DOCSLIB.ORG

Autocrine VEGF/VEGFR1 Signaling in a Subpopulation of Cells Associates with Aggressive Osteosarcoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Autocrine VEGF/VEGFR1 Signaling in a Subpopulation of Cells Associates with Aggressive Osteosarcoma Published OnlineFirst April 23, 2014; DOI: 10.1158/1541-7786.MCR-14-0037 Molecular Cancer Cell Death and Survival Research Autocrine VEGF/VEGFR1 Signaling in a Subpopulation of Cells Associates with Aggressive Osteosarcoma Tetsuro Ohba1,7, Justin M.M. Cates3, Heather A. Cole1, David A. Slosky6, Hirotaka Haro7, Takashi Ando7, Herbert S. Schwartz1, and Jonathan G. Schoenecker1,2,3,4,5 Abstract Osteosarcoma is the most common primary bone malignancy and accounts for more than half of primary skeletal malignancies in children and young adults. Although vascular endothelial growth factor (VEGF) expression in osteosarcoma has been associated with poor outcome, its role in the pathogenesis of osteosarcoma remains controversial. Here, VEGF and VEGFR1 expression in both human and murine osteosarcoma cells associated with increasing malignant potential. Autocrine VEGF/VEGFR1 signaling resulted in constitutive activation of VEGFR1 in highly aggressive osteosarcoma cells. In addition, survival and proliferation of highly aggressive osteosarcoma cells was dependent on autocrine VEGF/R1 signaling in vitro. The effect of VEGFR1 expression on in vivo tumor growth and angiogenesis was evaluated by immunoselecting sub- populations of osteosarcoma cells that express high or low levels of VEGFR1. Cell enriched for high VEGFR1 expression showed increased VEGF production, tumor growth, tumor angiogenesis, and osteolysis in vivo.In addition, it was demonstrated that VEGF and VEGFR1 are coexpressed by a subset of tumor cells in human osteosarcoma, similar to what was observed in the murine osteosarcoma cells. These results suggest that autocrine VEGF/VEGFR1 signaling in a subpopulation of tumor cells plays a pivotal role in osteosarcoma progression. Implications: Aggressive osteosarcoma phenotypes are mediated by autocrine VEGF/VEGFR1 signaling and improved stratification measures and novel anti-angiogenic strategies may benefit this specific tumor type. Mol Cancer Res; 12(8); 1100–11. Ó2014 AACR. Introduction diagnosis (<30% 5-year survival rate; ref. 1). Consequently, Osteosarcoma is the most common primary bone malig- new therapies are needed. Alternative adjuvant therapies nancy in children and young adults and accounts for more designed to inhibit biologic activities, which are crucial for than 50% of primary skeletal malignancies in this popula- tumor growth and metastasis have increased overall and tion. These aggressive tumors commonly metastasize and progression-free survival and decreased morbidity (2, 3). therefore are routinely treated with neoadjuvant chemother- Identifying key molecular mechanisms that drive tumor apy in addition to surgical resection. Despite newly devised progression is critical for the development of effective adju- poly-chemotherapy regimens combined with wide margin, vant therapies. limb-sparing surgical resection, osteosarcoma continues to Vascular endothelial growth factor (VEGF) is over- confer a poor prognosis in patients who do not respond to expressed by the vast majority of solid tumors (4, 5). chemotherapy or who present with metastatic disease at VEGF includes multiple isoforms. For the purposes of this article, the abbreviation VEGF refers to isoform VEGF-A unless otherwise indicated. Serum VEGF levels are ele- 1 2 vated in many patients with cancer, including those with Authors' Affiliations: Departments of Orthopaedics, Center for Bone – Biology, 3Pathology, Microbiology and Immunology, 4Pharmacology, osteosarcoma (6 8). Inhibition of VEGF effectively sup- 5Pediatrics, and 6Cardio-oncology, Vanderbilt University Medical Center, presses osteosarcoma-induced