Proteolytic Allergen Proder P 1, a Major House Dust Mite the Crystal

Total Page:16

File Type:pdf, Size:1020Kb

Proteolytic Allergen Proder P 1, a Major House Dust Mite the Crystal The Crystal Structure of Recombinant proDer p 1, a Major House Dust Mite Proteolytic Allergen This information is current as Kåre Meno, Peter B. Thorsted, Henrik Ipsen, Ole Kristensen, of September 26, 2021. Jørgen N. Larsen, Michael D. Spangfort, Michael Gajhede and Kaare Lund J Immunol 2005; 175:3835-3845; ; doi: 10.4049/jimmunol.175.6.3835 http://www.jimmunol.org/content/175/6/3835 Downloaded from References This article cites 49 articles, 10 of which you can access for free at: http://www.jimmunol.org/content/175/6/3835.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 26, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Crystal Structure of Recombinant proDer p 1, a Major House Dust Mite Proteolytic Allergen1 Kåre Meno,2* Peter B. Thorsted,* Henrik Ipsen,* Ole Kristensen,† Jørgen N. Larsen,* Michael D. Spangfort,* Michael Gajhede,† and Kaare Lund* Allergy to house dust mite is among the most prevalent allergic diseases worldwide. Most house dust mite allergic patients react to Der p 1 from Dermatophagoides pteronyssinus, which is a cysteine protease. To avoid heterogeneity in the sample used for crystallization, a modified recombinant molecule was produced. The sequence of the proDer p 1 allergen was modified to reduce glycosylation and to abolish enzymatic activity. The resulting rproDer p 1 preparation was homogenous and stable and yielded crystals diffracting to a resolution of 1.61 Å. The active site is located in a large cleft on the surface of the molecule. The 80-aa pro-peptide adopts a unique fold that interacts with the active site cleft and a substantial adjacent area on the mature region, excluding access to the cleft and the active site. Studies performed using crossed-line immunoelectrophoresis and IgE inhibition experiments indicated that several epitopes are Downloaded from covered by the pro-peptide and that the epitopes on the recombinant mature molecule are indistinguishable from those on the natural one. The structure confirms previous results suggesting a preference for aliphatic residues in the important P2 position in substrates. Sequence variations in related species are concentrated on the surface, which explains the existence of cross-reacting and species-specific antibodies. This study describes the first crystal structure of one of the clinically most important house dust mite allergens, the cysteine protease Der p 1. The Journal of Immunology, 2005, 175: 3835–3845. http://www.jimmunol.org/ nhalation allergy to house dust mite is among the most prev- (i.e., D. pteronyssinus and D. farinae). Because the house dust alent allergic diseases worldwide (1, 2). Allergy to house dust mites are taxonomically related, the different species contain ho- I mite causes symptoms typical for type 1 immediate hyper- mologous allergens with structural similarities, which causes IgE reactivity, such as rhinoconjunctivitis and asthma. The allergic cross-reactivity (5). Patients sensitized to one species therefore of- phenotype is characterized by a persistent inflammation in the air- ten also react to the other species (6, 7). way mucosa and the presence of allergen-specific IgE. Allergen- Several proteins derived from house dust mites have been specific IgE binds to high-affinity receptors on the surface of mast characterized as allergens. The most important allergens in cells and basophiles, thereby enabling these cells to become terms of prevalence of reactivity are the group 1, 2, 3, and 9 activated by allergen. After activation, mast cells and baso- allergens, to which Ͼ90% of mite allergic patients have IgE (8). by guest on September 26, 2021 philes release mediators, such as histamine, leukotrienes, en- Group 1 and group 2, however, account for most of the IgE on zymes, etc., that are the direct causes of the allergic symptoms. a quantitative basis. Whereas the biological function of the The binding of allergen molecules to receptor-bound IgE and group 2 mite allergen has not yet been identified, the other the cross-linking of these on the surface of mast cells and ba- mentioned allergens are proteases. Groups 3 and 9 are serine sophiles is therefore the key event in the triggering of a cascade proteases, and group 1 is a cysteine protease located in the of events leading directly to allergic symptoms. A thorough alimentary canal of the mite (5). understanding of the molecular events leading to activation of Derp1isamajor allergen from D. pteronyssinus (9). In one mast cells and basophiles is thus facilitated by the elucidation of study, the prevalence of IgE to Der p 1 was 97% in a population