S264 22.66 Type-I Hair Keratin D17S1807 61.48 11 and Plakoglobin 17q21.2 D17S800 62.01 Genes. D17S934 63.62 (KRTHA 1)

Desmogleins and D18S1107 51.21 12 Desmocollins D18S478 52.86 18q21 (DSG & DSC D18S847 56.71 Cluster) D18S536 62.29

------24 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

Transglutaminase D20S478 54.09 13 II/III 20q11.2 D20S107 55.74 (TGM 1 and 3) D20S119 61.77 *Combined Sex-averaged Kosambi centimorgans from Marshfield genetic map (Broman et al., 1998)

------25 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

Table 2.2: List of autosomal recessive nonsyndromic deafness loci tested for linkage in the present study

NO LOCUS MARKERS LOCATION cM* D13S143 - 1 DFNB1 D13S115 - D13S787 8.87 D11S2371 76.13 2 DFNB2 D11S527 - D11S1989 84.31 D17S122 41.12 3 DFNB3 D17S953 43.01 D17S1294 50.7 D7S501 118.9 4 DFNB4 D7S496 119.81 D7S523 123.01 D14S599 40.68 5 DFNB5 D14S306 44.06 D14S587 55.82 D3S2432 57.98 6 DFNB6 D3S2409 70.61 D3S1766 78.64 D9S301 66.32 7 DFNB7 D9S1122 75.88 D9S922 80.31 D21S1446 57.75 8 DFNB8 D21S1575 - D2S405 47.93 9 DFNB9 D2S165 47.43 D21S1260 46.71 10 DFNB10 GATA129D11 40.49 D21S1446 57.75 D10S1432 93.92 11 DFNB12 GATA121A08 88.41 D10S532 105.04 D7S676 156.19 12 DFNB13 D7S495 144.72 D7S820 98 13 DFNB14 D7S692 121 D3S1744 161.04 D3S1763 176.54 14 DFNB15 D19S1034 20.75 D19S586 32.94 D15S165 20.24 15 DFNB16 D15S659 43.47 D15S652 52.33 D7S655 125.15 16 DFNB17 D7S480 125.95

------26 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

D11S1981 21.47 17 DFNB18 D11S1999 17.19 D18S976 12.81 18 DFNB19 D18S843 28.1 D11S2359 147.77 19 DFNB20 D11S912 131.26 D11S1986 105.74 D11S1998 113.13 20 DFNB21 D11S4464 123 D11S912 131.26 D10S220 70.23 21 DFNB23 D10S1225 80.77 D11S2000 100.62 22 DFNB24 D11S1986 105.74 D11S1998 113.13 D4S1632 45.6 23 DFNB25 D4S2397 42.74 D4S1627 60.16 D4S1644 143.31 D4S1625 145.98 24 DFNB26 D1S534 151.88 D1S1679 170.84 D22S683 36.22 25 DFNB28 D22S423 46.42 D22S274 51.54 D14S43 84.16 26 DFNB35 D14S77 80.82 D14S88 75.61 D7S1818 69.56 27 DFNB44 D7S2469 61.53 D7S2209 57.79

*Combined sex-averaged Kosambi centimorgans from Marshfield genetic map (Broman et al., 1998).

------27 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

Table 2.3: Sequences of the primers used for PCR amplification of exons 2-19 of the human hairless (HR) gene

Exon Forward Reverse Annealing (5/ 3/) (5/ 3/) Temp (°C) 2-1 GCCTTACTGGTTTGAGCTGC TGAGATGGCCACCACTATGC 58

2-2 TCCTGAGCACCCCAGACTCC CTTGGGGTTGACTGTGGGGC 61

2-3 AGGCTGTAAGGTGCTTGGGA ACAGTGGAAGGGCATCTTGG 59

3-1 GAGGGCTTCAGTATTCTCCC AGTGGGTGGGTAGGATGAAC 56

3-2 GAATCCTTGCCCGCTCTTCC CTGAGGAACTCCCAGAGAGC 58

4 CATCCTCAGACTCCCTGCTC TGGCTGTGTCTTCCTCCTGC 59

5 CTGCCACTCTCAGCAAGTGC CCTTAGGTCTAGGAGCTGGC 58

6 CTCTCCATGGAAGCTGCTCC GCCAACGAATGACCACAGGC 59

7 GCTGTGTCTCTATGTGACCC GGTGGTGAGTGTAGACCAAC 56

8-1 AGCTTCCCGTCTGATTGTCC GGGAATTAGCCTGATCCCAC 57

8-2 CGGGACTGCCTGTTGGTCAC CCATTTGCAGGCACGATACC 59

9 GGTAGAAGTCCATGAGCAAC AAGGTGTTTGGAGGCATGTC 55

10 TGCAGGAAAAGCAGTAGAGC ATGTTGGTGATGCGGTCATC 56

11 AGCGAATACACATGGCCTTC TAAGGGCAGTAGAACAGCTC 55

12 TCCCCGAGCTGTTCTACTGC ACAGGAGGAGACAGAACGGC 60

13 AGCGTAAGTGTCCCCAACAC ACATGAGAGTACCAGGGACC 57

14 CCTGGTACTCTCATGTTTGC TGGAATCAGAGAAGCGCTTC 55

15 ACTCCTGACCTCAGGTGATC TCCAGGCCTGAAAGGAAGTC 56

16 TCAGCATCCTGGTGCATGCC TTGGGTCTGTGCAGCTCACC 61

17 CTGCCCTTCAAGACTTGACC CTCAGTGACTTCAAGGCCTC 56

18 GAATCTGCTCTCTGAGAGCC AGGGTGGGATCTGCTATGTC 56

19-1 CTGGGATTACAGGTGTGAGC AGATCTTTTGGCAGGAGGGC 57

19-2 AGGAGACAAACAGCCCTTCC GCTGCCCTACTCCATTTGTC 57

Primers Web site (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi)

------28 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

Table 2.4: Primers for PCR amplification of GJB2 gene exon 2

Exon 2 (GJB2 gene) Primers (5`Æ 3`) Annealing Temp. (°C) Forward Reverse

GTAAGAGTTGGTGTTTGCTC GATGACCCGGAAGAAGATGC 63

CAGCTGATCTTCGTGTCCAC GAGTTTCACCTGAGGCCTAC 63

Primers Web site (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi)

------29 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 2 Materials and Methods

Table 2.5: Oligonucleotide sequences of ARMS primers

Primers Oligonucleotide sequence Allele specific primers Mutant 5' – CTC CTT AAA CCT GTC TTG TAA CCT TGA TAG-3' IVS-I-5 Normal 5' – CTC CTT AAA CCT GTC TTG TAA CCT TGA TAC-3' Mutant 5'- CCT TGC CCC ACA GGG CAG TAA CGG CAC ACC-3' FSC 8-9 Normal 5'- CCT TGC CCC ACA GGG CAG TAA CGG CAC ACT-3' Mutant 5'- GAG TGG ACA GAT CCC CAA AGG ACC AAC CT-3' CD 41/42 Normal 5'- GAG TGG ACA GAT CCC CAA AGG ACT CAA AG-3' Mutant 5' -AAG AAA ACA TCA AGG GTC CCA TAG ACA CAT-3' IVS-II-I Normal 5'- AAG AAA ACA TCA AGG GTC CCA TAG ACA CAC-3' Mutant 5'-CAC ACA GAC CAG CAC GTT GCC CAG GAG CTT-3' IVS-II-848 (C-A) Normal 5'-CAC ACA GAC CAG CAC GTT GCC CAG GAG CTG-3' Mutant 5' -TTA AAC CTG TCT TGT AAC CTT GAT ACG AAA -3' IVS-I-I (G-T) Normal 5' -TTA AAC CTG TCT TGT AAC CTT GAT ACG AAC-3' Mutant 5' -TTA AAC CTG TCT TGT AAC CTT GAT ACC AAT-3' IVS-I-I (G-A) Normal 5' -TTA AAC CTG TCT TGT AAC CTT GAT ACG AAC-3' Mutant 5'- CAC CAA CTT CAT CCA CGT TCA CCT TGG CCT-3' CD 15 Normal 5' - CAC CAA CTT CAT CCA CGT TCA CCT TGG CCC-3' Mutant 5'- TCA CCA CCA ACT TCA TCC ACG TTC AGC TTC-3' CD 16 Normal 5'- TCA CCA CCA ACT TCA TCC ACG TTC AGC TTG-3' Mutant 5'-TAA CCT TGA TAC CAA CCT GCC CAG GGG CTT-3' CD 26(G-A) Normal 5'-TAA CCT TGA TAC CAA CCT GCC CAG GGG CTC-3' Mutant 5'- TAA ACC TGT CTT GTA ACC TTG ATA CCT ACG-3' CD 30(G-C) Normal 5'- TAA ACC TGT CTT GTA ACC TTG ATA CCT ACC-3' Mutant 5'- TAA ACC TGT CTT GTA ACC TTG ATA CCT ACG-3' CD 30(G-A) Normal 5'- TAA ACC TGT CTT GTA ACC TTG ATA CCT ACC-3' Mutant 5'-ACA GGG CAG TAA CGG CAG ACT TCT ACT CG-3' FSC-5 Normal 5'-ACA GGG CAG TAA CGG CAG ACT TCT CAT CAG-3' Mutant 5'-CAG ATC CCC AAA GGA CTC AAA GAA CCA CTA-3' CD 39(C-T) Normal 5'-CAG ATC CCC AAA GGA CTC AAA GAA CCA CTG-3' Mutant 5'- TCA CTT AGA CCT CAC CCT GTG GAG CCT CAT-3' -88 Normal 5'- TCA CTT AGA CCT CAC CCT GTG GAG CCT CAC-3' Mutant 5'- AAA AGT CAG GGC AGA GCC ATC TAT TGG TTC-3' Cap+1(A-C) Normal 5'- AAA AGT CAG GGC AGA GCC ATC TAT TGG TTT-3' Mutant 5'-CGG CAG ACT TCT CCT CAG GAG TCA GGC GCG-3' Initiation CD (T-C) Normal 5'-CGG CAG ACT TCT CCT CAG GAG TCA GGC GCA-3' ' ' II. Common primer 5-ACC TCA CCC TGT GGA GCC AC -3 ' ' III. Internal Control A 5-CAA TGT ATC ATG CCT CTT TGC ACC-3 ' ' control primer CD2 5-TGA CCT CCC ACA TTC CCT TTT –3 Primers were synthesized by Gene Link: Order No.116573 and 116574

------30 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

CONSANGUINITY

Introduction

Typically the term consanguinity refers to marital unions between individuals who belong to the same genealogical kin, sharing at least one common ancestor. In ancient times, incestuous marriages were permitted and favored in some societies like the Egyptian Pharaohs. The past history of such marriages taught the coming generations of the devastating effects of “incestuous marriages upon the offspring” and changed the attitude of people in this regard (Goody, 1983; Banerjee and Roy, 2002).

Now-a-days all living societies consider incest to be a taboo. However marriages between relatives are common while degree of relationship makes a marriage depend upon the custom and religion of society (Reddy, 1992; Bittles, 2001). In genetic studies, unions up to second cousins or closer are known as consanguineous marriages (Bittles, 2002). These marriages are strongly favored in many countries especially in Pakistan where overall prevalence of the consanguineous marriages is high, and ranges from 31.1% to 58.9% (Hussain and Bittles, 1998).

In literature various factors like religion, ethnicity, socioeconomic conditions, education, occupation, etc are discussed as consanguinity promotive factors (Jurdi and Saxena, 2003; Kir et al., 2005). The relationship between inbreeding and the health of human population has been a subject of major interest in medical genetics (Shami et al., 1989). A number of workers contributed to the various parameters of health like fertility (Verma et al., 1992; Bittles et al., 2002), pregnancy losses (Shami and Minhas, 1984; Verma et al., 1992; Hussain, 1998), morbidity and mortality among the offspring (Khoury and Massad, 2000; Tamim et al., 2003).

Furthermore the association between consanguinity and genetic disorders has been observed for a long time. It is found that the closer the relationship between parents, the more severe the effect on offspring (Seemanova, 1971). Various studies have revealed that inbreeding resulting from consanguinity contributes to elevated mortality levels of offspring through congenital defects and recessive genetic disorders (Stoltenberg et al., 1997; Tamim et al., 2003; Schulpen et al., 2006). That is why, it is suggested that about 60% of the mortality and severe morbidity could be eliminated by ceasing inbreeding in population (Bundey and Alam, 1993).

------31 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

The appreciation, understanding, management and prevention of genetic disorders in a certain population require the basic knowledge of the structure and prevalence of consanguinity. Unfortunately, representative information on consanguineous marriage is sparse or even unavailable. Therefore, in the present study we have described the various aspects of consanguineous marriages in population of Dera Ghazi Khan.

Materials and Methods

One thousand, six hundred and eleven families from general population and 322 afflicted couples having at least two genetically affected offspring or one genetically affected offspring with positive history were included and were interviewed for data collection about various aspects of consanguinity as described in Chapter 2.

Results

1. Data Collection

During the data collection, 5000 families belonging to different areas of the Dera Ghazi Khan District were approached randomly. In which, 1611 families (32.22%) responded positively and provided their consent to participate in this study. Ethnically, the highest positive response was found among Migrant families (74.40%) as compared to Native (28.73%) and Baloch families (25.13%). Table 3.1 presents relative numbers and percent frequencies of families belonging to different ethnic groups and administrative areas with in the sample. The Baloch, Migrant and Native families were 23.40%, 23.09%, and 53.51%, respectively. All the migrant families were settled in urban areas. Among Baloch, 85% families were tribal in origin, while the remaining (15%) settled in urban areas were found to be still in contact with their respective tribes. Among the Native, 78% families were rural. However, no family belonging to Migrant and Native groups came from tribal area.

2. Marriages

2.1. Endogamous and Exogamous Marriages

Endogamous marriages were found to be more prevalent in the population of DG Khan (70.52%). The frequencies of such marriages in ethnic groups were observed to be: 71.62%, 69.62%, and 70.42% in Baloch, Migrant, and Native couples (Table 3.2). The comparison of endogamous and exogamous marriages in Baloch, Migrant and Native 2 ethnic groups revealed a non-significant difference (χ 2= 0.367; 0.75 < P <0.90).

------32 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

However, highly significant differences were found between the prevalence of endogamous and exogamous marriages in total sample as well as within the ethnic 2 2 groups, Baloch, Migrant and Native (χ 1=271.22, P < 0.001; χ 1= 70.467, P < 0.001; 2 2 χ 1=57.30, P < 0.001 and χ 1= 141.74, P < 0.001, respectively).

2.2. Distribution of Marriage Types

All marriage types with diverse frequencies were found in three ethnic groups but the first cousin marriages were found to be more prevalent. The percentages of double first cousin, first cousin, first cousin once removed, second cousin, second cousin once removed, distantly related and non-related in total population were 2.731%, 38.733%, 2.669%, 9.435%, 1.304%, 15.642% and 29.485%, respectively.

Table 3.3 presents the percentages of various marriage types among ethnic groups. First cousin marriages were found more common in Natives as compared to Baloch and Migrants. However, non-related marriages were more prevalent in Migrants as compared to others. Statistically significant difference was observed among various types of 2 marriages in Baloch, Migrants and Natives (χ 12 = 42.622; P < 0.001).

2.3 First Cousin Marriages, Sub-Types

Among the various types of first cousin marriages, father’s brother’s daughter marriages were found predominant in all groups. Overall, parallel cousin marriages (FBD and MBD) were more frequent than cross cousin marriages (FSD and MSD). The relative numbers and percentages of various types of first cousin marriages are presented in Table 3.4. The different types of first cousin marriages in three ethnic groups did not differ 2 significantly (χ 5= 9.5193; 0.05 < P < 0.10).

2.4 Consanguineous and Non-Consanguineous Marriages

The frequency of consanguineous marriages in total population was 53.57%. Similarly in ethnic groups, the incidence of consanguineous marriages was 52.79%, 45.97% and 57.19 % in Baloch, Migrant and Native, respectively. Table 3.5 shows the comparison of consanguineous and non-consanguineous marriages in Baloch, Migrants 2 and Natives, which differed significantly (χ 2=13.285; 0.001 < P <0.005). In the total sample, significant difference was also found between consanguineous and non- 2 consanguineous marriages (χ 1= 8.209; 0.001 < P < 0.005). However non-significant difference was found between consanguineous and non-consanguineous marriages in 2 2 Baloch (χ 1=1.170; 0.25 < P < 0.30) and Migrant (χ 1 =2.420; 0.10< P < 0.20) while

------33 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity significant difference was found in consanguineous and non-consanguineous marriages of 2 Natives (χ 1=17.838; P < 0.001).

On further comparison, non-significant difference was found between the consanguineous marriages of Baloch and Migrant (Z =1.86; P > 0.05) and Baloch and Native (Z =1.438; P > 0.05) while significant difference was observed between the consanguineous marriages of Migrant and Native (Z =3.669; P < 0.05).

2.5 Trend of Consanguinity (Before and After 1975)

On the basis of year of marriage, the sample was further divided in to two groups i.e. the marriages commenced before and after 1975 (Table 3.6). Among couples married before 1975, consanguineous and non-consanguineous marriages were 56.34% and 44.42%, respectively; however after 1975 these were 52.94% and 47.06%, respectively. But the comparison showed non-significant difference between the consanguineous and 2 non-consanguineous marriages of two periods (χ 2=0.8264; 0.30< P < 0.50).

In the total sample, 2.64% decrease in consanguineous marriages was observed over the time. A similar trend was also observed among consanguineous marriages in Migrant and Native couples of these periods (i.e. 6.19% and 3.56% decrease respectively) but 2.73% increase in consanguineous marriages in Baloch couples was witnessed. However, analysis showed non-significant differences between consanguineous and non- consanguineous marriages of these periods within Baloch, Migrant and Native couples 2 2 2 i.e. (χ 1= 0.1857; 0.50< P < 0.70), (χ 1 = 1.1172; 0.25< P < 0.30), and (χ 1= 0.8172; 0.30 < P < 0.50) respectively.

2.6 Mean Inbreeding Coefficient (F)

The mean inbreeding coefficient (F) for the total population was calculated as 0.0301. Moreover, the mean inbreeding coefficients (F) for the Baloch, Migrant and Native populations were also found high (Table 3.5). These estimates showed the higher degree of consanguinity in Native and Baloch as compared to Migrant population. Table 3.7 presents the previous studies showing the relative number of consanguineous and non-consanguineous marriages along with inbreeding coefficient (F) of different populations of Pakistan.

3. Factors Effecting Rate of Consanguinity There are a number of factors which have direct or indirect impact on the rate of consanguinity. These factors include, but do not encompass all, cultural ties, caste, socio-

------34 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity economic conditions, family structure, educational level of spouses, religion, and geography. In the present study, the most significant factors have been presented which includes: education (both male and female education), male socioeconomic status, and male occupation. Education is always considered an important factor in selection of mate in all civilized societies.

3.1. Male Education In order to assess the impact of male education on the marriage types; the sample was divided in to three groups based on male schooling years at the time of marriage (see chapter 2). As a result, in total samples, the Group-I, II, and III representing the lower, middle and higher levels of male education comprised 270 (16.76%), 634 (39.35%), and 707 (43.89%) couples, respectively.

3.1.1. Marriage Types and Male Education As a whole, the first cousin marriages in Group-I and Group-II (48.5% and 42.1%, respectively), and unrelated marriages in Group-III (36.6%) were found to be more prevalent as compared to other types of marriages. However, for double first cousin marriages alone, the highest ratio (3.4%) was observed in Group-III. The relative number and percentages of different types of marriages with respect to the male educational level at the time of marriage in the sample are presented in Table 3.8.

Statistical comparison showed highly significant difference between various types 2 of marriage with respect to male educational level (χ 12 = 50.606; P < 0.001) in total sample. A decreasing trend in the ratios of first cousin, first cousin once removed and distant related marriages with increasing education level was observed. Specifically, for first cousin marriages the linear trend was found remarkable (R2 = 0.98; Figure 3.1; Table 3.8). On the contrary, a strong upward trend was observed for UR marriages with increasing education level (R2 = 0.99; Figure 3.1; Table 3.8).

Within ethnic groups, comparison between various types of marriage with respect to male educational level showed highly significant difference among Native couples 2 (χ 12 = 52.090; P < 0.001) and non-significant differences among Baloch and Migrant 2 2 couples (χ 12 =19.060; 0.05 < P < 0.10 and χ 12 =19.154; 0.05< P < 0.10, respectively). However, the ratios of first cousin marriages were found to be more prevalent in Group-I and Group-II with in all ethnic groups. However in Group-III, unrelated marriages in Migrant and Native communities (36% and 39.1%, respectively) and first cousin

------35 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity marriages in Baloch community (35.3%) were found most prevalent. Furthermore, the linear decline in prevalence of first cousin marriages was observed with increasing educational levels in Migrant and Natives but not in Baloch ethnic community.

3.1.2. Consanguinity and Male Education

The analysis showed that in the total sample there was a decline in the inbreeding coefficient (F) with increasing educational level (Figure 3.2). A similar trend was also witnessed in Native community. This trend, however, was not remarkable in Baloch and Migrant communities.

The relative number of consanguineous and non-consanguineous marriages and mean inbreeding coefficient (F) with respect to male education at the time of marriage are presented in Table 3.9. The statistical comparison between consanguineous and non- consanguineous marriages in the total sample with respect to male’s education showed 2 highly significant difference (χ 2= 21.777; P < 0.001). Further intra-group comparison in total sample showed that consanguineous marriages were significantly higher than non- consanguineous marriages in Group-I (Z = 3.8270; P < 0.05) and lower in Group-III (Z =

- 4.1506; P < 0.05) but non-significant difference in Group-II (Z = 1.1094; P > 0.05) was found.

With in ethnic groups, non-significant differences between consanguineous and non-consanguineous marriages with respect to male education were observed among 2 2 Migrant and Baloch couples (χ 2= 4.903; 0.05 < P < 0.10 and χ 2 = 0.293; 0.75 < P < 0.90 2 respectively) while significant difference was observed among Native couples (χ 2 = 27.929; P < 0.001). On further analysis , the cases of consanguineous couples as compared to non-consanguineous couples in Natives were found significantly higher in

Group-I (Z = 4.4294; P < 0.05) and significantly lower in Group-III (Z = - 4.734; P <

0.05) but difference in this regard was non-significant in Group-II (Z = 1.747; P > 0.05).

3.2. Female Education In order to evaluate the impact of female education on various marriage types, the total sample was divided in to three groups based on female schooling years at the time of marriage (see Materials and Methods). In total sample, the Group-I, II, and III representing the lower, middle and higher levels of female education consisted of 577 (35.82%), 627 (38.92%), and 407 (25.26%) couples, respectively.

------36 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

3.2.1. Marriage Types and Female Education As a whole, the first cousin marriages in Group-I and Group-II (49.4% and 37.2%, respectively) and unrelated marriages in Group-III (46%) were found the most prevalent marriage types.

The relative number and percentages of different types of marriages with respect to the female education at the time of marriage in the sample are presented in Table 3.10. Statistical comparison showed highly significant differences between various types of 2 marriage with respect to female education level in total sample (χ 12 =123.876; P < 0.001) 2 2 as well as in ethnic groups: Baloch (χ 12 = 28.152; 0.005 < P < 0.01), Migrant (χ 12 2 =35.541; P < 0.001), and Native couples (χ 12 = 81.061; P < 0.001). Moreover, the ratios of first cousin, first cousin once removed and distantly related marriages manifested a downward trend with increasing female education level. A more pronounced linear trend was revealed for first cousin marriages (R2 = 0.999; Figure 3.3; Table 3.10). Surprisingly, the double first cousin marriages had the highest ratio in Group-III. On the other hand, the ratios of unrelated marriages showed an upward trend with increasing female education level (R2 = 0.97; Figure 3.3; Table 3.10). Similar trends were also observed in individual ethnic communities.

3.2.2. Consanguinity and Female Education The data analysis manifested a negative correlation between female education and consanguinity (Figure 3.4). A clear decline in consanguinity and inbreeding coefficient (F) with increase in female education level was found in the total sample i.e. Group III (40.8%; 0.0222) < Group II (52.8%; 0.0285) < Group I (63.4%;0.0369). Similar tend was also observed in individual ethnic groups. The relative number of consanguineous and non-consanguineous marriages and mean inbreeding coefficient (F) with respect to female education at the time of marriage are presented in Table 3.11.

The statistical comparison between consanguineous and non-consanguineous marriages within total sample with respect to female education showed a highly 2 significant difference (χ 2 = 49.455; P < 0.001). ). On further analysis , the number of observed cases of consanguineous couples as compared to non-consanguineous couples

within the group were found significantly higher in Group I (Z = 6.0426; P < 0.05) and

significantly lower in Group-III (Z = - 5.9816 ; P < 0.05) while non-significant difference

was found in Group-II (Z = - 0.5021 ; P > 0.05).

------37 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

With-in ethnic groups, non-significant difference between the consanguineous and non-consanguineous marriages with respect to female education was found among 2 Migrant couples (χ 2 = 5.249; 0.05 < P < 0.10) while significant differences were found 2 2 among couples of Native and Baloch communities (χ 2= 39.046; P < 0.001 and χ 2 = 11.285; 0.001 < P < 0.005 respectively). On further statistical analysis , the number of consanguineous couples as compared to non-consanguineous couples was found

significantly higher in Group-I of Baloch (Z = 2.5458; P < 0.05) and Natives (Z = 5.5651;

P < 0.05) and significantly less in Group-III of Baloch (Z = -3.1588 ; P < 0.05) and

Native (Z = -5.0839 ; P < 0.05). However, differences between consanguineous and non-

consanguineous couples were found non-significant in Group -II of Baloch (Z = 0.6327; P

> 0.05) and Natives (Z = - 0.7050; P >0.05).