angiogenesis in a murine Nashville, Tennessee; and 7Department of Orthopaedic Surgery, Faculty of fi Medicine, University of Yamanashi, Chuo, Yamanashi, Japan model of osteosarcoma (9). Unfortunately, the ef cacy of anti-VEGF/VEGF receptor (VEGFR) therapy in mouse Note: Supplementary data for this article are available at Molecular Cancer fi Research Online (http://mcr.aacrjournals.org/). models have not translated well to clinical ef cacy in humans (10), largely because of resistance (11). This Corresponding Author: Jonathan G. Schoenecker, Vanderbilt University Medical Center, 4202 DOT, 2200 Children's Way, Nashville, TN 37232- generality notwithstanding, regorafenib, a novel oral mul- 9565. Phone: 615-936-3080; Fax: 615-343-2423; E-mail: ti-kinase inhibitor of angiogenic (VEGFR1–3, TIE2), [email protected] stromal (PDGFRb, FGFR), and oncogenic kinases (KIT, doi: 10.1158/1541-7786.MCR-14-0037 RET, and RAF) has shown an acceptable safety profile Ó2014 American Association for Cancer Research. and preliminary evidence of antitumor activity in patients 1100 Mol Cancer Res; 12(8) August 2014 Downloaded from mcr.aacrjournals.org on September 23, 2021. © 2014 American Association for Cancer Research. Published OnlineFirst April 23, 2014; DOI: 10.1158/1541-7786.MCR-14-0037 Autocrine VEGF/R1 Signaling in Osteosarcoma with solid tumors, including osteosarcoma (12). To Absorbance was measured at 490 nm with a microplate understand the molecular pathways responsible for resis- reader (Biotek). tance to anti-VEGFR therapy, the mechanisms of oste- Proliferation. Bromodeoxyuridine (BrdUrd) incorpo- osarcoma growth and angiogenesis need to be further ration assays were performed as recommended by the man- elucidated. ufacturer (Cell Proliferation ELISA, BrdU Kit; Roche). VEGF receptors [VEGFR1 (flt-1), VEGFR2 (KDR, K7M3 and K12 cells were incubated in serum-free media flk-1), and neuropilin1 (NRP1)] are thought to promote for 18 hours as described for the MTT assay. Absorbance was cell proliferation, survival, adhesion, migration, and capillary measured at 370 nm. morphogenesis, VEGFR2 is the primary receptor of VEGF Measures of cell apoptosis. Human or murine cells (8 Â on endothelial cells (13, 14). VEGFR1 has been reported to 105 cells/well) were plated on 6-well plates and incubated for promote autocrine-stimulated proliferation and cell survival 6 hours in 100 mL growth media. Cells were exposed to 40 in melanoma and breast carcinoma (15, 16). Here we show mmol/L TGFbRI kinase inhibitor or VEGFR1 kinase inhib- that osteosarcoma cells express VEGFR1, but not VEGFR2, itor for 24 hours and then trypsinized and pelleted by and that VEGFR1 expression and activation is associated centrifugation. Cell pellets were washed with PBS twice and with increased malignant potential. In addition, only a resuspended in 300 mL binding buffer at a density of 1 Â 106 subpopulation of highly aggressive osteosarcoma cells shows cells/mL. To detect apoptosis, 100 mL of the cell suspension evidence of autocrine signaling through VEGFR1, driving a was analyzed by flow cytometry (BD FACSCantoII) after feed-forward loop upregulating VEGF production and cells were stained with 1 mL Annexin V-FITC and 10 mL increasing cell proliferation and survival. This cell subpop- propidium iodide solution (Trevigen Inc.). ulation may even drive locoregional angiogenesis within Transcription of small interfering RNA. K7M3 cells the tumor microenvironment. The results suggest that were cultured (5 Â 105 cells/well) for 24 hours in 6-well VEGF/R1 signaling by a relatively small subpopulation of plates in DMEM with 10% FBS and were transiently tumor cells may contribute to the aggressive behavior of transfected with 10 or 50 pmol/L siVEGFR1 (Mm.389712) osteosarcoma. or siControl (#4390843) using the Silencer Select small interfering RNA (siRNA) system (Invitrogen Life Tech- Materials and Methods