Independent Human Prostate Cancer Cell Lines

Home , Diethylstilbestrol, Raloxifene

[CANCER RESEARCH 62, 5365–5369, September 15, 2002] Raloxifene, a Mixed Estrogen Agonist/Antagonist, Induces Apoptosis in Androgen- independent Human Prostate Cancer Cell Lines

Isaac Yi Kim, Byung-Chul Kim, Do Hwan Seong, Dug Keun Lee, Jeong-Meen Seo, Young Jin Hong, Heung-Tae Kim, Ronald A. Morton, and Seong-Jin Kim1 Laboratory of Cell Regulation and Carcinogenesis, National Cancer Institute, Bethesda, Maryland 20892 [I. Y. K., B. C. K., D. H. S., D. K. L., J-M. S., H-T. K., S-J. K.]; Scott Department of Urology, Baylor College of Medicine, Houston, Texas 77030 [I. Y. K., R. A. M.]; and Clinical Research Center, College of Medicine, Inha University, Inchon, South Korea 400-711 [Y. J. H.]

ABSTRACT metastasis. After androgen withdrawal, there is a dramatic decrease in PSA with improvement in clinical parameters. However, prostate Raloxifene, a selective estrogen receptor (ER) modulator, is a mixed cancer cells inevitably become resistant to the androgen-withdrawal estrogen agonist/antagonist that has been shown to prevent osteoporosis therapy with a median time of 18–24 months (5). Once the hormone and breast cancer in women. Because the prostate contains high levels of ER-␤, the present study investigated the effect of raloxifene in three refractory prostate cancer emerges, treatment is largely limited to well-characterized, androgen-independent human prostate cancer cell palliative care. lines: (a) PC3; (b) PC3M; and (c) DU145. Reverse transcriptase-PCR and Raloxifene is the prototypical SERM that has been shown to Western blot analysis for ER-␣ and ER-␤ demonstrated that all three cell prevent osteoporosis and breast cancer (6, 7); other well-known mem- lines express ER-␤, whereas only PC3 and PC3M cells were positive for bers of SERMs include tamoxifene, droloxifene, and idoxifene. ER-␣. After the treatment with raloxifene, a dramatic increase in cell SERMs are synthetic estrogen ligands that can exhibit either an death was observed in a dose-dependent manner in the three prostate estrogenic or an antiestrogenic effect depending on the tissue types ؊9 ؊6 cancer cell lines (10 to 10 M range). Because the three prostate cancer (reviewed in Refs. 8 and 9). Specifically, SERMs are usually ER cell lines demonstrated similar morphological changes after the raloxifene agonists in bone, liver, and cardiovascular system; ER antagonists in treatment, PC3 (ER-␣/ER-␤؉) and DU145 (ER-␤؉ only) cells were brain and breast; and mixed ER agonists/antagonists in the uterus selected to further characterize the raloxifene-induced cell death. Using the nucleus-specific stain 4؅,6-diamidino-2-phenylindole, nuclear frag- (reviewed in Refs. 8 and 9). Published works have demonstrated that ␣ ␤ mentation was observed in a time-dependent manner in both cell lines raloxifene binds to both ER- and ER- with high affinity (10, 11); ␤ ␣ ؊6 after exposure to 10 M raloxifene. Using the terminal deoxynucleotidyl however, the binding affinity to ER- is four times higher than ER- . transferase-mediated nick end labeling apoptotic assay, it was demon- Among the SERMs, raloxifene is unique in that it is an estrogen strated that the nuclear fragmentation was caused by apoptosis. To in- antagonist in the uterus (12). In the breast and bone, although, all vestigate the possibility that caspase activation is involved in raloxifene- SERMs act as estrogen antagonists and agonists, respectively (13). induced apoptosis, cells were treated with the pan-caspase inhibitor The mechanism for the observed tissue-specific effect of SERMs has ZVAD. The results demonstrated that the dramatic change in cellular been shown recently to be attributable to differences in coregulator morphology after treatment with raloxifene was no longer observed when recruitment in a tissue-specific manner (14). cells were pretreated