DOCSLIB.ORG

TAF2 Mouse Monoclonal Antibody [Clone ID: OTI2A5] Product Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
TAF2 Mouse Monoclonal Antibody [Clone ID: OTI2A5] Product Data OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for CF504588 TAF2 Mouse Monoclonal Antibody [Clone ID: OTI2A5] Product data: Product Type: Primary Antibodies Clone Name: OTI2A5 Applications: WB Recommended Dilution: WB 1:2000 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 782-1121 of human TAF2(NP_003175) produced in E.coli. Formulation: Lyophilized powder (original buffer 1X PBS, pH 7.3, 8% trehalose) Reconstitution Method: For reconstitution, we recommend adding 100uL distilled water to a final antibody concentration of about 1 mg/mL. To use this carrier-free antibody for conjugation experiment, we strongly recommend performing another round of desalting process. (OriGene recommends Zeba Spin Desalting Columns, 7KMWCO from Thermo Scientific) Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 136.8 kDa Gene Name: Homo sapiens TATA-box binding protein associated factor 2 (TAF2), mRNA. Database Link: NP_003175 Entrez Gene 170844 RatEntrez Gene 319944 MouseEntrez Gene 6873 Human Q6P1X5 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 TAF2 Mouse Monoclonal Antibody [Clone ID: OTI2A5] – CF504588 Background: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq] Synonyms: CIF150; MRT40; TAF2B; TAFII150 Protein Families: Protease, Transcription Factors Protein Pathways: Basal transcription factors Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Cat# [PS100001], Left lane) or pCMV6-ENTRY TAF2 (Cat# [RC213159], Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS- PAGE and immunoblotted with anti-TAF2(Cat# [TA504588]). Positive lysates [LY418826] (100ug) and [LC418826] (20ug) can be purchased separately from OriGene. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Clinicopathological and Molecular Genetic Analysis of Low-Grade Glioma in Adults
    A CLINICOPATHOLOGICAL AND MOLECULAR GENETIC ANALYSIS OF LOW-GRADE GLIOMA IN ADULTS Presented by ANUSHREE SINGH MSc A thesis submitted in partial fulfilment of the requirements of the University of Wolverhampton for the degree of Doctor of Philosophy Brain Tumour Research Centre Research Institute in Healthcare Sciences Faculty of Science and Engineering University of Wolverhampton November 2014 i DECLARATION This work or any part thereof has not previously been presented in any form to the University or to any other body whether for the purposes of assessment, publication or for any other purpose (unless otherwise indicated). Save for any express acknowledgments, references and/or bibliographies cited in the work, I confirm that the intellectual content of the work is the result of my own efforts and of no other person. The right of Anushree Singh to be identified as author of this work is asserted in accordance with ss.77 and 78 of the Copyright, Designs and Patents Act 1988. At this date copyright is owned by the author. Signature: Anushree Date: 30th November 2014 ii ABSTRACT The aim of the study was to identify molecular markers that can determine progression of low grade glioma. This was done using various approaches such as IDH1 and IDH2 mutation analysis, MGMT methylation analysis, copy number analysis using array comparative genomic hybridisation and identification of differentially expressed miRNAs using miRNA microarray analysis. IDH1 mutation was present at a frequency of 71% in low grade glioma and was identified as an independent marker for improved OS in a multivariate analysis, which confirms the previous findings in low grade glioma studies.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Figure S1. HAEC ROS Production and ML090 NOX5-Inhibition