nologies). For transfections, Lipofectamine 2000 reagent (Invitrogen) was used according to the manufacturer's Immortalized osteosarcoma cell lines and culture instructions. Human osteosarcoma lines TE85 and 143B were pro- RT-PCR amplification. Total RNA was isolated from vided by Dr. H. Luu (Department of Orthopedics, Uni- murine cell lines using RNeasy (Qiagen). Aliquots of 1 mgof versity of Chicago, Chicago, IL; ref. 17). Murine osteosar- total RNA were converted to cDNA by RT synthesized with coma K-lines initially derived from a primary osteosarcoma SuperScript-III reverse transcriptase (Invitrogen Life Tech- in a Balb/C mouse (18) were provided by Dr. E. Kleinerman nologies) using oligo-dT primers (Sigma-Aldrich). Subse- (Department of Pediatrics, University of Texas M.D. Ander- quently, polymerase chain reaction (PCR) was performed son Cancer Center, Houston, TX) and bEnd.3 mouse using Taq polymerase (Qiagen) in a total reaction volume of endothelioma cells (19) were obtained from the American 25 mL. The oligonucleotide sequences of the primers were as Type Culture Collection. All cells were maintained in follows: complete Dulbecco's Modified Eagle Medium (DMEM; Invitrogen Life Technologies) supplemented with 10% fetal fi Mouse VEGFR1 Forward, CGCTTTTTGTCAGTCATCTTCA calf serum (FBS; HyClone/Thermoscienti c) with 5.0% Reverse, TCTCGGCATTCACTTTGGTC antimycotic solution (Invitrogen Life Technologies) at 37C fi Mouse VEGFA Forward, CGGGTGCAGGCATTCCAGAG in a humidi ed normoxic atmosphere in the presence of 5% Reverse, CTCCGTGGGACAGAGAGGAC CO2. Mouse VEGFR2 Forward, TACACAATTCAGAGCGATGTGTGGT Reverse, CTGGTTCCTCCAATGGGATATCTTC Measures of cell viability, proliferation, and apoptosis Mouse b-actin Forward, TGGAATCCTGTGGCATC Viability. For methyl-tetrazolium bromide mitochon- Reverse, TAAAACGCAGCTCAGTAACAGTCCG drial activity assay (MTT), human or murine cells were plated in 96-well plates (7.0 Â 103 cells/well), and incubated Cycling conditions were 92Cfor2.5minutes,59C for 4 hours in 100 mL growth media,
Load more

Recommended publications
  • The Role of Vascular Endothelial Growth Factor Receptor-1 Signaling In
    Laboratory Investigation (2015) 95, 456–468 & 2015 USCAP, Inc All rights reserved 0023-6837/15 The role of vascular endothelial growth factor receptor-1 signaling in compensatory contralateral lung growth following unilateral pneumonectomy Yoshio Matsui1, Hideki Amano1,2, Yoshiya Ito3, Koji Eshima4, Hideaki Tamaki5, Fumihiro Ogawa1, Akira Iyoda6, Masafumi Shibuya7, Yuji Kumagai2, Yukitoshi Satoh6 and Masataka Majima1 Compensatory lung growth models have been widely used to investigate alveolization because the remaining lung can be kept intact and volume loss can be controlled. Vascular endothelial growth factor (VEGF) plays an important role in blood formation during lung growth and repair, but the precise mechanisms involved are poorly understood; therefore, the aim of this study was to investigate the role of VEGF signaling in compensatory lung growth. After left pneumonectomy, the right lung weight was higher in VEGF transgenic mice than wild-type (WT) mice. Compensatory lung growth was suppressed significantly in mice injected with a VEGF neutralizing antibody and in VEGF receptor-1 tyrosine kinase-deficient mice (TK À / À mice). The mobilization of progenitor cells expressing VEGFR1 þ cells from bone marrow and the recruitment of these cells to lung tissue were also suppressed in the TK À / À mice.WTmicetransplantedwithbonemarrowfromTKÀ / À transgenic GFP þ mice had significantly lower numbers of GFP þ /aquaporin 5 þ ,GFPþ /surfactant protein A þ ,andGFPþ /VEGFR1 þ cells than WT mice transplanted with bone marrow from WTGFP þ mice. The GFP þ /VEGFR1 þ cells also co-stained for aquaporin 5 and surfactant proteinA.Overall,theseresultssuggest that VEGF signaling contributes to compensatory lung growth by mobilizing VEGFR1 þ cells.