with ZVAD. Immunoblot demonstrated activation of Since the discovery of ER-␤ from the rat prostate cDNA library caspases 8 and 9 in PC3 and DU145 cells, respectively. Taken together, these results demonstrate that the mixed estrogen agonist/antagonist, (15), series of evidence have suggested an important role for estro- raloxifene, induces apoptosis in androgen-independent human prostate gen/ER in the prostate: (a) in the rat prostate, immunohistochemistry cancer cell lines. has demonstrated that ER-␣ is present in the stroma, whereas ER-␤ is localized preferentially in the epithelium (16); (b) increased expres- INTRODUCTION sion of ER-␣ has been associated with prostate cancer progression, metastasis, and hormone-refractory phenotype (17); (c) a recent Phase In the United States, prostate cancer is the most common malig- II clinical trial using the estrogen agonist diethylstilbestrol in nancy and the second leading cause of male cancer deaths (1). Since hormone-refractory prostate cancer demonstrated Ͼ50% decrease in 2 the widespread implementation of PSA for prostate cancer screening the level of PSA in 43% of the patients (18); and (d) ER-␤ knockout in the late 1980s, the incidence of nonorgan-confined prostate cancer mice exhibit prostate and bladder hyperplasia (19). These observa- has decreased dramatically (2). Nevertheless, ϳ30% of prostate can- tions, taken together, suggest that ER is a reasonable target for cer patients who undergo radical prostatectomy or radiotherapy for therapeutic intervention in prostate cancer patients. Therefore, the clinically localized disease go on to develop either a local or distant present study examined the effect of raloxifene in androgen-indepen- relapse (3, 4). Once prostate cancer recurs after the definitive treat- dent human prostate cancer cell lines. We report that raloxifene ment for a localized disease, the most widely used treatment is either induced apoptosis in androgen-independent human prostate cancer a medical or a surgical androgen withdrawal; chemotherapy has been cells. shown to be largely ineffective in treating prostate cancer. In addition to patients with recurrence, androgen ablation is also the treatment of MATERIALS AND METHODS choice for those who present with extensive local invasion or distant Cell Culture and Mitogenic Assay. Human prostate (PC3 and DU145) Received 3/20/02; accepted 7/11/02. and breast (MCF-7, ZR-75–1, and HS-578T) cancer cell lines were purchased The costs of publication of this article were defrayed in part by the payment of page from American Type Culture Collection (Rockville, MD). PC3M cells were charges. This article must therefore be hereby marked advertisement in accordance with kindly provided by Dr. Jane Trepel (National Cancer Institute, NIH). All cells 18 U.S.C. Section 1734 solely to indicate this fact. used in this study were from 35th through 40th passages. Cells were routinely 1 To whom requests for reprints should be addressed, at Laboratory of Cell Regulation and Carcinogenesis, National Cancer Institute, Building 41, Rm C629, 9000 Rockville maintained in RPMI 1640 containing 10% FBS, penicillin (100 units/ml), and Pike, Bethesda, MD 20892. Phone: (301) 496-8350; Fax: (301) 496-8395; E-mail: streptomycin (100 ␮g/ml). Raloxifene (Eli-Lily, Indianapolis, IN) was diluted Ϫ [email protected]. to 10 2 M in 70% ethanol and added to the culture medium at selected 2 The abbreviations used are: PSA, prostate-specific antigen; ER, estrogen receptor; concentrations. RT-PCR, reverse transcription-PCR; DAPI, 4Ј,6-diamidino-2-phenylindole; FBS, fetal bovine serum; TUNEL, terminal deoxynucleotidyl transferase-mediated nick end labeling; For cell counts, cells were plated at 20,000/well in 24-well culture plates in TBS, Tris-buffered saline; SERM, selective estrogen receptor modulator. RPMI 1640 supplemented with 10% FBS and allowed to adhere for 24 h. Then 5365