the three-dimensional structure of the allergen molecule. Fur- of 35 house dust mite allergic individuals, as measured by radioal- thermore, allergen structures facilitate the rational design of lergosorbent tests using purified nDer p 1 (8). Derp1isa25-kDa allergen variants with reduced IgE binding, which has possible cysteine protease that is present in mite feces in high concentra- uses in specific allergy vaccination (3). tions. The proteolytic activity of Der p 1 has been proposed to Several species of house dust mites have been identified con- enhance the capacity of the molecule to sensitize human beings tributing to the environmental exposure of human beings (4). The (10). The gene encoding Der p 1 has been cloned and sequenced most prevalent species belong to the genus Dermatophagoides (11) and shown to display isoallergenic variation (12). The open reading frame encodes an 18-aa signal peptide, an 80-aa pro-pep- tide, and the mature region that comprises an additional 222 aa. *ALK-Abello´A/S, Research Department, Hørsholm, Denmark; and †Department of The sequence includes four potential N-linked glycosylation sites, Medicinal Chemistry, Danish University of Pharmaceutical Sciences, Copenhagen, three in the mature sequence and one in the pro-peptide. Der p 1 Denmark is produced in the mite as an enzymatically inactive pro-enzyme Received for publication March 16, 2005. Accepted for publication June 27, 2005. that becomes enzymatically active after cleavage and detachment The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance of the pro-peptide. Apart from inhibiting the activity of the pro- with 18 U.S.C. Section 1734 solely to indicate this fact. enzyme, the pro-peptide may also act as a folding scaffold for 1 The coordinates and structure factors of rproDer p 1-CN have been deposited with mature Der p 1, as suggested for other proteases (13, 14). When the Protein Data Bank coordinate file 1XKG and related structure factor file Derp1isextracted from mite feces, it is present in the mature R1XKGSF. form (nDer p 1). Recombinant Der p 1 has been produced in Esch- 2 Address correspondence and reprint requests to Dr. Kåre Meno, ALK-Abello´A/S, Research Department, Bøge Alle´ 6–8, DK-2970 Hørsholm, Denmark. E-mail ad- erichia coli, but the resulting protein had much reduced IgE bind- dress: [email protected] ing indicating improper folding (15). In Pichia pastoris, rproDer p Copyright © 2005 by The American Association of Immunologists, Inc. 0022-1767/05/$02.00 3836 CRYSTAL STRUCTURE OF proDer p 1 Table I. Primer sequences Primer No. Primer Sequence 5Ј-3Ј Primer 1, forward GTCGCTCGAGAAAAGAAGACCATCTTCTATTAAGACTTTCGAAGAATAC Primer 2, reverse GCCTCTAGATCAGTGATGGTGGTGATGGTGACCAGTTTGACCCAAAATGACAACGTATGGATATTCTTC Primer 3, reverse GTTCAGCAAGATCCAATGATTGGTCACGGTAAGCCAAATAAGC Primer 4, forward GCTTATTTGGCTTACCGTGACCAATCATTGGATCTTGCTGAAC Primer 5, reverse ACCAGAGAAAGCCCAAGCTGAACCACAGCC Primer 6, forward GGCTGTGGTTCAGCTTGGGCTTTCTCTGGT Primer 7, reverse GTTCAGCAAGATCCAATGATTGTTCACGGTAAGCCAAATAAGC Primer 8, forward GCTTATTTGGCTTACCGTGAACAATCATTGGATCTTGCTGAAC 1 can be produced as a hyperglycosylated pro-enzyme with re- Construction of site-specific mutations C114A and N132D was done by the duced enzymatic activity and IgE binding (16). After in vitro mat- overlap extension method (21). Briefly, primer 1 (Table I) was used together uration, however, enzymatic activity and IgE binding can be re- with primer 5 in one PCR, primer 3 was used together with primer 6 in another PCR, and primer 2 was used together with primer 4 in a third PCR, all with stored independently of glycosylation (17). proderp1 as a template. The full fragment containing the mutations was then The cysteine proteases are divided into five clans, each containing created by using the three resulting PCR products together with primers 1 and a number of families. Der p 1 belongs to clan CA, family C1, which 2 in a final PCR, followed by directional cloning of the 957-bp XhoI-XbaI Downloaded from also includes papain and its
Recommended publications
  • Helical Domain That Prevents Access to the Substrate-Binding Cleft