    [Show full text]
  • Ret Oncogene and Thyroid Carcinoma
    ndrom Sy es tic & e G n e e n G e f T o Elisei et al., J Genet Syndr Gene Ther 2014, 5:1 Journal of Genetic Syndromes h l e a r n a DOI: 10.4172/2157-7412.1000214 r p u y o J & Gene Therapy ISSN: 2157-7412 Review Article Open Access Ret Oncogene and Thyroid Carcinoma Elisei R, Molinaro E, Agate L, Bottici V, Viola D, Biagini A, Matrone A, Tacito A, Ciampi R, Vivaldi A and Romei C* Endocrine Unit, Department of Clinical and Experimental Medicine, University of Pisa, Italy Abstract Thyroid cancer is a malignant neoplasm that originates from follicular or parafollicular thyroid cells and is categorized as papillary (PTC), follicular (FTC), anaplastic (ATC) or medullary thyroid carcinoma (MTC). The alteration of the Rearranged during trasfection (RET) (proto-oncogene, a gene coding for a tyrosine-kinase receptor involved in the control of cell differentiation and proliferation, has been found to cause PTC and MTC. In particular, RET/PTC rearrangements and RET point mutations are related to PTC and MTC, respectively. Although RET/PTC rearrangements have been identified in both spontaneous and radiation-induced PTC, they occur more frequently in radiation-associated tumors. RET/PTC rearrangements have also been reported in follicular adenomas. Although controversial, correlations between RET/PTC rearrangements, especially RET/PTC3, and a more aggressive phenotype and a more advanced stage have been identified. Germline point mutations in the RET proto-oncogene are associated with nearly all cases of hereditary MTC, and a strict correlation between genotype and phenotype has been demonstrated.
    [Show full text]
  • Serum Levels of VEGF and MCSF in HER2+ / HER2- Breast Cancer Patients with Metronomic Neoadjuvant Chemotherapy Roberto J
    Arai et al. Biomarker Research (2018) 6:20 https://doi.org/10.1186/s40364-018-0135-x SHORTREPORT Open Access Serum levels of VEGF and MCSF in HER2+ / HER2- breast cancer patients with metronomic neoadjuvant chemotherapy Roberto J. Arai* , Vanessa Petry, Paulo M. Hoff and Max S. Mano Abstract Metronomic therapy has been gaining importance in the neoadjuvant setting of breast cancer treatment. Its clinical benefits may involve antiangiogenic machinery. Cancer cells induce angiogenesis to support tumor growth by secreting factors, such as vascular endothelial growth factor (VEGF). In breast cancer, Trastuzumab (TZM) based treatment is of key importance and is believed to reduce diameter and volume of blood vessels as well as vascular permeability. Here in we investigated serum levels of angiogenic factors VEGF and MCSF in patients receiving metronomic neoadjuvant therapy with or without TZM. We observed in HER2+ cohort stable levels of MCSF through treatment, whereas VEGF trend was of decreasing levels. In HER2- cohort we observed increasing levels of MCSF and VEGF trend. Overall, HER2+ patients had better pathological response to treatment. These findings suggest that angiogenic pathway may be involved in TZM anti-tumoral effect in the neoadjuvant setting. Keywords: Metronomic chemotherapy, Angiogenesis, Biomarker, Neoadjuvant, Breast cancer Background chemotherapeutic drugs in vitro and in vivo studies [9] Neoadjuvant chemotherapy was initially indicated to con- including rectal carcinomas [10]. Proliferation and/or vert a nonresectable into a resectable lesion [1, 2]. Data on induction of apoptosis of activated endothelial cells the efficacy and safety of metronomic chemotherapy in (ECs) is selectively inhibited as well as inhibition of the neoadjuvant setting for breast cancer (BC) is accumu- migration of EC, increase in the expression of lating and supporting application [3–6].