3.3. Male Socioeconomic Status In order to access the impact of male socioeconomic status at the time of marriage, the sample was divided into three categories with respect to male’s income and the availability of other life comforts (i.e., own residence, automobile, property and bank balance), at the time of marriage (see Materials and Methods). On this criteria, in the sample, 494 (30.66%), 586 (36.37%), and 532 (33.02%) couples were found in the groups of lower, middle and higher socioeconomic status respectively.

3.3.1. Marriage Types and Male Socioeconomic Status

The relative number and percentages of different types of marriages with respect to the socioeconomic status of male are shown in Table 3.12, which revealed significant difference between various marriage types with respect to male socioeconomic status 2 (χ 12 = 78.450; P < 0.001) in the total sample. Likewise, highly significant differences 2 2 were also observed in Baloch, Migrant and Native groups (χ 12 = 51.859; P < 0.001, χ 12 2 =27.449; 0.005 < P < 0.01, and χ 12 =48.507; P < 0.001, respectively).

Furthermore the analysis showed that within the total sample, first cousin marriages were found most prevalent in Lower and Middle socioeconomic levels, however, unrelated marriages predominated in the category of higher socioeconomic level (Table 3.12; Figure 3.5). This observation was also found true in almost all ethnic communities.

Furthermore, a tendency of decline in the ratios of first cousin marriages with increasing socioeconomic level was also observed. In particular, for first cousin marriages

------38 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity the linear downward trend was remarkable (R2 = 0.97; Figure 3.5). A similar trend for first cousin marriages was also observed in all ethnic communities. Conversely, a trend in the increase of unrelated marriages was revealed with increasing socioeconomic levels. However, this linear trend was not found very strong (R2=0.85; Figure 3.5). Interestingly, there was a slight increase in distantly related marriages with increasing socioeconomic levels. This later observation, however, was not found valid in Migrant ethnic group, in which there was a decline in ratio of DR marriages with increase in socioeconomic level.

3.3.2. Consanguinity and Male Socioeconomic Status

The analysis showed that in total sample there was a decrease in the inbreeding coefficient (F) with increasing male socioeconomic status (Figure 3.6; Table 3.13). This trend was also witnessed in Baloch and Native ethnic communities but not in Migrant.

The estimated mean inbreeding coefficient (F), relative number of consanguineous and non-consanguineous marriages with respect to male socioeconomic status at the time of marriages is presented in Table 3.13. Statistical analysis showed highly significant difference between consanguineous and non-consanguineous marriages in the total 2 sample with respect to male socioeconomic status at the time of marriages (χ 2 = 33.943; P <0.001).

On further intra- group comparison in total sample, observed number of consanguineous couples as compared to non-consanguineous couples were found

significantly high in male’s lower socio-economic group (Z = 4.2217; P < 0.05) and

significantly less in male’s higher socio-economic group (Z = -5.6435; P < 0.05). However in male’s middle socio-economic group, non-significant difference between

observed cases of consanguineous and non-consanguineous marriages were found (Z = 1.3583; P > 0.05).

Among ethnic groups, non-significant difference was found between the frequencies of consanguineous and non-consanguineous marriages with various male 2 socioeconomic status among Migrants (χ 2 = 5.920; 0.05 ≤ P < 0.10). But highly significant differences were found between the frequencies of consanguineous and non- consanguineous marriages with various male’s socioeconomic status among couples of 2 2 Native and Baloch communities (χ 2= 23.118; P < 0.001, and χ 2 =11.424; 0.001 < P < 0.005 respectively). On further analysis, the number of observed cases of consanguineous couples as compared to non-consanguineous couples were found significantly high in

------39 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

male lower socio-economic group of Baloch (Z = 3.1704; P < 0.05) and Native (Z = 3.7350; P < 0.05) and significantly less in male’s higher socio-economic group of Baloch

(Z = - 2.8180; P < 0.05) and Natives (Z = - 4.5469; P < 0.05). However, differences between consanguineous and non-consanguineous couples were found non-significant in

male’s middle socio-economic groups of Baloch (Z = - 0.1113; P > 0.05) and Native (Z = 0.3759; P > 0.05).

3.4. Male Occupation

To test the effect of male occupation at the time of marriage on various marriage types, the total collected sample is divided in to four groups (see Materials and Methods):such as 1024 (63.6%), 262 (16.3%), 149 (9.2%) and 176 (10.9%) couples were included in the Group-I, Group-II, Group-III and Group-IV respectively on the basis of male occupation.

3.4.1. Marriage Types and Male Occupation

The analysis showed that the ratios of first cousin marriages were pronounced in all occupational groups. There was an increasing trend in first cousin marriages from occupational Group-I to Group- III (35.3%, 39.7% and 57.0%, respectively), but in Group-IV the rate of first cousin marriages was declined (42%; Figure 3.7; Table 4.14). Similar trend was witnessed in Migrant and Native ethnic communities but not in Baloch. Remarkably, the decrease in ratios of unrelated marriages from occupational Group-I to Group-IV was observed and a linear trend was revealed (R2 = 0.91; Figure 3.7; Table 3.14). This trend was also found in Native but not in Baloch and Migrant.

The relative number and percentages of different types of marriages with respect to the husband occupation are shown in Table 3.15. Statistically, highly significant difference was found between various types of marriage and husband occupational groups 2 (χ 12 =67.955; P < 0.001) in total sample. Within various ethnic groups, highly significant 2 differences was also observed among couples of Native (χ 12 =50.160; P < 0.001) and 2 Baloch communities (χ 12 = 45.872; P < 0.001) but not among couples of Migrant 2 community (χ 12 =23.841; 0.10 < P < 0.25).

3.4.2. Consanguinity and Male Occupation

The analysis showed that marriage types were associated with male occupation. Highest inbreeding coefficient (F) and consanguinity were observed in occupational Group-III, whereas the Group-II showed lowest values (Figure 3.8; Table 3.15). The

------40 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Mean (F) and relative number of consanguineous and non-consanguineous marriages with respect to male occupation at the time of marriage is presented in Table 3.15.

The statistical comparison between consanguineous and non-consanguineous marriages in the total sample with respect to male occupation showed highly significant 2 difference (χ 2= 19.729; P < 0.001). On further analysis, with in different occupational groups, number of consanguineous couples as compared to non-consanguineous couples

were found significantly high in Group- III (Z = 4.838; P < 0.05) while non-significant differences were found in Group-I (Z = -1.825; P < 0.05), Group-II (Z = -1.2263; P >

0.05) and Group-IV (Z = 0.2800; P > 0.05). In ethnic groups, non-significant differences were found between consanguineous and non-consanguineous marriages with respect to 2 male occupational groups among couples of Migrant and Baloch ( χ 2 = 6.535; 0.10 < P < 2 0. 25 and χ 2 = 2.663; 0.25 < P < 0.50 respectively) but difference was significant among 2 Native couples (χ 2 = 19.508; P < 0.001).

On further comparison, the number of consanguineous couples as compared to non-consanguineous couples in Natives were found significantly less in occupational

Group- I (Z = -3.0701; P > 0.05) and high in Group-III (Z = 3.729; P > 0.05) and Group-

IV (Z = 2.325; P > 0.05) while non-significant difference in Group –II (Z = -1.000; P < 0.05) in Native were found in this regard.

4. Effects of Consanguinity

To study the effect of consanguinity on reproductive outputs, and genetic disorders, information were also collected.

4.1. Reproductive Outputs

Out of 1611 couples, 1328 couples were included to study the effects of consanguinity on reproductive outputs i.e. the mean pregnancy per couple, pregnancy loss, perinatal deaths, and infant deaths. Remaining 283 couples were found either newly married or with out child. Table 3.16 presents the relative number and mean, percentages of pregnancies, pregnancy losses, perinatal deaths, and infant deaths among consanguineous and non-consanguineous couples belonging to Baloch, Migrant, and Native ethnic groups.

4.1.1. Pregnancies Out of total 6462 recorded pregnancies among 1328 couples, the mean pregnancy per couple was (4.87 ± 0.077). On ethnic basis, the mean pregnancy per couple was

------41 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity highest among Baloch (5.1770 ± 0.1770) than Migrant (5.1535 ± 0.1722) and Native (4.6317 ± 0.0979). Statistical comparison of mean pregnancy per couple among interethnic groups showed significant differences between Native and Baloch (t1013 =

2.7144; 0.005 < P < 0.01), Native and Migrant (t1055 = 2.6354; 0.005 < P < 0.01) and non- significant differences between Baloch and Migrant (t582 = 0.1075; P > 0.50).

Overall, the mean pregnancies per consanguineous couple (4.9135 ± 0.1034) were found higher than non-consanguineous couples (4.6932 ± 0.1106) but the difference was

statistically non-significant (t1328 = 1.4541; 0.10 < P < 0.20; Table 3.16). Among ethnic groups statistical comparison of mean pregnancy per consanguineous and non- consanguineous couples showed non-significant differences in Migrant (t311 = 0.6972;

0.20 < P ≤ 0.50), Natives (t742 = 0.6225; P > 0.50) and Baloch (t269 = 0.2541; P > 0.50). Similarly non-significant differences were also found between inter-ethnic mean pregnancy per couple among consanguineous marriages of Native and Baloch (t588 =

1.9579; 0.02 < P ≤ 0.05) , Migrant and Baloch (t302 = 0.1967; P > 0.50) and non- consanguineous marriages between Baloch and Native (t423 = 1.8177; 0.05 < P < 0.10) ,

Migrant and Baloch (t278 = 0.2324; P > 0.50 ) , and Migrant and Natives (t467 = 1.7191; 0.05 < P < 0.10 ) while significant difference is found among consanguineous couples of

Migrant and Native (t586 = 2.0721; 0.02 < P < 0.05 ).

4.1.2. Pregnancy Loss

Out of 6462 pregnancies, loss of 327 (5.06%) pregnancies as a result of abortions and premature termination of pregnancies was observed while 6135 (94.94%) pregnancies were found matured after completion of the normal gestation period.

Overall, the pregnancy loss among consanguineous couples (4.48%) were found lower than non-consanguineous couples (5.80%) and the difference was statistically significant (Z = 2.3571; P < 0.05). In different ethnic groups, pregnancy loss in sample of Baloch, Migrant and Natives was 5.92%, 3.47% and 5.46% respectively. The statistical comparison of pregnancy losses out of total pregnancies between interethnic groups

showed non-significant differences between Native and Baloch (Z = 0.6571; P > 0.05),

and significant differences between Native and Migrants (Z = 3.6182; P < 0.05) and

Baloch and Migrants (Z = 3.1818; P < 0.05; Table 3.16)

Among consanguineous and non-consanguineous couples of different ethnic groups, pregnancy loss was found highest among non-consanguineous couples (6.55%) of

------42 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Natives (Table 3.18). Statistical comparison of pregnancy loss among pregnancies of consanguineous and non-consanguineous couples showed non-significant differences in Migrant (Z= 1.2105; P > 0.05) and Baloch (Z= 0.7076; P > 0.05) while significant difference in Natives (Z=2.3212; P < 0.05).

On comparing the pregnancy loss between ethnic groups, significant differences were found between pregnancies of consanguineous marriages of Migrant and Baloch (Z

= 2.630; P < 0.05), Migrant and Native (Z = 2.3506; P < 0.05) and non-consanguineous

marriages between Migrant and Baloch (Z = 2.0339; P < 0.05), and Migrant and Natives

(Z = 2.642; P < 0.05). However, non-significant differences were found between pregnancy loss among pregnancies of inter-ethnic consanguineous marriages of Native

and Baloch (Z = 0.8632; P > 0.05) and non-consanguineous marriages between Baloch and Native (Z = 0.965; P > 0.05).

4.1.3. Perinatal Deaths

Out of total 6135 births, 5964 (97.21 %) were found live born and 171(2.79 %) were found perinatal deaths (Table 3.16). The term ‘perinatal mortality’ includes both late fetal deaths (Still births) and early neonatal deaths. According to ethnic stratification, perinatal death out of total deliveries was lowest among Baloch (1.364%) than Natives 2.27%) and Migrants (5.074%). The statistical comparison of perinatal death out of total births between interethnic groups showed significant differences between Native and

Baloch (Z = 2.2098; P < 0.05), Native and Migrants (Z = 4.5161; P < 0.05) and Baloch

and Migrants (Z = 5.7906; P < 0.05).

Overall the perinatal death among consanguineous couple (3.34%) is found higher than non-consanguineous couples (2.07%) but the difference was statistically significant (Z = 3.0976; P < 0.05). Similarly, among consanguineous and non-consanguineous couples of different ethnic groups, perinatal death was also found highest among consanguineous couples of Migrants. Statistical comparison in perinatal death among pregnancies of consanguineous and non-consanguineous couples showed non- significant differences in Migrant (Z= 0.4091; P>0.05) and Baloch (Z= 1.915; P > 0.05) and significant difference in Natives (Z=2.3065; P < 0.05).

Similarly significant differences were also found between perinatal death among

pregnancies of inter-ethnic consanguineous marriages of Native and Baloch (Z = 2.0254;

P < 0.05), Migrant and Baloch (Z = 3.7402; P <0.05), Migrant and Native (Z = 2.4885; P

------43 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

<0.05) and non-consanguineous marriages between Migrant and Baloch (Z = 4.8706; P <

0.05), and Migrant and Natives (Z = 3.3860; P < 0.05). However, non-significant differences were found between perinatal death among pregnancies of inter-ethnic non-

consanguineous marriages between Baloch and Native (Z = 0.3077; P > 0.05).

4.1.4. Infant Death

The infant deaths in total sample of live births were (6.22%). The prevalence of infant deaths in different ethnic groups, Baloch, Migrants and Natives were 8.22%, 6.36% and 5.34% respectively (Table 3.16). The statistical comparison of infant deaths out of total live births between interethnic groups showed non-significant differences between

Native and Migrants (Z = 1.36; P > 0.05) and Baloch and Migrants (Z = 1.8788; P > 0.05)

and significant differences between Native and Baloch (Z = 3.3488; P < 0.05; Table 3.20).

Overall, infant deaths were found higher among consanguineous couple (7.27%) than non-consanguineous couples (4.87%). Statistical comparison in infant deaths among live births of consanguineous and non-consanguineous couples showed significant 2 difference in total population and in Migrant (χ 1= 3.7325; 0.05

Non-significant differences were found between infant deaths among live births of inter-ethnic consanguineous marriages of Migrant and Baloch (Z = 0.3288; P > 0.05)

, Native and Baloch (Z = 1.6869; P > 0.05) and non-consanguineous marriages between

Migrant and Natives (Z = 0.1089; P > 0.05) while significant differences were found between infant deaths among live births of inter-ethnic consanguineous marriages of

Migrant and Native (Z = 2.0336; P <0.05 ) and non-consanguineous marriages between

Migrant and Baloch (Z = 3.0918; P < 0.05), and Baloch and Native ( Z = 3.3651; P < 0.05).

4.2. Genetic Disorders

During the survey, 319 afflicted couples, having at least two genetically affected children or one genetically affected child with positive history, were identified. To study the effect of marriage types on specific group of genetic disorders, these couples were divided in to seven groups such as group of skin disorders, non-syndromic deafness, microcephally, muscular dystrophies, mental retardations, thalassemia, and digital abnormalities.

------44 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Among these, the group of skin disorders was found more heterogeneous. This group has included 17, 04, 04, 06, 11, 03, and 03 afflicted couples with albinism, xeroderma pigmentosa, ichthyosis, psoriasis, ectodermal dysphasia, nail disorder and alopecia, respectively. Furthermore 06 cases of Aposthia (natural circumcision) were also included in this group. Similarly, the groups of muscular dystrophies (MD), mental retardations and digital abnormalities were also found heterogeneous. In MD group, the couples were found to be affected with DMD and BMD (12 couples), and other types of MDs (4 couples). The couples of MR were also found with different and overlapping symptoms. However in case of digital anomalies group, only afflicted couples with syndactylies (31) and Brachydactylies (25) were included.

Over all the afflicted couples with Thalassemia were found most prevalent in the sample. The abundance of afflicted couples in different groups of disorders was found in the order: thalassemia (35.11%) > digital anomalies (17.55%) > skin anomalies (16.93%) > non-syndromic deafness (15.36%) > microcephally (5.64%) > muscular dystrophies (5.02%) > mental retardations (4.39%; Table 3.17). On ethnic base, 58.62%, 26.33% and 15.05% of total afflicted couples were found to be related with the Native, Baloch and Migrant groups respectively.

Endogamous marriages were found most abundant in afflicted couples (98.746%) as compared to general population (70.52%). In different groups of afflicted couples based on genetic disorders, endogamy was found 100% in skin anomalies, non-syndromic deafness, muscular dystrophies, mental retardations, and digital anomalies while 94.44% and 97.32% endogamy was found in couples affected with microcephally and thalassemia respectively (Table 3.18).

The frequency of consanguineous marriages in the sample of afflicted couples was 68.03% with mean inbreeding co-efficient 0.0366. Statistically significant difference was 2 found between consanguineous and non-consanguineous couples in the sample (χ 1= 41.4576; P< 0.001). Table 3.19 shows the mean coefficient of inbreeding, relative number and percentages of consanguineous and non-consanguineous marriages among afflicted couples with respect to the genetic disorder. The prevalence of consanguineous marriages along with mean value in various groups of disorders was found different in the order: microcephally (94.44%; 0.0564) > thalassemia (81.25%; 0.0453) > muscular dystrophies (75%; 0.0410) > skin disorders (59.26%; 0.0310) > non-syndromic deafness (59.18%; 0.0319) > digit anomalies (51.79%; 0.0243) > mental retardation (50%;

------45 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

0.0245). Statistical comparison showed significant differences between consanguineous 2 and non-consanguineous couples in the groups of microcephally (χ 1= 14.222; P < 0.001), 2 2 thalassemia ( χ 1= 43.75 ; P < 0.001) and muscular dystrophy (χ 1= 4.000; 0.025 < P < 0.05) while non-significant difference between consanguineous and non-consanguineous 2 was found among afflicted couples with skin anomalies ( χ 1=1.8518; 0.10 < P <0.25), 2 2 non-syndromic deafness (χ 1 = 1.653, 0.10 < P < 0.25 ), digit anomalies (χ 1 = 0.0714; P > 2 0.50 ) and mental retardation (χ 1=0000).

Comparison of consanguineous and non-consanguineous couples of general 2 population with afflicted couples showed highly significant difference (χ 2= 22.5781; P > 0.001; Table 3.20). Similarly consanguineous and non-consanguineous afflicted couples of Baloch and Native were significantly different from consanguineous and non- 2 consanguineous couples of general Baloch and Native populations (χ 2= 26.378; P > 2 0.001 and χ 2= 6.3378; 0.025 < P < 0.05 respectively) while among Migrants, difference 2 in both categories was non-significant ( χ 2= 0.01995; P > 0.50).

Discussion

In the present study, a survey was conducted to identify various aspects of marriage patterns especially consanguinity and to assess its impact on the population structure of Dera Ghazi Khan District of Punjab province.

The population of Indian sub-continent is stratified in to thousands of endogamous groups and people can’t marry out side their groups because of family and caste bindings (Gadgil et al., 1998). In the present study, our results also showed 70.52% endogamous marriages in the general population and 71.62%, 69.62%, and 70.42% in Baloch, Migrant, and Native populations, respectively (Table 3.2). The preference for endogamous marriages is mostly based on ethnicity and tribal/clan/caste affiliation. Within the bounds of endogamy defined by the above parameters, close consanguineous unions are preferential due to a congruence of key features of group- and individual-level background factors.

The present study revealed a high rate of consanguinity (53.57%) with 0.0301 mean coefficient of inbreeding in general population (Table 3.5). Our results are in agreement with the findings of a previous study conducted at Pakistan level by Hussain and Bittles, (1998). But the comparison with other populations of different areas of

------46 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Pakistan (Table 3.7) showed that present estimate of consanguinity in district DG Khan was significantly higher than most of the previously studied areas.

Possible reasons of high prevalence of consanguinity might be:

1. Tribalism is deeply rooted in civilization history of population understudy. It is simple ingrained human habit of identifying oneself in terms of group of viewing one’s own group as somehow ‘special’ and superior to others and of discouraging social intercourse with members of the other group.

2. High rate of endogamy along with the factors like geographical conditions, poverty, illiteracy and adverse means of transportation that have restricted the human movements, resulted the population stratification in to small communal groups where choice of appropriate mate becomes limited out side family.

3. Extended family culture existence in the area increases chance of consanguinity.

This study revealed a high rate of consanguinity in ethnic populations like Baloch (52.79%), Migrant (45.97%) and Native (57.19%; Table 3.5). These ethnic groups differed significantly from each other with respect to consanguineous marriages. Surprisingly, non-related marriages were found more prevalent in Migrants as compared to other ethnic populations. Possible reason of this unexpected result might be due to long historic association of Migrant with predominant population of Hindus of north western parts of India where consanguineous marriages were prohibited (Rao et al., 2002).

The social attitudes of population play role in preference for different types of cousin marriages (Reddy and Rao, 1978). The predominance of first cousin marriages (38.73%) among consanguineous couples in population understudy has already been recognized in different Pakistani populations. Furthermore, father’s brother’s daughter (FBD) marriages and parallel-cousin marriages were found common in all strata of our population (Table 3. 3, 3. 4). These findings are in conformity with those of other studies made in Pakistan (Shami and Iqbal, 1983; Shami and Minhas, 1984; Hussain and Bittles, 1998). Overall marriage pattern of study area reflected the patriarchal nature of society as stated by Wahab and Ahmad (1996). The high percentage of first cousin marriages may be due to a conservative social attitude prevailing in the population in which the key role of the eldest man in a family has a long established dominancy in all domestic affairs.

------47 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

In various countries, ups and downs in consanguinity rate with passage of time have been observed (Benjamin and Charles, 1994). On the other hand, in India and Pakistan no change in the incidence of consanguineous marriages with the passage of time was reported (Rao et al., 1972; Afzal, 1988). The present study also showed non- significant change in the incidence of consanguineous marriages (Table 3.6). The continuous stability in rate of consanguineous marriages indicates that there may be no appreciable development in socio-economic conditions of society under study. These changes usually occur because of industrialization and urbanization (Pena et al., 2002).

In the present study, we studied the effect of education (both male and female), male socioeconomic status, and male occupation on prevalence of consanguinity. Rate of consanguinity is found strongly linked with these factors (Table 3.8 to 3.15). The sample when categorized in different levels/status groups showed clear-cut boundaries in the frequencies of consanguineous marriages. The consanguineous marriages were found to be very common in lower level/status, while trend of consanguineous marriages decrease with increase in level/status. This gradient of change was very significant especially with female literacy. Consanguineous marriages were inversely proportional to female literacy.

This showed that female literacy had significant effect on consanguinity. It is evident that education gives the decision power to woman so they like to select/suggest a match of equal status, when not found in their family and they preferred to get married out side the family. All these findings correlated with previous studies from different areas of world (Afzal, 1988; Bittles 1991).

However interesting situation appeared, when we studied the effect of these factors in ethnic groups. Among Baloch and Native, the studied parameters have significant effect in reducing the consanguineous marriages but surprisingly the relative contribution of all these factors remain less explicit (visible) in Migrants. The likely reasons of this stringent attitude of Migrants might be the cultural norm associated with their origin. These cultural ties have been established due to long co-existence with the dominated and influential population of northern Hindus. On the other hand, the significant effect of studied factors evident in Baloch and Native could be attributed to a change in cultural norms /showing a transition from tribe to a rural society.

The effect of consanguinity on reproductive outputs were studied that revealed non-significant differences with respect to mean pregnancy per couple between

------48 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity consanguineous and non-consanguineous marriages. This result may be due to cultural influence. For example, female early age marriages are common, artificial pregnancy termination is considered a sin and production of offspring is the happiness of God and family elders

In case of pregnancy losses (Miscarriages, abortions, prenatal deaths), and perinatal deaths (still births, birth of dead child and early neonatal deaths), significantly positive and negative associations, respectively with consanguinity was observed in this study. Interestingly, non-significant differences with respect to pregnancy loss and perinatal deaths between consanguineous and non-consanguineous marriages were found among Baloch and Migrant populations.

According to Nair and Murthy (1985), genetic compatibility enhancement due to consanguinity would be expected between mother and fetus in consanguineous unions, which decrease the chances of pregnancy loss. On the other hand the causes of perinatal deaths are often due to maternal, obstetric and the conditions affecting babies during pregnancy and postnatal period (Fikree et al., 2002). The consanguineous couples usually live along extended families where pregnant females face poor nutritional status and lack of antenatal care which may be possible cause of perinatal deaths.

In case of infant death, the significant increase in infant death among consanguineous marriages as compared to non-consanguineous marriages was observed in population that is correlated with previous studies (Bittles et al., 1993; Stoltenberg et al., 1997; Hussain et al., 2001; Tamim et al., 2003). These studies suggested that elevated mortality levels of offspring among consanguineous marriages might be through congenital defects and recessive genetic disorders.

Considerable attention has been paid to the role of consanguineous marriage as a causative factor in the prevalence of genetic disorders, (Jain et al., 1993; Bittles, 2005). In the present study, the effect of marriage types on specific group of genetic disorders like skin disorders, non-syndromic deafness, microcephally, muscular dystrophies, mental retardations, thalassemia, and digital abnormalities was also analyzed. Overall endogamous marriages were found significantly most abundant among afflicted couples as compared to general population (Table 3.18). Similarly, consanguineous marriages were found significantly higher than non-consanguineous marriages among couples having offspring’s afflicted with microcephally, thalassemia and muscular dystrophy and

------49 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity non-significant difference between consanguineous and non-consanguineous marriages was found in case of skin anomalies, non-syndromic deafness, digit anomalies and mental retardation. This finding correlate to the findings of studies conducted in Palestinian by Zlotogora et al., 2002).