    Figure S1. HAEC ROS production and ML090 NOX5-inhibition. (a) Extracellular H2O2 production in HAEC treated with ML090 at different concentrations and 24 h after being infected with GFP and NOX5-β adenoviruses (MOI 100). **p< 0.01, and ****p< 0.0001 vs control NOX5-β-infected cells (ML090, 0 nM). Results expressed as mean ± SEM. Fold increase vs GFP-infected cells with 0 nM of ML090. n= 6. (b) NOX5-β overexpression and DHE oxidation in HAEC. Representative images from three experiments are shown. Intracellular superoxide anion production of HAEC 24 h after infection with GFP and NOX5-β adenoviruses at different MOIs treated or not with ML090 (10 nM). MOI: Multiplicity of infection. Figure S2. Ontology analysis of HAEC infected with NOX5-β. Ontology analysis shows that the response to unfolded protein is the most relevant. Figure S3. UPR mRNA expression in heart of infarcted transgenic mice. n= 12-13. Results expressed as mean ± SEM. Table S1: Altered gene expression due to NOX5-β expression at 12 h (bold, highlighted in yellow). N12hvsG12h N18hvsG18h N24hvsG24h GeneName GeneDescription TranscriptID logFC p-value logFC p-value logFC p-value family with sequence similarity NM_052966 1.45 1.20E-17 2.44 3.27E-19 2.96 6.24E-21 FAM129A 129. member A DnaJ (Hsp40) homolog. NM_001130182 2.19 9.83E-20 2.94 2.90E-19 3.01 1.68E-19 DNAJA4 subfamily A. member 4 phorbol-12-myristate-13-acetate- NM_021127 0.93 1.84E-12 2.41 1.32E-17 2.69 1.43E-18 PMAIP1 induced protein 1 E2F7 E2F transcription factor 7 NM_203394 0.71 8.35E-11 2.20 2.21E-17 2.48 1.84E-18 DnaJ (Hsp40) homolog.
    [Show full text]
  • TAF10 Complex Provides Evidence for Nuclear Holo&Ndash;TFIID Assembly from Preform
    ARTICLE Received 13 Aug 2014 | Accepted 2 Dec 2014 | Published 14 Jan 2015 DOI: 10.1038/ncomms7011 OPEN Cytoplasmic TAF2–TAF8–TAF10 complex provides evidence for nuclear holo–TFIID assembly from preformed submodules Simon Trowitzsch1,2, Cristina Viola1,2, Elisabeth Scheer3, Sascha Conic3, Virginie Chavant4, Marjorie Fournier3, Gabor Papai5, Ima-Obong Ebong6, Christiane Schaffitzel1,2, Juan Zou7, Matthias Haffke1,2, Juri Rappsilber7,8, Carol V. Robinson6, Patrick Schultz5, Laszlo Tora3 & Imre Berger1,2,9 General transcription factor TFIID is a cornerstone of RNA polymerase II transcription initiation in eukaryotic cells. How human TFIID—a megadalton-sized multiprotein complex composed of the TATA-binding protein (TBP) and 13 TBP-associated factors (TAFs)— assembles into a functional transcription factor is poorly understood. Here we describe a heterotrimeric TFIID subcomplex consisting of the TAF2, TAF8 and TAF10 proteins, which assembles in the cytoplasm. Using native mass spectrometry, we define the interactions between the TAFs and uncover a central role for TAF8 in nucleating the complex. X-ray crystallography reveals a non-canonical arrangement of the TAF8–TAF10 histone fold domains. TAF2 binds to multiple motifs within the TAF8 C-terminal region, and these interactions dictate TAF2 incorporation into a core–TFIID complex that exists in the nucleus. Our results provide evidence for a stepwise assembly pathway of nuclear holo–TFIID, regulated by nuclear import of preformed cytoplasmic submodules. 1 European Molecular Biology Laboratory, Grenoble Outstation, 6 rue Jules Horowitz, 38042 Grenoble, France. 2 Unit for Virus Host-Cell Interactions, University Grenoble Alpes-EMBL-CNRS, 6 rue Jules Horowitz, 38042 Grenoble, France. 3 Cellular Signaling and Nuclear Dynamics Program, Institut de Ge´ne´tique et de Biologie Mole´culaire et Cellulaire, UMR 7104, INSERM U964, 1 rue Laurent Fries, 67404 Illkirch, France.