    [Show full text]
  • Regulation of Vascular Endothelial Growth Factor Receptor-1 Expression by Specificity Proteins 1, 3, and 4In Pancreatic Cancer Cells
    Research Article Regulation of Vascular Endothelial Growth Factor Receptor-1 Expression by Specificity Proteins 1, 3, and 4in Pancreatic Cancer Cells Maen Abdelrahim,1,4 Cheryl H. Baker,4 James L. Abbruzzese,2 David Sheikh-Hamad,3 Shengxi Liu,1 Sung Dae Cho,1 Kyungsil Yoon,1 and Stephen Safe1,5 1Institute of Biosciences and Technology, Texas A&M University Health Science Center; 2Department of Gastrointestinal Medical Oncology, University of Texas M. D. Anderson Cancer Center; 3Division of Nephrology, Department of Medicine, Baylor College of Medicine, Houston, Texas; 4Cancer Research Institute, M. D. Anderson Cancer Center, Orlando, Florida; and 5Department of Veterinary Physiology and Pharmacology, Texas A&M University, College Station, Texas Abstract through their specific interactions with VEGF receptors (VEGFR), Vascular endothelial growth factor receptor-1 (VEGFR1) is which are transmembrane tyrosine kinases and members of the expressed in cancer cell lines and tumors and, in pancreatic PDGF receptor gene family. and colon cancer cells, activation of VEGFR1 is linked to VEGFR1 (Flk-1), VEGFR2(Flt-1/KDR), and VEGFR3 (Flt-4) are the three major receptors for VEGF and related angiogenic factors. increased tumor migration and invasiveness.Tolfenamic acid, The former two receptors are primarily involved in angiogenesis in a nonsteroidal anti-inflammatory drug, decreases Sp protein endothelial cells, whereas VEGFR3 promotes hematopoiesis and expression in Panc-1 and L3.6pl pancreatic cancer cells, and lymphoangiogenesis (2, 3, 7, 8). VEGFR2 plays a critical role in this was accompanied by decreased VEGFR1 protein and angiogenesis; homozygous knockout mice were embryonic lethal mRNA and decreased luciferase activity on cells transfected [gestation day (GD) 8.5–9.0] and this was associated with the with constructs (pVEGFR1) containing VEGFR1 promoter failure to develop blood vessels (9).
    [Show full text]
  • Moguntinones—New Selective Inhibitors for the Treatment of Human Colorectal Cancer
    Published OnlineFirst April 17, 2014; DOI: 10.1158/1535-7163.MCT-13-0224 Molecular Cancer Small Molecule Therapeutics Therapeutics Moguntinones—New Selective Inhibitors for the Treatment of Human Colorectal Cancer Annett Maderer1, Stanislav Plutizki2, Jan-Peter Kramb2, Katrin Gopfert€ 1, Monika Linnig1, Katrin Khillimberger1, Christopher Ganser2, Eva Lauermann2, Gerd Dannhardt2, Peter R. Galle1, and Markus Moehler1 Abstract 3-Indolyl and 3-azaindolyl-4-aryl maleimide derivatives, called moguntinones (MOG), have been selected for their ability to inhibit protein kinases associated with angiogenesis and induce apoptosis. Here, we characterize their mode of action and their potential clinical value in human colorectal cancer in vitro and in vivo. MOG-19 and MOG-13 were characterized in vitro using kinase, viability, and apoptosis assays in different human colon cancer (HT-29, HCT-116, Caco-2, and SW480) and normal colon cell lines (CCD-18Co, FHC, and HCoEpiC) alone or in combination with topoisomerase I inhibitors. Intracellular signaling pathways were analyzed by Western blotting. To determine their potential to inhibit tumor growth in vivo, the human HT-29 tumor xenograft model was used. Moguntinones prominently inhibit several protein kinases associated with tumor growth and metastasis. Specific signaling pathways such as GSK3b and mTOR downstream targets b were inhibited with IC50 values in the nanomolar range. GSK3 signaling inhibition was independent of KRAS, BRAF, and PI3KCA mutation status. While moguntinones alone induced apoptosis only in concentra- tions >10 mmol/L, MOG-19 in combination with topoisomerase I inhibitors induced apoptosis synergistically at lower concentrations. Consistent with in vitro data, MOG-19 significantly reduced tumor volume and weight in combination with a topoisomerase I inhibitor in vivo.