The skin anomalies, digit anomalies and mental retardation groups were predominantly composed of autosomal recessive type disorders. Several studies have demonstrated that the autosomal recessive disorders have been found in excess among the offspring of consanguineous couples (Vanita et al., 1999; Kaur and Balgir, 2005). Because it is usually thought that closely related individuals have a higher probability of carrying the same alleles than less related individuals. Consequently, an inbred child will more frequently be homozygous for various alleles than the offspring of unrelated persons (Overall and Nichols, 2001).

During present study, similar conditions i.e. strict endogamy and positive family history was observed among the rarely occurring skin quantitative trait or disorder- Aposthia (Absence of fore-skin of the glans penis) affected cases. Furthermore the genetic analysis showed that the trait is inherited from aposthia father to aposthia son. This mode of inheritance indicates that the expression of aposthia condition requires certain Y-linked modifier loci in addition to a number of autosomal recessive genes. The appearance of the trait may be due to aggregation of recessive loci and special Y- chromosome with modifier locus because of strict endogamy and frequent consanguineous marriages that increases inbreeding (Din et al., 2007).

Bittles et al. (2004) in Indian population found higher rate of autosomal recessive deafness among communities with higher consanguinity. Surprisingly in present study, non-significant difference between consanguineous and non-consanguineous couples in respect of deafness was found. This suggests that the people of the area have sufficient knowledge about the genetic nature of deafness.

------50 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.1: Data summary on basis of Ethnicity and Tehsils

Sample DG Khan Tanusa Tribal Total Couples

377 Baloch 73 37 267 (23.40%)

372 Migrants 365 07 00 (23.09%)

862 Natives 692 170 00 (53.51%)

Total 1130 214 267 1611

Table 3.2: The comparison of Endogamous and Exogamous marriages between Baloch, Migrant and Native couples from Dera Ghazi Khan Population

Sample Endogamous Exogamous Total 2 χ 1 marriages marriages

Baloch 270 107 377 70.467 (71.62%) (28.38%) P < 0.001 Migrant 259 113 372 57.30 (69.62%) (30.38%) P < 0.001 Native 607 255 862 141.74 (70.42%) (29.58%) P < 0.001 Total 1136 475 1611 271.22 (70.52%) (29.48%) P < 0.001 2 χ 2 = 0.367; 0.90 < P < 0.75

------51 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.3: Distribution of marriage types in Baloch, Migrant and Native

Type of F Balochis Migrants Natives Total marriage DFC 0.125 15 05 24 44 (3.98%) (1.34%) (2.78%) (2.73%) FC 0.0625 137 134 353 624 (36.34%) (36.02%) (40.95%) (38.73%) FCOR 0.0313 13 06 24 43 (3.45%) (1.61%) (2.78%) (2.67%) SC 0.0156 34 26 92 152 (9.02%) (6.99%) (10.67%) (9.44%) SCOR 0.0078 05 01 15 21 (1.33%) (0.27%) (1.74%) (1.30%) DR < 0.0078 66 87 99 252 (17.51%) (23.39%) (11.48%) (15.64%) NR 0 107 113 255 475 (28.38%) (30.38%) (29.58%) (29.49%) Total 377 372 862 1611 2 χ 12 = 42.622; P > 0.001 Double first cousin (DFC), first cousin (FC), first cousin once removed (FCOR), second cousin (SC), second cousin once removed (SCOR), distantly related (DR) and non-related (NR)

Table 3.4: Distribution of various types of first cousin marriages among Baloch, Migrant and Native samples

Marriage Baloch Migrant Native Total with %age No. %age No. %age No. %age No.

40.06 FBD 65 47.45 54 40.30 131 37.11 250

20.83 MSD 18 13.14 27 20.15 85 24.08 130

16.35 FSD 26 18.98 21 15.67 55 15.58 102

22.76 MBD 28 20.44 32 23.88 82 23.23 142

Total 137 100 134 100 353 100 624 100

2 χ 5= 9.5193; 0.50< P < 0.25

Father’s brother daughter (FBD), mother’s sister daughter (MSD), father’s sister daughter (FSD) and mother’s brother daughter (MBD)

------52 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.5: Comparison of consanguineous and non-consanguineous marriages in Baloch, Migrant and Native

Sample Mean F CM NCM 2 χ 1 Baloch 0.0303 199 178 1.170 (52.79%) (47.21%) P < 0.25 Migrant 0.0258 171 201 2.420 (45.97%) (54.03%) 0.25< P < 0.10 Native 0.0318 493 369 17.838 (57.19%) (42.81%) P > 0.001 Total 0.0301 863 748 8.209 (53.57%) (46.43%) P >0.05 2 χ 2=13.285; 0.005< P < 0.001 Consanguineous marriages (CM) Non consanguineous marriages (NCM)

Table 3.6: Distribution of consanguineous and non-consanguineous marriages among Baloch, Migrant and Native over the time

2 Sample CM NCM Total χ 2 Up to 40 39 79 1975 50.63% 49.37% 0.1857 Baloch After 159 139 298 1975 53.36% 46.64% Up to 50 49 99 1975 50.51% 49.49% 1.1172 Migrant After 121 152 273 1975 44.32% 55.68% Up to 124 83 207 1975 59.90% 40.10% 0.8172 Native After 369 286 655 1975 56.34% 43.66 Up to 214 171 385 1975 55.58% 44.42% 0.8264 Total After 649 577 1226 1975 52.94% 47.06%

Consanguineous marriages (CM) Non consanguineous marriages (NCM)

------53 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.7: The comparison of inbreeding coefficient in Dera Ghazi Khan with various other Pakistani populations

2 Locality Type of marriage Reference χ 1 CM NCM Total F Jhelum 455 572 1027 0.0262 Shami and Minhas(1984) 21.537*

Lahore 456 510 966 0.0269 Shami and Zahida (1982) 9.789*

Mianchannu 51 84 135 0.0236 Shami (1983) 12.453*

Muridke 103 148 251 0.024 Shami (1983) 13.665*

Rawalpindi 481 519 1000 0.0286 Shami and Siddiqui(1984) 7.3887*

Sheikhupura 492 515 1007 0.0271 Shami and Iqbal (1983) 5.5083#

Swat 449 569 1018 0.0168 Wahab and Ahmad (1996) 22.3452*

DG Khan 863 748 1611 0.03013 Present study

Consanguineous marriages (CM) Non consanguineous marriages (NCM) Significant (*), Non-significant (#)

------54 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.8: Distribution of marriage types with respect to the husband’s educational level at time of marriage

Population Education Marriage types Total 2 χ 12 level DFC FC FCOR SC SCOR DR UR Group-I 2 14 4 4 2 9 10 45

%age 4.4 31.1 8.9 8.9 4.4 20.0 22.2 100 Group-II 3 47 4 10 3 24 26 117 19.060

Baloch %age 2.6 40.2 3.4 8.5 2.6 20.5 22.2 100 0.01< P < Group-III 10 76 5 20 0 33 71 215 0.05

%age 4.7 35.3 2.3 9.3 0 15.3 33.0 100 Total 15 137 13 34 5 66 107 377 Group-I 1 40 1 6 0 24 13 085

%age 1.2 47.1 1.2 7.1 0 28.2 15.3 100 Group-II 1 52 1 9 1 34 50 148 19.154

Migrant %age 0.7 35.1 0.7 6.1 0.7 23.0 33.8 100 0.01< P < Group-III 3 42 4 11 0 29 50 139 0.05

%age 2.2 30.2 2.9 7.9 0 20.9 36.0 100 Total 5 134 06 26 01 87 113 372 Group-I 3 77 8 13 0 14 25 140

%age 2.1 55.0 5.7 9.3 0 10.0 17.9 100 Group-II 10 168 12 34 8 45 92 52.090 369 Native %age 2.7 45.5 3.3 9.2 2.2 12.2 24.9 P > 0.001 Group-III 11 108 4 45 7 40 138 353

%age 3.1 30.6 1.1 12.7 2.0 11.3 39.1 100 Total 24 353 24 92 15 99 255 862 Group-I 6 131 13 23 2 47 48 270

%age 2.2 48.5 4.8 8.5 0.7 17.4 17.8 100 Group-II 14 267 17 53 12 103 168 634 50.606 Total

sample %age 2.2 42.1 2.7 8.4 1.9 16.2 26.5 100 P > 0.001 Group-III 24 226 13 76 7 102 259 707

%age 3.4 32.0 1.8 10.7 1.0 14.4 36.6 100 Total 44 62 4 15 21 252 475 1611

DFC = double first cousin, FC= first cousin, FCOR= first cousin once removed, SC= second cousin, SCOR= second cousin once removed, DR= distantly related, UR= unrelated.

------55 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Figure 3.1: Distribution of marriage types with respect to husband’s education

60 DFC 2 R = 0.9835 FC

R2 = 0.9982 FCOR 40 SC

SCOR

DR 20 Percentage % UR

Linear (FC)

0 Linear (UR) Low Middle High Husband's Educational Level

DFC = double first cousin, FC= first cousin, FCOR= first cousin once removed, SC= second cousin, SCOR= second cousin once removed, DR= distantly related, UR= unrelated. Linear trends with R2 values in boxes are calculated for FC and UR marriages

Figure 3.2: Husband’s education vs. consanguinity and Mean (F)

80 Consanguinity (%) 0.04 0.0359 Inbreeding coefficient (F)

0.0312 60 0.03 0.0266

40 0.02 Mean (F) Mean Percentage 20 0.01

0 0 Low Middle High Husband's Educational Level

------56 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.9: Mean inbreeding coefficient (F), consanguineous and non-consanguineous marriages with respect to husband’s education

Husband’s Education Level Population Mean (F) and Total

Marriage type Lower Middle Higher Mean (F) 0.0292 0.0307 0.0301

Consanguineous 24 64 111 199

Baloch Non-consanguineous 21 53 104 178

Total 45 117 215 377

Significance χ2 = 0.293; 0.90 < P< 0.75 2 Mean (F) 0.0324 0.0236 0.0237

Consanguineous 48 63 60 171

Migrant Non-consanguineous 37 85 79 201 Total 85 148 139 372

Significance χ2 = 4.903; 0.10 < P< 0.05 2 Mean (F) 0.0403 0.0343 0.0254

Consanguineous 101 224 168 493

Native Non-consanguineous 39 145 185 369 Total 140 369 353 862

Significance χ2 = 27.929; P>0.001 2 Mean (F) 0.0359 0.0312 0.0266

Consanguineous 173 351 339 863

Total sample Non-consanguineous 97 283 368 748 Total 270 634 707 1611

Significance χ2 = 21.777; P>0.001 2

------57 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.10: Distribution of marriage types with respect to the female’s educational level at time of marriage

Population Education level Marriage types Total 2 χ 12 DFC FC FCOR SC SCOR DR UR Group-I 6 54 7 11 2 22 24 126

%age 4.8 42.9 5.6 8.7 1.6 17.5 19.0 100 Group-II 6 51 5 9 3 24 31 129 28.152

Baloch %age 4.7 39.5 3.9 7.0 2.3 18.6 24.0 100 0.01 < P< Group-III 3 32 1 14 0 20 52 122 0.005

%age 2.5 26.2 0.8 11.5 0 16.4 42.6 100 Total 15 137 13 34 5 66 107 377 Group-I 2 67 3 8 0 42 30 152

%age 1.3 44.1 2.0 5.3 0 27.6 19.7 100 Group-II 0 48 1 13 1 35 45 143 35.541 Migrant %age 0 33.6 0.7 9.1 0.7 24.5 31.5 100 P>0.001 Group-III 3 19 2 5 0 10 38 77

%age 3.9 24.7 2.6 6.5 0 13.0 49.4 100 Total 5 134 6 26 01 87 113 372 Group-I 9 164 13 22 2 34 55 299

%age 3.0 54.8 4.3 7.4 0.7 11.4 18.4 100 Group-II 8 134 10 46 11 45 101 355 81.061 Native %age 2.3 37.7 2.8 13.0 3.1 12.7 28.5 100 P>0.001 Group-III 7 55 1 24 2 20 99 208

%age 3.4 26.4 0.5 11.5 1.0 9.6 47.6 100 Total 24 353 24 92 15 99 255 862 Group-I 17 285 23 41 4 98 109 577

%age 2.9 49.4 4.0 7.1 0.7 17.0 18.9 100 Group-II 14 233 16 68 15 104 177 627 123.876 Total

sample %age 2.2 37.2 2.6 10.8 2.4 16.6 28.2 100 P>0.001 Group-III 13 106 4 43 2 50 189 407

%age 3.2 26.0 1.0 10.6 0.5 12.3 46.4 100 Total 44 624 43 152 21 252 475 1611

------58 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Figure 3.3: Distribution of marriage types with respect to female education

60 DFC

R2 = 0.9994 FC R2 = 0.9663 FCOR 40 SC

SCOR

DR 20 Percentage % UR

Linear (FC)

0 Linear (UR) Low Middle High Female's Educational Level

DFC = double first cousin, FC= first cousin, FCOR= first cousin once removed, SC= second cousin, SCOR= second cousin once removed, DR= distantly related, UR= unrelated. Linear trends with R2 values in boxes are calculated for FC and UR marriages.

Figure 3.4: Female’s education vs. consanguinity and Mean (F)

80 Consanguinity (%) 0.04 0.0369 Inbreeding coefficient (F)

60 0.03 0.0285

0.0222 40 0.02 Mean (F) Mean Percentage 20 0.01

0 0 Low Middle High Female's Educational Level

------59 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.11: Mean inbreeding coefficient (F), consanguineous and non-consanguineous marriages with respect to the Female’s educational level

Mean (F) and Female’s Educational Level Population Total Marriage type Lower Middle Higher

Mean F 0.0358 0.0328 0.0215

Consanguineous 78 71 50 199

Baloch Non- 48 58 72 178 consanguineous Total 126 129 122 377

Significance χ2 = 11.285; 0.005 < P< 0.001 2 Mean F 0.0306 0.0226 0.0221 total

Consanguineous 80 62 29 171

Non- Migrant 72 81 48 201 consanguineous Total 152 143 77 372

Significance χ2 = 5.249; 0.10 < P< 0.05 2 Mean F 0.0406 0.0363 0.0228 total

Consanguineous 208 198 87 493

Non- Native 91 157 121 369 consanguineous Total 299 355 208 862

Significance χ2 = 39.046; P>0.001 2 Mean F 0.0369 0.0285 0.0222 total

Consanguineous 366 331 166 863

Non- Total sample 211 296 241 748 consanguineous Total 577 627 407 1611

Significance χ2 = 49.455; P>0.001 2

------60 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.12: Distribution of various marriage types with respect to the husband’s socioeconomic status at the time of marriage

Population Socioeconomic Marriage types Total 2 χ 12 status DFC FC FCOR SC SCOR DR UR Low 6 50 5 10 4 17 17 109

%age 5.5 45.9 4.6 9.2 3.7 15.6 15.6 100 Middle 7 36 6 17 1 32 27 126 51.859; Baloch %age 5.6 28.6 4.8 13.5 0.8 25.4 21.4 100 P>0.001 High 2 51 2 7 0 17 63 142

%age 1.4 35.9 1.4 4.9 0 12.0 44.4 100 Total 15 137 13 34 5 66 107 377 Low 1 42 0 1 1 28 26 99

%age 1.0 42.4 0 1.0 1.0 28.3 26.3 100 Middle 4 61 4 17 0 37 41 164 27.449; Migrant 0.01

%age 0 28.4 1.8 7.3 0 20.2 42.2 100 Total 5 134 6 26 1 87 113 372 Low 6 149 14 19 3 26 68 285

%age 2.1 52.3 4.9 6.7 1.1 9.1 23.9 100 Middle 8 122 6 39 7 35 79 296 48.507; Native %age 2.7 41.2 2.0 13.2 2.4 11.8 26.7 100 P>0.001 High 10 82 4 34 5 38 108 281

%age 3.6 29.2 1.4 12.1 1.8 13.5 38.4 100 Total 24 353 24 92 15 99 255 862 Low 13 241 19 30 8 71 111 493

%age 2.6 48.9 3.9 6.1 1.6 14.4 22.5 100 Middle 19 219 16 73 8 104 147 586 Total 78.450; sample %age 3.2 37.4 2.7 12.5 1.4 17.7 25.1 100 P>0.001 High 12 164 8 49 5 77 217 532

%age 2.3 30.8 1.5 9.2 0.9 14.5 40.8 100 Total 44 624 43 152 21 252 475 1611

DFC = double first cousin, FC= first cousin, FCOR= first cousin once removed, SC= second cousin, SCOR= second cousin once removed, DR= distantly related, UR= unrelated.

------61 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Figure 3.5: Distribution of marriage types with respect to husband’s socioeconomic status

60 DFC

R2 = 0.9762 FC R2 = 0.8541 FCOR 40 SC

SCOR

DR 20 Percentage % UR

Linear (FC)

0 Linear (UR) Low Middle High Socioeconomic Status

DFC = double first cousin, FC= first cousin, FCOR= first cousin once removed, SC= second cousin, SCOR= second cousin once removed, DR= distantly related, UR= unrelated. Linear trends with R2 values in boxes are calculated for FC and UR marriages

Figure 3.6: Husband’s socioeconomic status vs. consanguinity and Mean (F)

80 0.04 Consanguinity (%) 0.0361 Inbreeding coefficient (F)

60 0.0303 0.03

0.0241 40 0.02 Mean (F) Mean Percentage 20 0.01

0 0 Low Middle High Husband's Socioeconomic Status

------62 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.13: Mean inbreeding coefficient (F), consanguineous and non-consanguineous marriages with respect to socioeconomic status

Population Mean (F) and Socioeconomic status Marriage type Total Low Middle High

Mean (F) 0.0384 0.0284 0.0254

Consanguineous 71 66 62 199

Baloch Non-consanguineous 38 60 80 178

Total 109 126 142 377

Significance χ2 =11.424; 0.005 < P< 0.001 2 Mean (F) 0.0279 0.0287 0.0211

Consanguineous 44 86 41 171

Migrant Non-consanguineous 55 78 68 201 Total 99 164 109 377

Significance χ2 =5.920; 0.025 < P< 0.01 2 Mean (F) 0.0379 0.0321 0.0250

Consanguineous 188 175 130 493

Native Non-consanguineous 97 121 151 369 Total 285 296 281 862

Significance χ2 = 23.118; P>0.001 2 Mean (F) 0.0361 0.0303 0.0241

Consanguineous 303 327 233 863

Total sample Non-consanguineous 190 259 299 748

Total 493 586 532 1611 Significance χ2 = 33.943; P>0.001 2

------63 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.14: Distribution of marriage types with respect to the husband’s occupational groups

Population Occupational Marriage types 2 Total χ 18 group DFC FC FCOR SC SCOR DR UR I 12 110 9 27 1 47 90 296

%age 4.1 37.2 3.0 9.1 0.3 15.9 30.4 100

II 0 7 1 2 0 2 8 20 45.872 %age 0 35.0 5.0 10.0 0 10.0 40.0 100

Baloch III 2 5 1 2 0 0 2 12 P>0.001 %age 16.7 41.7 8.3 16.7 0 0 16.7 100 IV 1 15 2 3 4 17 7 49 %age 2.0 30.6 4.1 6.1 8.2 34.7 14.3 100 Total 15 137 13 34 5 66 107 377 I 4 59 3 16 0 34 66 182

%age 2.2 32.4 1.6 8.8 0 18.7 36.3 100

II 0 44 3 7 1 29 32 116 23.841 %age 0 37.9 2.6 6.0 0.9 25.0 27.6 100 Migrant III 0 18 0 1 0 9 5 33 %age 0 54.5 0 3.0 0 27.3 15.2 100 IV 1 13 0 2 0 15 10 41 %age 2.4 31.7 0 4.9 0 36.6 24.4 100 Total 5 134 6 26 1 87 113 372 I 17 192 12 70 9 63 183 546

%age 3.1 35.2 2.2 12.8 1.6 11.5 33.5 100

II 3 53 2 9 3 23 33 126

%age 2.4 42.1 1.6 7.1 2.4 18.3 26.2 100 50.160 Native III 1 62 5 8 2 4 22 104 P>0.001 %age 1.0 59.6 4.8 7.7 1.9 3.8 21.2 100 IV 3 46 5 5 1 9 17 86 %age 3.5 53.5 5.8 5.8 1.2 10.5 19.8 100 Total 24 353 24 92 15 99 255 862 I 33 361 24 113 10 144 339 1024

%age 3.2 35.3 2.3 11.0 1.0 14.1 33.1 100

II 3 104 6 18 4 54 73 262

%age 1.1 39.7 2.3 6.9 1.5 20.6 27.9 100 67.955 Total III 3 85 6 11 2 13 29 149 sample P>0.001 %age 2.0 57.0 4.0 7.4 1.3 8.7 19.5 100 IV 5 74 7 10 5 41 34 176 %age 2.8 42.0 4.0 5.7 2.8 23.3 19.3 100 G.Total 44 624 43 152 21 252 475 1611

DFC = double first cousin, FC= first cousin, FCOR= first cousin once removed, SC= second cousin, SCOR= second cousin once removed, DR= distantly related, UR= unrelated.

------64 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Fig 3.7: Distribution of marriage types with respect to husband’s occupational groups

60 DFC

FC

FCOR 40 SC 2 R = 0.9068 SCOR 20 Percentage % DR

UR

0 Linear (UR) I II III IV Occupational Group

DFC = double first cousin, FC= first cousin, FCOR= first cousin once removed, SC= second cousin, SCOR= second cousin once removed, DR= distantly related, UR= unrelated. Linear trend with R2 value in the box is calculated for UR marriages.

Figure 3.8: Husband’s occupational group vs. consanguinity and Mean (F)

100 0.05 Consanguinity (%) Inbreeding coefficient (F) 80 0.0406 0.04

0.0322 60 0.03 0.0285 0.0281

40 0.02 (F) Mean Percentage

20 0.01

0 0 I II III IV Husband's Occupational Group

------65 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.15: Mean inbreeding coefficient (F), consanguineous and non-consanguineous marriages with respect to husband’s occupational group

Husband’s occupational group Population Mean (F) and Marriage type Total I II III IV Mean F 0.0307 0.0250 0.0521 0.0239

Consanguineous 158 10 10 21 199

Baloch Non- 138 10 02 28 178 consanguineous Total 296 20 12 49 377

Significance χ2 = 6.535 0.25 < P< 0.10 3 Mean F 0.0248 0.0255 0.0346 0.0236

Consanguineous 82 54 19 16 171

Non- Migrant 100 62 14 25 201 consanguineous Total 182 116 33 41 372

Significance χ2 = 2.663 0.50 < P< 0.25 3 Mean F 0.0425 0.0309 0.0412 0.0405

Consanguineous 291 67 76 59 493

Non- Native 255 59 28 27 369 consanguineous Total 546 126 103 86 862

Significance χ2 = 19.508 P>0.001 3 Mean F 0.0285 0.0281 0.0406 0.0322

Consanguineous 531 131 105 96 863

Non- Main 493 131 44 80 748 consanguineous Total 1024 262 149 176 1611

Significance χ2 = 19.729 P>0.001 3

------66 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.16: Distribution of mean pregnancies, pregnancy loss, perinatal and infant death among consanguineous and non-consanguineous couple in Baloch, Migrants and Natives

Pregnancy Perinatal Pregnancy Infant death Population Attribute loss death No X No % No % No % 5.209 CM 797 ± 44 5.52 14 1.859 61 8.25 0.237 5.119 NCM 606 ± 39 6.44 04 0.70 46 8.17 Baloch 0.265 5.170 Total 1403 ± 83 5.92 18 1.364 107 8.22 0.177 t = 0.2541 Z= 0.7076 Z= 1.915 Z = 0.0526 P Significance P >0.50 P > 0.05 P>0.05 > 0.05 5.278 CM 797 ± 23 2.89 41 5.30 64 8.73 0.258 5.037 NCM 816 ± 33 4.04 38 4.85 30 4.03 Migrant 0.230 5.154 Total 1613 ± 56 3.47 79 5.07 94 6.36 0.172 t = 0.6972 Z= 1.2105 Z= 0. 4091 Z = 3.7325 Significance P ≤ 0.50 P > 0.05 P >0.05 P < 0.05 4.683 CM 2042 ± 96 4.70 61 3.135 119 6.31 0.125 4.558 NCM 1404 ± 92 6.55 13 0.99 51 3.93 Native 0.157 4.632 Total 3446 ± 188 5.46 74 2.27 170 5.34 0.098 t = 0.6225 Z= 2.3212 Z= 2.3065 Z = 3.0909 Significance P > 0.50 P < 0.05 P < 0.05 P < 0.05 4.914 CM 3636 ± 163 4.48 116 3.34 244 7.27 0.103 4.693 NCM 2826 ± 164 5.80 55 2.07 127 4.87 Total 0.111 4.861 Total 6462 ± 327 5.06 171 2.79 371 6.22 0.077 t = 1.4541 Z= 2.3571 Z= 3.0976 Z = 3.8709 P Significance P < 0.20 P < 0.05 P < 0.05 < 0.05 X = average with Standard error

------67 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.17: Data Collection Summary of Afflicted Couples

Genetic Disorders Ethnic Groups Total 1 2 3 4 5 6 7

84 Baloch 14 11 05 02 00 52 00

26.33 % 16.67 13.09 5.95 2.38 00 61.90 00.00

49 Migrant 10 03 08 02 04 04 18

15.36 % 20.83 6.25 16.67 4.17 8.33 8.33 37.50

186 Native 30 35 05 12 10 56 38

58.31 % 16.04 18.72 2.67 6.42 5.35 29.95 20.32

Total 54 49 18 16 14 112 56 319

% 16.93 15.36 5.64 5.02 4.39 35.11 17.55 100

1= Skin anomalies; 2= Non-syndromic deafness; 3= Microcephally; 4= Muscular dystrophies; 5= Mental retardations; 6=Thalassaemia; 7= Digit abnormalities

Table 3.18: Distribution of endogamous and exogamous marriages among afflicted couples with respect to the disorder

Marriage Genetic Disorders Types 1 2 3 4 5 6 7 Total EDM 54 49 17 16 14 109 56 315 % 100 100 94.44 100 100 97.32 100 98.746 EXM 00 00 01 00 00 03 00 04 % 00 00 05.56 00 00 02.678 00 01.254 Total 54 49 18 16 14 112 56 319 1= Skin anomalies; 2= Deafness; 3= Microcephally 4= Muscular dystrophy; 5= Mental retardation; 6=Thalassaemia 7= Digit abnormalities; EDM =Endogamous marriages; EXM =Exogamous marriages.

