DOCSLIB.ORG

KCNJ6 Is Associated with Adult Alcohol Dependence and Involved in Gene &Times

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
KCNJ6 Is Associated with Adult Alcohol Dependence and Involved in Gene &Times Neuropsychopharmacology (2011) 36, 1142–1148 & 2011 American College of Neuropsychopharmacology. All rights reserved 0893-133X/11 $32.00 www.neuropsychopharmacology.org KCNJ6 is Associated with Adult Alcohol Dependence and Involved in Gene  Early Life Stress Interactions in Adolescent Alcohol Drinking ,1 2,3 4 4 2 Toni-Kim Clarke* , Manfred Laucht , Monika Ridinger , Norbert Wodarz , Marcella Rietschel , 5 6 1 7 1 Wolfgang Maier , Mark Lathrop , Anbarasu Lourdusamy , Ulrich S Zimmermann , Sylvane Desrivieres 1,5 and Gunter Schumann 1 2 Section of Addiction Biology, MRC-SGDP Centre, Institute of Psychiatry, King’s College London, London, UK; Department of Child and 3 Adolescent Psychiatry and Psychotherapy, Central Institute of Mental Health, Mannheim, Germany; Department of Psychology, Division of 4 Clinical Psychology and Psychotherapy, University of Potsdam, Potsdam, Germany; Department of Psychiatry and Psychotherapy, University of 5 6 Regensburg, Regensburg, Germany; Department of Psychiatry and Psychotherapy, University of Bonn, Bonn, Germany; Centre National de 7 Genotypage, Evry, France; Department of Psychiatry and Psychotherapy, University Hospital Carl Gustav Carus, Technische Universita¨t, Dresden, Germany Alcohol abuse and dependence have proven to be complex genetic traits that are influenced by environmental factors. Primate and human studies have shown that early life stress increases the propensity for alcohol abuse in later life. The reinforcing properties of alcohol are mediated by dopaminergic signaling; however, there is little evidence to indicate how stress alters alcohol reinforcement. KCNJ6 (the gene encoding G-protein-coupled inwardly rectifying potassium channel 2 (GIRK2)) is a brain expressed potassium channel with inhibitory effects on dopaminergic tone. The properties of GIRK2 have been shown to be enhanced by the stress peptide corticotrophin-releasing hormone. Therefore, we sought to examine the role of KCNJ6 polymorphisms in adult alcohol dependence and stress-related alcohol abuse in adolescents. We selected 11 SNPs in the promoter region of KCNJ6, which were genotyped in 1152 adult alcohol dependents and 1203 controls. One SNP, rs2836016, was found to be associated with alcohol dependence (p ¼ 0.01, false discovery rate). We then assessed rs2836016 in an adolescent sample of 261 subjects, which were characterized for early life stress and adolescent hazardous drinking, defined using the Alcohol Use Disorders Identification Test (AUDIT), to examine gene–environment interactions. In the adolescent sample, the risk genotype of rs2836016 was significantly associated with increased AUDIT scores, but only in those individuals exposed to high levels of psychosocial stress in early life (p ¼ 0.01). Our findings show that KCNJ6 is associated with alcohol dependence and may moderate the effect of early psychosocial stress on risky alcohol drinking in adolescents. We have identified a candidate gene for future studies investigating a possible functional link between the response to stress and alcohol reinforcement. Neuropsychopharmacology (2011) 36, 1142–1148; doi:10.1038/npp.2010.247; published online 9 February 2011 Keywords: alcoholism; genetics; GIRK2; stress; gene  environment; KCNJ6 INTRODUCTION environmental factors are almost equally contributing to produce a complex phenotype. The dopaminergic meso- In 2002, the WHO’s World Health Report concluded that limbic system is one of the main neuronal networks alcohol was the fifth leading cause of death and disability responsible for inducing the reinforcing effects of drugs of worldwide, accounting for 9.2% of disability-adjusted life abuse (Robbins and Everitt, 1999, Tupala and Tiihonen, years in the developed world (Grimm, 2008). Alcoholism 2004). Ion channels are known to regulate dopaminergic is estimated to be between 50 and 60% heritable (Dick and neuronal signalling. One such family of ion channels Bierut, 2006), which suggests that both genetic and includes the G-protein-coupled inwardly rectifying potas- sium channels (GIRKs). GIRKs induce the postsynaptic inhibitory tone in response to the activation of the D2, D3 *Correspondence: Dr T-K Clarke, Translational