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE Researchprovided Article by Elsevier1193 - Publisher Connector The prosequence of procaricain forms an a-helical domain that prevents access to the substrate-binding cleft Matthew R Groves, Mark AJ Taylor, Mandy Scott, Nicola J Cummings Richard W Pickersgill* and John A Jenkins* Background: Cysteine proteases are involved in a variety of cellular processes Address: Department of Food Macromolecular including cartilage degradation in arthritis, the progression of Alzheimer’s Science, Institute of Food Research, Earley Gate, disease and cancer invasion: these enzymes are therefore of immense biological Whiteknights Road, Reading, RG6 6BZ, UK. importance. Caricain is the most basic of the cysteine proteases found in the *Corresponding authors. latex of Carica papaya. It is a member of the papain superfamily and is E-mail: [email protected] homologous to other plant and animal cysteine proteases. Caricain is naturally [email protected] expressed as an inactive zymogen called procaricain. The inactive form of the Key words: caricain, cysteine protease, density protease contains an inhibitory proregion which consists of an additional 106 modification, X-ray structure, zymogen N-terminal amino acids; the proregion is removed upon activation. Received: 25 June 1996 Results: The crystal structure of procaricain has been refined to 3.2 Å Revisions requested: 23 July 1996 Revisions received: 12 August 1996 resolution; the final model consists of three non-crystallographically related Accepted: 28 August 1996 molecules. The proregion of caricain forms a separate globular domain which binds to the C-terminal domain of mature caricain.
    [Show full text]
  • A Rationale for Targeting Sentinel Innate Immune Signaling of Group 1 House Dust Mite Allergens Th
    Molecular Pharmacology Fast Forward. Published on July 5, 2018 as DOI: 10.1124/mol.118.112730 This article has not been copyedited and formatted. The final version may differ from this version. MOL #112730 1 Title Page MiniReview for Molecular Pharmacology Allergen Delivery Inhibitors: A Rationale for Targeting Sentinel Innate Immune Signaling of Group 1 House Dust Mite Allergens Through Structure-Based Protease Inhibitor Design Downloaded from molpharm.aspetjournals.org Jihui Zhang, Jie Chen, Gary K Newton, Trevor R Perrior, Clive Robinson at ASPET Journals on September 26, 2021 Institute for Infection and Immunity, St George’s, University of London, Cranmer Terrace, London SW17 0RE, United Kingdom (JZ, JC, CR) State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing, P.R. China (JZ) Domainex Ltd, Chesterford Research Park, Little Chesterford, Saffron Walden, CB10 1XL, United Kingdom (GKN, TRP) Molecular Pharmacology Fast Forward. Published on July 5, 2018 as DOI: 10.1124/mol.118.112730 This article has not been copyedited and formatted. The final version may differ from this version. MOL #112730 2 Running Title Page Running Title: Allergen Delivery Inhibitors Correspondence: Professor Clive Robinson, Institute for Infection and Immunity, St George’s, University of London, SW17 0RE, UK [email protected] Downloaded from Number of pages: 68 (including references, tables and figures)(word count = 19,752) 26 (main text)(word count = 10,945) Number of Tables: 3 molpharm.aspetjournals.org
    [Show full text]
  • Serine Proteases from Nematode and Protozoan Parasites
    Proc. Natl. Acad. Sci. USA Vol. 86, pp. 4863-4867, July 1989 Biochemistry Serine proteases from nematode and protozoan parasites: Isolation of sequence homologs using generic molecular probes (molecular evolution/trypsin/cysteine/active sites/polymerase chain reaction) JUDY A. SAKANARI*t, CATHERINE E. STAUNTON*t, ANN E. EAKIN§, CHARLES S. CRAIK§, AND JAMES H. MCKERROW* *Department of Pathology and §Department of Pharmaceutical Chemistry, University of California, San Francisco, CA 94143; and tCornell University Medical College, New York, NY 10021 Communicated by Russell F. Doolittle, March 27, 1989 ABSTRACT Serine proteases are one of the biologically represent some of the world's greatest health problems (16- most important and widely distributed families of enzymes. 18). Parasite proteases may facilitate invasion of host tissue, Isolation of serine protease genes from organisms of widely metabolism of host proteins, and evasion of the host immune diverged phylogenetic groups would provide a basis for study- response. A generic molecular technology for isolation of ing their biological function, the relationship between structure serine protease genes from diverse sources would be of and function, and the molecular evolution of these enzymes. immense value in expanding the data base for serine proteases Serine proteases for which little structural information is and to further our understanding of the function of these known are those that are important in the pathogenesis of enzymes in a variety of organisms. parasitic nematode and protozoan diseases. Identification and In the first step of developing such a generic molecular isolation of protease genes from these organisms is a critical strategy, we report the isolation offour serine protease genes first step in understanding their function for the parasite and from a parasitic nematode using degenerate oligonucleotide possibly suggesting innovative approaches to arresting para- primers and genomic DNA.