------68 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 3 Consanguinity

Table 3.19: Distribution of Consanguineous and Non-consanguineous marriages and mean (F) values among afflicted couples with respect to the Disorder

Marriage Genetic Disorders Types 1 2 3 4 5 6 7 Total

F .0310 .0319 .0564 .0410 .0451 .0476 .0243 .0366

CM 32 29 17 12 07 91 29 217 % 59.26 59.18 94.44 75.00 50.00 81.25 51.79 68.03

NCM 22 20 01 04 07 21 27 102 % 40.74 40.82 05.56 25.00 50.00 18.75 48.21 31.97 Total 54 49 18 16 14 112 56 319 2 χ 1 1.852 1.653 14.222 4.00 00.00 43.75 0.0714 40.028 significance N.S N.S S S N.S S N.S S 1= Skin anomalies; 2= Non-syndromic deafness; 3= Microcephally; 4= Muscular dystrophies; 5= Mental retardations; 6=Thalassaemia; 7= Digit abnormalities; CM = Consanguineous marriages; NCM = Non- consanguineous marriages; S=Significant; N.S= Non-significant.

Table 3.20: Comparison of Consanguineous and Non-consanguineous marriages between general couple and afflicted couples of Baloch, Migrant and Native

Ethnicity CM NCM Total χ2 1 GC 199 178 377 26.378 Baloch AC 70 14 84 P > 0.001 Total 269 192 461 GC 171 201 372 0.01995 Migrant AC 22 27 49 P > 0.50 Total 193 228 421 GC 493 369 862 6.33780.

Native AC 125 61 186 025 < P < Total 618 430 1048 0.05 GC 863 748 1611 22.5781 Total AC 217 102 319 P > 0.001 Total 1080 850 1930

GC = General couples; AC=Afflicted couples

------69 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

Skin Disorders Introduction

The skin disorders comprise a heterogeneous group of diseases, produced because of anatomical and physiological malfunctions of various skin components. Normally the human skin consists of three layers. The epidermis is a thick, keratinized, outer most epithelial layer, composed of keratinocytes, melanocytes, merkel, and langerhans cells, arranged in four sub-layers: stratum basale, stratum spinosum, stratum granulosum, and stratum corneum. In palmoplantar skin, an additional layer, the stratum lucidum lies below stratum corneum. Beneath the epidermis, the dermis layer consisting collagen, reticular fibers, elastic fibers, and ground substance, is divided into the upper papillary layer and the lower reticular layer. The papillae layer produces the ridged fingerprints. The major part of ectodermal appendages like hair follicles and glands reside in this layer. The hypodermis layer attaches the dermis to underlying tissues (Moore et al., 1998; Merrill et al., 2001).

The epidermis proliferates throughout life and differentiates into nails, hair, sebaceous and sweat glands. Nails are located at the ends of fingers and toes while hair and sebaceous glands are located throughout skin except palms and soles. The hair has an expanded root and a shaft, hidden in the hair follicle. The sebaceous glands are usually attached by a duct to a hair follicle and secrete sebum. Sweat glands regulate the body temperature (O’Shaughnessy and Christiano, 2004).

During development, the blueprint for ectodermal appendages is laid down and the process starts with the formation of epidermal thickenings, called placodes by reciprocal signaling between the epithelial cells and the mesenchyme. In case of the hair follicles and glands development, the placodes divide extensively to form epithelial columns that grow into the dermis. However, the nail appears as a flattened area, then the invagination of epidermis on the surface of the digit, outlined by grooves that later become the shallow lateral nail folds and the deep proximal nail folds. The nail plate is produced entirely by the matrix. The inability to produce or pattern these placodes, leads to various diseases of ectodermal dysplasias (Pispa and Thesleff, 2003; O’Shaughnessy and Christiano, 2004).

In this study, two types of skin disorders, Ectodermal dysplasia and Alopecia has been investigated in families living in Dera Ghazi Khan.

------70 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

Ectodermal dysplasia

Ectodermal dysplasias (EDs) constitute a heterogeneous group of genetic disorders comprising defects in two or more tissues of ectodermal origin: hair, teeth, nails, sweat glands and skin (Freire-Maia, 1984; Naeem et al ., 2007). To date about 200 different pathological and molecular conditions have been recognized as ectodermal dysplasias (Sahin et al., 2004; Naeem et al ., 2006b). The number of novel ED conditions is continuously increasing with the time that requires a proper identification. Priolo et al. (2000) have classified EDs in to nine groups on clinical bases. Group I is composed of so called pure EDs. Group II includes diseases characterized by premature aging. Group III is constituted by multiple congenital anomalies of EDs in which skeletal abnormalities are always present. Group IV includes syndromic EDs characterized by premature aging and predisposition to neoplasias. Group V diseases are all characterized by skin associated disorders, such as keratoderma and skin fragility. Group VI is EDs with deafness as major clinical criteria. Group VII is EDs with ocular anomalies/ retinal dystrophy. Group VIII is EDs with renal abnormalities. Group IX is EDs with associated endocrine-neuroendocrine abnormalities. Recently Lamartine, (2003) classified the EDs into four main functional groups, defects in developmental regulation, epithelial-mesenchymal interaction, cytoskeleton maintenance, and cell stability.

To date about 30 EDs have been studied at molecular level and few causative genes have been identified, but still molecular genetics of ectodermal dysplasia is poorly understood because of genetic heterogeneity and clinical overlapping among various ED conditions.

Alopecia

Hair is a highly keratinized tissue formed within the hair follicle. Each folicle produces many distinct hairs like lanugo, vellus, and terminal hairs during a lifetime (Shimomura et al., 2006). In addition, the hair follicle periodically revert to a morphogenic program of cellular events as a part of its normal phases of growth (anagen), regression (catagen), rest (telogen), and shedding (exogen; Fuchs et al ., 2001). The elements necessary for follicle formation and functioning are genetically controlled (Stenn and Paus, 2001). Information about molecular mechanisms that drive hair follicle morphogenesis in mice and humans has significantly increased and in recent years has witnessed remarkable advances in our understanding of congenital alopecias. The genetic

------71 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders basis of about 15 monogenic forms of inherited hair loss has been elucidated within less than a decade .

Total or partial absence of hair occurs either alone or in association with other anomalies as a part of syndrome of a very diverse nature. The major defects reported to be associated with total or partial absence of hair, either singly or in various combinations, includes dwarfism, mental retardation, epilepsy, nail dystrophy, total or partial anodontia, hyperkeratosis, impaired sweating, cataracts, etc (Pinheiru et al., 1985; Feinstein et al., 1987; John et al., 2006; Wali et al., 2006, 2007a). The isolated form of congenital alopecia has been reported in sporadic and familial cases. Various mode of inheritance were reported in families affected with congenital alopecia (Ahmad et al., 1993; Ahmad et al., 1998; Kljuic et al., 2003; Rafique et al., 2003; Aslam et al., 2004; Wali et al., 2007b).

Defective hair structure caused by mutations in key hair structural proteins can result in severe alopecia. The best characterized conditions at the molecular level in this category are monilethrix (Stevens et al ., 1996) and Netherton syndrome (Chavanas et al ., 2000). Monilethrix is an autosomal dominant disorder in which alopecia is the presenting variable manifestation. Among the isolated forms of alopecia autosomal recessive congenital atrichia is the most extreme example of hair loss. Congenital atrichia has been linked to chromosome 8p21, where several mutations of the hairless gene have been reported as the underlying cause of congenital atrichia (Ahmad et al ., 1998). Netherton syndrome is a rare autosomal recessive disorder and serine protease inhibitor, kazal type- 5 gene is mutated in Netherton syndrome (Chavanas et al ., 2000).

Hypotrichosis simplex is an autosomal dominant disorder that can affect all body hair or can be limited to the scalp. Levy-Nissenbaum et al. (2003) found nonsense mutations in the corneodesmosin gene located on chromosome 6p21.3. The autosomal recessive localized hereditary Hypotrichosis (LAH) has been linked to chromosome 18p21.1 (Rafique et al., 2003) which contains a cluster of desmoglein and desmocollin genes. Desmosomes integrity is critical for cell-cell adhesion, because the transmission of survival signal is disrupted in the absence of intact cell-cell adhesion. Mutations in Desmoglein 4 gene ( DSG4 ) have been implicated in LAH (Kljuic et al., 2003; Rafiq et al ., 2004). Second Hypotrichosis locus AH has been mapped to chromosome 3q26.33- q27.3 (Aslam et al ., 2004). Recently Wali et al. (2007b) have mapped a third locus for autosomal recessive form of hypotrichosis (LAH3) on chromosome 13q14.11-q21.32 in

------72 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders two large Pakistani families. Certainly these studies have revealed various genetic alterations in a number of genodermatoses. However, little is currently known about the molecular epidemiology of these disorders.

Families Studied

For the study presented here, seven families including five (A, B, C, D, E) with ectodermal dysplasias and two (F, G) with alopecia were ascertained from different parts of Dera Ghazi Khan District.

Family A

The family ‘A’ resides in a village near Kot Chutta town of Dera Ghazi Khan District and belongs to Chingwani tribe. The family members traditionally marry within the family and result in consanguineous marriages. The family history presented in the pedigree (Figure 4.1) indicates five generations having four affected persons. Affected individuals include 3 affected males (IV-2, IV-5, and IV-7) and an affected female (IV-4). The ages of the affected individuals vary from 16 to 40 years. As the disease controlling trait appears in both males and females, affected individuals are produced by normal parents after skipping the generations thus suggesting that the trait is transmitted in the autosomal recessive mode.

Clinical Features

In all the affected persons, both skin and nails were normal at birth. Nychodystrophy of fingers and toes started at the age of 7-8 years. Dystrophy initiated from free margins of nails and progressed gradually towards onychodermal band, nails plate, lunula, and cuticle and ultimately reached to eponychium. Onychodystrophy affect both finger and toenails. Dystrophic changes in toenail were observed more rapid than finger nails (Figure 4.2). The skin was rough, which bruises and blisters easily. Sweating was abnormally high and ear wax was normal. The affected persons reportedly have higher threshold to pain. Finger-prints were missing and palmoplanter was observed in IV-2 and IV-4 at 40 and 32 years of age, respectively.

Family B

The family ‘B’ resides in a small village, Chah Qazi Wala near Paigan (one of the oldest town) of Dera Ghazi Khan and belongs to Chingwani tribe. The family members traditionally marry within the family, which result in consanguineous marriages. The

------73 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders family history presented in the pedigree (Figure 4.3) indicates five generation having 4 affected males (IV-2, IV-5, IV-7, and V-8) and an affected female (V-2). The ages of the affected individuals vary from 13 to 55 years. As the disease controlling trait appears in both males and females, affected individuals are produced by consanguineous couples, thus suggesting that the trait is transmitted in the autosomal recessive mode.

Clinical Features

In all the affected persons, both skin and nails were normal at birth. Nychodystrophy of finger and toes started at the age of 7-8 years. Dystrophy initiated from free margins of nails and progressed gradually towards onychodermal band, nails plate, lunula, and cuticle. Onychodystrophy affect both finger and toenails. Dystrophic changes in toenail were observed more rapid than finger nails (Figure 4.4). The skin was rough, which bruises and blisters easily. Sweating was high and ear wax was normal. Finger-prints were missing and palmoplanter was observed in IV-2, IV-5, and IV-7 at 52, 42, and 40 years of age, respectively.

Family C

The family ‘C’ resides in a farm house near Basti Jalbani of Dera Ghazi Khan and belongs to Chandia tribe. The family members traditionally marry within the family. The family history presented in the pedigree (Figure 4.5) indicates five generations having an affected male (V-4) and four affected females (IV-7, V-2, V-5, V-7). The ages of the affected individuals vary from 12 to 35 years. As the disease controlling trait appears in both males and females, affected individuals are produced by normal parents after skipping the generations thus suggesting that the trait is transmitted in the autosomal recessive mode.

Clinical Features

In all the affected persons, both skin and nails were normal at birth. Nychodystrophy of finger and toes started at the age of 6-7 years. Dystrophy initiated from free margins of nails and progressed gradually towards onychodermal band, nails plate, lunula, and cuticle and ultimately reached to eponychium. Onychodystrophy affect both finger and toenails. Dystrophic changes in toenail were observed more rapid than finger nails (Figure 4.6). The skin was rough, which bruises and blisters easily. Sweating was high and ear wax was normal. Finger-prints were missing and palmoplanter was observed in IV-27 at 35 years of age.

------74 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

Family D

The family ‘D’ resides in a village Julbani of Dera Ghazi Khan. The family members traditionally marry within the family and result in consanguineous marriages. The family history presented in the pedigree (Figure 4.7) indicates six generations having two affected males (V-6 and VI-8) and three affected females (VI-1, VI-2, and VI-15). The ages of the affected individuals vary from 16 to 45 years. As the disease controlling trait appears in both males and females, affected individuals are produced by normal parents after skipping the generations thus suggesting that the trait is transmitted in the autosomal recessive mode.

Clinical Features

In all the affected persons, both skin and nails were normal at birth. Nychodystrophy of finger and toes started at the age of 6-7 years. Dystrophy initiated from free margins of nails and progressed gradually towards onychodermal band, nails plate, lunula, and cuticle and ultimately reached to eponychium. Onychodystrophy affect both finger and toenails. Dystrophic changes in toenail were observed more rapid than finger nails (Figure 4.8). The skin was rough, which bruises and blisters easily. Sweating was abnormally high and ear wax was normal. The affected persons reportedly have higher threshold to pain. Finger-prints were missing and palmoplanter was observed in V- 6, VI-1, and VI-8 at 45, 30, and 32 years respectively.

Family E

The family ‘E’ resides in a village Buzdar near Kot Chuta town of Dera Ghazi Khan and belongs to Buzdar tribe. The family members marry within the family. The ages of the affected individuals vary from 30 to 55 years at the time of study. The family history presented in the pedigree (Figure 4.9) indicates five generations having three affected males (IV-3, IV-4, and IV-5) and four affected females (IV-2, IV-11, V-2, and V-3). As the disease controlling trait appears in both males and females, affected individuals are produced by normal parents after skipping the generations thus suggesting that the trait is transmitted in the autosomal recessive mode.

Clinical Features

In all the affected persons, both skin and nails were normal at birth. Nychodystrophy of finger and toes started at the age of 7-8 years. Dystrophy initiated from free margins of nails and progressed gradually towards onychodermal band, nails

------75 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders plate, lunula, and cuticle and ultimately reached to eponychium. Onychodystrophy affect both finger and toenails. Dystrophic changes in toenail were observed more rapid than fingernails (Figure 4.10). The skin was rough, which bruises and blisters easily. Sweating was abnormally high and ear wax was normal. Finger-prints were missing and palmoplanter was observed in IV-2, IV-3, IV-4, and IV- 5 at 55, 50, 42, and 36 years of age respectively.

Family F

The family F resides in a remote village near Ghazi Ghat bridge of Dera Ghazi Khan. They rarely marry out side family and consequently consanguineous unions are very common. The family history presented in the pedigree (Figure 4.11) indicates five generations having 2 affected males (V-1and V-7) and 4 affected females (III-2, V-3, V- 8, and V-9). The parents of affected children, II-3 and II-4, IV-1 and IV-2, and IV-4 and IV-5 were normal. As the disease controlling trait appears in both sexes, affected individuals are produced by normal parents after skipping the generations thus suggests that the trait is transmitted in the autosomal recessive mode.

Blood samples were collected from six affected (III-3, V-1,V-7, V-3,V-8 and V-9) and nine normal members ( II-1 , II-2, IV-1 , IV-2 , IV-4 , IV-5, V-2,V-5 , and V-6) of family.

Clinical Features

All the affected individuals showed the symptoms of congenital atrichia with papules. Patients of this family exhibited typical features of congenital atrichia with papules, including absence of hair in the scalp, axillae, pubic, and other parts of the body (Figure 4.12). Few keratins filled follicular cysts were observed on the thighs in affected individuals. Beside the absence of hairs no other abnormality has been observed in the affected individuals. Facial appearance, sweating, and nails were normal.

Family G

The family G resides in a remote village of Dera Ghazi Khan near Jam Pur city and belongs to Mastoi caste. The family members traditionally marry within the family, which result in consanguineous marriages. The family history presented in the pedigree (Figure 4.13) indicates five generations having 2 affected males (V-2 and V-6) and 4 affected females (V-3, V-4, V-5, and V-7). As the disease controlling trait appears

------76 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders equally among males and females, affected individuals are produced by normal parents thus suggesting that the trait is transmitted in the autosomal recessive mode.

Blood samples were collected from 9 individuals including 5 affected (V-2, V-3, V-4, V-5, V-6, and V-7) and 4 normal individuals (IV-3, IV-4, V-1, and V-8) of the family. The peripheral blood was processed for DNA extraction.

Clinical Features

All the affected individuals showed the symptoms of congenital alopecia (Figure 4.14). Beside the absence of hairs no other abnormality has been observed in the affected individuals. Facial appearance and nail were normal. Sweating was normal too. The affected individuals were in good general health, and were of normal intelligence.

Linkage Studies

Two families (F and G) were tested for linkage to 16 known hair loss and ectodermal dysplasia loci (Table 2.1). In family F, linkage to the hair loss gene at chromosome 8p21 was detected, where as family G was not linked to this locus. Table 2.1 summarizes the microsatellite markers, which were used in the present study for candidate gene analysis. Average heterozygosity for the selected markers was > 70%. Analysis of microsatellite markers was carried out using a standard PCR reaction and electrophoresis in 8% non-denaturing polyacrylamide gel. Microsatellite markers were visualized by staining the gel with ethidium bromide and genotypes were assigned manually. The obtained data was analyzed to evaluate the chances of linkage to the tested loci.

Family F

In family F, DNA samples from 15 individuals including six affected (III-2, V-1, V-7, V-3, V-8, and V-9) and nine normal (II-1, II-2, IV-1, IV-2, IV-4, IV-5, V-2, V-5, and V-6) individuals were selected for genotyping with the polymorphic microsatellite markers presented in Table 2.1. Analysis of the genotypes revealed the exclusion of all the known loci except chromosome 8 markers. The markers D8S298, D8S258, and D8S1786 linked to hairless gene at chromosome 8p21 were fully informative and six affected members of the family F were homozygous for these markers suggesting linkage to the hair loss locus (Ahmad et al., 1998). In addition, nine unaffected members of the families were heterozygous for the linked markers.

------77 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

Mutation Screening of Hairless Gene in Family F

All 19 exons and splice-site junctions of the human hairless gene were amplified (Table 2.3) by polymerase chain reaction (PCR) and sequenced directly in the ABI Prism 310 Automated DNA Sequencer, using the ABI Big dye Terminator V 3.1 cycle sequencing kit (Applied Biosystem, Foster City, CA, USA) following purification by Rapid PCR Purification System (Marligen Biosciences USA). The entire coding portion and intron-exon borders of the hairless gene were sequenced in affected and normal individuals of the family. In family F sequence analysis of the PCR product corresponding to exon 2 revealed a single base pair deletion mutation at position 431 (431delC) leading to frameshift and premature termination codon 68 bp downstream in the same exon. The mutation was present in homozygous state in all affected individuals and in heterozygous state in the obligate carriers of the family (Figure 4.15).

Family G

In family ‘G’, nine DNA samples including five affected (V-3, V-5, V-6, V-7, and V-8) and four normal individuals (IV-3, IV-4, V-1, and V-8) were selected for genotyping the markers linked to the candidate genes. Two to three markers per locus were used to test the linkage. The results obtained with polymorphic microsatellite markers specific for known hair loss and ectodermal dysplasia loci revealed that the affected individuals were heterozygous for different combinations of the parental alleles. These results indicate the exclusion of known candidate genes from linkage in family G (Figure 4.16).

Discussion

The study of skin diseases and their complications is most important because skin disorders comprise clinically heterogeneous group produced due to anatomical and physiological malfunctions of various skin components. These disorders occur as a result of defects in gene/s that are usually involved in the development of different ectodermal components. They may be present at birth or occur considerably later, they may be inherited or acquired in fetal life and they may appear as an isolated anomaly or, as a minor feature, forming part of a complex syndrome.

Ectodermal dysplasias (EDs) constitute a heterogeneous group of genetic disorders comprising defects in two or more tissues of ectodermal origin: hair, teeth, nails, sweat glands and skin (Naeem et al ., 2007). Similarly, there are several forms of

------78 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders hereditary hair loss disorders without involving other ectodermal structure, known as alopecia, which represent a dysregulation of the hair development and growth (Ahmad et al., 1998). The molecular genetics of ectodermal dysplasia is poorly understood because of genetic heterogeneity and clinical overlapping among various ED conditions. It’s why clinical evaluation based on observation and careful phenotypic description is very important for establishing the diagnostic hypothesis for the ectodermal dysplasia cases. In the present study, seven highly consanguineous families (A-G) demonstrating various skin disorders, have been ascertained. The five extended families (A, B, C, D, and E) having a disorder of nail and skin, were collected from various villages within the area of 20 km 2 located in the Dera Ghazi Khan District. Overall, 27 affected individuals (14 males and 13 females) belonging to these families were clinically examined and similarities were found in their various clinical symptoms, though these families belonged to different endogamous groups. According to our findings, the disorder show onset at the age of 7-8 years. All the affected persons had abnormal nails and skin. Nychodystrophy of fingernails and toenails started at the same time but differentially lead to anonychia on toenails and onycholysis on fingernails (Figures 4.2, 4.4, 4.6, 4.8, 4.10). The skin was abnormal which bruises and blisters easily. From the age of onset sweating increased; at the age of 15-18 years, finger-prints were lost while palmoplanter keratoderma became severe in old age (above 50 yrs). The clinical findings observed among affected individuals of five families are similar to the features of ectodermal dysplasia as suggested by Dhanrajani and Jiffiy (1998), Nordgarden et al . (2003), and Shigli et al . (2005). The presence of functional sweat glands and the involvement of other ectodermal structures excluded the possibility of anhidrotic type of ectodermal dysplasia in the five families presented here. Clinical symptoms in our families differ also from those reported earlier from Dera Ghazi Khan District by Rafiq et al. (2004, 2005).

Two families (F, G) demonstrating autosomal recessive form of non-syndromic alopecia, have been ascertained in present study from different villages of Dera Ghazi Khan District. Patients of these families exhibited typical features of congenital alopecia including absence of hair in the scalp, axillae, pubic, and other parts of the body (Figure 4.12, 4.14). Beside the absence of hairs no other abnormality has been observed in the affected individuals.

------79 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

In family F, linkage was established to hair loss locus on chromosome 8p21 (Ahmad et al., 1998). Sequence analysis of the HR gene revealed a single base pair deletion mutation at position 431 (431delC) in exon 2, leading to frameshift and premature termination codon 68 bp downstream in the same exon (Figure 4.15). Thus, predicting an absence of functional mRNA secondary to nonsense-mediated mRNA decay and absence of the hairless protein (Maquat, 1996).

Up to now, ten frame shift mutations, in the hairless gene have been reported that can cause congenital atrichia (John et al ., 2005). In the case of a possible synthesis of a truncated protein, its length differs in all these cases. The shortest observed truncated protein is the result of a 22 bp deletion having a length of first 446 amino acids of HR protein lacking the zinc finger domain (Ahmad et al., 1999).

In family G with alopecia, genotyping with microsatellite markers failed to detect linkage to any of the known alopecia / ED loci (Figure 4.16, 4.17). However, further study including genome wide search to locate the disease locus in family G was not performed.

------80 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

I I:1 I:2

II II:1 II:2 II:3 II:4 II:5

III III:1 III:2 III:3 III:4 III:5 III:6 III:7 III:8

IV IV:1 IV:2 IV:3 IV:4 IV:5 IV:6 IV:7

V V:1 V:2 V:3

Figure 4.1 : Pedigree of family A with ectodermal dysplasia showing autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

------81 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

a b

Figure 4.2: Clinical findings in an affected individual (IV-5) of family A. Anonychia of toenails (a) dystrophic fingernails (b)

------82 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

I I:1 I:2

II II:1 II:2 II:3 II:4

III III:1 III:2 III:3 III:4 III:5

IV IV:1 IV:2 IV:3 IV:4 IV:5 IV:6 IV:7

V V:1 V:2 V:3 V:4 V:5 V:6 V:7 V:8 V:9

VI VI:1 VI:2

Figure 4.3 : Pedigree of family B with ectodermal dysplasia showing autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

------83 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

a b

Figure 4.4: Clinical findings in an affected individual (IV-2) of family B. Dystrophic fingernails (a) toenails showing anonychia (b).

------84 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

I I:1 I:2 I:3 I:4

II II:1 II:2 II:3 II:4 II:5 II:6

III III:1 III:2 III:3 III:4

IV IV:1 IV:2 IV:3 IV:4 IV:5 IV:6 IV:7 IV:8 IV:9 IV:10 IV:11 IV:12

V V:1 V:2 V:3 V:4 V:5 V:6 V:7

Figure 4.5 : Pedigree of family C with ectodermal dysplasia showing autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals.

------85 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

a b

Figure 4.6: Clinical findings in an affected individual (V-4) of family C. Dystrophic fingernails (a) and toenails (b).