Research Laboratory, Department of Psychiatry, School of Medicine, University of dopamine receptors, although their effects are not limited to Pennsylvania, Room 2109, 125 South 31st St Phila, Philadelphia, PA dopaminergic neurons (Kuzhikandathil et al, 1998). As the 19104, USA, Tel: + 1 215 746 3665, E-mail: [email protected] GIRK channel is opened, potassium ions permeate the cell, Received 14 September 2010; revised 16 November 2010; accepted 8 hyperpolarization ensues (Nicoll, 1988), and the neuronal December 2010 firing rate is reduced (Werner et al, 1996). KCNJ6 polymorphisms, stress and alcoholism T-K Clarke et al 1143 While dopaminergic signalling reinforces alcohol con- also assessed for nicotine dependence using diagnostic sumption, exposure to early life stress is known to promote criteria according to the DSM-IV and ICD-10. All partici- vulnerability to alcohol abuse in later life. This concept has pants were of German descent. Parents of the participants been extensively studied in Rhesus macaques, where it has were living in Bavaria and participants themselves were been shown that stress during early life increases alcohol born and raised in this area. Written informed consent consumption in adults (Fahlke et al, 2000). An enhanced was obtained for all participants before the investigation. sensitivity to stress in later life is also seen in these animals, Diagnosis was assessed after alcohol withdrawal by the who display increased salivary cortisol in response to social Composite International Diagnostic Interview (Wittchen isolation. Similar findings are observed in human beings et al, 1996) performed by trained staff who rated partici- with the number of adverse childhood experiences being pants independently. Patients with a lifetime history of correlated with an increased propensity for adolescent schizophrenia or an addiction to drugs other than tobacco alcohol abuse (Dube et al, 2006). Despite a well-established or alcohol were excluded from the study. link between early life stress and alcohol abuse in later life, In total, 1203 individuals were from the region of Bonn, there is currently no known mechanism showing how such Germany, and were recruited from 2001 to 2003 within the effects are mediated. Interestingly, the efficiency of the German National Research Project to serve as controls for GIRK channels has been shown to be increased by stress genetic studies in several neuropsychiatric phenotypes. peptides such as corticotrophin-releasing hormone (CRH) Population-based recruitment was performed in colla- (Beckstead et al, 2009). Inhibitory postsynaptic currents boration with the local consensus bureau. Participants were mediated by GIRK2 channels in D2-dopaminergic neurons screened for neurological and psychiatric disorders with of the mouse brain were found to be enhanced by CRH, and self-report questionnaires adapted from the German version this was dependent on the CRH-R1 receptor. Furthermore, of the inventory to diagnose depression (Kuhner, 1997); protein levels of GIRKs (GIRK1 and GIRK2) have been smoking and drinking were diagnosed with the Fagerstro¨m shown to be regulated by corticosterones in the brain of rats Tolerance Questionnaire (Fagerstrom, 1978) and the (Muma and Beck, 1999), providing evidence that GIRK2 Alcohol Use Disorders Identification Test (AUDIT) (Bohn interacts with neuronal stress systems. GIRK2 channels et al, 1995). More than 96% of the participants were of therefore may establish a link between brain stress systems, German or Western European origin as ascertained by place dopaminergic signalling, and thus reinforcement-related of birth of their grandparents. For all patients and controls, behavior. written informed consent was obtained before study Animal studies have analyzed the effects of ethanol on participation. GIRK2-null mice. They found that they could not establish a place preference or conditioned taste aversion for 2–3 g/kg Adolescent at-risk sample. Participants were members of of ethanol in mice lacking GIRK2 channels (Hill et al, 2003), the Mannheim Study of Children at Risk, an ongoing concluding that GIRK2 may be mediating the reinforcing epidemiological cohort study examining the outcome of and/or aversive motivational aspects of ethanol action. In early risk factors from infancy into adulthood (Laucht et al, human beings, only one study has examined GIRK2 and 2000). The