    [Show full text]
  • Structure and Mechanism of the RNA Polymerase II Transcription Machinery
    Downloaded from genesdev.cshlp.org on October 9, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Structure and mechanism of the RNA polymerase II transcription machinery Allison C. Schier and Dylan J. Taatjes Department of Biochemistry, University of Colorado, Boulder, Colorado 80303, USA RNA polymerase II (Pol II) transcribes all protein-coding ingly high resolution, which has rapidly advanced under- genes and many noncoding RNAs in eukaryotic genomes. standing of the molecular basis of Pol II transcription. Although Pol II is a complex, 12-subunit enzyme, it lacks Structural biology continues to transform our under- the ability to initiate transcription and cannot consistent- standing of complex biological processes because it allows ly transcribe through long DNA sequences. To execute visualization of proteins and protein complexes at or near these essential functions, an array of proteins and protein atomic-level resolution. Combined with mutagenesis and complexes interact with Pol II to regulate its activity. In functional assays, structural data can at once establish this review, we detail the structure and mechanism of how enzymes function, justify genetic links to human dis- over a dozen factors that govern Pol II initiation (e.g., ease, and drive drug discovery. In the past few decades, TFIID, TFIIH, and Mediator), pausing, and elongation workhorse techniques such as NMR and X-ray crystallog- (e.g., DSIF, NELF, PAF, and P-TEFb). The structural basis raphy have been complemented by cryoEM, cross-linking for Pol II transcription regulation has advanced rapidly mass spectrometry (CXMS), and other methods. Recent in the past decade, largely due to technological innova- improvements in data collection and imaging technolo- tions in cryoelectron microscopy.
    [Show full text]
  • V / DISSERTATION DOCTOR of PHILOSOPHY Denton, Texas May, 1992
    3~7? /V / MOLECULAR MECHANISM OF ACTION OF STEROID HORMONE RECEPTORS DISSERTATION Presented to the Graduate Council of the University of North Texas in Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY By Zafar Nawaz, B.S., M.S. Denton, Texas May, 1992 Nawaz, Zafar, Molecular Mechanism of Action of Steroid Hormone Receptors. Doctor of Philosophy (Biology), May, 1992, 136 pp., V tables, 46 illustrations, bibliography, 204 titles. A novel bacterial expression system that is capable of producing high levels of soluble, stable, biologically active human vitamin D3 and estrogen receptors has been developed. The method utilizes ubiquitin fusion technology and a low temperature nalidixic acid induction of the lambda PL promoter. This system can produce large quantities of receptor antigen, but only a small fraction displays wild-type DNA and hormone binding properties. Therefore, the use of this system to overproduce receptors for crystallization studies is not practical. To overcome these problems, a 2 um based ubiquitin fusion system which allows regulated expression of the estrogen receptor in yeast (Saccharomyces cerevisiae) was developed. This system produces the estrogen receptor to a level of 0.2% of the total soluble protein. Moreover, this protein is undegradable, soluble, and biologically active. To test the transcriptional activity of the estrogen receptor produced in yeast, a cis-trans transcription assay was developed. This assay revealed that the transcriptional activity of the human estrogen receptor expressed in yeast was similar to that observed in transfected mammalian cells. This reconstituted estrogen transcription unit in Saccharomyces cerevisiae was utilized to examine the regulation of estrogen receptor functions by antiestrogens, to develop a random and rapid approach for identifying novel estrogen response elements, to characterize estrogen receptor variants cloned from human breast tumors, and to examine the effect of estrogen receptor on the regulation of osteocalcin gene.