------86 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

I I:1 I:2

II II:1 II:2 II:3 II:4 II:5 II:6

III III:1 III:2 III:3 III:4 III:5 III:6 III:7

IV IV:1 IV:2 IV:3 IV:4 IV:5 IV:6 IV:7 IV:8

V V:1 V:2 V:3 V:4

V:5 V:6 V:7 V:8 V:9 V:10

VI VI:1 VI:2 VI:3 VI:4 VI:5 VI:6 VI:7 VI:8 VI:9 VI:10 VI:11 VI:12 VI:13 VI:14 VI:15 VI:16 VI:17 VI:18 VI:19 VI:20

Figure 4.7 : Pedigree of family D with ectodermal dysplasia showing autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

------87 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

a b

c d

Figure 4.8: Clinical findings in an affected individual (VI-8) of family D. Severely dystrophic fingernails (a) and anonychia in toenails (c). Thumb image of an affected individual (V-5) (b) finger print missing (d).

------88 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

I I:1 I:2 I:3 I:4

II:3 II:4 II:5 II II:1 II:2

III:12 III III:1 III:2 III:4 III:6 III:7 III:8 III:9 III:10 III:11 III:13 III:15

III:3 III:5 III:14

IV IV:1 IV:2 IV:3 IV:4 IV:5 IV:6 IV:7 IV:8 IV:9 IV:10 IV:11

V V:1 V:2 V:3

Figure 4.9 : Pedigree of family E with ectodermal dysplasia showing autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals.

------89 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

a b

c

Figure 4.10: Clinical findings in an affected individual (IV-3) of family E. Severely dystrophic fingernails (a) and toenails showing anonychia (b), along with severely stretched skin (a, b). Palmoplanter is visible in the lower panel (c).

------90 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

I I:1 I:2

II II:1 II:2 II:3 II:4 II:5 II:6

III III:1 III:2 III:3 III:4 III:5 III:6

IV IV IV:1 IV:2 IV:3 IV:4 IV:5

V V V:1 V:2 V:3 V:4 V:5 V:6 V:7 V:8 V:9

Figure 4.11 : Pedigree of family F with congenital alopecia showing autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

------91 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

Figure 4.12: Clinical findings in congenital atrichia. Phenotypic appearance of an affected individual (V-7) of family F at 10 years of age, with complete scalp atrichia and absence of eyebrows and eyelashes. Few skin colored papules are present on face and scalp.

------92 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

I I:1 I:2

II II:1 II:2 II:3 II:4

III III:1 III:2 III:3 III:4

IV IV:1 IV:2 IV:3 IV:4 IV:5 IV:6

V V:1 V:2 V:3 V:4 V:5 V:6 V:7 V:8

Figure 4.13 : Pedigree of family G with congenital alopecia showing autosomal recessive mode of inheritance. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

------93 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

Figure 4.14: Clinical findings in congenital alopecia. Phenotypic appearance of an affected male (V-2) in family G at 25 years of age. Note the complete absence of scalp hair with sparse eye brows and eye lashes and beard hair.

------94 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

Figure 4.15: Representative chromatograms generated by Big Dye terminator sequencing of exon 2 of the hairless gene from controls individual (A), a heterozygous carrier (B), and a homozygous (affected) individuals (C). The arrow indicates a homozygous deletion of a nucleotide C at position 431, resulting in frame shift premature termination codon 68 bp downstream in the same exon.

------95 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

I I-1 I-2

II II-1 II-2 II-3 II-4

III III-1 III-2 III-3 III-4 IV VI-1 VI-2 VI-3 VI-4 VI-5 VI-6

D1S1660 1 2 1 2 PKP1 D1S373 1 2 1 2 D1S1723 1 2 1 2

D1S442 1 2 1 2 LOR D1S498 1 2 1 2 D1S305 1 2 1 2

D2S1343 1 2 1 2 D2S1889 1 2 1 2 EDAR D2S2236 1 2 1 2 D2S141 1 2 1 2

APMR1, AH D3S3578 1 2 1 2 D3S3592 1 2 1 2 D3S1262 1 2 1 2

D6S1615 1 2 1 2 D6S439 1 2 1 2 CDSN D6S273 1 2 1 2

D8S298 1 2 1 2 HR D8S1048 1 2 1 2 D8S560 1 2 1 2

D11S1998 1 2 1 2 PVRL1 D11S4129 1 2 1 2 D11S1299 1 2 1 2

V V-1 V-2 V-3 V-4 V-5 V-6 V-7 V-8

D1S1660 12 12 12 12 12 12 12 PKP1 D1S373 12 12 12 12 12 12 12 D1S1723 12 12 12 12 12 12 12

D1S442 1 2 1 2 1 2 1 2 1 2 1 2 1 2 LOR D1S498 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D1S305 1 2 1 2 1 2 1 2 1 2 1 2 1 2

D2S1343 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D2S1889 1 2 1 2 1 2 1 2 1 2 1 2 1 2 EDAR D2S2236 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D2S141 1 2 1 2 1 2 1 2 1 2 1 2 1 2

APMR1, AH D3S3578 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D3S3592 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D3S1262 1 2 1 2 1 2 1 2 1 2 1 2 1 2

D6S1615 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D6S439 1 2 1 2 1 2 1 2 1 2 1 2 1 2 CDSN D6S273 1 2 1 2 1 2 1 2 1 2 1 2 1 2

D8S298 1 2 1 2 1 2 1 2 1 2 1 2 1 2 HR D8S1048 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D8S560 1 2 1 2 1 2 1 2 1 2 1 2 1 2

D11S1998 1 2 1 2 1 2 1 2 1 2 1 2 1 2 PVRL1 D11S4129 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D11S1299 1 2 1 2 1 2 1 2 1 2 1 2 1 2 Figure 4.16: Pedigree of family G. Haplotypes for the STS markers tightly linked to known ectodermal dysplasia and alopecias loci. The alleles are denoted 1-2 according to their sizes.

------96 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 4 Skin Disorders

I I-1 I-2

II II-1 II-2 II-3 II-4

III III-1 III-2 III-3 III-4 IV VI-1 VI-2 VI-3 VI-4 VI-5 VI-6

D12S90 1 2 1 2 KRT1 D12S368 1 2 1 2 D12S398 1 2 1 2

D13S633 1 2 1 2 GJB6 D13S250 1 2 1 2 D13S787 1 2 1 2

D14S50 1 2 1 2 TGM1 D14S1040 1 2 1 2 D14S264 1 3 1 2

D17S800 1 1 1 2 KRTHA1 D17S934 1 2 1 2 D17S1807D171807 1 2 1 1

D18S1107 1 2 1 1 DSG AND D18S478 1 2 1 2 DSG cluster D18S847 1 2 1 2 D18S536 1 2 1 2

D20S119 1 2 1 2 TGM 1 and 3 D20S478 1 2 1 2 D20S107 1 2 1 2

V V-1 V-2 V-3 V-4 V-5 V-6 V-7 V-8

D12S90 1 2 1 2 1 2 1 2 1 2 1 2 1 2 KRT1 D12S368 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D12S398 1 2 1 2 1 2 1 2 1 2 1 2 1 2

D13S633 1 2 1 2 1 2 1 2 1 2 1 2 1 2 GJB6 D13S250 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D13S787 1 2 1 2 1 2 1 2 1 2 1 2 1 2

D14S50 1 2 1 2 1 2 1 2 1 2 1 2 1 2 TGM1 D14S1040 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D14S264 1 3 1 1 1 2 1 3 1 2 1 2 1 2

D17S800 1 2 1 2 1 2 1 2 1 2 1 2 1 2 KRTHA1 D17S934 1 2 1 1 1 2 1 2 1 2 1 2 1 2 DD17180717S1807 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D18S1107 1 2 1 2 1 2 1 2 1 2 1 2 1 2 DSG AND D18S478 1 2 1 2 1 2 1 2 1 2 1 2 1 2 DSG cluster D18S847 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D18S536 1 2 1 2 1 2 1 2 1 2 1 2 1 2

D20S119 1 2 1 2 1 2 1 2 1 2 1 2 1 2 TGM 1 and 3 D20S478 1 2 1 2 1 2 1 2 1 2 1 2 1 2 D20S107 1 2 1 2 1 2 1 2 1 2 1 2 1 2

Figure 4.17: Pedigree of family G. Haplotypes for the STS markers tightly linked to known ectodermal dysplasia and alopecias loci. The alleles are denoted 1-3 according to their sizes.

------97 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 5 Non-syndromic deafness

Non-syndromic Deafness

Introduction

Non-syndromic deafness is one of the most common hereditary forms of hearing impairment in humans. It accounts for up to 70% of all inherited deafness with various modes of inheritance (Friedman and Griffith, 2005).

The hearing is a complex phenomenon. Human ear is composed of the outer (auricle), middle (tympanic cavity), and inner ear. Sound waves are captured by the auricle and conveyed to the tympanic membrane. Its vibrations are then transmitted to the inner ear by a chain of three ossicles i.e. the malleus, the stapes and the incus. The inner ear consists of the bony and membranous labyrinths in which the cochlea, the vestibule and the semicircular canals with the sacculus and the utriculus are present. The membranous part of the cochlea is formed by the cochlear duct having the hair cells, which are crowned at their apices by a hair bundle consisting of an array of stereocilia. Each stereocilium consists of an actin core covered by the plasma membrane. The forces of sound produce shearing between the hair cells and the tectorial membrane and causes deflection of the hair bundle. The tip of each stereocilium is linked to the shaft of its neighbors by myosin. The resultant changes in adjacent stereocilia probably function as gating springs for the opening of potassium channels. The influx of potassium ions that bathes the hair cells results in a change in membrane potential. Depolarization of the hair cells then activates calcium channels on the basolateral side of the cells, leading to calcium influx into the hair cells. This influx triggers the release of neurotransmitters that activate the acoustic nerve (Markin and Hudspeth, 1995).

Clinically deafness is described by several criteria, including the severity (Normal: 0-15 dB, mild or 20 to 39 dB, moderate or 40 to 69 dB, severe or 70 to 89 dB, and profound or >90 dB), age of onset, and the type of defect like conductive, sensorineural and central or a mixed type (Petit et al., 2001; Schrijver, 2004).

Non-syndromic deafness is a paradigm of genetic heterogeneity with 85 loci and 39 nuclear disease genes reported so far. Autosomal recessive genes are responsible for about 80% of the cases of non-syndromic deafness of pre-lingual onset with 23 different genes identified to date (http://dnalab-www.uia.ac.be/dnalab/hhh). These genes play diverse roles for the normal hearing and belong to a wide variety of protein classes

------98 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

(Ahmed et al., 2004; Ghosh et al., 2004). Few most important genes/mutations implicated in non-syndromic deafness are:

1): Connexin genes encode proteins that are involved in the formation of channels through the plasma membrane of many cells and play role in intercellular communication (Bruzzone et al., 1996). Connexin mutations implicated in deafness include mutations in the connexin 26 and connexin 31. The connexin 26 (Gap-junction protein beta 2 genes, GJB2) mutations are associated with two forms of non-syndromic deafness i.e. DFNB1 and DFNB3 . One connexin 26 mutation, the deletion of a guanine at position 30 (30delG), is prevalent in many populations of the world (Scott et al., 1998; Kelley et al., 1998). Another connexin 26 mutation, deletion of thymine at position 167 (167delT), was found to be particularly frequent among Ashkenazi Jews (Morell et al., 1998). Connexin 26 mutations have also been identified in an autosomal dominant deafness linked to chromosome 13q ( DFNA3 ; Denoyelle et al., 1998).

2): Myosin genes encode proteins that exert mechanical forces. They have functions, including transport of intracellular organelles, phagocytosis, secretion, contraction, and cellular movement (Mooseker and Cheney, 1995). Patients of Usher’s syndrome have mutations in the myosin 7A gene. This gene is also implicated in two forms of nonsyndromic deafness ( DFNB2 and DFNA11 ). Similarly the myosin 15 gene is the site of mutations in humans ( DFNB3 locus) (Wang et al., 1998).

3): Tectorin gene encodes a cochlea-specific protein that interacts with ß-tectorin (Ahituv et al., 2000). Its mutations have been found in deaf families with DFNA8 , DFNA12 and DFNB21 (Rabionet et al., 2000). Otoferlin gene is at the DFNB9 locus on chromosome 2p that is expressed in the inner hair cells, the utriculus, and the sacculus, probably involved in the transport of membrane vesicles to the plasma membrane (Noben-Trauth et al., 1997).

4): Mitochondrial mutations are responsible for many clinical abnormalities especially the hearing loss (Fischel-Ghodsian, 1999). Two mitochondrial genes, the tRNA Ser gene and the 12S rRNA gene, have also been found associated with non-syndromic hearing loss (Guan et al., 2001).

In recent years a number of genes responsible for deafness have been isolated and many others localized, but the molecular genetics of deafness is still in its infancy that requires further work. Identification of additional genes involved in hereditary hearing loss will

------99 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness help in our understanding of the basic mechanisms underlying normal hearing, in early diagnosis and therapy (Petersen and Willems, 2006).

In this study, three families with non-syndromic deafness from different parts of Dera Ghazi khan have been described.

Families Studied

Three families (H, I, J) with hereditary non-syndromic deafness have been located from Dera Ghazi Khan District and presented here. The families were ascertained from parts of Dera Ghazi Khan population, where due to socio-ethnic reasons; the consanguineous marriages are common and thus are suitable for locating the defective genes by genetic linkage studies.

Family H

The family ‘H’ resides in the Dera Ghazi Khan city. The family members traditionally marry within the family and result in consanguineous marriages. The family history presented in the pedigree (Figure 5.1) indicates five generations having four affected persons. Affected individuals include two males (IV-1 and V-1) and two females (IV-2 and IV- 4). The ages of the affected individuals vary from 15 to 23 years. As the disease controlling trait appears equally among males and females, affected individuals are produced by normal parents after skipping the generations thus suggests that the trait is transmitted in the autosomal recessive mode. All affected individual present with prelingual profound hearing impairment which affects all frequencies and is probably congenital. The affected individuals use sign language for communication. Affected individual underwent a physical examination, and no clinical features, including mental retardation were observed. In addition, no gross vestibular involvement was observed.

Blood samples were collected from nine members of the family including five normal (III-1, III-2, IV-3, IV-5 and IV-6) and four affected (IV-1, IV-2, IV-4, V-1) individuals and processed for genomic DNA extraction.

Family I

The family ‘I’ resides in a village of Dera Ghazi Khan. The family members are engaged in subsistence farming and traditionally marry within the family and result in consanguineous marriages. The family history presented in the pedigree (Figure 5.2) indicates five generations having four affected persons. Affected individuals include two

------100 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness males (V-1 and V-5) and two females (V-2 and V-3). The ages of the affected individuals vary from 10 to 21 years. As the disease controlling trait appears among males and females, affected individuals are produced by normal parents after skipping the generations thus suggests that the trait is transmitted in the autosomal recessive mode. All affected individual present with prelingual profound hearing impairment which affects all frequencies and is probably congenital. The affected individuals use sign language for communication. Affected individual underwent a physical examination, and no clinical features, including mental retardation were observed. In addition, no gross vestibular involvement was observed.

Blood samples were collected from seven members of the family including three normal (IV-1, IV-2, V-4) and four affected (V-1, V-2, V-3, V-5) individuals and processed for genomic DNA extraction.

Family J

The family ‘J’ resides in a village near Dera Ghazi Khan City. The family members are engaged in subsistence farming and traditionally marry within the family and result in consanguineous marriages. The family history presented in the pedigree (Figure 5.3) indicates five generations having three affected persons. Affected individuals include two males (V-2 and V-3) and one female (V-1). The ages of the affected individuals vary from 10 to 18 years. As the disease controlling trait appears among males and females, affected individuals are produced by normal parents after skipping the generations thus suggests that the trait is transmitted in the autosomal recessive mode. All affected individual present with prelingual profound hearing impairment which affects all frequencies and is probably congenital. The affected individuals use sign language for communication. Affected individual underwent a physical examination, and no clinical features, including mental retardation were observed. In addition, no gross vestibular involvement was observed.

Blood samples were collected from six members of the family including three normal (IV-1, IV-2, V-4) and three affected (V-1, V-2, V-3) individuals and processed for genomic DNA extraction

------101 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

Linkage Studies

In the current study linkage analysis was carried out in family H, I, and J. Linkage in these families was initially searched by using microsatellite markers linked to GJB2 gene at locus DFNB1 locus on chromosome 13q11-q12 (Table 2.2). In family J, linkage to the DFNB1 locus was detected, where as families H and I were not linked to this locus. After exclusion of GJB2 gene in family H and I, additional markers, corresponding to candidate genes involved in related autosomal recessive non-syndromic deafness, were typed. Table 2.2 summarizes the microsatellite markers, which were used in the present study for candidate gene analysis. Average heterozygosity for the selected markers is > 70%. Analysis of microsatellite markers was carried out using a standard PCR reaction and electrophoresis in 8% non-denaturing polyacrylamide gel. Microsatellite markers were visualized by staining the gel with ethidium bromide and genotypes were assigned manually. The obtained data was analyzed to evaluate the chances of linkage to the tested loci.

Family H

In family ‘H’ (Figure 5.1) nine DNA samples including five normal (III-1, III-2, IV-3, IV-5 and IV-6) and four affected (IV-1, IV-2, IV-4, V-1) individuals were selected for genotyping the markers linked to the candidate genes. Two to three markers per locus were used to test the linkage. From the analysis of the results obtained with polymorphic microsatellite markers specific for known non-syndromic deafness loci (Figure 5.4-5.6), it was evident that all the affected individuals were homozygous for markers on chromosome 14. All the affected individuals (IV-1, IV-2, IV-4 and V-1) were homozygous at markers D14S43, D14S77 and D14S588 (Figure 5.4-5.6). These results indicate the linkage of the family A to DFNB35 locus on chromosome 14q24.1-14q24.3 (Ansar et al., 2003).

Family I

In family I, 7 DNA samples including four affected (V-1, V-2, V-3, V-5) and three normal (IV-1, IV-2, IV-4) individuals were selected for genotyping the polymorphic microsatellite markers presented in Table 2.2. Analysis of the genotypes revealed the exclusion of all the known loci mentioned in the Table 2.2 except chromosome 7 markers. The markers D7S1818, D7S2469 and D7S2209 (Figures 5.7-5.9) were fully informative and four affected members of the family B were homozygous for these markers

------102 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness suggesting linkage to the DFNB44 locus on chromosome 7p14.1-q11.22 (Ansar et al., 2004).

Family J

In family J, 7 DNA samples including four affected (V-1, V-2, V-3, V-5) and three normal (IV-1, IV-2, IV-4) individuals were selected for genotyping the polymorphic microsatellite markers presented in Table 2.2. Analysis of the genotypes revealed the linkage of this family to the DFNB1 locus. The markers D13S787 (Figure 5.10), D13S143 (Figure 5.11) and D13S115 (Figure 5.12) were fully informative and three affected members of the family C were homozygous for these markers suggesting linkage to the DFNB1 locus (Kelsell et al., 1997). All the affected individuals were homozygous at marker D13S115 while affected individuals were heterozygous for different parental alleles (Figure 5.12).

Mutation Screening

In order to confirm the linkage to DFNB1 locus in family I, GJB2 gene was sequenced. To screen for the mutation in the GJB2 gene from genomic DNA, single coding exon and splice junctions were PCR amplified by using primers mentioned in the methods (Table 2.4).

PCR products were analyzed on 2% agarose gel and were purified with Centri-Sep Spin Columns (Marligen Biosciences, USA) to remove the unincorporated primers and nucleotides. The purified PCR products were directly sequenced in an ABI Prism 310 Automated DNA Sequencer. Comparison of the chromatograms of normal and affected individuals identified a G-to-A substitution at nucleotide position 71, resulting in a premature stop codon (W24X) (Figure 5.13).

DISCUSSION

Autosomal recessive non-syndromic deafness is genetically heterogeneous. Therefore, genetic mapping of hereditary deafness represent an important and challenging area for ongoing molecular genetic research. To date, 68 autosomal recessive non- syndromic hearing loss loci ( DFNB1-DFNB68 ) have been mapped on human chromosomes. All the ARNSHL loci are typically characterized by congenital, profound sensorineural hearing loss, with two exceptions, i.e., DFNB8 and DFNB13 (Mustapha et al ., 1998). Over 400 different phenotypes have also been identified, where the hearing

------103 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness loss is associated with other defects like Pendred and Usher syndromes, and about 60 causative genes for such syndromic hearing loss have been identified (Petersen and Willems, 2006).

In the present study, three highly consanguineous families (H, I, J) demonstrating autosomal recessive form of non-syndromic hearing loss, have been ascertained from Dera Ghazi Khan, two living in rural areas and one in city of D G Khan. In these families affected individuals have pre-lingual severe to profound hearing loss, with no associated abnormality, and hence can be regarded as non-syndromic hearing loss. The mode of inheritance of the hearing loss in all the families is autosomal recessive. The affected individuals from various age groups show the same level of severe to profound hearing loss, implying that deafness was not progressive in any of the families studied.

To identify the genes underlying the autosomal recessive non-syndromic deafness phenotype, in the families presented here, a classical linkage analysis approach called “Homozygosity Mapping” was followed. In family H, linkage was detected with markers mapped in the region of DFNB35 locus (Ansar et al., 2003), while linkage in family I was detected with markers mapped in the region of DFNB44 locus (Ansar et al., 2004). The third family J was found to be linked to DFNB1 locus that harbors GJB2 gene.

The Family H was linked to the DFNB35 locus which maps to a 17.54 cM region on chromosome 14. The locus was identified previously by Ansar et al., (2003). This region contain genes, which include splicing factor SRP40-1, Presenilin 1 , numb homologue, v-fos FBJ and transforming growth factor, beta 3 , however, these genes are not strong candidates for DFNB35 (Ansar et al ., 2003). Three other loci for hearing loss have been localized to 14q: (1) DFNB5 , an autosomal recessive locus mapped to 14q in a consanguineous Indian kindred with severe to profound hearing impairment (Fukushima et al .,1995); (2) DFNA9 responsible for postlingual progressive sensorineural hearing loss was mapped to chromosome 14q12 13
in large kindred with autosomal dominant hearing loss (Manolis et al., 1996); and (3) DFNA23 , an autosomal dominant locus was mapped to 14q21 q22,
in a Swiss German kindred were hearing impaired members presented with prelingual neurosensory and conductive hearing loss (Häfner et al., 2000). The DFNB35 locus is telomeric to the DFNA23 locus and both DFNB5 and DFNA9 are centromeric to the DFNA23 locus. The region for DFNB35 does not overlap with DFNB5 , DFNA9 and DFNA23 , thus indicating the presence of a novel gene (Ansar et al., 2003).

------104 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

Furthermore, the family H is the second family linked to DFNB35 locus. The family H resemble to family studied by Ansar et al. (2003) in respect of the same ethnic group (Native sairaiki speaking) and caste (Bhutta). However, family studied by Ansar et al. (2003) settled in another District, Muzaffar Garh. This finding indicates that the locus (DFNB35 ) may be prevalent in this ethnic group and also indicate presence of common ancestor.

In case of Family I, the locus DFNB44 was identified. This locus was firstly reported in a region 20.9 cM on chromosome 7p14.1-q11.22 in consanguineous Pakistani kindred (Ansar et al., 2004). Five loci for autosomal recessive NSHI have previously been localized on chromosome 7, DFNB4 (7q31), DFNB13 (7q34-q36), DFNB14 (7q31), DFNB17 (7q31) and DFNB39 (7q11.22-q21.12), but the DFNB44 locus does not overlap with any of these loci (Ansar et al., 2004).

In family J, sequence analysis of the coding exon of GJB2 gene led to the identification of a G-to-A substitution at nucleotide position 71, resulting in a premature stop codon (W24X) (Figure 5.13). Incorporation of a stop codon at this position results in the formation of truncated nonfunctional protein.

Kelsell et al . (1997) firstly reported the mutation in connexin 26 gene ( GJB2) . This gene is located on the long arm of chromosome 13 and accounts for up to 50% congenital deafness (Denoyelle et al. , 1997). Connexins vary in their expression pattern and in the ion selectivity and gating properties of their respective connexons. The topology of connexins is highly conserved, consisting of four transmembranes domains (M1-M4), two extra cellular domains (E1-E2) and three cytoplasmic regions (Dahl et al. , 2001). Furthermore, in cochlea, connexin 26 ( Cx26 ) is expressed in the supporting cells, stria vascularis, basement membrane, limbus, spiral prominence and supporting cells (Lautermann et al ., 1998).

At present there are >100 known mutations for GJB2 , of which 56 are associated with autosomal recessive non-syndromic deafness. Some GJB2 mutations have high prevalence rates in specific populations, namely: 35delG among people of European descent, 167delT in the Ashkenazim, 235delC among East Asians, and 427C>T (R143W) in the Ghanaian population (Lerer et al., 2000). The commonly described mutations 35delG, 427C>T (R143W), and 235 delC were not found in the Pakistani population.

------105 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

Kelsell et al. (1997) have reported W24X and W77X mutations among three consanguineous families of Pakistani origin. These two mutations result in premature stop codons. The 231G>A (W77X) variant has only been reported in people originating from the Indian subcontinent while, the 71G>A(W24X) variant has been observed in Europeans, but its prevalence is about three times higher in Pakistanis and at least 20 times higher in Indians (Maheshwari et al., 2003). Thus, the spectrum of GJB2 variants in Pakistan reflect shared origins of hearing impairment alleles within the Indian subcontinent (Santos et al., 2005b).

Interestingly, Family J belong to Native ethnic group that is sairiki speaking. Previously Santos et al. (2005b) also found the same mutation 71G>A (W24X) in four out of five sairiki speaking families.