the cultures were washed two times with PBS, and the cells from wells selected membranes were incubated in the presence of rabbit-antimouse secondary previously were counted to determine the plating efficiency. Cells in the antibody (Pierce Chemical Co., Rockford, IL) at a dilution of 1:3000 for 2 h. remaining wells were cultured for 4 days in phenol red-free RPMI 1640 After washing several times with TBST, immunoreactive bands were visual- supplemented with 1% charcoal-stripped FBS containing raloxifene at 0, ized by enhanced chemiluminescence. Ϫ Ϫ Ϫ Ϫ Ϫ 10 11,10 9,10 7,10 6, and 10 5 M. Raloxifene was added such that the ratio TUNEL and ZVAD Treatment. Cells were plated on chamber slides and of 70% ethanol to the culture medium was 1:1000. For control, 70% ethanol incubated 24 h before treatment with raloxifene. After exposure to raloxifene was added to culture at 1:1000. The medium was changed at day 2. After for a designated amount of time, cells were fixed in 4% paraformaldehyde removing the medium and detaching the cells with 0.5 ml of 0.05% trypsin, (pH 7.4) for 10 min. TUNEL assay of fragmented DNA was performed as cells were counted using hemocytometer. Photomicrographs were taken to recommended by the manufacturer (Roche Molecular Biochemicals, Indian- document the changes in cellular morphology. All experiments were repeated apolis, IN). three times, and similar results were obtained each time. ZVAD (Roche Molecular Biochemicals) was dissolved in DMSO to a RNA Isolation and RT-PCR. RT-PCR for ER-␣ and ER-␤ was carried concentration of 50 mM. Then it was added to medium at 50 ␮M 30 min before out as described previously (17). Cells were harvested, and total RNA was treatment with raloxifene. As control, DMSO was added to the culture medium isolated using TRIzol reagent (Life Technologies, Inc., Grand Island, NY), at 1:1000. Cells were observed for 48 h, and photomicrographs were taken to according to the manufacturer’s protocol. Once isolated, total RNA was document the changes in cellular morphology. reverse transcribed using Superscript (Life Technologies, Inc.) and random Statistics. All numerical data are expressed as mean Ϯ SE with triplicate hexamer using the following conditions: 42°C for 50 min and 70°C for 15 min. observations. Differences of the means among different treatments were com- After reverse transcription, the samples were incubated with RNase H for 30 pared by ␹2. A value of P Ͻ 0.05 was considered statistically significant. min at 37°C. Subsequently, PCR amplification was performed as follows: 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min for 35 cycles followed by 10-min incubation at 72°C. The following primers were used: ER-␣,5Ј RESULTS primer–tactgcatcagatccaaggg, 3Ј primer–gtgggaatgatgaaaggtgg; ER-␤,5Ј primer–tgaaaaggaaggttagtgggaacc, 3Ј primer–tggtcagggacatcatcatgg; glyceral- Effect of Raloxifene in Androgen-independent Human Prostate dehyde-3-phosphate dehydrogenase, 5Ј primer–accacagtccatgccatcac, 3Ј prim- Cancer Cell Lines. RT-PCR was initially carried out to determine er–tccaccaccctgttgctgta. To visualize the PCR products, the samples were the status of ER expression in the three androgen-independent human subjected to electrophoresis in 1% agarose gel followed by staining with prostate cancer cell lines: (a) PC3; (b) PC3M; and (c) DU145. ethidium bromide. The authenticity of the products was confirmed by Southern Authenticity of the PCR products was confirmed by Southern blot blot analysis. analysis. The results demonstrate that only PC3 and PC3M cells Nuclear Staining. Cells were plated on glass slides and treated with expressed ER-␣, whereas all three cell lines were positive for ER-␤ raloxifene for varying lengths of time. Subsequently, they were fixed in cold (data not shown). To confirm the results of RT-PCR, immunoblot for 3.5% paraformaldehyde for 5 min and washed with PBS once. After perme- ␣ ␤ abilizing for 2 min with methanol at Ϫ20°C, cells were rinsed with PBS and ER- and - was subsequently carried out (Fig. 1a). As expected, all ␤ incubated for 5 min in 50 m[scap]m glycine in PBS. After another wash with three cell lines expressed ER- , whereas only PC3 and PC3M had PBS, the slides were mounted with the mounting media Vectashield containing detectable levels of ER-␣. These results are consistent with previous DAPI (Vector Laboratories, Burlingame, CA). Nuclear morphology was visu- reports which demonstrated that PC3 cells express both ER-␣ and -␤, alized using con-focal microscopy. whereas DU145 cells had only ER-␤ (20). Immunoblot Analysis. Cells were harvested and lysed using lysis buffer To determine the effect of raloxifene in the four human andro- (0.0625 N Trizma base, 2% SDS, and 5% 2-mercaptoethanol). After deter- gen-independent prostate cancer cell lines, cell numbers were mining the concentration of protein using Bradford assay, the samples were determined after treatment with increasing doses of raloxifene for ␮ boiled for 10 min, and electrophoresis was carried out using 50 g of total 4 days. The result, shown in Fig 1b, demonstrated that raloxifene protein in each lane. After electrophoresis, protein was transferred to a 0.2-␮m inhibited the proliferation of all three prostate cancer cell lines in nitrocellulose membrane (Invitrogen, La Jolla, CA). After the transfer, the membranes were incubated in blocking buffer TBST (5% nonfat dry milk, a dose-dependent manner. The minimum concentration of ralox- TBS, and 0.1% Tween) for 1 h. Subsequently, the membranes were incubated ifene needed to detect a significant decrease in cell number was Ϫ9 Ϫ6 with TBST-containing appropriate antibodies at a dilution of 1:1000 overnight 10 M. The cell count at 10 M raloxifene was ϳ5, 25, and 20% at 4°C. Antibodies against caspases 8 and 9 and ER-␣ and –␤ were purchased of that of control in DU145, PC3, and PC3M cells, respectively. At Ϫ5 from Upstate Biotechnology (Lake Placid, NY). After washing with TBST, the 10 M raloxifene, the cell counts of all three cell lines were Ͻ10%