    [Show full text]
  • High Molecular Weight Kininogen Is an Inhibitor of Platelet Calpain
    High molecular weight kininogen is an inhibitor of platelet calpain. A H Schmaier, … , D Schutsky, R W Colman J Clin Invest. 1986;77(5):1565-1573. https://doi.org/10.1172/JCI112472. Research Article Recent studies from our laboratory indicate that a high concentration of platelet-derived calcium-activated cysteine protease (calpain) can cleave high molecular weight kininogen (HMWK). On immunodiffusion and immunoblot, antiserum directed to the heavy chain of HMWK showed immunochemical identity with alpha-cysteine protease inhibitor--a major plasma inhibitor of tissue calpains. Studies were then initiated to determine whether purified or plasma HMWK was also an inhibitor of platelet calpain. Purified alpha-cysteine protease inhibitor, alpha-2-macroglobulin, as well as purified heavy chain of HMWK or HMWK itself inhibited purified platelet calpain. Kinetic analysis revealed that HMWK inhibited platelet calpain noncompetitively (Ki approximately equal to 5 nM). Incubation of platelet calpain with HMWK, alpha-2- macroglobulin, purified heavy chain of HMWK, or purified alpha-cysteine protease inhibitor under similar conditions resulted in an IC50 of 36, 500, 700, and 1,700 nM, respectively. The contribution of these proteins in plasma towards the inhibition of platelet calpain was investigated next. Normal plasma contained a protein that conferred a five to sixfold greater IC50 of purified platelet calpain than plasma deficient in either HMWK or total kininogen. Reconstitution of total kininogen deficient plasma with purified HMWK to normal levels (0.67 microM) completely corrected the subnormal inhibitory activity. However, reconstitution of HMWK deficient plasma to normal levels of low molecular weight kininogen (2.4 microM) did not fully correct the subnormal calpain inhibitory capacity […] Find the latest version: https://jci.me/112472/pdf High Molecular Weight Kininogen Is an Inhibitor of Platelet Calpain Alvin H.
    [Show full text]
  • VEGF-A Induces Angiogenesis by Perturbing the Cathepsin-Cysteine
    Published OnlineFirst May 12, 2009; DOI: 10.1158/0008-5472.CAN-08-4539 Published Online First on May 12, 2009 as 10.1158/0008-5472.CAN-08-4539 Research Article VEGF-A Induces Angiogenesis by Perturbing the Cathepsin-Cysteine Protease Inhibitor Balance in Venules, Causing Basement Membrane Degradation and Mother Vessel Formation Sung-Hee Chang,1 Keizo Kanasaki,2 Vasilena Gocheva,4 Galia Blum,5 Jay Harper,3 Marsha A. Moses,3 Shou-Ching Shih,1 Janice A. Nagy,1 Johanna Joyce,4 Matthew Bogyo,5 Raghu Kalluri,2 and Harold F. Dvorak1 Departments of 1Pathology and 2Medicine, and the Center for Vascular Biology Research, Beth Israel Deaconess Medical Center and Harvard Medical School, and 3Departments of Surgery, Children’s Hospital and Harvard Medical School, Boston, Massachusetts; 4Cancer Biology and Genetics Program, Memorial Sloan-Kettering Cancer Center, New York, New York; and 5Department of Pathology, Stanford University, Stanford, California Abstract to form in many transplantable mouse tumor models are mother Tumors initiate angiogenesis primarily by secreting vascular vessels (MV), a blood vessel type that is also common in many endothelial growth factor (VEGF-A164). The first new vessels autochthonous human tumors (2, 3, 6–8). MV are greatly enlarged, to form are greatly enlarged, pericyte-poor sinusoids, called thin-walled, hyperpermeable, pericyte-depleted sinusoids that form mother vessels (MV), that originate from preexisting venules. from preexisting venules. The dramatic enlargement of venules We postulated that the venular enlargement necessary to form leading to MV formation would seem to require proteolytic MV would require a selective degradation of their basement degradation of their basement membranes.