The recent identification of several deafness genes by molecular genetic studies has enabled the investigators to define the molecular basis of normal and pathological auditory functions. The genes identified encode proteins that have a role in hair cell transduction, ionic homeostasis in cochlear duct and integrity of the tectorial membrane. Many of the genes, known to be responsible for human hereditary deafness, have been identified in the past few years making this a very exciting and fast moving field. The function of some of these genes is still a mystery, but valuable clues to the function of others have come from establishing the type of protein that they encode and their expression patterns. Further study and identification of the genes at loci expected in families A and B and characterization of the proteins they encode will further increase our knowledge of molecular process involved in the auditory system.

------106 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

I:1 I:2

II:1 II:2 II:3 II:4 II:5 II:6

III:1 III:2 III:3 III:4

IV:1 IV:2 IV:3 IV:4 IV:5 IV:6

V:1

Figure 5.1: Pedigree of the family H with non-syndromic autosomal recessive hearing loss. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

I:1 I:2

II:1 II:2 II:3 II:4

III:1 III:2 III:3 III:4

IV:1 IV:2

V:1 V:2 V:3 V:4 V:5

Figure 5.2: Pedigree of the family I with non-syndromic autosomal recessive hearing loss. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

------107 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

I:1 I:2

II:1 II:2 II:3 II:4 II:5

III:1 III:2 III:3 III:4

IV:1 IV:2

V:1 V:2 V:3 V:4 V:5

Figure 5.3: Pedigree of the family J with non-syndromic autosomal recessive hearing loss. Circles represent females, squares represent males. Filled squares and circles represent affected individuals. Cross lines at the symbols indicate deceased individuals.

------108 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

1 2 3 4 5 6 7 8 9

Family H

Lane 1- IV-1 Lane 6- III-2 Lane 2- IV-2 Lane 7- IV-3 Lane 3- IV-4 Lane 8- IV-5 Lane 4- V-1 Lane 9- IV-6 Lane 5- III-1

Figure 5.4 : Electropherogram of the ethidium bromide stained 8% non-denaturing polyacrylamide gel showing allele pattern obtained with marker D14S43, and linked to DFNB35 locus on chromosome 14. All the affected individuals (IV-1, IV-2, IV-4, V-1) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

1 2 3 4 5 6 7 8 9

Family H

Lane 1- IV-1 Lane 6- III-2 Lane 2- IV-2 Lane 7- IV-3 Lane 3- IV-4 Lane 8- IV-5 Lane 4- V-1 Lane 9- IV-6 Lane 5- III-1 Figure 5.5 : Electropherogram of the ethidium bromide stained 8% non-denaturing polyacrylamide gel showing allele pattern obtained with marker D14S77, and linked to DFNB35 locus on chromosome 14. All the affected individuals (IV-1, IV-2, IV-4, V-1) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

------109 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

1 2 3 4 5 6 7 8 9

Family H

Lane 1- IV-1 Lane 6- III-2 Lane 2- IV-2 Lane 7- IV-3 Lane 3- IV-4 Lane 8- IV-5 Lane 4- V-1 Lane 9- IV-6 Lane 5- III-1 Figure 5.6 : Electropherogram of the ethidium bromide stained 8% non-denaturing polyacrylamide gel showing allele pattern obtained with marker D14S588, and linked to DFNB35 locus on chromosome 14. All the affected individuals (IV-1, IV-2, IV-4, V-1) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

1 2 3 4 5 6 7

Family I

Lane 1- IV-1 Lane 5- V-3 Lane 2- IV-2 Lane 6- V-5 Lane 3- V- 1 Lane 7- V-4 Lane 4- V-2 Figure 5.7 : Electropherogram of the ethidium bromide stained 8% non-denaturing polyacrylamide gel showing allele pattern obtained with marker D7S1818, and linked to DFNB44 locus on chromosome 7. All the affected individuals (V-1, V-2, V-3, V-5) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

------110 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

1 2 3 4 5 6 7

Family I

Lane 1- IV-1 Lane 5- V-3 Lane 2- IV-2 Lane 6- V-5 Lane 3- V- 1 Lane 7- V-4 Lane 4- V-2 Figure 5.8 : Electropherogram of the ethidium bromide stained 8% non-denaturing polyacrylamide gel showing allele pattern obtained with marker D7S2469, and linked to DFNB44 locus on chromosome 7. All the affected individuals (V-1, V-2, V-3, V-5) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

1 2 3 4 5 6 7

Family I

Lane 1- IV-1 Lane 5- V-3 Lane 2- IV-2 Lane 6- V-5 Lane 3- V- 1 Lane 7- V-4 Lane 4- V-2 Figure 5.9 : Electropherogram of the ethidium bromide stained 8% non-denaturing polyacrylamide gel showing allele pattern obtained with marker D7S2209, and linked to DFNB44 locus on chromosome 7. All the affected individuals (V-1, V-2, V-3, V-5) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

------111 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

1 2 3 4 5 6

Family J

Lane 1- IV-1 Lane 4- V-5 Lane 2- V-1 Lane 5- V-3 Lane 3- V- 2 Lane 6- IV-2 Figure 5.10 : Electropherogram of the ethidium bromide stained 8% non-denaturing polyacrylamide gel showing allele pattern obtained with marker D13S787, and linked to DFNB1 locus on chromosome 13. Two affected individuals (V-3, V-5) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

1 2 3 4 5 6

Family J

Lane 1- IV-1 Lane 4- V-5 Lane 2- V-1 Lane 5- V-3 Lane 3- V- 2 Lane 6- IV-2

Figure 5.11 : Electropherogram of the ethidium bromide stained 8% non-denaturing polyacrylamide gel showing allele pattern obtained with marker D13S143, and linked to DFNB1 locus on chromosome 13. All the affected individuals (V-1, V-2, V-3) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

------112 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

1 2 3 4 5 6

Family J

Lane 1- IV-1 Lane 4- V-5 Lane 2- V-1 Lane 5- V-3 Lane 3- V- 2 Lane 6- IV-2

Figure 5.12: Electropherogram of the ethidium bromide stained 8% non-denaturing polyacrylamide gel showing allele pattern obtained with marker D13S115, and linked to DFNB1 locus on chromosome 13. All the affected individuals (V-1, V-2, V-3) are homozygous for the common allele. The Roman with Arabic numerals refers to the individuals in the pedigree.

------113 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 5 Non-syndromic deafness

A

B

C

Figure 5.13: Representative chromatograms generated by Big Dye Terminator sequencing of coding exon of GJB2 gene from homozygous affected individuals (Panel A), a control normal individual (Panel B) and heterozygous carrier (Panel C) of family C. The arrow in panel A indicates a G-to-A substitution at nucleotide position 71, resulting in a premature stop codon (W24X). A double arrow in panel C is indicative of heterozygous sequence in carrier.

------114 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK

Chapter 6 -thalassemia

βββ-Thalassemia

Introduction

β-thalassemia is a common autosomal recessive, monogenic blood disorder. Because of this disease, hemoglobin contained in every red blood cell (RBC) is abnormally synthesized or completely suppressed (Khateeb et al ., 2000; Hafeez et al., 2007). This leads to a drop in blood Hb level, resulting in anaemia, microcytosis, hypochromia, hematuria, splenomegaly, and jaundice with elevated Hb-A2 and Hb-F levels. In addition, dwarfism, hypothyroidism, hypogonadism etc., might also be associated with thalassemia major (Jensen et al ., 1998).

The spectrum of clinical manifestations can be divided into asymptomatic and symptomatic forms (Cao et al., 1996). So the diagnosis of
-thalassemia relies upon the measurement of red blood cell indices. However, molecular analysis of the gene encoding the
-globin chain is the best diagnostic approach.

The
-globin gene cluster on chromosome 11p15.4-11p15.5 spaning 45 Kb and consists of globin like five genes: 5’-  - G  - A  -  -
-3’ (Olivieri, 1999; Das and Talukder, 2002). Mutations in various regions of
-globin gene result in either the absence or reduction of the synthesis of globin chains, while some mutations produces highly unstable
-globin products (Higgs et al ., 2001). The common defects in
- thalassemia are because of point mutations, small deletions or insertions in the
-globin gene (Mansoor et al., 1998).

To date over 300 mutations of
- globin genes have been identified worldwide (http://www.uwcm.ac.uk/uwcm/mg/hgmd.html; http://globin.cse.psu.edu), while only 20 mutations being most common. Generally, the mutations are known to be population specific. In any particular ethnic group there are usually four to six common mutations, which account for more than 90% of
–thalassemia cases, and variable number of rarer ones (Mansoor et al., 1998; Fakher et al., 2007).

Identification of both common and rare
-thalassemia mutations has proved essential for the implementation of screening and prenatal diagnosis programs. In addition, these mutations can be used as genetic markers to study the origin and spread of
-thalassemia genes, revealing historical relationships between populations (Makhoul et al., 2005). Therefore, the spectrum of
-thalassemia alleles has been determined in a

------115 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia

wide variety of populations including Greeks and Italians, Sicilians, Turks, Spaniards, Asian Indians and Chinese (Kazazian et al., 1984b; Chehab et al., 1987; Kazazian and Boehm, 1988; Varawalla et al., 1991; Benito et al., 1996; Cao et al., 1996; Loukopoules, 1996).

In Iran, more than 23 different mutations have been identified for
-thalassemia (Fakher et al., 2007). Among these, most common mutations like IVS-I-5 (G-C), IVS I-110 (G-A), IVS-I-6 (T-C), IVSII-1 (G-A), IVS- I-1 (G-A) , IVS-II-745 (C-G), FSC- 5, FSC-8/9 (+G) FSC-44 (-C) , codon 30 (G-C), codon 39 (C-T) and IVS -I-25 (-25del) were reported (Mahboudi et al., 1996). Similarly various mutations were also identified from different Indian regions, of which five common ones accounted for 91.8 to 93.6%; namely the ones at IVS -1 - 5 (G-C), FSC - 8/9 (+G), IVS-1 - 1 (G-T), FSC- 41/42 (- CTTT) and the 619 bp deletion at the 3' end of the gene (Varawalla et al., 1991;Verma et al., 1997; Vaz et al., 2000).

In Pakistan, thalassemia is one of the most common blood disorders. Although comprehensive epidemiological studies are lacking and the disease allele frequencies remained to be elucidated, yet it is estimated that 5-7% the population are carriers of this diseases. Several molecular studies conducted basically in larger cities, are available for Pakistan and 20 different mutations have been reported (Ahmad et al., 1996; Khan and Riazuddin, 1998; Khateeb et al ., 2000; El-Kalla and Mathews, 1997; Baig et al., 2005, 2006a,b). Among these, five most common mutations, IVS-I-5 (G-C), FSC-8/9 (+G), 619bp del, FSC-41/42 (-TTCT) and IVSI-1 (G-T), were detected in population through out the country. The IVS-I-5 (G-C) mutation is more prevalent in Sindh and Balochistan while the FSC-8/9 (+G) is found more common in Punjab and NWFP.

In the present work, we have studied the prevalence, distribution and mutation spectrum of thalassemia in various population strata of Dera Ghazi Khan District.

Subjects Studied

During the study, 112 unrelated families having one or more family member affected with beta thalassemia major were ascertained (Table 6.1). Among these, eighty two families gave their consent to participate in the study. The diagnosis was made through clinical data, hematological indices and hemoglobin electrophoresis. β- thalassemia trait was diagnosed when the percentage of hemoglobin A2 was ≥ 3.5%

------116 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia

(Steinberg and Adams, 1991). Collectively, 392 individuals (82 patients, 310 relatives) were included in this study.

Molecular Analysis

In this study 164
-thalassemia chromosomes were analyzed in 392 blood samples (82 transfusion dependent patients, 310 carriers /normal).

Our analysis showed a spectrum of
-thalassemia mutations in the Dera Ghazi Khan population. By applying ARMS-PCR and Multiplex ARMS-PCR techniques, 164/164 (100%)
-globin alleles were characterized for the nine
-thalassemia mutations i.e. IVS- I-5 (G-C), FSC- 8/9 (+G), FSC- 41/42 (-TTCT), IVS- I-1(G-T), IVS-II- 848 (C- A), CD 15 (G-A), CD 16 (-C), CD 30 (G-C), and FSC-5 (-CT). The relative frequencies of mutant chromosomes are listed in Table 6.2. Two mutations IVS-I-5 (G-C; 59.15%) and FSC 8-9 (+G; 33.54%) accounted for 92.68 % of the
-thalassemia chromosomes.

Figure 6.1 presents the ARMS-PCR results for most common
-thalassemia mutation IVS-1-5 (G-C), while Figure 6.2 shows Multiplex ARMS-PCR results for the mutations IVS-1-5 (G-C), FSC-8/9 (+G) and FSC- 41/42 (-TTCT).

Among patients, true homozygote and compound heterozygous mutations were observed in 65 (79.27%) and 17 (20.73%) patients, respectively (Table 6.3). These mutations included homozygous mutations of IVS -1-5 (G-C) in 38 (46.34%), FSC 8/9 (+G) in 25 (30.49%) and FSC-5 (-CT) in 2 (2.44%) patient while compound heterozygous, a combination of IVS -1-5 (G-C) with FS- 8/9 (+G) , CD30 (G-C) and CD 15 (G-A) were detected in 12 (14.63%), 01 (1.22%), and 01 (1.22%) patients respectively. In addition, two combinations of FSC- 8/9 (+G) with FSC- 41/42 (-TTCT) and IVS 11- 848 (C-A) with CD 16 (-C) were found in 01 (1.22%) and 01 (1.22%) patient, respectively.

Ethnic Distribution of
-Thalassemia Mutations

The frequency and distribution of
-thalassemia mutations by the various ethnic groups are presented in Table 6.4. Among ethnic groups Baloch and Migrants were found to be relatively more homogeneous than Native in their
-globin mutations distribution.

Fifty four β-thalassemia chromosomes were analyzed in the Baloch subjects. Three different
-globin mutations were detected in Baloch subjects. Two mutations IVS- I-5 (G-C; 81.48%) and FSC-8/9 (+G; 16.67%) accounted for 98.15% of the
-thalassemia

------117 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia chromosomes. The CD 15 (G-A) mutation was rare (1.85%) but exclusive to the Baloch ethnic group.

In the Native subjects, 105 β-thalassemia chromosomes were analyzed. This group was found most heterogeneous with seven different mutations. The IVS-I-5 (G-C) mutation (50.98%) followed by FSC- 8/9 (+G; 39.22%) were the most common. Five mutations IVS-I-1 (G-T; 1.96 %), IVS-II-848 (C-A; 0.98%), CD16 (-C; 0.98%), CD30 (G-C; 1.96%), and FSC- 5 (-CT; 3.92%) were found to be exclusive to Native ethnic group.

For the Migrants, three mutations were found in twenty
-thalassemia chromosomes. Two mutations IVS-I-5 (G-C; 12.50%) and FSC-8/9 (+G; 75.0 %) accounted for 87.50% of the
-thalassemia chromosomes The FSC- 41/42 (-TTCT) mutation was also 12.50% but exclusive to the Migrant ethnic group.

Distribution of
-Thalassemia mutations in various castes

Being part of Indian subcontinent, population is divided in to a number of endogamous groups called castes/sub tribes. Different castes were found with different types of molecular defects. The presence of various
-thalassemia mutations in different castes and tribes is presented in Table 6.5. In all the endogamous groups, only one or two mutations were found. However in some castes, the detected mutation was not found in any other group. Such as FSC-41/42 (-TTCT), FSC-5 (-CT) and CD15 (G-A) were reported in Sherwanii (Migrant caste), Jaskani (Native caste) and Jarwar (Khosa Baloch tribe) respectively. In two Native castes two mutations IVS-1-1 (G-T) and CD30 (G-C) in Sontra, and CD16 (-C), and IVS-II-848 (C-A) in Dasti families were reported.

Regional Distribution of
- Thalassemia Mutations

Table 6.6 presents the distribution of
-thalassemia mutations in administratively and geographically different areas of the District i.e. Tribal area, Taunsa, and DG Khan Rural and Urban areas. The families from Tribal area and Taunsa were found to be relatively more homogeneous than that of DG Khan in their
-globin mutations distribution.

Thirty six β-thalassemia chromosomes were found in the subjects belonging to Tribal area. Only two
-globin mutations, IVS-I-5 (G-C; 86.11%) and FSC-8/9 (+G; 13.84%), were present in tribal subjects. Similarly eighteen β-thalassemia chromosomes

------118 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia were found in subjects belonging to Taunsa and only two
-globin mutations, IVS-I-5 (G- C; 77.78 %) and FSC-8/9 (+G; 22.22%), were found. However, the subjects belonging to rural and urban areas of DG Khan were found more heterogeneous with five and six different mutations, respectively. The IVS-I-5 (G-C) mutation and FSC -8/9 (+G) were the most common in both areas. Other mutations like IVS-I-1 (G-T), CD15 (G-A), and CD30 (G-C) in rural areas, and IVS-II-848 (C-A), CD16 (-C), FSC- 5 (-CT) and FSC- 41/42 (-CTTT) in urban areas were found.

Discussion

-thalassemia is characterized by its genetic heterogeneity at the molecular level. More than 300 mutations of the -globin gene have been detected all over the world, though each population seems to harbour only a few of these mutations (Bandyopadhyay et al., 1999; http://globin.cse.psu.edu). Therefore, molecular characterization of - thalassemia is absolutely necessary for premarital counseling, prenatal diagnosis, as well as epidemiological study in the region (Balgir, 2002; Baig et al., 2005; Samara et al., 2007).

In this regard, the advent of the polymerase chain reaction (PCR), the subsequent development of more convenient DNA analysis methods, and the continuous accumulation of knowledge on the
-globin gene mutations, gave a great impetus to the rapid screening of large numbers of individuals (Tadmouri and Gulen, 2003). Among various PCR based molecular available methods, Amplification refractory mutation system-PCR (ARMS-PCR) and Multiplex ARMS-PCR are the most convenient and cost effective methods for the detection of known
-thalassemia mutations. Several groups have already used the ARMS-PCR technique successfully for population screening (Ahmed et al., 2000; Panyasai, et al., 2004; Makhoul et al., 2005; Baig et al., 2006a, b).

By using ARMS-PCR method in present study, we analyzed 164
-thalassemia chromosomes obtained from 82 different families from Dera Ghazi Khan and detected nine different mutations in the
-globin gene. The mutations found were IVS-I-5 (G-C), FSC-8/9 (+G), FSC-5 (-CT), IVS-I-1(G-T), CD41/42 (-TTCT), IVS-II-848 (C-A) and CD15 (G-A), CD16 (-C) and CD30 (G-C). The spectrum of
-globin gene mutations revealed by our study is in agreement with previous reports from different areas of Pakistan (Ahmad et al., 1996; Khan and Riazuddin, 1998; Khateeb et al., 2000; Baig et al., 1999, 2005, 2006a, b).

------119 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia

The distribution and frequency of mutations in the population under studied have several striking characteristics and provide important demographic insights.

The IVS-I-5 (G-C) is the most common mutation, found in 59% of the subjects and was represented in all the ethnic groups as well as most of the castes (Table 6.6). The frequency of IVS-1-5 in this study is one of the highest as compared to the previous studies conducted in various regions of Pakistan (Baig et al., 2005, 2006a, b; Table 6.8).

The second most common mutation identified in the present study is FSC- 8/9 (33.54%), which is in agreement with the earlier reports from Northern areas of the country and Bahawalpur, Faisalabad and other cities of Punjab province (Rabbi et al., 1999; Ahmed et al., 2000; Baig et al., 2005, 2006a, b).

Other mutations FSC-5 (-CT), IVS-I-1(G-T), CD41/42 (-TTCT), IVS-II-848 (C- A) and CD15 (G-A), CD16 (-C) and CD30 (G-C) are in low frequencies and detected in one or two families belonging to same caste. Interestingly, the 619 bp deletion mutation reported in Sindh and DG Khan Region (Muzaffar Garh and Liah Districts) by various previous studies like Khan and Riazuddin (1998) and Baig et al. (2006a, b) was not detected in any family in present study.

In the present study, 79.27% affected children were true homozygotes. In these true homozygotes, 46.34% had IVSI-5 (G-C)/IVS-I-5 (G-C), 30.49% had FSC8-9 (+G)/FSC8-9 (+G), and 2.44% had FSC-5 (-CT)/FSC-5(-CT) genotypes. The diagnosis of these homozygotes confirms our data, that majority of the couples were close relatives, first cousins or belonging to the same tribe/caste. The present study also confirms the association between consanguinity and high rate of true homozygosity of these mutations in Pakistani population (Ahmed and Saleem, 2002).

In this scenario, it became clear that the population is mainly divided in to two main groups: IVS-1-5 (G-C) and FSC-8/9(+G). The very specific pattern of distribution of these two mutations in population seems to be very old as previously described for the Indian subcontinent (Varawalla et al ., 1992; Agarwal et al ., 2000). This indicates that groups have different origin or they may be bifurcated before the appearance of these mutations. The group having IVS-1-5 (G-C) seems to have acquired this mutation from Dravidians or people of south India where the incidence is very high (Ambekar et al., 2001). Other group having FSC-8/9 (+G) mutation may come and settled during the

------120 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia various historic migrations and invasions from northren areas where high prevalence of FSC-8/9 (+G) mutation was reported by Khateeb et al . (2000).

Low frequency of other mutations i.e. FSC-5 (-CT), IVS-I-1(G-T), CD41/42 (- TTCT), IVS-II-848 (C-A) and CD15 (G-A), CD16 (-C) and CD30 (G-C), in the families concludes that these mutations dispersed through population migration and gene flow. However, surprisingly despite the claim of certain tribes/castes having origin from outside Indian continent, only mutation/s exclusively found in India and Pakistan were detected among these in this study.

We believe that these mutations represent most, if not all, of the mutations in the population because our study is not hospital based like most of the previous studies conducted in Pakistan. In this study, families were collected by random survey so the results can be used to extrapolate prevalence of thalassemia in the general population and can allow us to establish a prenatal diagnosis program for the population of DG Khan District.

------121 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia

Table 6.1: Ethnic distribution of families affected with thalassemia disorder in Dera Ghazi Khan

Ethnic Group Natives Baloch Migrants

1 Angari = 1 Ahmadani = 3 Pathan = 1

2 Arain = 3 Bindwani = 1 Sadiquee = 1 3 Bhati- = 5 Buglani = 1 Sh.qureshi = 1 4 Birmani = 1 Buzdar = 6 Sherwani

5 Bubur = 1 Gulyani = 4 6 Chatani = 1 Habtani = 2 7 Chinah = 1 Hadyani = 1

8 Chugtai = 1 Hajbani = 2 9 Chunar = 1 Hatwani = 1 10 Dasti- = 2 Hijrani = 1

11 Dhainga = 1 Jarwar = 1 12 Jafar = 1 Jhingal = 2 13 Jaskani = 2 Jindani = 1

14 Jat arabi = 1 Jiyani = 1 15 Kharpat = 1 Jogiani- = 1 16 Khokher = 2 Khosa = 2 Caste/ Tribe 17 Malik = 6 Kungrani = 1 18 Mastoi = 1 Lashari = 5

19 Mehowna = 1 Laskani = 2

20 Mulghani = 1 Leghari = 2 21 Mundae = 1 Lund = 1

22 Munjhotha = 1 Muridani = 1 23 Native = 1 Nutkani = 2 24 Native = 2 Qaisrani = 5

25 Patafi = 2 Saisrani = 1 26 Qureshi = 1 Sikhani = 1 27 Saial = 2 Wadani = 1

28 Sandhela = 1 29 Sanghi = 2 30 Sayed = 1

31 Seraii = 1 32 Shadi khail = 1 33 Shamsi = 1

34 Sipal = 3 35 Somroo = 1 36 Sontra = 1 37 Uttra = 1

Total 56 52 04

------122 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia

M 1 2 3 4 5 6 7 8 9 10 11 12

Mt 576 bp

293 bp

576 bp N 293 bp

Figure 6.1: Photograph of agarose gel showing the analysis for IVS-I-5 (G-C) mutation. Lane 1: control homozygote; lane 2: heterozygote; lane 3: control normal for this mutation; lanes 4, 9, and 12 samples are heterozygote; lanes 6 and 7 samples are homozygous while lanes 5, 10, and 11 are negative for IVS-I-5 mutation.

M 1 2 3 4 5 6 7 8 9 10 11 12

576 bp Mt 451 bp 293 bp 215 bp

N 576 bp 451 bp 293 bp 215 bp

Figure 6.2: Photograph showing Multiplex ARMS–PCR and gel electrophoresis analysis for the most common mutations IVS -I -5, FSC-8/9 (+G) and FSC-41/42 mutations. lane 1: control Homozygous for IVS I-5, Lane 2: compound heterozygote for IVS I-5 and FSC-8/9; lane 3: control compound heterozygote for FSC-8/9 and FSC-41/42 ; lanes 4: homozygous for IVS I-5; 6 & 10 are heterozygous for FSC-8/9 ; 7 is compound heterozygous sample for FSC-8/9 and FSC-41/42; 9 & 12 are heterozygous for IVS- I-5; while 5, 8 & 11 samples are negative for these mutations.