    [Show full text]
  • Engineered Type 1 Regulatory T Cells Designed for Clinical Use Kill Primary
    ARTICLE Acute Myeloid Leukemia Engineered type 1 regulatory T cells designed Ferrata Storti Foundation for clinical use kill primary pediatric acute myeloid leukemia cells Brandon Cieniewicz,1* Molly Javier Uyeda,1,2* Ping (Pauline) Chen,1 Ece Canan Sayitoglu,1 Jeffrey Mao-Hwa Liu,1 Grazia Andolfi,3 Katharine Greenthal,1 Alice Bertaina,1,4 Silvia Gregori,3 Rosa Bacchetta,1,4 Norman James Lacayo,1 Alma-Martina Cepika1,4# and Maria Grazia Roncarolo1,2,4# Haematologica 2021 Volume 106(10):2588-2597 1Department of Pediatrics, Division of Stem Cell Transplantation and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 2Stanford Institute for Stem Cell Biology and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 3San Raffaele Telethon Institute for Gene Therapy, Milan, Italy and 4Center for Definitive and Curative Medicine, Stanford School of Medicine, Stanford, CA, USA *BC and MJU contributed equally as co-first authors #AMC and MGR contributed equally as co-senior authors ABSTRACT ype 1 regulatory (Tr1) T cells induced by enforced expression of interleukin-10 (LV-10) are being developed as a novel treatment for Tchemotherapy-resistant myeloid leukemias. In vivo, LV-10 cells do not cause graft-versus-host disease while mediating graft-versus-leukemia effect against adult acute myeloid leukemia (AML). Since pediatric AML (pAML) and adult AML are different on a genetic and epigenetic level, we investigate herein whether LV-10 cells also efficiently kill pAML cells. We show that the majority of primary pAML are killed by LV-10 cells, with different levels of sensitivity to killing. Transcriptionally, pAML sensitive to LV-10 killing expressed a myeloid maturation signature.
    [Show full text]
  • Supplemental Figure 4B
    Supplementary materials 1 Supplemental figure legends 2 3 Supplemental Fig. 1 (A) Volcano Plot of differentially expressed miRNAs. 4 Abscissa axis: log2 (FC); Vertical axis: -log10 (FDR); Green: downregulated 5 miRNAs; Red: upregulated miRNAs; Black: no significant differences in 6 miRNAs expression. (B) Heat map of differentially expressed miRNAs. 7 Green: downregulated miRNAs; Red: upregulated miRNAs. FDR: false 8 discovery rate; FC: fold change. 9 10 Supplemental Fig. 2 (A) Volcano Plot of differentially expressed mRNAs. 11 Abscissa axis: log2 (FC); Vertical axis: -log10 (FDR); Green: downregulated 12 mRNAs; Red: upregulated mRNAs; Black: no significantly differences in 13 mRNA expression. (B) Heat map of differentially expressed mRNAs. 14 Green: downregulated mRNAs; Red: upregulated miRNAs. 15 16 Supplemental Fig. 3 The top 10 hub genes of upregulated(A) and 17 downregulated(B) DE-miRNAs. 18 19 Supplemental Fig. 4 IHC data from the Human Protein Atlas. High 20 expression of NR3C1, EZH2, and GATA4 in normal endometrial tissues 21 (Supplemental Fig. 4A, 4C, and 4E) than in EC tissues (Supplemental Fig. 22 4B, 4D, and 4F). 1 1 2 Supplemental Fig. 5 The validation in TIMER 2.0 between the 3 tumor-infiltrating immune cells and the three hub genes, NR3C1, EZH2, 4 as well as GATA4. (A-C) shows the correlation between each 5 tumor-infiltrating immune cell and three hub genes. 6 2 Supplemental Table 1 Sequences of primers for qRT-PCR Name Sequence Hsa-miR-18a-5p Forward CGGGCTAAGGTGCATCTAGTG Reverse CCTGTTGTCTCCAGCCACAAAAGAGCACAATATTTCAGGAGA
    [Show full text]
  • CREB-Dependent Transcription in Astrocytes: Signalling Pathways, Gene Profiles and Neuroprotective Role in Brain Injury
    CREB-dependent transcription in astrocytes: signalling pathways, gene profiles and neuroprotective role in brain injury. Tesis doctoral Luis Pardo Fernández Bellaterra, Septiembre 2015 Instituto de Neurociencias Departamento de Bioquímica i Biologia Molecular Unidad de Bioquímica y Biologia Molecular Facultad de Medicina CREB-dependent transcription in astrocytes: signalling pathways, gene profiles and neuroprotective role in brain injury. Memoria del trabajo experimental para optar al grado de doctor, correspondiente al Programa de Doctorado en Neurociencias del Instituto de Neurociencias de la Universidad Autónoma de Barcelona, llevado a cabo por Luis Pardo Fernández bajo la dirección de la Dra. Elena Galea Rodríguez de Velasco y la Dra. Roser Masgrau Juanola, en el Instituto de Neurociencias de la Universidad