initial sample comprised 384 children born addictive phenotypes. A large-scale candidate gene study between 1986 and 1988, of predominantly (499.0%) analyzed SNPs in 1050 nicotine-dependent individuals and European descent. Infants were recruited from two obstetric 879 controls (Saccone et al, 2007). An SNP in the promoter and six children’s hospitals of the Rhine-Neckar Region of of KCNJ6, the gene encoding GIRK2, provided one of the Germany and were included consecutively into the sample top signals for nicotine dependence in this study, suggesting according to a two-factorial design intended to enrich and that GIRK2 may be important in human nicotine addiction. control the status of the sample with regard to obstetric and Our approach was to explore the significance of genetic psychosocial risks (Laucht et al, 1997). Only firstborn variations in the promoter of KCNJ6 in alcohol dependence children with singleton births and
Load more

Recommended publications
  • (253), Re15. [DOI: 10.1126/Stke.2532004Re15] 2004
    The VGL-Chanome: A Protein Superfamily Specialized for Electrical Signaling and Ionic Homeostasis Frank H. Yu and William A. Catterall (5 October 2004) Sci. STKE 2004 (253), re15. [DOI: 10.1126/stke.2532004re15] The following resources related to this article are available online at http://stke.sciencemag.org. This information is current as of 7 July 2009. Article Tools Visit the online version of this article to access the personalization and article tools: http://stke.sciencemag.org/cgi/content/full/sigtrans;2004/253/re15 Supplemental "Supplementary Table 1" Materials http://stke.sciencemag.org/cgi/content/full/sigtrans;2004/253/re15/DC1 Related Content The editors suggest related resources on Science's sites: http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2006/360/tw376 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2006/350/pe33 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2006/333/tw149 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2005/307/pe50 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2005/302/pe46 Downloaded from http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2005/270/tw55 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2004/233/pe22 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2004/233/pe23 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2004/227/pe16 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2004/219/re4 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2003/194/pe32 http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2003/188/re10
    [Show full text]
  • 1 Molecular and Genetic Regulation of Pig Pancreatic Islet Cell Development 2 3 4 Seokho Kim1,9, Robert L
    bioRxiv preprint doi: https://doi.org/10.1101/717090; this version posted January 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Molecular and genetic regulation of pig pancreatic islet cell development 2 3 4 Seokho Kim1,9, Robert L. Whitener1,9, Heshan Peiris1, Xueying Gu1, Charles A. Chang1, 5 Jonathan Y. Lam1, Joan Camunas-Soler2, Insung Park3, Romina J. Bevacqua1, Krissie Tellez1, 6 Stephen R. Quake2,4, Jonathan R. T. Lakey5, Rita Bottino6, Pablo J. Ross3, Seung K. Kim1,7,8 7 8 1Department of Developmental Biology, Stanford University School of Medicine, 9 Stanford, CA, 94305 USA 10 2Department of Bioengineering, Stanford University, Stanford, CA, 94305 USA 11 3Department of Animal Science, University of California Davis, Davis, CA, 95616 USA 12 4Chan Zuckerberg Biohub, San Francisco, CA 94518, USA. 13 5Department of Surgery, University of California at Irvine, Irvine, CA, 92868 USA 14 6Institute of Cellular Therapeutics, Allegheny Health Network, Pittsburgh, PA, 15212 USA 15 7Department of Medicine, Stanford University School of Medicine, Stanford, CA, 94305 USA 16 8Stanford Diabetes Research Center, Stanford University School of Medicine, 17 Stanford, CA, 94305 USA 18 19 9These authors contributed equally 20 21 Correspondence and requests for materials should be addressed to S.K.K (email: 22 [email protected]) 23 24 Key Words: pancreas; metabolism; organogenesis; b-cell; a-cell; d-cell; diabetes mellitus 25 26 Summary Statement: This study reveals transcriptional, signaling and cellular programs 27 governing pig pancreatic islet development, including striking similarities to human islet 28 ontogeny, providing a novel resource for advancing human islet replacement strategies.