------123 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia

Table 6.2: Frequency of -thalassemia mutations in the population (164 Alleles) Mutations Number of alleles Frequency 1.IVS-1 -5 (G-C) 97 59.15% 2. FSC-8-9 (+G) 55 33.54% 3 IVS-II-848 (C-A) 01 0.61% 4. CD 16 (-C) 01 0.61% 5. FSC-41-42 (-TTCT) 01 0.61% 6.CD 15 (G-A) 01 0.61% 7.IVS-1-1 (G-T) 02 1.22% 8.FSC-5 (-CT) 04 2.44% 9.CD 30 (G-C) 02 1.22% 164 100.01

Table 6.3: Frequency of -thalassemia mutations in the patients

Status S.No Mutation/s Number of Frequency patients Homozygous 1 IVS 1-5/ IVS 1-5 38 46.34%

79.27% 2 FSC 8-9/ FSC 8-9 25 30.49%

3 FSC-5/FSC-5 02 2.44%

Compound 4 IVS 1-5/ FSC 8-9 12 14.63% heterozygous 5 IVS 1-5/ Cd-15 1 1.22% 20.73% 6 FSC 8-9/FSC-41-42 1 1.22%

7 IVS 1-1/ Cd-30 2 2.44%

8 IVS 11-848/ Cd-16 1 1.22%

Total 82 100

------124 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia

Table 6.4: Frequency of β-thalassemia Mutations in ethnic groups

Mutation Baloch Migrant Native Total IVS-I-5 (G-C) 44 01 52 97 (81.48%) (12.50%) (50.98%) FSC-8/9 (+G) 09 06 40 55 (16.67%) (75.00%) (39.22%) FSC-41/42 (-TTCT) - 01 - 01 (12.50%) IVS-I-1 (G-T) - - 02 02

(1.96%) IVS-II-848 (C-A) - - 01 01 (0.98%) CD 15 (G-A) 01 - - 01 (1.85%) CD16 (-C) - - 01 01 (0.98%)

CD30 (G-C) - - 02 02

(1.96%) FSC- 5(-CT) - - 04 04 (3.92%) Total 54 08 102 164

------125 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia

Table 6.5: Representation of various mutation/s in different castes and sub-tribes Ethnicity/ Mutations Total caste 1 2 3 4 5 6 7 8 9 Pathan - + ------01

Migrant Siddique - + ------01 Sheikh ------Qureshi + + ------02 Sherwani + - + ------02 Leghari + + ------02 Gulyani + ------01

Baloch Lashari + ------01 Khosa + + - - - + - - - 02 Kasrani + + ------02 Buzdar - + ------01 Laskani + ------01

Bhati + ------01 Arain - + ------01 Sipal + + ------02 Chugtai - + ------01 Chunar + ------01 Dasti - - - + + - - - - 02 Sontra ------+ - + 02 Jafar + + ------02 Malik + ------01 Native Native Khoja + ------01 Pathan + + ------02 Sanghi + ------01 Saial + + ------02 Jaskani ------+ - 01 Khokhar - + ------01 Mujawar - + ------01 Mastoi - + ------01

1. IVS- I-5 (G-C), 2. FSC- 8/9 (+G), 3. FSC- 41/42 (-TTCT), 4. Cd-16 (-C), 5. IVS-II-848(C-A), 6.Cd-15(G-A), 7.IVS- 1-1(G-T), 8.FSC-5 (-CT), 9.Cd-30(G-C)

------126 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia

Table 6.6: Geographical distribution of β-thalassemia Mutations Mutation Tribal area Taunsa DGK DGK Total Rural Urban IVS-I-5 (G-C) 31 14 25 27 97 (86.11%) (77.78%) (62.25%) (38.57%) FSC-8/9 (+G) 05 04 10 36 55 (13.89%) (22.22%) (25.00%) (51.43%) FSC-41/42 - - 01 01 (-TTCT) (01.43%) IVS-I-1 (G-T) - - 02 02 (05.00%) IVS-II-848 (C- - - - 01 01 A) (1.43%) CD 15 (G-A) - 01 - 01 (2.50%) CD16 (-C) - - - 01 01 (1.43%) CD30 (G-C) - - 02 - 02 (05.00%) FSC- 5(-CT) - - - 04 04 (5.71%) Total 36 18 40 70 164

------127 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 6 -thalassemia

Table 6.7: Regional comparison of Frequency of β-thalassemia Mutations Mutation Pakistan* RWP/IBD* FAD* LH, MN,* DGK** KHI IVS-I-5 (G-C) 38.31 30.51 47.93 31.25 59.15% FSC-8/9 (+G) 25.20 28.81 17.36 11.25 33.54% CD41/42 (-TTCT) 7.46 9.61 9.1 2.50 0.61% IVS-I-1 (G-T) 2.82 2.26 1.65 - 1.22% IVS-II-I (G-T) 2.42 3.96 4.13 - - 619bp del 0.40 00 1.65 - -

IVS-II-848 (C-A) 4.23 2.82 5.79 8.75 0.61% CD -15 (G-A) 3.23 2.26 3.31 7.50 0.61%

CD-16 (-C) 2.22 4.52 - 2.50 0.61%

IVSI-I (G-A) 3.43 3.39 4.96 6.25 -

CD-30 (G-C) 1.01 2.26 - - 1.22%

CD-26 (G-A) 0.81 1.70 - 1.25 -

CD-39 (C-T) 0.40 1.13 - - -

CD-30 (G-A) 0.61 0.56 - 2.50 -

Initiation CD (T-C) 0.40 1.13 - - -

Cap+1 0.40 0.56 0.83 - -

-88 0.40 0.56 - 1.25 -

FSC-5 (-CT) - - - - 2.44%

96.01 96.70 75.00 100.01

* Khan and Riazuddin, 1998; Khateeb et al., 2000; Baig et al., 2006a,b ** Present study

------128 A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK Chapter 7 References

REFERENCES

• Abdel-Meguid N, Zaki MS, Hammad SA (2000) Premarital genetic investigations: effect of genetic counselling. East Mediterr Health J 6: 652-660

• Afzal M (1988) Consequences of consanguinity on cognitive behavior. Behav Genet 18: 583-594

• Agarwal S, Hattori Y, Agarwal SS (2000) Rare beta-thalassemia mutations in Asian Indians. Prenat Diagn 20: 986-991

• Ahituv N, Sobe T, Robertson NG, Morton CC, Taggart RT, Avraham KB (2000) Genomic structure of the human unconventional myosin VI gene. Gene 261: 269- 275

• Ahmad M, Abbas H, Haque S (1993) Alopecia universalis as a single abnormality in an inbred Pakistani kindred. Am J Med Genet 46: 369-371

• Ahmad W, Faiyaz ul Haque M, Brancolini V, Tsou HC, ul Haque S, Lam H, Aita VM, Owen J, deBlaquiere M, Frank J, Cserhalmi-Friedman PB, Leask A, McGrath JA, Peacocke M, Ahmad M, Ott J, Christiano AM (1998) Alopecia universalis associated with a mutation in the human hairless gene. Science 30: 720-724

• Ahmad W, Nomura K, McGrath JA, Hashimoto I, Christiano AM (1999) A homozygous nonsense mutation in the zinc-finger domain of the human hairless gene underlies congenital atrichia. J Invest Dermatol 113: 281-283

• Ahmed S, Petrou M, Saleem M (1996) Molecular genetics of β-thalassemia in Pakistan: a basis for prenatal diagnosis. Br J Hematol 94: 476-482

• Ahmed S, Saleem M (2002) Screening extended families for genetic hemoglobin disorders in Pakistan. New Engl J Med 347: 1162-1168

• Ahmed S, Saleem M, Sultana N, Raashid Y, Waqar A, Anwar M, Modell B, Karamat A, Petrou M (2000) Prenatal diagnosis of β-thalassemia in Pakistan: experience in a Muslim country. Prenat Diagn 20: 378-383

• Ahmed ZM, Li XC, Powell SD, Riazuddin S, Young TL, Ramzan K, Ahmad Z, Luscombe S, Dhillon K, MacLaren L, Ploplis B, Shotland LI, Ives E, Riazuddin S,

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 129

Chapter 7 References

Friedman TB, Morell RJ, Wilcox ER (2004) Characterization of a new full length TMPRSS3 isoform and identification of mutant alleles responsible for nonsyndromic recessive deafness in Newfoundland and Pakistan. BMC Med Genet 5: 24-27

• Al-Abdulkareem AA, Ballal SG (1998) Consanguineous marriage in an urban area of Saudi Arabia: rates and adverse health effects on the offspring. J Community Health 23: 75-83

• Al-Arrayed SS (1999) Review of the spectrum of genetic diseases in Bahrain. East Mediterr Health J 6: 1114- 1120

• Al-Awadi SA, Moussa MA, Naguib KK, Farag TI, Teebi AS, El-Khalifa M, El- Dossary L (1985) Consanguinity among the Kuwaiti population. Clin Genet 27: 483-486

• Al-Awadi SA, Naguib KK, Moussa MA, Farag TI, Teebi AS, El-Khalifa MY (1986) The effect of consanguineous marriages on reproductive wastage. Clin Genet 29: 384-388

• Al-Gazali L (2005) Attitudes toward genetic counseling in the United Arab Emirates. Commun Genet 8: 48-51

• Al-Gazali L, Hamamy H, Al-Arrayad S (2006) Genetic disorders in the Arab world. Br Med J 333: 831-834

• Al-Gazali LI, Bener A, Abdulrazzaq YM, Micallef R, Al-Khayat AI, Gaber T (1997) Consanguineous marriages in The United Arab Emirates. J Biosoc Sci 29: 491-497

• Ali SGM, Hussain M (1976) Pattern of inbreeding and its effects on the human biology of Bangla Desh. Pro III Ann Conf of the Indian soc human genetics, Delhi Univ.p.48

• Al-Nassar KE, El-Kazimi AA, Kelly CL (1989) Patterns of consanguinity in the population of Kuwait. Am J Hum Genet 45: 910-915

• Al-Thakeb F (1985) The arab family and modernity: evidence from Kuwait. Curr Anthropol 26: 575-580

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 130

Chapter 7 References

• Alwan A, Modell B (1997) Community control of genetic and congenital disorders. Alexandria: Eastern Mediterranean Regional Office, World Health Organization, EMRO Technical Publication, 24

• Ambekar SS, Phadke MA, Balpande DN, Mokashi GD, Khedkar VA, Bankar PS, Gambhir PM, Bulakh DG Basutkar (2001) The Prevalence and Heterogeneity of Beta Thalassemia Mutations in The Western Maharashtra Population: A Hospital Based Study. Int J Hum Genet 1: 219-223

• Amudha S, Aruna N, Rajangam S (2005) Consanguinity and chromosomal abnormality. Indian J Hum Genet 11: 108-110

• Ansar M, Chahrour MH, Amin Ud Din M, Arshad M, Haque S, Pham TL, Yan K, Ahmad W, Leal SM (2004) DFNB44, a novel autosomal recessive non-syndromic hearing impairment locus, maps to chromosome 7p14.1-q11.22. Hum Hered 57: 195-199

• Ansar M, Din MA, Arshad M, Sohail M, Faiyaz-Ul-Haque M, Haque S, Ahmad W, Leal SM (2003) A novel autosomal recessive non-syndromic deafness locus (DFNB35) maps to 14q24.1-14q24.3 in large consanguineous kindred from Pakistan. Eur J Hum Genet 11: 77-80

• Aslam M, Chahrour MH, Razzaq A, Haque S, Yan K, Leal SM, Ahmad W (2004) A novel locus for autosomal recessive form of hypotrichosis maps to chromosome 3q26.33-q27.3. J Med Genet 41: 849-852

• Azevedo ES, Freire-Maia N, Azevedo MCC, Weimer TA, Souza MMM (1980) Inbreeding in A Brazilian general hospital. Ann Hum Genet 43: 255-264

• Baig SM, Azhar A, Hassan H, Baig JM, Aslam M, Ud Din MA, Qureshi JA, Zaman T (2006a) Prenatal diagnosis of beta-thalassemia in Southern Punjab, Pakistan. Prenat Diagn 26: 903-905

• Baig SM, Azhar A, Hassan H, Baig JM, Kiyani A, Hameed U, Rabbi F, Bokhari H, Aslam M, Ud Din MA, Baig SA, Hassan K, Qureshi JA, Zaman T (2006b) Spectrum of beta-thalassemia mutations in various regions of Punjab and Islamabad, Pakistan: establishment of prenatal diagnosis. Haematologica 91: ELT02

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 131

Chapter 7 References

• Baig SM, Rabbi F, Hameed U, Qureshi JA, Mahmood Z, Bokhari SH, Kiani A, Hassan H, Baig JM, Azhar A, Zaman T. (2005) Molecular characterization of mutations causing β -thalassemia in Faisalabad Pakistan using the amplification refractory mutation system (ARMS-PCR). Indian J Hum Genet 11: 80-83

• Baig, SM, Rabbi F, Yaqoob N, Baig S, Khan MMA, Shamsi ST, Fatima N, and Qureshi JA (1999) Molecular study and prenatal diagnosis of β-thalassemia in Pakistan by ARMS-PCR. First Scientific Symposium of The Children Hospital Lahore held on December 3-4

• Balgir RS (2002) Genetic dimension of sickle cell hemoglobinopathy among the scheduled caste populations of India. Indian Practr 55: 503-514

• Bandyopadhyay A, Bandyopadhyay S, Chowdhury MD, Dasgupta UB(1999) Major beta-globin gene mutations in eastern India and their associated haplotypes. Hum Reprod 49: 232-235

• Banerjee K, Roy TK (2002) Parental consanguinity and offspring mortality: The search for possible linkage in the Indian context. Asia Pac Popul J 17: 17-38

• Banerjee SK, Roy TK (1996) Incidence of consanguineous marriage in India and its impact on child mortality. Paper presented at the XIX Annual Conference of IASP, M.S. University, Vadodara

• Bassi RA, Freire-Maia N (1985) Marriage age and inbreeding in Curitiba, Southern Brazil. Rev Bras Genet 8: 199-203

• Bellew HW (1979) The Races of Afghanistan. Lahore: Sang-e-Meel Publications

• Benito A, Villegas A, Perez-Cano R, Bernal R. (1996) -Thalassaemia in south- western Spain: High frequency of G A (IVS-I-1) mutation. Br J Haematol 92: 336-338

• Benjamin GP, Charles H (1994) Modernization and consanguineous marriage in Iran. J Marriage and Family 56: 820-854

• Bennett RL, Steinhaus KA, Uhrich SB, O'Sullivan CK, Resta RG, Lochner-Doyle D, Markel DS, Vincent V, Hamanishi J (1995) Recommendations for standardized human pedigree nomenclature. Pedigree standardization task force of the national Society of genetic counselors. Am J Hum Genet 56: 745-752

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 132

Chapter 7 References

• Bittles AH (1991) Societal stratification, consanguinity and fertility. Behav Brain Sci 14: 312-313.

• Bittles AH (1995) The influence of consanguineous marriage on reproductive behaviour in India and Pakistan. In: Diversity and Adaptability in Human Populations, eds. A.J. Boyce and V. Reynolds, pp. 72-85. Oxford: Oxford University Press

• Bittles AH (1998) Empirical Estimates of the Prevalence of Con-sanguineous Marriage in Contemporary Societies. Working Report No. 74, Morrison Institute for Population and Resource Studies, Stanford, Stanford University

• Bittles AH (2001) Consanguinity and its relevance to clinical genetics. Clin Genet 60: 89-98

• Bittles AH (2002) Endogamy, consanguinity and community genetics. J Genet 81: 91-98

• Bittles AH (2005) Endogamy, consanguinity and community disease profiles. Commun Genet 8: 17-20

• Bittles AH, Egerbladh I (2005) The influence of past endogamy and consanguinity on genetic disorders in northern Sweden. Ann Hum Genet 69: 549-558

• Bittles AH, Grant JC, Shami SA (1993) An evaluation of consanguinity as a determinant of reproductive behaviour and mortality in Pakistan. Int J Epidemiol 22: 463-467

• Bittles AH, Mason WM, Greene J, Rao NA (1991) Reproductive behavior and health in consanguineous marriages. Science 252: 789-794

• Bittles AH, Neel JV (1994) The costs of human inbreeding and their implications for variation at the DNA level. Nat Genet 8: 117-121.

• Bittles AH, Savithri HS, Murthy HSV, Baskaran G, Wang W (2001) Consanguinity: a familiar story full of surprises, pp. 68–78 In: Health and Ethnicity, (eds) Macbeth H, Shetty P, Taylor and Francis, London

• Bittles AH, Savithri HS, Rao NA (2002) Community genetics in developing countries: Community Genet. 5:151–152

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 133

Chapter 7 References

• Bittles AH, Savithri HS, Venkatesha Murthy HS, Baskaran G, Wang W, Cahill J (2001) Human inbreeding: a familiar story full of surprises. In: Ethnicity and Health, (eds) Macbeth H, Shetty P, pp. 68-78. London: Taylor and Francis

• Bittles AH, Shami SA, Rao NA (1992) Consanguineous marriage in Southern Asia: incidence, causes and effects. In Minority Populations: Genetics, Demography and Health, (eds) A.H. Bittles and D.F. Roberts, pp. 102-118. London: Macmillan

• Bittles AH, Sullivan SG, Zhivotovsky LA (2004) Consanguinity, caste and deaf- mutism in Punjab, 1921. J Biosoc Sci 36: 221-234

• Bouazzaoui LN (1994) Consanguinity and public health in Morocco. Bull Acad Natl Med 178: 1013-1025

• Broman KW, Murray JC, Sheffield VC, White RL, Weber JL (1998) Comprehensive human genetic maps: individual and sex-specific variation in recombination. Am J Hum Genet 63: 861-869

• Bruzzone R, White TW, Paul DL (1996) Connections with connexins: the molecular basis of direct intercellular signaling. Eur J Biochem 238: 1-27

• Bundey S, Alam H (1993) A five –year prospective study of the health of children in different ethnic groups, with particular reference to the effect of inbreeding. Eur J Hum Genet 1: 206-219

• Burchard EG, Ziv E, Coyle N, Gomez SL, Tang H, Karter AJ, Mountain JL, Perez-Stable EJ, Sheppard D, Risch N (2003) The importance of race and ethnic background in biomedical research and clinical practice. N Engl J Med 348: 1170-1175

• Cao A, Galanello R (2002) Effect of consanguinity on screening for thalassemia. N Engl J Med 347: 1200-1202

• Cao A, Rosatelli MC, Galanello R (1996) Control of beta-thalassaemia by carrier screening, genetic counselling and prenatal diagnosis: the Sardinian experience. Ciba Found Symp 197: 137-151

• Caroe O (1992) The Pathans. Karachi: Oxford University Press, 1992

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 134

Chapter 7 References

• Chavanas S, Bodemer C, Rochat A, Hamel-Teillac D, Ali M, Irvine AD, Bonafe JL, Wilkinson J, Taieb A, Barrandon Y, Harper JI, de Prost Y, Hovnanian A (2000) Mutations in SPINK5, encoding a serine protease inhibitor, cause Netherton syndrome. Nat Genet 25: 141-142

• Chehab FF, Der KV, Khouri FP, Deeb SS, Kan YW (1987) The molecular basis of b-thalassemia in Lebanon: application to prenatal diagnosis. Blood 69: 1141–45

• Cooper E, Zhang M (1993) Patterns of cousin marriage in rural Zhejing and in dream of the red chamber. J Asian Stud 52: 90–106

• Dahl HH, Saunders K, Kelly TM, Osborn AH, Wilcox S, Cone-Wesson B, Wunderlich JL, Du Sart D, Kamarinos M, Gardner RJ, Dennehy S, Williamson R, Vallance N, Mutton P (2001) Prevalence and nature of connexin 26 mutations in children with non-syndromic deafness. Med J Aust 175: 191-194

• Das S K, Talukder G (2002) Beta globin gene and related diseases, a review. Int J Hum Genet 2: 139-152

• Das SK, Talukder G (2001) A review on the origin and spread of deleterious mutants of the Beta-globin gene in Indian populations. Homo 52 : 93-109

• Denoyelle F, Lina-Granade G, Plauchu H, Bruzzone R, Chaib H, Levi-Acobas F, Weil D, Petit C (1998) Connexin 26 gene linked to a dominant deafness. Nature 393: 319-320

• Denoyelle F, Weil D, Maw MA, Wilcox SA, Lench NJ, Powell ADR, Osborn AH, Dahl HH, Middleton A, Houseman MJ, Dodé C, Marlin S, ElGaïed BA, Grati M, Ayadi H, BenArab S, Bitoun P, Granade LG, Godet J, Mustapha M, Loiselet J, El- Zir E, Aubois A, Joannard A, Petit C (1997) Prelingual deafness: high prevalence of a 30delG mutation in the connexin 26 gene. Hum Mol Genet 6: 2173-2177 • Dhanrajani PJ, Jiffry AO (1998) Management of ectodermal dysplasia: a literature review. Dent Update 25: 73-75

• Din MA, Salam A, Rafiq Ma, Khaliq I, Ansar M, Ahmad W (2007) Aposthia: a birth defect or normal quantitative recessive human genetic trait? East Mediter Health Journal 13(2):280-286

• El-Hazmi MAF (1999) Spectrum of genetic disorders and the impact of health care delivery: an introduction. East Mediter Health Journal 5:1104-1113

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 135

Chapter 7 References

• El-Kalla S, Mathews ARA (1997) Significant β-thalassemia heterogeneity in the United Arab Emirates. Hemoglobin 21: 237-247

• El-Shanti H (2001) The impact of genetic diseases on Jordanians: strategies towards prevention. J Biomed Biotechnol 1: 45–47

• Fakher R, Bijan K, Taghi AM (2007) Application of diagnostic methods and molecular diagnosis of hemoglobin disorders in Khuzestan province of Iran. Indian J Hum Genet 13: 5-15

• Feinstein A, Engelberg S, Goodman RM (1987) Genetic disorders associated with severe alopecia in children: a report of two unusual cases and a review. J Craniofac Genet Dev 7: 301-310

• Fikree FF, Azam SI, Berendes HW (2002) Time to focus child survival programmes on the newborn: assessment of levels and causes of infant mortality in rural Pakistan. Bull World Health Organization 80: 271-276

• Fischel-Ghodsian N (1999) Mitochondrial deafness mutations reviewed. Hum Mutat 13: 261-270

• Freire-Maia N (1984) Effects of consanguineous marriages on morbidity and precocious mortality: genetic counseling. Am J Med Genet 18: 401-406

• Freir-Maia N, Azvedo JBC (1971) The inbreeding load in Brazilian Whites and Negroes as estimated with sib and cousin controls. Am J Hum Genet 23: 1-7

• Freundich E, Hino N (1984) Consanguineous marriage among rural Arabs in Israel. Isr J Med Sci 20: 1035-1038

• Friedman TB, Griffith AJ (2005) Human nonsyndromic sensorineural deafness. Annu Rev Genomics Hum Genet 4: 341–402

• Fuchs E, Merrill BJ, Jamora C, DasGupta R (2001) At the roots of a never-ending cycle. Dev Cell 1: 13-25

• Fukushima K, Ramesh A, Srisailapathy CR, Ni L, Chen A, O'Neill M, Van Camp G, Coucke P, Smith SD, Kenyon JB, Jain P, Wilcox ER, Zbar RIS, Smith RJH (1995) Consanguineous nuclear families used to identify a new locus for recessive non-syndromic hearing loss on 14q. Hum Mol Genet 4: 1643-1648

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 136

Chapter 7 References

• Gadgil M, Joshi NVC, Manoharan S, Patil S, Prasad UVS (1998) Peopling of India; in Balasubramanian D, Rao NA. The Indian Human Heritage. Hyderabad, Universities Press. pp 100–129

• Ghosh M, Vijaya R, Kabra M (2004) Genetics of deafness in India. Indian J Pediatr 71: 531-533

• Gonzalez-Martin A, Toja, D (2002) Inbreeding, Isonomy, and Kin-structured Migration in the principality of Andoria. Hum Biol 74: 587-601

• Goody J (1983) The development of family and marriage in Europe. Cambridge Univ Press

• Guan MX, Fischel-Ghodsian N, Attardi G (2001) Nuclear background determines biochemical phenotype in the deafness-associated mitochondrial 12S rRNA mutation. Hum Mol Genet 10: 573-580

• Guo G (1993) Use of sibling data to estimate family mortality effects in Guatemala. Demography 30: 15-32

• Guttmacher AE, Collins FS (2002) Genomic medicine--a primer. N Engl J Med 347: 1512-1520

• Haan EA (2003) The clinical geneticist and the "new genetics". Med J Aust 178: 458-462

• Hafeez M, Aslam M, Ali A, Rashid Y, Jafri H (2007) Regional and ethnic distribution of beta thalassemia mutations and effect of consanguinity in patients referred for prenatal diagnosis. J Coll Physicians Surg Pak 17: 144-147

• Häfner FM, Salam AA, Linder TE, Balmer D, Baumer A, Schinzel AA, Spillmann T, Leal SM (2000) A novel locus (DFNA24) for prelingual nonprogressive autosomal dominant nonsyndromic hearing loss maps to 4q35-qter in a large Swiss German kindred. Am J Hum Genet 66: 1437-1442

• Hamamy H, Alwan A (1997) Genetic disorders and congenital abnormalities: strategies for reducing the burden in the Region. East Mediterr Health J 3: 123- 132

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 137

Chapter 7 References

• Hedrick P (1991) Fertility, Health, and Consanguineous Marriages. Science 254: 1434

• Higgs DR, Thein SL, Wood WG (2001) Distribution and population genetics of the thalassemias. In: Weatherall DJ, Clegg JB, editors. The Thalassemia Syndromes. 4 th ed. Blackwell Science, Oxford, 237-284

• Hosoda Y, Fujiki K, Nakajima A (1983) A research of consanguinity in Japanese young couples. Jpn J Hum Genet 28: 205-207

• Hussain R (1998) The impact of consanguinity and inbreeding on perinatal mortality in Karachi, Pakistan. Paediatrics Perinatal Epidemiology 12: 370-382

• Hussain R (1999) Community perceptions of reasons for preference for consanguineous marriages in Pakistan. Journal of Biosocial Science 31: 449-461

• Hussain R, Bittles AH (1998) The prevalence and demographic characteristics of consanguineous marriages in Pakistan. J Biosoc Sci 30: 261-275

• Hussain R, Bittles AH, Sullivan S (2001) Consanguinity and early mortality in the muslim populations of India and Pakistan. Am J Hum Biol 13:777-787