    [Show full text]
  • Chapter 11 Cysteine Proteases
    CHAPTER 11 CYSTEINE PROTEASES ZBIGNIEW GRZONKA, FRANCISZEK KASPRZYKOWSKI AND WIESŁAW WICZK∗ Faculty of Chemistry, University of Gdansk,´ Poland ∗[email protected] 1. INTRODUCTION Cysteine proteases (CPs) are present in all living organisms. More than twenty families of cysteine proteases have been described (Barrett, 1994) many of which (e.g. papain, bromelain, ficain , animal cathepsins) are of industrial impor- tance. Recently, cysteine proteases, in particular lysosomal cathepsins, have attracted the interest of the pharmaceutical industry (Leung-Toung et al., 2002). Cathepsins are promising drug targets for many diseases such as osteoporosis, rheumatoid arthritis, arteriosclerosis, cancer, and inflammatory and autoimmune diseases. Caspases, another group of CPs, are important elements of the apoptotic machinery that regulates programmed cell death (Denault and Salvesen, 2002). Comprehensive information on CPs can be found in many excellent books and reviews (Barrett et al., 1998; Bordusa, 2002; Drauz and Waldmann, 2002; Lecaille et al., 2002; McGrath, 1999; Otto and Schirmeister, 1997). 2. STRUCTURE AND FUNCTION 2.1. Classification and Evolution Cysteine proteases (EC.3.4.22) are proteins of molecular mass about 21-30 kDa. They catalyse the hydrolysis of peptide, amide, ester, thiol ester and thiono ester bonds. The CP family can be subdivided into exopeptidases (e.g. cathepsin X, carboxypeptidase B) and endopeptidases (papain, bromelain, ficain, cathepsins). Exopeptidases cleave the peptide bond proximal to the amino or carboxy termini of the substrate, whereas endopeptidases cleave peptide bonds distant from the N- or C-termini. Cysteine proteases are divided into five clans: CA (papain-like enzymes), 181 J. Polaina and A.P. MacCabe (eds.), Industrial Enzymes, 181–195.
    [Show full text]
  • ^ P X R, for the PURPOSES of INFORMATION ONLY
    WORLD INTELLECTUAL PROPERTY ORGANIZATION PCT International Bureau INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (51) International Patent Classification 6 : (11) International Publication Number: WO 98/49190 C07K 5/06, 5/08, 5/10 A l (43) International Publication Date: 5 November 1998 (05.11.98) (21) International Application Number: PCT/US98/08259 (74) Agents: BURKE, John, E. et al.; Cushman Darby & Cushman, Intellectual Property Group of Pillsbury Madison & Sutro, (22) International Filing Date: 24 April 1998 (24.04.98) 1100 New York Avenue, N.W., Washington, DC 20005 (US). (30) Priority Data: 60/044,819 25 April 1997 (25.04.97) US (81) Designated States: AL, AM, AT, AU, AZ, BA, BB, BG, BR, Not furnished 23 April 1998 (23.04.98) US BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GE, GH, GM, GW, HU, ID, IL, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, (71) Applicant (for all designated States except US): CORTECH, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, INC. [US/US]; 6850 North Broadway, Denver, CO 80221 TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZW, ARIPO (US). patent (GH, GM, KE, LS, MW, SD, SZ, UG, ZW), Eurasian patent (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), European (72) Inventors; and patent (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, (75) Inventors/Applicants(for US only): SPRUCE, Lyle, W. IE, IT, LU, MC, NL, PT, SE), OAPI patent (BF, BJ, CF, [US/US]; 948 Camino Del Sol, Chula Vista, CA 91910 CG, Cl, CM, GA, GN, ML, MR, NE, SN, TD, TG).