    [Show full text]
  • Ion Channels
    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
    [Show full text]
  • Therapeutic Approaches to Genetic Ion Channelopathies and Perspectives in Drug Discovery
    fphar-07-00121 May 7, 2016 Time: 11:45 # 1 REVIEW published: 10 May 2016 doi: 10.3389/fphar.2016.00121 Therapeutic Approaches to Genetic Ion Channelopathies and Perspectives in Drug Discovery Paola Imbrici1*, Antonella Liantonio1, Giulia M. Camerino1, Michela De Bellis1, Claudia Camerino2, Antonietta Mele1, Arcangela Giustino3, Sabata Pierno1, Annamaria De Luca1, Domenico Tricarico1, Jean-Francois Desaphy3 and Diana Conte1 1 Department of Pharmacy – Drug Sciences, University of Bari “Aldo Moro”, Bari, Italy, 2 Department of Basic Medical Sciences, Neurosciences and Sense Organs, University of Bari “Aldo Moro”, Bari, Italy, 3 Department of Biomedical Sciences and Human Oncology, University of Bari “Aldo Moro”, Bari, Italy In the human genome more than 400 genes encode ion channels, which are transmembrane proteins mediating ion fluxes across membranes. Being expressed in all cell types, they are involved in almost all physiological processes, including sense perception, neurotransmission, muscle contraction, secretion, immune response, cell proliferation, and differentiation. Due to the widespread tissue distribution of ion channels and their physiological functions, mutations in genes encoding ion channel subunits, or their interacting proteins, are responsible for inherited ion channelopathies. These diseases can range from common to very rare disorders and their severity can be mild, Edited by: disabling, or life-threatening. In spite of this, ion channels are the primary target of only Maria Cristina D’Adamo, University of Perugia, Italy about 5% of the marketed drugs suggesting their potential in drug discovery. The current Reviewed by: review summarizes the therapeutic management of the principal ion channelopathies Mirko Baruscotti, of central and peripheral nervous system, heart, kidney, bone, skeletal muscle and University of Milano, Italy Adrien Moreau, pancreas, resulting from mutations in calcium, sodium, potassium, and chloride ion Institut Neuromyogene – École channels.
    [Show full text]
  • Trisomy of the G Protein-Coupled K Channel Gene, Kcnj6, Affects Reward Mechanisms, Cognitive Functions, and Synaptic Plasticity
    Trisomy of the G protein-coupled K+ channel gene, Kcnj6, affects reward mechanisms, cognitive functions, and synaptic plasticity in mice Ayelet Coopera, Gayane Grigoryanb, Liora Guy-Davida, Michael M. Tsooryc, Alon Chenb, and Eitan Reuvenya,1 aDepartment of Biological Chemistry, bDepartment of Neurobiology, and cDepartment of Veterinary Resources, The Weizmann Institute of Science, Rehovot 76100, Israel Edited* by Lily Yeh Jan, University of California, San Francisco, CA, and approved January 3, 2012 (received for review June 7, 2011) G protein-activated inwardly rectifying K+ channels (GIRK) gener- channels consist of GIRK2 are present (18). Studies of null mice ate slow inhibitory postsynaptic potentials in the brain via Gi/o for the various GIRK-channel subunits implicated these channels protein-coupled receptors. GIRK2, a GIRK subunit, is widely abun- in brain mechanisms that relates to hyperalgesia, seizure suscep- dant in the brain and has been implicated in various functions and tibility, cognitive functions, reward mechanisms, and anxiety (18). pathologies, such as learning and memory, reward, motor coordi- Most of the information collected so far has been obtained using nation, and Down syndrome. Down syndrome, the most prevalent animal models that lack one or two of the GIRK channel subunits; cause of mental retardation, results from the presence of an extra however, very little is known about the pathological consequences Kcnj6 maternal chromosome 21 (trisomy 21), which comprises the associated with an increase in gene number. More specifically, gene (GIRK2). The present study examined the behaviors and cel- little is known about the consequences of GIRK2 gene trisomy lular physiology properties in mice harboring a single trisomy of Kcnj6 Kcnj6 fi and its relation to DS.