Autónoma de Barcelona. Doctorando Directoras de tesis Luis Pardo Fernández Dra. Elena Galea Dra. Roser Masgrau In memoriam María Dolores Álvarez Durán Abuela, eres la culpable de que haya decidido recorrer el camino de la ciencia. Que estas líneas ayuden a conservar tu recuerdo. A mis padres y hermanos, A Meri INDEX I Summary 1 II Introduction 3 1 Astrocytes: physiology and pathology 5 1.1 Anatomical organization 6 1.2 Origins and heterogeneity 6 1.3 Astrocyte functions 8 1.3.1 Developmental functions 8 1.3.2 Neurovascular functions 9 1.3.3 Metabolic support 11 1.3.4 Homeostatic functions 13 1.3.5 Antioxidant functions 15 1.3.6 Signalling functions 15 1.4 Astrocytes in brain pathology 20 1.5 Reactive astrogliosis 22 2 The transcription
    [Show full text]
  • Investigating Prenatal Stress in a Stem Cell Model of Human Neuronal Development
    INVESTIGATING PRENATAL STRESS IN A STEM CELL MODEL OF HUMAN NEURONAL DEVELOPMENT Lilia Papst Dissertation at the Graduate School of Systemic Neurosciences Ludwig‐Maximilians‐Universität München May, 2019 L. Papst Investigating prenatal stress in a stem cell model of human neuronal development Supervisor Prof. Dr. Dr. med. Elisabeth Binder Translational Research in Psychiatry Max Planck Institute of Psychiatry First Reviewer: Prof. Dr. Dr. med. Elisabeth Binder Second Reviewer: Prof. Dr. Moritz Rossner Third Reviewer: Prof. Dr. Edna Grünblatt Date of Submission: May 27th 2019 Date of Defense: September 23rd 2019 [2] L. Papst Investigating prenatal stress in a stem cell model of human neuronal development CONTENTS Abstract ...................................................................................................................................... 7 List of Abbreviations ............................................................................................................. 8 1. Introduction .................................................................................................................... 9 1.1 Theoretical Background ..................................................................................... 9 1.1.1 Epidemiology of Psychiatric Disorders ...................................................... 9 1.1.2 Prenatal Stress in Psychiatric Disorders .................................................... 9 1.1.2.1 Developmental Origins of Health and Disease ........................................... 9 1.1.2.2
    [Show full text]
  • Integrative Framework for Identification of Key Cell Identity Genes Uncovers
    Integrative framework for identification of key cell PNAS PLUS identity genes uncovers determinants of ES cell identity and homeostasis Senthilkumar Cinghua,1, Sailu Yellaboinaa,b,c,1, Johannes M. Freudenberga,b, Swati Ghosha, Xiaofeng Zhengd, Andrew J. Oldfielda, Brad L. Lackfordd, Dmitri V. Zaykinb, Guang Hud,2, and Raja Jothia,b,2 aSystems Biology Section and dStem Cell Biology Section, Laboratory of Molecular Carcinogenesis, and bBiostatistics Branch, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC 27709; and cCR Rao Advanced Institute of Mathematics, Statistics, and Computer Science, Hyderabad, Andhra Pradesh 500 046, India Edited by Norbert Perrimon, Harvard Medical School and Howard Hughes Medical Institute, Boston, MA, and approved March 17, 2014 (received for review October 2, 2013) Identification of genes associated with specific biological pheno- (mESCs) for genes essential for the maintenance of ESC identity types is a fundamental step toward understanding the molecular resulted in only ∼8% overlap (8, 9), although many of the unique basis underlying development and pathogenesis. Although RNAi- hits in each screen were known or later validated to be real. The based high-throughput screens are routinely used for this task, lack of concordance suggest that these screens have not reached false discovery and sensitivity remain a challenge. Here we describe saturation (14) and that additional genes of importance remain a computational framework for systematic integration of published to be discovered. gene expression data to identify genes defining a phenotype of Motivated by the need for an alternative approach for iden- interest. We applied our approach to rank-order all genes based on tification of key cell identity genes, we developed a computa- their likelihood of determining ES cell (ESC) identity.
    [Show full text]