    [Show full text]
  • The Role of Cysteine Cathepsins in Cancer Progression and Drug Resistance
    International Journal of Molecular Sciences Review The Role of Cysteine Cathepsins in Cancer Progression and Drug Resistance Magdalena Rudzi ´nska 1, Alessandro Parodi 1, Surinder M. Soond 1, Andrey Z. Vinarov 2, Dmitry O. Korolev 2, Andrey O. Morozov 2, Cenk Daglioglu 3 , Yusuf Tutar 4 and Andrey A. Zamyatnin Jr. 1,5,* 1 Institute of Molecular Medicine, Sechenov First Moscow State Medical University, 119991 Moscow, Russia 2 Institute for Urology and Reproductive Health, Sechenov University, 119992 Moscow, Russia 3 Izmir Institute of Technology, Faculty of Science, Department of Molecular Biology and Genetics, 35430 Urla/Izmir, Turkey 4 Faculty of Pharmacy, University of Health Sciences, 34668 Istanbul, Turkey 5 Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, 119991 Moscow, Russia * Correspondence: [email protected]; Tel.: +7-4956229843 Received: 26 June 2019; Accepted: 19 July 2019; Published: 23 July 2019 Abstract: Cysteine cathepsins are lysosomal enzymes belonging to the papain family. Their expression is misregulated in a wide variety of tumors, and ample data prove their involvement in cancer progression, angiogenesis, metastasis, and in the occurrence of drug resistance. However, while their overexpression is usually associated with highly aggressive tumor phenotypes, their mechanistic role in cancer progression is still to be determined to develop new therapeutic strategies. In this review, we highlight the literature related to the role of the cysteine cathepsins in cancer biology, with particular emphasis on their input into tumor biology. Keywords: cysteine cathepsins; cancer progression; drug resistance 1. Introduction Cathepsins are lysosomal proteases and, according to their active site, they can be classified into cysteine, aspartate, and serine cathepsins [1].
    [Show full text]
  • Proteolytic Cleavage—Mechanisms, Function
    Review Cite This: Chem. Rev. 2018, 118, 1137−1168 pubs.acs.org/CR Proteolytic CleavageMechanisms, Function, and “Omic” Approaches for a Near-Ubiquitous Posttranslational Modification Theo Klein,†,⊥ Ulrich Eckhard,†,§ Antoine Dufour,†,¶ Nestor Solis,† and Christopher M. Overall*,†,‡ † ‡ Life Sciences Institute, Department of Oral Biological and Medical Sciences, and Department of Biochemistry and Molecular Biology, University of British Columbia, Vancouver, British Columbia V6T 1Z4, Canada ABSTRACT: Proteases enzymatically hydrolyze peptide bonds in substrate proteins, resulting in a widespread, irreversible posttranslational modification of the protein’s structure and biological function. Often regarded as a mere degradative mechanism in destruction of proteins or turnover in maintaining physiological homeostasis, recent research in the field of degradomics has led to the recognition of two main yet unexpected concepts. First, that targeted, limited proteolytic cleavage events by a wide repertoire of proteases are pivotal regulators of most, if not all, physiological and pathological processes. Second, an unexpected in vivo abundance of stable cleaved proteins revealed pervasive, functionally relevant protein processing in normal and diseased tissuefrom 40 to 70% of proteins also occur in vivo as distinct stable proteoforms with undocumented N- or C- termini, meaning these proteoforms are stable functional cleavage products, most with unknown functional implications. In this Review, we discuss the structural biology aspects and mechanisms
    [Show full text]
  • Virtual Screening of Anti-HIV1 Compounds Against SARS-Cov-2
    www.nature.com/scientificreports OPEN Virtual screening of anti‑HIV1 compounds against SARS‑CoV‑2: machine learning modeling, chemoinformatics and molecular dynamics simulation based analysis Mahesha Nand1,6, Priyanka Maiti 2,6*, Tushar Joshi3, Subhash Chandra4*, Veena Pande3, Jagdish Chandra Kuniyal2 & Muthannan Andavar Ramakrishnan5* COVID‑19 caused by the SARS‑CoV‑2 is a current global challenge and urgent discovery of potential drugs to combat this pandemic is a need of the hour. 3‑chymotrypsin‑like cysteine protease (3CLpro) enzyme is the vital molecular target against the SARS‑CoV‑2. Therefore, in the present study, 1528 anti‑HIV1compounds were screened by sequence alignment between 3CLpro of SARS‑CoV‑2 and avian infectious bronchitis virus (avian coronavirus) followed by machine learning predictive model, drug‑likeness screening and molecular docking, which resulted in 41 screened compounds. These 41 compounds were re‑screened by deep learning model constructed considering the IC50 values of known inhibitors which resulted in 22 hit compounds. Further, screening was done by structural activity relationship mapping which resulted in two structural clefts. Thereafter, functional group analysis was also done, where cluster 2 showed the presence of several essential functional groups having pharmacological importance. In the fnal stage, Cluster 2 compounds were re‑docked with four diferent PDB structures of 3CLpro, and their depth interaction profle was analyzed followed by molecular dynamics simulation at 100 ns. Conclusively, 2 out of 1528 compounds were screened as potential hits against 3CLpro which could be further treated as an excellent drug against SARS‑CoV‑2. Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) is the causative agent of the COVID-19.