Fig. 1. Effect of raloxifene on androgen-independent human prostate cancer cell lines. a, immunoblot analysis for ERs in human prostate cancer cell lines. As expected, all three prostate cancer cell lines were positive for ER-␤, whereas only PC3 and PC3M expressed ER-␣. b, cell count. There were significant decreases in cell numbers in a dose-dependent manner.

5366

observed changes included shrinkage of cytoplasm and increased Ϫ6 frequency of cytosolic vacuoles. After the treatment with 10 M raloxifene for 48 h, numerous intracellular vesicles followed by float- ing cellular debris appeared in the culture. For comparison, MCF-7 and HS-578T human breast cancer cells were also treated with raloxifene. RT-PCR demonstrated that MCF-7 cells express ER-␣, whereas HS-578T cells have undetectable levels of expression of both ER-␣ and -␤. As expected based on the ER expression profile, raloxifene significantly decreased the rate of proliferation in MCF-7 cells but not that of HS-578T cells. It was observed that the profile of sensitivity to raloxifene is similar between the prostate and the MCF-7 cells, dem- onstrating that the effect of raloxifene is likely ER specific in human prostate cancer cells (data not shown). Raloxifene-induced Cell Death in Human Prostate Cancer Cell Lines. To investigate the possibility that the raloxifene-induced cell Fig. 2. Effect of raloxifene on cellular morphology. In association with the significant death in human prostate cancer cell lines is apoptosis, PC3 (ER-␣ and decrease in cell count, a dramatic change in cellular morphology suggestive of cell death -␤ positive) and DU145 (ER-␤ positive) were selected for further appeared after treatment with raloxifene. Ϫ6 analysis. The following experiments were all carried out at 10 M raloxifene, because this concentration induced near complete cell of control. Interestingly, the ER-␣-positive cells, PC3 and PC3M, death in all three cell lines. Initially, nuclear staining using DAPI was were more resistant to raloxifene than DU145 cells. carried out to determine the nuclear morphology after treatment with Ϫ6 With the decrease in cell count, dramatic changes in cellular mor- raloxifene at 10 M. As shown in Fig. 3a, a time-dependent increase phology suggestive of cell death were also observed (Fig. 2). The in nuclear fragmentation was observed.

Fig. 3. Raloxifene-induced apoptosis in prostate cancer cells. a, photomicrographs of nuclear morphology. b, TUNEL apoptotic assay. c, number of apoptotic cells per 100 cells. Using the nucleus-specific staining DAPI and TUNEL assay, a time-dependent increase in the rate of nuclear fragmentation and apoptosis was observed in both cell lines after treatment Ϫ6 with 10 M raloxifene. 5367

Fig. 4. Caspase in raloxifene-induced apoptosis. a, cellular morphology after treatment with the pan-caspase inhibitor ZVAD. b, immunoblot for caspases 8 and 9 in DU145 cells. c, immunoblot for caspases 8 and 9 in PC3 cells. Pretreatment with ZVAD completely blocked the dramatic change observed previously in cellular morphology in- Ϫ6 duced by raloxifene at 10 M. Caspase 8 activation was observed in PC3 cells, whereas caspase 9 activation was detected in DU145 cells.