    [Show full text]
  • Unveiling the Molecular Mechanisms Regulating the Activation of the Erbb Family Receptors at Atomic Resolution Through Molecular Modeling and Simulations
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Spring 2011 Unveiling the Molecular Mechanisms Regulating the Activation of the ErbB Family Receptors at Atomic Resolution through Molecular Modeling and Simulations Andrew Shih University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biophysics Commons, Other Biomedical Engineering and Bioengineering Commons, and the Structural Biology Commons Recommended Citation Shih, Andrew, "Unveiling the Molecular Mechanisms Regulating the Activation of the ErbB Family Receptors at Atomic Resolution through Molecular Modeling and Simulations" (2011). Publicly Accessible Penn Dissertations. 302. https://repository.upenn.edu/edissertations/302 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/302 For more information, please contact [email protected]. Unveiling the Molecular Mechanisms Regulating the Activation of the ErbB Family Receptors at Atomic Resolution through Molecular Modeling and Simulations Abstract The EGFR/ErbB/HER family of kinases contains four homologous receptor tyrosine kinases that are important regulatory elements in key signaling pathways. To elucidate the atomistic mechanisms of dimerization-dependent activation in the ErbB family, we have performed molecular dynamics simulations of the intracellular kinase domains of the four members of the ErbB family (those with known kinase activity), namely EGFR, ErbB2 (HER2)
    [Show full text]
  • Dual Inhibition Using Cabozantinib Overcomes HGF/MET Signaling Mediated Resistance to Pan-VEGFR Inhibition in Orthotopic and Metastatic Neuroblastoma Tumors
    INTERNATIONAL JOURNAL OF ONCOLOGY 50: 203-211, 2017 Dual inhibition using cabozantinib overcomes HGF/MET signaling mediated resistance to pan-VEGFR inhibition in orthotopic and metastatic neuroblastoma tumors ESTELLE DAUDIGEOS-DUBUS1, LUDIVINE LE DRET1, OLIVIA Bawa2, PAULE OPOLON2, ALBANE Vievard3, IRÈNE VILLA4, JACQUES BOSQ4, GILLES VASSAL1 and BIRGIT GEOERGER1 1Vectorology and Anticancer Therapies, UMR 8203, CNRS, Univ. Paris-Sud, Gustave Roussy, Université Paris-Saclay, Villejuif; 2Preclinical Evaluation Platform, Gustave Roussy, Villejuif; 3Tribvn, Châtillon; 4Pathology Laboratory, Gustave Roussy, Villejuif, France Received August 8, 2016; Accepted October 6, 2016 DOI: 10.3892/ijo.2016.3792 Abstract. MET is expressed on neuroblastoma cells and Introduction may trigger tumor growth, neoangiogenesis and metastasis. MET upregulation further represents an escape mechanism The tyrosine kinase receptor c-MET, also called MET or to various anticancer treatments including VEGF signaling hepatocyte growth factor receptor (HGFR), is the only known inhibitors. We developed in vitro a resistance model to pan- receptor for hepatocyte growth factor (HGF) (1). Aberrant VEGFR inhibition and explored the simultaneous inhibition MET signaling plays a pivotal role in angiogenesis as well as in of VEGFR and MET in neuroblastoma models in vitro and tumor cell proliferation, survival and migration (2-4). Several in vivo using cabozantinib, an inhibitor of the tyrosine kinases studies suggest that HGF/c-MET signaling promotes angio- including VEGFR2, MET, AXL and RET. Resistance in genesis directly by stimulating endothelial cells in response to IGR-N91-Luc neuroblastoma cells under continuous in vitro VEGF in various tumor types (5-8). Moreover, MET has been exposure pressure to VEGFR1-3 inhibition using axitinib was described as an oncogene in different pathologies such as liver associated with HGF and p-ERK overexpression.