    [Show full text]
  • Subcellular Localization of K+ Channels in Mammalian Brain Neurons: Remarkable Precision in the Midst of Extraordinary Complexity
    Neuron Review Subcellular Localization of K+ Channels in Mammalian Brain Neurons: Remarkable Precision in the Midst of Extraordinary Complexity James S. Trimmer1,2,* 1Department of Neurobiology, Physiology, and Behavior 2Department of Physiology and Membrane Biology University of California, Davis, Davis, CA 95616, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.neuron.2014.12.042 Potassium channels (KChs) are the most diverse ion channels, in part due to extensive combinatorial assem- bly of a large number of principal and auxiliary subunits into an assortment of KCh complexes. Their structural and functional diversity allows KChs to play diverse roles in neuronal function. Localization of KChs within specialized neuronal compartments defines their physiological role and also fundamentally impacts their activity, due to localized exposure to diverse cellular determinants of channel function. Recent studies in mammalian brain reveal an exquisite refinement of KCh subcellular localization. This includes axonal KChs at the initial segment, and near/within nodes of Ranvier and presynaptic terminals, dendritic KChs found at sites reflecting specific synaptic input, and KChs defining novel neuronal compartments. Painting the remarkable diversity of KChs onto the complex architecture of mammalian neurons creates an elegant pic- ture of electrical signal processing underlying the sophisticated function of individual neuronal compart- ments, and ultimately neurotransmission and behavior. Introduction genes are expressed in distinct cellular expression patterns Mammalian brain neurons are distinguished from other cells by throughout the brain, such that particular neurons express spe- extreme molecular and structural complexity that is intimately cific combinations of KCh a and auxiliary subunits. However, the linked to the array of intra- and intercellular signaling events proteomic complexity of KChs is much greater, as KChs exist as that underlie brain function.
    [Show full text]
  • 1 1 2 3 Cell Type-Specific Transcriptomics of Hypothalamic
    1 2 3 4 Cell type-specific transcriptomics of hypothalamic energy-sensing neuron responses to 5 weight-loss 6 7 Fredrick E. Henry1,†, Ken Sugino1,†, Adam Tozer2, Tiago Branco2, Scott M. Sternson1,* 8 9 1Janelia Research Campus, Howard Hughes Medical Institute, 19700 Helix Drive, Ashburn, VA 10 20147, USA. 11 2Division of Neurobiology, Medical Research Council Laboratory of Molecular Biology, 12 Cambridge CB2 0QH, UK 13 14 †Co-first author 15 *Correspondence to: [email protected] 16 Phone: 571-209-4103 17 18 Authors have no competing interests 19 1 20 Abstract 21 Molecular and cellular processes in neurons are critical for sensing and responding to energy 22 deficit states, such as during weight-loss. AGRP neurons are a key hypothalamic population 23 that is activated during energy deficit and increases appetite and weight-gain. Cell type-specific 24 transcriptomics can be used to identify pathways that counteract weight-loss, and here we 25 report high-quality gene expression profiles of AGRP neurons from well-fed and food-deprived 26 young adult mice. For comparison, we also analyzed POMC neurons, an intermingled 27 population that suppresses appetite and body weight. We find that AGRP neurons are 28 considerably more sensitive to energy deficit than POMC neurons. Furthermore, we identify cell 29 type-specific pathways involving endoplasmic reticulum-stress, circadian signaling, ion 30 channels, neuropeptides, and receptors. Combined with methods to validate and manipulate 31 these pathways, this resource greatly expands molecular insight into neuronal regulation of 32 body weight, and may be useful for devising therapeutic strategies for obesity and eating 33 disorders.