To show that the raloxifene-induced cell death is apoptosis, 9 demonstrated that the observed cell death after the raloxifene TUNEL apoptotic assay was carried out (Fig. 3, b and c). As indicated treatment is apoptosis. These results, taken together, provide a valu- by the number of dark brown positive cells, there were significant able insight concerning the role of estrogen/ER in prostate cancer cells increases in the rate of apoptosis in a time-dependent manner after and suggest raloxifene as a potential treatment in patients with hor- raloxifene treatment. mone refractory prostate cancer. Because caspase activation is usually necessary for apoptosis, cells Although the precise role of estrogen and its receptors in benign were treated with the pan-caspase inhibitor, ZVAD, before raloxifene and malignant prostatic epithelial cells has not been established, there treatment. The results revealed that the dramatic change in cellular is a body of evidence which suggests that estrogens and its receptors morphology induced by raloxifene was no longer observed after the are important regulators of the prostate. First, the level of expression addition of ZVAD to the culture medium (Fig. 4a). To determine the of ER-␤ is highest in the prostate (21). In fact, ER-␤ was originally possibility that caspases 8 and 9 are involved in raloxifene-induced cloned from a rat prostate cDNA library (15). Second, ER-␤ knockout apoptosis, immunoblot analysis was carried out. Raloxifene treatment mice have benign prostate hyperplasia (19). Third, Bonkhoff et al. caused caspase 9 activation in DU145 cells (Fig. 4b) and caspase 8 (17) demonstrated a preliminary association between increased levels activation in PC3 cells (Fig. 4c). These results suggest that the of ER-␣ expression and hormone refractory/metastatic phenotype of raloxifene-induced cell death in androgen-independent human pros- prostate cancer after examining samples obtained from six patients tate cancer cell lines is apoptosis and that the actual apoptotic pathway varies with cell types and involves both caspase 8-dependent and with hormone refractory cancer and two patients with metastatic –independent pathways. disease. In the present study, it was demonstrated that all three androgen-independent prostate cancer cell lines express ER-␤, whereas two of the three cell lines express ER-␣. These results are DISCUSSION consistent with previous reports in which ER-␣ was detected in PC3 Results of the present study demonstrated that the mixed estrogen cells, whereas ER-␤ was seen in PC3 and DU145 cells (20). The agonist/antagonist raloxifene induces cell death in androgen-indepen- consistent expression of ERs in human prostate cancer cell lines dent human prostate cancer cell lines. Analysis using nuclear staining, suggests that estrogen/ERs may be potential targets for therapeutic TUNEL apoptotic assay, and immunoblot analysis for caspases 8 and intervention in prostate cancer patients. 5368