    [Show full text]
  • Vascular Endothelial Growth Factor (VEGF) Signaling in Tumor Progression Robert Roskoski Jr
    Critical Reviews in Oncology/Hematology 62 (2007) 179–213 Vascular endothelial growth factor (VEGF) signaling in tumor progression Robert Roskoski Jr. ∗ Blue Ridge Institute for Medical Research, 3754 Brevard Road, Suite 116A, Box 19, Horse Shoe, NC 28742, USA Accepted 29 January 2007 Contents 1. Vasculogenesis and angiogenesis....................................................................................... 180 1.1. Definitions .................................................................................................... 180 1.2. Physiological and non-physiological angiogenesis ................................................................. 181 1.3. Activators and inhibitors of angiogenesis ......................................................................... 181 1.4. Sprouting and non-sprouting angiogenesis ........................................................................ 181 1.5. Tumor vessel morphology....................................................................................... 183 2. The vascular endothelial growth factor (VEGF) family ................................................................... 183 3. Properties and expression of the VEGF family .......................................................................... 183 3.1. VEGF-A ...................................................................................................... 183 3.2. VEGF-B ...................................................................................................... 185 3.3. VEGF-C .....................................................................................................
    [Show full text]
  • Heparin-Binding VEGFR1 Variants As Long-Acting VEGF Inhibitors for Treatment of Intraocular Neovascular Disorders
    Heparin-binding VEGFR1 variants as long-acting VEGF inhibitors for treatment of intraocular neovascular disorders Hong Xina, Nilima Biswasa, Pin Lia, Cuiling Zhonga, Tamara C. Chanb, Eric Nudlemanb, and Napoleone Ferraraa,b,1 aDepartment of Pathology, University of California San Diego, La Jolla, CA 92093; and bDepartment of Ophthalmology, University of California San Diego, La Jolla, CA 92093 Contributed by Napoleone Ferrara, April 20, 2021 (sent for review December 4, 2019; reviewed by Jayakrishna Ambati and Lois E. H. Smith) Neovascularization is a key feature of ischemic retinal diseases and VEGF inhibitors have become a standard of therapy in mul- the wet form of age-related macular degeneration (AMD), all lead- tiple tumors and have transformed the treatment of intraocular ing causes of severe vision loss. Vascular endothelial growth factor neovascular disorders such as the neovascular form of age-related (VEGF) inhibitors have transformed the treatment of these disor- macular degeneration (AMD), proliferative diabetic retinopathy, ders. Millions of patients have been treated with these drugs and retinal vein occlusion, which are leading causes of severe vision worldwide. However, in real-life clinical settings, many patients loss and legal blindness (3, 5, 18). Currently, three anti-VEGF drugs do not experience the same degree of benefit observed in clinical are widely used in the United States for ophthalmological indica- trials, in part because they receive fewer anti-VEGF injections. tions: bevacizumab, ranibizumab, and aflibercept (3). Bevacizumab Therefore, there is an urgent need to discover and identify novel is a full-length IgG antibody targeting VEGF (19). Even though long-acting VEGF inhibitors.
    [Show full text]
  • RET: a Multi-Faceted Gene in Human Cancer
    Endocrinol Metab 27(3):173-179, September 2012 http://dx.doi.org/10.3803/EnM.2012.27.3.173 REVIEW ARTICLE RET: A Multi-Faceted Gene in Human Cancer Massimo Santoro, Francesca Carlomagno, Rosa Marina Melillo Department of Biology and Cellular and Molecular Pathology, University of Naples Federico II School of Medicine and Surgery, Naples, Italy REarranged during Transfection (RET) gene encodes a receptor tyrosine kinase and it was initially discovered as an in vitro trans- forming gene. For many years, RET has been involved in papillary thyroid carcinoma and medullary thyroid carcinoma. More re- cently, lung adenocarcinoma and chronic myelomonocytic leukemia samples have been found to display RET gene rearrange- ments. This knowledge is stimulating the search for protein kinase inhibitors to combat RET-driven malignancies. (Endocrinol Metab 27:173-179, 2012) Key Words: Kinase, Neoplasms, Oncogenes, Rearranged during transfection, Signal transduction, Thyroid REARRANGED DURING TRANSFECTION (RET) The RET RTK was originally identified as an oncogene activated RECEPTOR AT A GLANCE by a rearrangement occurred in vitro during transfection of NIH3T3 cells with human lymphoma DNA [8]. RET protein belongs to a Receptor tyrosine kinases (RTK) are transmembrane (TM) pro- cell-surface complex able to bind glial-derived neurotrophic factor teins featuring an intracellular domain containing the tyrosine ki- (GDNF) ligands (GDNF, neurturin, artemin, and persephin) in con- nase (TK) enzyme. RTKs are often involved in cancer formation [1- junction with co-receptors of the GDNF receptor α family, desig- 3]. Notable examples are epidermal growth factor receptor (EGFR/ nated GFRα 1-4 [9]. Binding to the ligand-co-receptor complex leads HER1) and anaplastic lymphoma kinase (ALK) in non-small cell to RET dimerization and kinase activation.