    [Show full text]
  • Activity-Based Profiling of Proteases
    BI83CH11-Bogyo ARI 3 May 2014 11:12 Activity-Based Profiling of Proteases Laura E. Sanman1 and Matthew Bogyo1,2,3 Departments of 1Chemical and Systems Biology, 2Microbiology and Immunology, and 3Pathology, Stanford University School of Medicine, Stanford, California 94305-5324; email: [email protected] Annu. Rev. Biochem. 2014. 83:249–73 Keywords The Annual Review of Biochemistry is online at biochem.annualreviews.org activity-based probes, proteomics, mass spectrometry, affinity handle, fluorescent imaging This article’s doi: 10.1146/annurev-biochem-060713-035352 Abstract Copyright c 2014 by Annual Reviews. All rights reserved Proteolytic enzymes are key signaling molecules in both normal physi- Annu. Rev. Biochem. 2014.83:249-273. Downloaded from www.annualreviews.org ological processes and various diseases. After synthesis, protease activity is tightly controlled. Consequently, levels of protease messenger RNA by Stanford University - Main Campus Lane Medical Library on 08/28/14. For personal use only. and protein often are not good indicators of total protease activity. To more accurately assign function to new proteases, investigators require methods that can be used to detect and quantify proteolysis. In this review, we describe basic principles, recent advances, and applications of biochemical methods to track protease activity, with an emphasis on the use of activity-based probes (ABPs) to detect protease activity. We describe ABP design principles and use case studies to illustrate the ap- plication of ABPs to protease enzymology, discovery and development of protease-targeted drugs, and detection and validation of proteases as biomarkers. 249 BI83CH11-Bogyo ARI 3 May 2014 11:12 gens that contain inhibitory prodomains that Contents must be removed for the protease to become active.
    [Show full text]
  • Biochemical Investigation of the Ubiquitin Carboxyl-Terminal Hydrolase Family" (2015)
    Purdue University Purdue e-Pubs Open Access Dissertations Theses and Dissertations Spring 2015 Biochemical investigation of the ubiquitin carboxyl- terminal hydrolase family Joseph Rashon Chaney Purdue University Follow this and additional works at: https://docs.lib.purdue.edu/open_access_dissertations Part of the Biochemistry Commons, Biophysics Commons, and the Molecular Biology Commons Recommended Citation Chaney, Joseph Rashon, "Biochemical investigation of the ubiquitin carboxyl-terminal hydrolase family" (2015). Open Access Dissertations. 430. https://docs.lib.purdue.edu/open_access_dissertations/430 This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. *UDGXDWH6FKRRO)RUP 8SGDWHG PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance 7KLVLVWRFHUWLI\WKDWWKHWKHVLVGLVVHUWDWLRQSUHSDUHG %\ Joseph Rashon Chaney (QWLWOHG BIOCHEMICAL INVESTIGATION OF THE UBIQUITIN CARBOXYL-TERMINAL HYDROLASE FAMILY Doctor of Philosophy )RUWKHGHJUHHRI ,VDSSURYHGE\WKHILQDOH[DPLQLQJFRPPLWWHH Chittaranjan Das Angeline Lyon Christine A. Hrycyna George M. Bodner To the best of my knowledge and as understood by the student in the Thesis/Dissertation Agreement, Publication Delay, and Certification/Disclaimer (Graduate School Form 32), this thesis/dissertation adheres to the provisions of Purdue University’s “Policy on Integrity in Research” and the use of copyrighted material. Chittaranjan Das $SSURYHGE\0DMRU3URIHVVRU V BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB $SSURYHGE\R. E. Wild 04/24/2015 +HDGRIWKH'HSDUWPHQW*UDGXDWH3URJUDP 'DWH BIOCHEMICAL INVESTIGATION OF THE UBIQUITIN CARBOXYL-TERMINAL HYDROLASE FAMILY Dissertation Submitted to the Faculty of Purdue University by Joseph Rashon Chaney In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy May 2015 Purdue University West Lafayette, Indiana ii All of this I dedicate wife, Millicent, to my faithful and beautiful children, Josh and Caleb.
    [Show full text]