• Jain VK, Nalini P, Chandra R (1993) Congenital malformations, reproductive wastage and consanguineous mating. Aust N Z J Obstet Gynaecol Suppl 33: 33-36

• Jensen CE, Tuck SM, Agnew JE, Koneru S, Morris RW (1998) High prevalence of low bone mass in thalassemia major Br J Hematol 103: 911-915

• John P, Ali G, Chishti MS, Naqvi SM, Leal SM, Ahmad W (2006) Localization of a novel locus for alopecia with mental retardation syndrome to chromosome 3q26.33-q27.3. Hum Gene 118: 665-667

• John P, Aslam M, Rafiq MA, Amin-ud-din M, Haque S, Ahmad W (2005) Atrichia with papular lesions in two Pakistani consanguineous families resulting from mutations in the human hairless gene. Arch Dermatol Res 297: 226-230

• Jurdi R, Saxena PC (2003) The prevalence and correlates of consanguineous marriages in Yemen: similarties and contrasts with other Arab countries. J Biol Sci 35: 1-13

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 138

Chapter 7 References

• Kapadia KM (1958) Marriage and Family in India, 2nd ed. Calcutta, Oxford University Press, pp. 117-137

• Kaur M, Balgir PP (2005) APOE2 and Consanguinity: A risky combination for Alzheimer's disease. J Alzheimer's Disease 8: 293-297

• Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG (1984) Molecular characterization of seven β-thalassemia mutations in Asian Indians. EMBO J 3: 593-596

• Kazazian, HH Jr, Boehm C (1988) Molecular basis and prenatal diagnosis of beta- thalassemia. Blood 72: 1107-1116

• Kelley PM, Harris DJ, Comer BC, Askew JW, Fowler T, Smith SD, Kimberling WJ (1998) Novel mutations in the connexin 26 gene (GJB2) that cause autosomal recessive (DFNB1) hearing loss. Am J Hum Genet 62: 792-799

• Kelsell DP, Dunlop J, Stevens HP, Lench NJ, Liang JN, Parry G, Mueller RF, Leigh IM (1997) Connexin 26 mutations in hereditary non-syndromic sensorineural deafness. Nature 387: 80-83

• Khan SN, Riazuddin S (1998) Molecular characterization of beta-thalassemia in Pakistan. Hemoglobin 22: 333-345

• Khateeb B, Moatter T, Shaghil AM, Haroon S, Kakepoto GN (2000) Genetic diversity of beta-thalassemia mutations in Pakistani population. J Pak Med Assoc 50: 293-296

• Khoury SA, Massad D (2000) Consanguineous marriages in Jordan. Am J Med Genet 43: 769-775

• Kir T, Güleç M, Bakir B, Hosgönül E, Tümerdem N (2005) The frequency and effecting factors of consanguineous marriage in a group of soldiers in Ankara. J Bioso Sci 37: 519-523

• Kljuic A, Bazzi H, Sundberg JP, Martinez-Mir A, O'Shaughnessy R, Mahoney MG, Levy M, Montagutelli X, Ahmad W, Aita VM, Gordon D, Uitto J, Whiting D, Ott J, Fischer S, Gilliam TC, Jahoda CA, Morris RJ, Panteleyev AA, Nguyen VT, Christiano AM (2003) Desmoglein 4 in hair follicle differentiation and

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 139

Chapter 7 References

epidermal adhesion: evidence from inherited hypotrichosis and acquired pemphigus vulgaris. Cell 113: 249-260

• Kushki AM, Zeyghami B (2005) The effect of Consanguineous Marriages on Congenital Malformation. JRMS 10: 298-301

• Lamartine J (2003) Towards a new classification of ectodermal dysplasias. Clin Exp Dermatol 28: 351-355

• Lautermann J, ten Cate WJ, Altenhoff P, Grummer R, Traub O, Frank H, Jahnke K, Winterhager E (1998) Expression of the gap-junction connexins 26 and 30 in the rat cochlea. Cell Tissue Res 294: 415-420

• Lemana WK, Feldman GI, Kerem BS (1990) Mutation analysis for heterozygote of cystic fibrosis. Eng J Med 322: 291-296

• Lerer I, Sagi M, Malamud E, Levi H, Raas-Rothschild A, Abeliovich D (2000) Contribution of connexin 26 mutations to nonsyndromic deafness in Ashkenazi patients and the variable phenotypic effect of the mutation 167delT. Am J Med Genet 95: 53-56

• Leutenegger AL, Genin E, Thompson EA, Clerget-Darpoux F (2002) Impact of parental relationships in maximum lod score affected sib-pair method. Genet Epidemiol 23: 413-425

• Levitan M, Montagu A (1977) Textbook of human genetics. Oxford University Press, NewYork

• Levy-Nissenbaum E, Betz RC, Frydman M, Simon M, Lahat H, Bakhan T, Goldman B, Bygum A, Pierick M, Hillmer AM, Jonca N, Toribio J, Kruse R, Dewald G, Cichon S, Kubisch C, Guerrin M, Serre G, Nothen MM, Pras E (2003) Hypotrichosis simplex of the scalp is associated with nonsense mutations in CDSN encoding corneodesmosin. Nat Genet 34:151-153

• Lewin B (2000) Genes VII. New York: Oxford University Press

• Lindelius R (1980) Effects of parental consanguinity on mortality and reproductive function. Hum Hered 30: 185-191

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 140

Chapter 7 References

• Lindholm C (1986) Caste in Islam and problem of deviant systems: a critique of recent theory. Contrib Indian Sociol 20: 61-96

• Lockwood WG (1972) Converts and consanguinity: the social organization of Moslem slaves in western Bosnia. Ethnology 11: 55-79

• Loukopoulos D (1996) Current status of thalassaemia and the sickle cell syndromes in Greece. Semin Hematol 33: 76-86

• Madhavan T, Narayan J (1991) Consanguinity and mental retardation. J Mental Defic Res 35:133-139.

• Mahboudi F, Zeinali S, Merat A, Delmaghani S, Mostavafi Pour K, Moghaddam Z, Haghshenas M. (1996) The molecular basis of beta-thalassemia mutations in Fars Province, Iran. Iran J Med Sci 21: 99-104

• Maheshwari M, Vijaya R, Ghosh M, Shastri S, Kabra M, Menon PS (2003) Screening of families with autosomal recessive non-syndromic hearing impairment (ARNSHI) for mutations in GJB2 gene: Indian scenario. Am J Med Genet 120: 180-184

• Makhoul N J, Wells RS, Kaspar H, Shbaklo H, Taher A, Chaka N, Zalloua PA (2005) Genetic Heterogeneity of Beta Thalassemia in Lebanon Reflects Historic and Recent Population Migration. Ann Hum Genet 69: 55–66

• Manolis EN, Yandavi N, Nadol JB Jr, Eavey RD, McKenna M, Rosenbaum S, Khetarpal U, Halpin C, Merchant SN, Duyk GM, MacRae C, Seidman CE, Seidman JG (1996) A gene for non-syndromic autosomal dominant progressive postlingual sensorineural hearing loss maps to chromosome 14q12-13. Hum Mol Genet 5: 1047-1050.

• Mansoor A, Ayub Q, Talat A Qamar R (1998) The Spectrum of Mutations in b- Thalassaemic Patients and Carriers from Punjab and N.W.F.P. in Pakistan. Nat Prod Lett 12: 199-207

• Maquat LE (1996) Defects in RNA splicing and the consequence of shortened translational reading frames. Am J Hum Genet 59:279-286

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 141

Chapter 7 References

• Markin VS, Hudspeth AJ (1995) Gating-spring models of mechanoelectrical transduction by hair cells of the internal ear. Annu Rev Biophys Biomol Struct 24: 59-83

• McKusick VA (1994) Mendelian Inheritance in Man. 11th ed. Johns Hopkins University Press, Baltimore.

• Mehdi SQ, Qamar R, Ayub Q, Khaliq S. Mansoor A, Ismail M, Mammer MF, Underhill PA, Cavalli- Sforza LL (1999) The origin of Pakistani populations:evidence from Y chromosome markers. In: Genomic Diversity: Applications in human population Genetics, Papiha S.S., Deka,R.and Chakraborty, R. ed.,Kluwer Academic/Plenum Publishers, New York, PP-83-90

• Merrill BJ, Gat U, DasGupta R, Fuchs E (2001) Tcf3 and Lef1 regulate lineage differentiation of multipotent stem cells in skin. Genes Dev 15: 1688-1705

• Mian A, Mushtaq R (1994) Consanguinity in population of Quetta (Pakistan): A preliminary study. J Hum Ecol 5: 49-53

• Miglani GS (2002) Advanced genetics. IVA Pub House, New Delhi India

• Modell B, Darr A (2002) Genetic counselling and customary consanguineous marriage. Nature Rev Genet 3: 225-229

• Moore GP, Jackson N, Isaacs K, Brown G (1998) Pattern and morphogenesis in skin. J Theor Biol 191: 87-94

• Mooseker MS, Cheney RE (1995) Unconventional myosins. Annu Rev Cell Dev Biol 11: 633-675

• Morell RJ, Kim HJ, Hood LJ, Goforth L, Friderici K, Fisher R, Van Camp G, Berlin CI, Oddoux C, Ostrer H, Keats B, Friedman TB (1998) Mutations in the connexin 26 gene (GJB2) among Ashkenazi Jews with nonsyndromic recessive deafness. N Engl J Med 339: 1500-1505

• Mustapha M, Salem N, Weil D, el-Zir E, Loiselet J, Petit C (1998) Identification of a locus on chromosome 7q31, DFNB14, responsible for prelingual sensorineural non-syndromic deafness. Eur J Hum Genet 6: 548-551

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 142

Chapter 7 References

• Naeem M, Wajid M, Lee K, Leal S M, Ahmad W (2006a) A mutation in the hair matrix and cuticle keratin KRTHB5 gene causes ectodermal dysplasia of hair and nail type. J Med Genet 43: 274-279

• Naeem M, Jelani M, Lee K, Ali G, Chishti MS, Wali A, Gul A, John P, Hassan MJ, Leal SM, Ahmad W (2006b) Ectodermal dysplasia of hair and nail type: mapping of a novel locus to chromosome 17p12-q21.2. Br J Dermatol 155: 1184- 1190

• Naeem M, John P, Ali G, Ahmad W (2007) Pure hair-nail ectodermal dysplasia maps to chromosome 12p11.1-q21.1 in a consanguineous Pakistani family. Clin Exp Dermatol 32: 502-505

• Naeem N, Muhammad D, Ahmad W (2005) Novel mutations in the EDAR gene in two Pakistani consanguineous families with autosomal recessive hypohidrotic ectodermal dysplasia. Br J Dermatol.153:46-50

• Nair RR, Murthy JS (1985) ABO blood group incompatibility and inbreeding effects: Evidence for an interaction. Hum Genet 69: 147-50

• Nath A, Patil C, Naik VA (2004) Prevalence of Consanguineous Marriages in a Rural Community and Its Effect on Pregnancy Outcome. Indian J Commun Med 29: 149-152

• Noben-Trauth K, Zheng QY, Johnson KR, Nishina PM (1997) mdfw: a deafness susceptibility locus that interacts with deaf waddler (dfw). Genomics 44: 266-272

• Nordgarden H, Storhaug K, Lyngstadaas SP, Jensen JL (2003) Salivary gland function in persons with ectodermal dysplasias. Eur J Oral Sci 111:371-376

• Olivieri NF (1999) The -thalassemias. N Engl J Med 341: 99-109

• O'Shaughnessy RF, Christiano AM (2004) Inherited disorders of the skin in human and mouse: from development to differentiation. Int J Dev Biol 48: 171- 179

• Overall ADJ, Nichols RA (2001) A method for distinguishing consanguinity and population substructure using multilocus genotype data. Mol Biol Evol 18: 2048- 2056

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 143

Chapter 7 References

• Panigrahi I, Marwaha RK (2006). Common Queries in Thalassemia Care. Indian J Pediatr 43: 513-518

• Panyasai S, Fucharoen S, Surapot S, Fucharoen G, Sanchaisuriya K (2004) Molecular basis and hematologic characterization of delta-beta-thalassemia and hereditary persistence of fetal hemoglobin in Thailand. Haematologica 89: 777- 781

• Peltonen L, Palotie A, Lange K (2000) Use of population isolates for mapping complex traits. Nat Rev Genet 1: 182–190

• Pena JA, Alfonso-Sanchez MA, Calderon R (2002) Inbreeding and demographic transition in the Orozco Valley (Basque Country, Spain). Am J Hum Biol 14: 713- 720

• Petersen MB, Willems PJ (2006) Non-syndromic, autosomal-recessive deafness. Clin Genet. 69: 371-392

• Petit C, Levilliers J, Hardelin JP (2001) Molecular genetics of hearing loss. Ann Rev Genet 35: 589-646

• Phadke SR (2004) Genetic counseling. Indian J Pediatr 71: 151-156

• Phillips JA, Hamid R (1999) Human mutations and their detection by gene and linkage analysis, allele sharing and association methods. East Mediterr Health J 5: 1140-1146

• Pinheiro M, Freire-Maia N, Gollop TR (1985) Odontoonychodysplasia with alopecia: a new pure ectodermal dysplasia with probable autosomal recessive inheritance. Am J Med Genet 20: 197-202

• Pispa J, Thesleff I (2003) Mechanisms of ectodermal organogenesis. Dev Biol 262: 195-205

• Priolo M, Silengo M, Lerone M, Ravazzolo R (2000) Ectodermal dysplasias: not only 'skin' deep. Clin Genet 58: 415-430

• Puri RD, Verma IC (2004) Dysmorphology diagnosis. Indian J Pediatr 71: 535- 539

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 144

Chapter 7 References

• Quddus SA (1990) The Tribal Baluchistan. Ferozsons (PVT) Ltd, Lahore, Pakistan

• Rabbi F, Baig SM., Yaqoob N, Baig S, Khan MMA, Shamsi, ST, Fatima N., and Qureshi, J.A. (1999) Regional distribution of β-thalassemia alleles in Pakistan. First Scientific Symposium of The Childrens Hospital, Lahore held on December 3-4

• Rabionet R, Gasparini P, Estivill X (2000) Molecular genetics of hearing impairment due to mutations in gap junction genes encoding beta connexins. Hum Mutat 16: 190-202

• Rafiq MA, Ansar M, Mahmood S, Haque S, Ul-Haque MF, Leal SM, Ahmad W (2004) A recurrent intragenic deletion mutation in DSG4 gene in three Pakistani families with autosomal recessive hypotrichosis. J Invest Dermatol 123:247-248

• Rafiq MA, Faiyaz-Ul-Haque M, Ud Din MA, Malik S, Sohail M, Anwar M, Haque S, Paterson AD, Tsui LC, Ahmad W (2005) A novel locus of ectodermal dysplasia maps to chromosome 10q24.32-q25.1. J Invest Dermatol 124: 338-342

• Rafique MA, Ansar M, Jamal SM, Malik S, Sohail M, Faiyaz-Ul-Haque M, Haque S, Leal SM, Ahmad W (2003) A locus for hereditary hypotrichosis localized to human chromosome 18q21.1. Eur J Hum Genet 11: 623-628

• Rao NA, Savithri HS, Bittles AH (2002) A genetic perspective on the South Indian tradition of consanguineous marriage. In Austral-Asian encounters (ed. C. Vanden Driesen and S. Nandan), pp. 326–341. Prestige Books, New Delhi.

• Rao PSS, Inbaraj SG (1977) Inbreeding effects on human reproduction in Tamil Nadu of South India. Ann Hum Genet 41: 87-98

• Rao PSS, Inbaraj SG (1979) Inbreeding effects on fertility and sterility in southern India. J Med Genet 16: 24-31

• Rao PSS, Inbaraj SG, Jesudian D (1972) Rural-Urban differentials in consanguinity. J Med Genet 9:174-178

• Reddy BM (1992) Inbreeding effects on reproductive performance: a study based on a large sample from the endogamous Vadde of Kolleru Lake, Andhra Pradesh, India. Hum Biol 64: 659-682

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 145

Chapter 7 References

• Reddy VR, Rao AP (1978) Effects of parental consanguinity on fertility, mortality, and morbidity among the pattusalis of Tirupati, South India. Hum Hered 28: 226-234

• Rund D, Rachmilewitz E (2005) -Thalassemia. N Engl J Med 353: 1135-1146

• Sahin MT, Turel-Ermertcan A, Chan I, McGrath JA, Ozturkcan S (2004) Ectodermal dysplasia showing clinical overlap between AEC, Rapp-Hodgkin and CHAND syndromes. Clin Exp Dermatol 29: 486-488

• Samara M, Chiotoglou I, Kalamaras A, Likousi S, Chassanidis C, Vagena A, Vagenas C, Eftichiadis E, Vamvakopoulos N, Patrinos G P, Kollia P (2007) Large-scale population genetic analysis for hemoglobinopathies reveals different mutation spectra in Central Greece compared to the rest of the country. Am J Hematol 82: 634-636

• Sambrook J, Fritsch EG, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn. New York: Cold Spring Harbor Laboratory Press CSH, 1989.

• Santos R, El-Shanti H, Sikandar S, Lee K, Bhatti A, Yan K, Chahrour M, McArthur N, PhamT , Mahasneh A, Ahmad W, Leal S (2005a) Novel sequence variants in the TMIE gene in families with autosomal recessive nonsyndromic hearing impairment. J Mol Med 31: 1-6

• Santos RLP, Wajid M, Pham TL, Hussan J, Ali G, Ahmad W, Leal S (2005b) Low prevalence of Connexin 26 (GJB2) variants in Pakistani families with autosomal recessive non-syndromic hearing impairment. Clin Genet 67: 61-68

• Schrijver I (2004) Hereditary non-syndromic sensorineural hearing loss: transforming silence to sound. J Mol Diagn 6: 275-284

• Schulpen TWJ, van Wieringen JCM, van Brummen P J, van Riel JM, Beemer F A, Westers P, Huber J (2006) Infant mortality, ethnicity, and genetically determined disorders in The Netherlands. The European Journal of Public Health 16: 290-293

• Scott DA, Kraft ML, Carmi R, Ramesh A, Elbedour K, Yairi Y, Srisailapathy CR, Rosengren SS, Markham AF, Mueller RF, Lench NJ, Van Camp G, Smith RJ,

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 146

Chapter 7 References

Sheffield VC (1998) Identification of mutations in the connexin 26 gene that cause autosomal recessive nonsyndromic hearing loss. Hum Mutat 11: 387-394

• Scriver CR (1985) Population screening: report of a workshop. Prog Clin Biol Res 163: 89-152

• Seemanova E (1971) A study of children of incestuous matings. Hum Hered 21: 108-128

• Shami SA (1983) Consanguineous marriages in Mianchannu and Muridke (Punjab) Pakistan. Biologia 29: 19-30

• Shami SA, Iqbal I (1983) Consanguineous marriages in the population of Sheikhupura (Punjab), Pakistan. Biologia 29: 231-244

• Shami SA, Minhas IB (1984) Effects of consanguineous marriages on offspring mortality in the City of Jhelum (Punjab), Pakistan. Biologia 30:153-165

• Shami SA, Schmitt LH, Bittles AH (1989) Consanguinity-related antenatal and postnatal mortality in the populations of seven Pakistani Punjab cities. J Med Genet 26: 267-271

• Shami SA, Siddiqui H (1984) The effects of parental consanguinity in Rawalpindi City (Punjab), Pakistan. Biologia 30: 189-200

• Shami SA, Zahida (1982) Study of consanguineous marriages in the population of Lahore, Punjab, Pakistan. Biologia 28: 1-15

• Shigli A, Reddy RV, Hugar SM, Deshpande D (2005) Hypohidrotic ectodermal dysplasia: A unique approach to esthetic and prosthetic management: A case report. J Indian Soc Pedod Prev Dent 23: 31-34

• Shimomura Y, Sakamoto F, Kariya N, Matsunaga K, Ito M (2006) Mutations in the desmoglein 4 gene are associated with monilethrix-like congenital hypotrichosis. J Invest Dermatol 126: 1281-1285

• Steinberg MH, Adams JG III (1991) Haemoglobin A2: origin, evolution and aftermath. Blood 78: 2165-2177

• Stenn KS, Paus R (2001) Controls of hair follicle cycling. Physiol Rev 2001 81: 449-494

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 147

Chapter 7 References

• Stevens HP, Kelsell DP, Bryant SP, Bishop DT, Dawber RP, Spurr NK, Leigh IM (1996) Linkage of monilethrix to the trichocyte and epithelial keratin gene cluster on 12q11-q13. J Invest Dermatol 106: 795-797

• Stoltenberg C, Mahnus P, Lie RT, Daltveit AK, Irgens LM (1997) Birth defects and parental consanguinity in Norway. Am J Epidemiol 145: 439-448

• Tadmouri GO, Gulen RI. Deniz (2003) The electronic database for beta- thalassemia mutations in the Arab world. Saudi Med J 24: 1192-1198

• Tamim H, Khogali M, Beydoun H, Melki I , Yunis K ( 2003) National collaborative perinatal neonatal network . Consanguinity and apnea of prematurity. Am J Epidemiol 158: 942-946

• Teebi AS (1994) Autosomal recessive disorders among Arabs: an overview from Kuwait. J Med Genet 31: 224-233

• Ul-Haque MF, Ahmad W, Zaidi SHE, Haque S, Teebi AS, Ahmad M, Cohn DH, Tsui LC (2002) Mutation in the cartilage-derived morphogenetic protein-1 (CDMP1) gene in a kindred affected with fibular hypoplasia and complex brachydactyly (DuPan syndrome). Clin Genet 61: 454-458

• Ul-Haque MF, Ahmad W, Zaidi SHE, Hussain S, Haque S, Ahmad M, Cohn DH, Tsui LC (2004) Novel mutations in the EXT1 gene in two consanguineous families affected with multiple hereditary exostoses (familial osteochondromatosis). Clin Genet 66: 144-151

• Valle D (2004) Genetics, Individuality, and Medicine in the 21st Century. Am J Hum Genet 74: 374-381

• Vanita, Singh JR, Singh D (1999) Genetic and segregation analysis of congenital cataract in the Indian population. Clin Genet 56: 389 393

• Varawalla NY, Fitches AC, Old JM. (1992) Analysis of -globin gene haplotypes in Asian Indians: origin and spread of -thalassaemia on the Indina subcontinent. Hum Genet 90: 443-449

• Varawalla NY, Old JM, Sarkar R, Venkatesan R, Weatherall DJ (1991a) The spectrum of beta-thalassaemia mutations on the Indian subcontinent: the basis for prenatal diagnosis. Br J Haematol 78: 242-247

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 148

Chapter 7 References

• Varawalla NY, Old JM, Weatherall DJ (1991b) Rare β-thalassemia mutations in Asian Indians. Br J Hematol 79: 640-644

• Vaz FEE, Thakur CB, Banerjee MK, Gangal SG (2000) Distribution of β- thalassemia mutations in Indian population referred to a diagnostic center, Hemoglobin 24: 181–194

• Verma IC, Prema A, Puri RK (1992) Health effects of consanguinity in Pondicherry. Indian Pediatr 29: 685-92

• Verma IC, Saxena R, Thomas E, Jain P K(1997) Regional disrtibution of β- thalassemia mutations in India, Hum Genet 100: 109–113

• Wahab A, Ahmad M (1996) Biosocial perspective of consanguineous marriages in rural and urban Swat, Pakistan. J Biosoc Sci 28: 305-313

• Wali A, Ali G, John P, Lee K, Chishti MS, Leal SM, Ahmad W (2007a) Mapping of a gene for alopecia with mental retardation syndrome (APMR3) on chromosome 18q11.2-q12.2. Ann Hum Genet 71: 570-577

• Wali A, Chishti MS, Ayub M, Yasinzai M, Kafaitullah, Ali G, John P, Ahmad W (2007b) Localization of a novel autosomal recessive hypotrichosis locus (LAH3) to chromosome 13q14.11-q21.32. Clin Genet 72: 23-29

• Wali A, John P, Gul A, Lee K, Chishti MS, Ali G, Hassan MJ, Leal SM, Ahmad W (2006) A novel locus for alopecia with mental retardation syndrome (APMR2) maps to chromosome 3q26.2-q26.31. Clin Genet 70: 233-239

• Wang A, Liang Y, Fridell RA, Probst FJ, Wilcox ER, Touchman JW, Morton CC, Morell RJ, Noben-Trauth K, Camper SA, Friedman TB (1998) Association of unconventional myosin MYO15 mutations with human nonsyndromic deafness DFNB3. Science 280: 1447-1451

• Wattendorf DJ, Hadley DW (2005) Family history: the three-generation pedigree. Am Fam Physician 72: 441-448

• Wirght S (1922) Coefficient of inbreeding and relationship. Am Nat 56: 330-338

• Zielenski, Tsui (1995) Cystic fibrosis: genotypic and phenotypic variations. Ann Rev Genet 29: 777-807

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 149

Chapter 7 References

• Zlotogora J, Habiballa H, Odatalla A, Barges S (2002) Changing family structure in a modernizing society: a study of marriage patterns in a single Muslim village in Israel. Am J Hum Biol 14: 680-682

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 150

Chapter 7 References

Electronic Database Information

o Marshfield Medical Research Foundation database website: http://research.marshfieldclinic.org/genetics/

o National Center for Biotechnology Information: http://www.ncbi.nlm.nih.gov/

o Van Camp G, Smith RJH. Hereditary Hearing Loss Homepage http://dnalab-www.uia.ac.be/dnalab/hhh/

Government Documents

• Census Reports a) 1891 b) 1911 c) 1931 d) 1951 e) 1971 f) 1998

• Dera Ghazi Khan District Gazetteer (1898) by Diack A H, District Settlement Officer.

------A study of certain aspects of human genetics including consanguinity and genetic disorders in the human population of DGK 151