    [Show full text]
  • A KCNJ6 Gene Polymorphism Modulates Theta Oscillations During Reward Processing
    International Journal of Psychophysiology 115 (2017) 13–23 Contents lists available at ScienceDirect International Journal of Psychophysiology journal homepage: www.elsevier.com/locate/ijpsycho A KCNJ6 gene polymorphism modulates theta oscillations during reward processing Chella Kamarajan a,⁎, Ashwini K. Pandey a, David B. Chorlian a,NiklasManza,1, Arthur T. Stimus a, Howard J. Edenberg b, Leah Wetherill b,MarcSchuckitc, Jen-Chyong Wang d, Samuel Kuperman e, John Kramer e, Jay A. Tischfield f, Bernice Porjesz a a Henri Begleiter Neurodynamics Lab, SUNY Downstate Medical Center, Brooklyn, NY, USA b Indiana University School of Medicine, Indianapolis, IN, USA c University of California San Diego Medical Center, San Diego, CA, USA d Icahn School of Medicine at Mount Sinai, New York, NY, USA e University of Iowa, Iowa City, IA, USA f The State University of New Jersey, Piscataway, NJ, USA article info abstract Article history: Event related oscillations (EROs) are heritable measures of neurocognitive function that have served as useful Received 5 October 2015 phenotype in genetic research. A recent family genome-wide association study (GWAS) by the Collaborative Received in revised form 9 December 2016 Study on the Genetics of Alcoholism (COGA) found that theta EROs during visual target detection were associated Accepted 15 December 2016 at genome-wide levels with several single nucleotide polymorphisms (SNPs), including a synonymous SNP, Available online 16 December 2016 rs702859, in the KCNJ6 gene that encodes GIRK2, a G-protein inward rectifying potassium channel that regulates excitability of neuronal networks. The present study examined the effect of the KCNJ6 SNP (rs702859), previously Keywords: Event-related oscillations (EROs) associated with theta ERO to targets in a visual oddball task, on theta EROs during reward processing in a mon- Theta power etary gambling task.
    [Show full text]
  • Review Article Channelopathies
    J Med Genet 2000;37:729–740 729 Review article J Med Genet: first published as 10.1136/jmg.37.10.729 on 1 October 2000. Downloaded from Channelopathies: ion channel defects linked to heritable clinical disorders Ricardo Felix Abstract number of inherited ion channel diseases Electrical signals are critical for the func- named collectively “channelopathies”, caused tion of neurones, muscle cells, and cardiac by mutations in K+,Na+,Ca2+, and Cl- channels myocytes. Proteins that regulate electrical that are known to exist in human and animal signalling in these cells, including voltage models. gated ion channels, are logical sites where Ion channels constitute a class of macromo- abnormality might lead to disease. Ge- lecular protein tunnels that span the lipid netic and biophysical approaches are bilayer of the cell membrane, which allow ions being used to show that several disorders to flow in or out of the cell in a very eYcient result from mutations in voltage gated ion fashion (up to 106 per second). This flow of channels. Understanding gained from ions creates electrical currents (in the order of early studies on the pathogenesis of a 10-12 to 10-10 amperes per channel) large enough group of muscle diseases that are similar to produce rapid changes in the transmem- in their episodic nature (periodic paraly- brane voltage, which is the electrical potential sis) showed that these disorders result diVerence between the cell interior and exte- from mutations in a gene encoding a volt- rior. Inasmuch as Na+ and Ca2+ ions are at age gated Na+ channel. Their characteri- higher concentrations extracellularly than in- sation as channelopathies has served as a tracellularly, openings of Na+ and Ca2+ chan- paradigm for other episodic disorders.