Raloxifene, a SERM that binds to both ER-␣ and ER-␤ with high mixed estrogen agonist/antagonist, induces apoptosis in androgen- affinity (10, 11), is a mixed estrogen agonist/antagonist. Clinical independent human prostate cancer cell lines. Because raloxifene has investigations have demonstrated that it is a safe agent for prevention minimal adverse effects while effectively preventing osteoporosis and of both osteoporosis and breast cancer (6, 7). In the present study, it breast cancer, the present study provides a rationale for a clinical trial was demonstrated that raloxifene causes cell death in a dose- and in hormone-refractory prostate cancer patients. In the future, the time-dependent manner in androgen-insensitive human prostate can- feasibility of raloxifene in treating and preventing prostate cancer will cer cell lines. This observed cell death was shown to be apoptosis be investigated. because nuclear fragmentation was detected in association with a positive TUNEL assay. Furthermore, pretreatment with the pan- REFERENCES caspase inhibitor ZVAD before exposure to raloxifene prevented the 1. Greenlee, R. T., Murray, T., Bolden, S., and Wingo, P. A. Cancer statistics, 2000. CA dramatic change observed previously in cellular morphology induced Cancer J. Clin., 50: 7–33, 2000. 2. Catalona, W. J., Smith, D. S., Ratliff, T. L., and Basler, J. W. Detection of organ- by raloxifene. The raloxifene-induced apoptosis in prostate cancer confined prostatic cancer is increased through prostate specific antigen based screen- cells may be ER mediated because all three cell lines express ER-␤, ing. JAMA, 270: 948–954, 1993. whereas PC3M and PC3 cells express both ER-␣ and -␤. Because ERs 3. Pound, C. R., Partin, A. W., Epstein, J. I., and Walsh, P. C. Prostate-specific antigen after anatomic radical retropubic prostatectomy. Patterns of recurrence and cancer in PC3 cells have been shown to be functional (20), it is likely that control. Urol. Clin. N. Am., 24: 395–406, 1997. these ERs in prostate cancer cell lines are physiologically significant. 4. Beyer, D. C., and Brachman, D. G. Failure free survival following brachytherapy alone for prostate cancer: comparison with external beam radiotherapy. Radiother. Alternatively, the presence of high-affinity binding sites for SERMS Oncol., 57: 263–267, 2000. that are independent of ER binding has been demonstrated in multiple 5. Olson, K. B., and Pienta, K. J. The treatment of hormone refractory prostate cancer. systems (22, 23). Because these ER-independent SERM-binding sites AUA Update Series, 18: 26–31, 1999. 6. Ettinger, B., Black, D. M., Mitlak, B. H., Knickerbocker, R. K., Nickelsen, T., are usually more abundant than ER (22, 23), it is possible that the Genant, H. K., Christiansen, C., Delmas, P. D., Zanchetta, J. R., Stakkestad, J., Gluer, observed raloxifene-induced apoptosis is mediated through an ER- C. C., Krueger, K., Cohen, F. J., Eckert, S., Ensrud, K. E., Avioli, L. V., Lips, P., and independent pathway in human prostate cancer cells. Cummings, S. R. Reduction of vertebral fracture risk in porstmenopausal women with osteoporosis treated with raloxifene. JAMA, 282: 637–645, 1999. Since the initial description of apoptosis, it has been demonstrated 7. Cummings, S. R., Eckert, S., Krueger, K. A., Grady, D., Powles, T. J., Cauley, J. A., that there are multiple pathways for programmed cell death. Cur- Norton, L., Nickelsen, T., Bjarnason, N. H., Morrow, M., Lippman, M. C., Black, D., Glusman, J. E., Costa, A., and Jordan, V. C. The effect of raloxifene in postmeno- rently, three basic apoptotic signaling pathways have been estab- pausal women. JAMA, 281: 2189–2197, 1999. lished: (a) mitochondria; (b) endoplasmic reticulum; and (c) death 8. Lonard, D. M., and Smith, C. L. Molecular perspectives on selective estrogen receptor receptor (24). The three pathways are similar in that they eventually modulators (SERMs): progress in understanding their tissue-specific agonist and antagonist actions. Steroid, 67: 15–24, 2002. involve activation of caspases; however, the subtypes of caspases that 9. Katznellenbogen, B. S., and Katznellenbogen, J. A. Defining the “S” in SERMS. are activated appear to differ significantly among the varying apo- Science (Wash. DC), 295: 2380–2381, 2002. ptotic pathways. In the present study, the activation of caspases 8 and 10. Bryant, H. U., Glasebrook, A. L., Yang, N. N., and Sato, M. An estrogen receptor basis for raloxifene action in bone. J. Ster. Biochem. Molec. Biol., 69: 37–44, 1999. 9 has been demonstrated in PC3 and DU145 cells, respectively. 11. Kuiper, G. G. J. M., Lemmen, J. G., Carlsson, B., Corton, J. C., Safe, S. H., van der Because different caspases are activated in the two prostate cancer cell Saag, P. T., van der Burg, B., and Gustafsson, J-A. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor-␤. Endocrinology, 13: 4252–4263, 1998. lines, raloxifene-induced apoptosis likely involves multiple and inde- 12. Bryant, H. U., Wilson, P. K., Adrian, M. D., Cole, H. W., Phillips, D. L., Dodge, J. A., pendent pathways. Grese, T. A., Sluka, J. P., and Glasebrook, A. L. Selective estrogen receptor modu- Interestingly, the magnitude of growth inhibition induced by ralox- lators: pharmacological profile in the rat uterus. J. Soc. Gynecol. Invest., 3: 152A, 1996. ifene was significantly different between ER-␣-positive (PC3 and 13. Kauffman, R. F., and Bryant, H. U. Selective estrogen receptor modulators. Drug PC3M) and ER-␣-negative cells (DU145). However, the rate of News Perpect., 8: 531–539, 1995. 14. Shang, Y., and Myles, B. Molecular determinants for the tissue specificity of SERMs. apoptosis was similar between the two types of cells. The mechanism Science (Wash. DC), 295: 2465–2468, 2002. for this observed difference in growth inhibition remains unclear at 15. Kuiper, G. G., Enmark, E., Pelto-Hukko, M., Nilsson, S., and Gustaffson, J. A. the present time. However, the present data suggest that raloxifene Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc. Natl. Acad. Sci. USA, 93: 5925–5930, 1996. affects at least two different signaling pathways, growth inhibition and 16. Chang, W. Y., and Prins, G. S. Estrogen receptor-␤: implication for the prostate apoptosis, in prostate cancer cells. Furthermore, our data imply that gland. Prostate, 40: 115–124, 1999. the expression of ER-␣ may render prostate cancer cells resistant to 17. Bonkhoff, H., Fixemer, T., Hunsicker, I., and Remberger, K. Estrogen receptor expression in prostate cancer and premalignant prostatic lesions. Am. J. Pathol., 155: the growth inhibitory but not apoptotic effect of raloxifene. Additional 641–647, 1999. work is under way to verify this concept. 18. Smith, D. C., Redman, B. G., Flaherty, L. E., Li, L., Strawderman, M., and Pienta, K. J. A phase II trial of oral diethylstilbesterol as a second-line hormonal agent in Lastly, it should be pointed out that the concentration of raloxifene advanced prostate cancer. Urology, 52: 257–260, 1998. Ϫ6 used in the majority of experiments in this study was 10 M. Clinical 19. Krege, J. H., Hodgin, J. B., Couse, J. F., Enmark, E., Warner, M., Mahler, J. F., Sar, M., Korach, K. S., Gustafsson, J-A., and Smithies, O. Generation and reproductive trials that investigated the utility of raloxifene have demonstrated that ␤ Ϫ9 phenotypes of mice lacking estrogen receptor- . Proc. Natl. Acad. Sci. USA, 95: the serum concentration of raloxifene is in the 10 M range when 15677–15682, 1998. given the currently recommended dose of 30–150 mg/day. Thus, it is 20. Lau, K-M., LaSapina, M., Long, J., and Ho, S-M. Expression of estrogen receptor Ϫ6 (ER)-␣ and ER-␤ in normal and malignant prostatic epithelial cells: regulation by possible that the 10 M may not be an achievable concentration in methylation and involvement in growth regulation. Cancer Res., 60: 3175–3182, vivo. Nevertheless, we believe that raloxifene may be an effective 2000. agent in treating androgen-independent prostate cancer patients for the 21. Saunders, P. T. K., Maguire, S. M., Gaughan, J., and Millar, M. R. Expression of oestrogen receptor beta (ER␤) in multiple rat tissues visualized by immunohisto- following two reasons: (a) the effect of raloxifene was observed chemistry. J. Endocrinol., 154: 13–16, 1997. Ϫ9 initially in prostate cancer cell lines at 10 M after 4 days of 22. Sutherland, R. C., Murphy, L. C., San Foo, M., Green, M. D., Whybourne, A. M., and treatment; and (b) the profile of sensitivity to raloxifene between Krozowski, Z. S. High affinity anti-estrogen binding sites distinct from the estrogen receptor. Nature (Lond.), 288: 273–275, 1988. breast and prostate cancer cell lines was similar. Currently, we are 23. Parisot, J. P., Hu, X. F., Sutherland, R. C., Wakeling, A., Zalcberg, J. R., and DeLuise, planning an animal study to determine the maximum achievable M. The pure anti-estrogen ICI182, 780 binds to a high affinity site distinct from the estrogen receptor. Int. J. Cancer, 62: 480–484, 1995. serum concentration of raloxifene in vivo. 24. Daniel, P. T. Dissecting the pathways to death. Leukemia (Baltimore), 14: 2035– In conclusion, the present study demonstrated that raloxifene, a 2044, 2000.

5369

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2002 American Association for Cancer Research. Raloxifene, a Mixed Estrogen Agonist/Antagonist, Induces Apoptosis in Androgen-independent Human Prostate Cancer Cell Lines

Isaac Yi Kim, Byung-Chul Kim, Do Hwan Seong, et al.

Cancer Res 2002;62:5365-5369.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/62/18/5365

Cited articles This article cites 18 articles, 5 of which you can access for free at: http://cancerres.aacrjournals.org/content/62/18/5365.full#ref-list-1

Citing articles This article has been cited by 6 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/62/18/5365.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/62/18/5365. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.