    [Show full text]
  • Novel Targeted Agents for the Treatment of Bladder Cancer: Translating Laboratory Advances Into Clinical Application
    �e�ie Article Biologic Agents in Bladder Cancer International Braz J Urol Vol. 36 (3): 273-282, May - June, 2010 doi: 10.1590/S1677-55382010000300003 Novel Targeted Agents for the Treatment of Bladder Cancer: Translating Laboratory Advances into Clinical Application Xiaoping Yang, Thomas W. Flaig Department of Medicine, Division of Medical Oncology, University of Colorado Denver School of Medicine ABSTRACT Bladder cancer is a common and frequently lethal cancer. Natural history studies indicate two distinct clinical and molecular entities corresponding to invasive and non-muscle invasive disease. The high frequency of recurrence of noninvasive bladder cancer and poor survival rate of invasive bladder cancer emphasizes the need for novel therapeutic approaches. These mechanisms of tumor development and promotion in bladder cancer are strongly associated with several growth factor pathways including the fibroblast, epidermal, and the vascular endothelial growth factor pathways. In this review, efforts to translate the growing body of basic science research of novel treatments into clinical applications will be explored. Key words: bladder neoplasms; drug therapy; vascular endothelial growth factors; epidermal growth factors; fibroblast growth factors Int Braz J Urol. 2010; 36: 273-82 INTRODUCTION reduced toxicity, GC has been adopted as a standard, first-line regimen for advanced bladder cancer. Bladder cancer is common with 68,810 new In the second or third-line setting, several cases and 14,100 deaths estimated in the United States traditional chemotherapy agents offer modest ac- in 2008. It is the fourth most common cancer in men tivity. Prior to the widespread use of GC, weekly and the ninth most common cancer in women (1).
    [Show full text]
  • Diagnostic Value of VEGF-A, VEGFR-1 and VEGFR-2 in Feline Mammary Carcinoma
    cancers Article Diagnostic Value of VEGF-A, VEGFR-1 and VEGFR-2 in Feline Mammary Carcinoma Catarina Nascimento 1 , Andreia Gameiro 1, João Ferreira 2, Jorge Correia 1 and Fernando Ferreira 1,* 1 CIISA—Centro de Investigação Interdisciplinar em Sanidade Animal, Faculdade de Medicina Veterinária, Universidade de Lisboa, Avenida da Universidade Técnica, 1300-477 Lisboa, Portugal; [email protected] (C.N.); [email protected] (A.G.); [email protected] (J.C.) 2 Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, 1649-028 Lisboa, Portugal; [email protected] * Correspondence: [email protected]; Tel.: +351-21-365-2800 (ext. 431234) Simple Summary: Feline mammary carcinoma (FMC) is the third most common neoplasia in the cat, showing a highly malignant behavior, with both HER2-positive and triple negative (TN) subtypes presenting worse prognosis than luminal A and B subtypes. Furthermore, FMC has become a reliable cancer model for the study of human breast cancer, due to the similarities of clinicopathological, histopathological, and epidemiological features among the two species. Therefore, the identification of novel diagnostic biomarkers and therapeutic targets is needed to improve the clinical outcome of these patients. The aim of this study was to assess the potential of the VEGF-A/VEGFRs pathway, in order to validate future diagnostic and checkpoint-blocking therapies. Results showed that serum VEGF-A, VEGFR-1, and VEGFR-2 levels were significantly higher in cats with HER2-positive and TN normal-like tumors, presenting a positive association with its tumor-infiltrating lymphocytes expres- sion, suggesting that these molecules may serve as promising non-invasive diagnostic biomarkers for these subtypes.
    [Show full text]