    [Show full text]
  • GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574
    Figure S1. Boxplots of normalized samples in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. The x‑axes indicate samples, and the y‑axes represent the expression of genes. Figure S2. Volanco plots of DEGs in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. Red nodes represent upregulated DEGs and green nodes indicate downregulated DEGs. Cut‑off criteria were P<0.05 and |log2 FC|>1. DEGs, differentially expressed genes; FC, fold change; adj.P.Val, adjusted P‑value. Figure S3. Transcription factor‑gene regulatory network constructed using the Cytoscape iRegulion plug‑in. Table SI. Primer sequences for reverse transcription‑quantitative polymerase chain reaction. Genes Sequences hsa‑miR‑124 F: 5'‑ACACTCCAGCTGGGCAGCAGCAATTCATGTTT‑3' R: 5'‑CTCAACTGGTGTCGTGGA‑3' hsa‑miR‑330‑3p F: 5'‑CATGAATTCACTCTCCCCGTTTCTCCCTCTGC‑3' R: 5'‑CCTGCGGCCGCGAGCCGCCCTGTTTGTCTGAG‑3' hsa‑miR‑34a‑5p F: 5'‑TGGCAGTGTCTTAGCTGGTTGT‑3' R: 5'‑GCGAGCACAGAATTAATACGAC‑3' hsa‑miR‑449a F: 5'‑TGCGGTGGCAGTGTATTGTTAGC‑3' R: 5'‑CCAGTGCAGGGTCCGAGGT‑3' CD44 F: 5'‑CGGACACCATGGACAAGTTT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' PCNA F: 5'‑GAACTGGTTCATTCATCTCTATGG‑3' F: 5'‑TGTCACAGACAAGTAATGTCGATAAA‑3' SYT1 F: 5'‑CAATAGCCATAGTCGCAGTCCT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' U6 F: 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' R: 5'‑CGCTTCACGAATTTGCGTGTCAT‑3' GAPDH F: 5'‑GGAAAGCTGTGGCGTGAT‑3' R: 5'‑AAGGTGGAAGAATGGGAGTT‑3' hsa, homo sapiens; miR, microRNA; CD44, CD44 molecule (Indian blood group); PCNA, proliferating cell nuclear antigen;
    [Show full text]
  • Potassium Channels and Their Potential Roles in Substance Use Disorders
    International Journal of Molecular Sciences Review Potassium Channels and Their Potential Roles in Substance Use Disorders Michael T. McCoy † , Subramaniam Jayanthi † and Jean Lud Cadet * Molecular Neuropsychiatry Research Branch, NIDA Intramural Research Program, Baltimore, MD 21224, USA; [email protected] (M.T.M.); [email protected] (S.J.) * Correspondence: [email protected]; Tel.: +1-443-740-2656 † Equal contributions (joint first authors). Abstract: Substance use disorders (SUDs) are ubiquitous throughout the world. However, much re- mains to be done to develop pharmacotherapies that are very efficacious because the focus has been mostly on using dopaminergic agents or opioid agonists. Herein we discuss the potential of using potassium channel activators in SUD treatment because evidence has accumulated to support a role of these channels in the effects of rewarding drugs. Potassium channels regulate neuronal action potential via effects on threshold, burst firing, and firing frequency. They are located in brain regions identified as important for the behavioral responses to rewarding drugs. In addition, their ex- pression profiles are influenced by administration of rewarding substances. Genetic studies have also implicated variants in genes that encode potassium channels. Importantly, administration of potassium agonists have been shown to reduce alcohol intake and to augment the behavioral effects of opioid drugs. Potassium channel expression is also increased in animals with reduced intake of methamphetamine. Together, these results support the idea of further investing in studies that focus on elucidating the role of potassium channels as targets for therapeutic interventions against SUDs. Keywords: alcohol; cocaine; methamphetamine; opioids; pharmacotherapy Citation: McCoy, M.T.; Jayanthi, S.; Cadet, J.L.
    [Show full text]
  • Vitro Generated to Ex Vivo CD8 T Cells Comparative and Functional
    Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology published online 27 August 2012 from submission to initial decision 4 weeks from acceptance to publication Comparative and Functional Evaluation of In Vitro Generated to Ex Vivo CD8 T Cells Dzana D. Dervovic, Maria Ciofani, Korosh Kianizad and Juan Carlos Zúñiga-Pflücker J Immunol http://www.jimmunol.org/content/early/2012/08/26/jimmun ol.1200979 Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2012/08/28/jimmunol.120097 9.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. Published August 27, 2012, doi:10.4049/jimmunol.1200979 The Journal of Immunology Comparative and Functional Evaluation of In Vitro Generated to Ex Vivo CD8 T Cells Dzˇana D. Dervovic´,*,† Maria Ciofani,*,†,1 Korosh Kianizad,*,† and Juan Carlos Zu´n˜iga-Pflu¨cker*,† The generation of the cytotoxic CD8 T cell response is dependent on the functional outcomes imposed by the intrathymic constraints of differentiation and self-tolerance.
    [Show full text]