Intestinal Complement Modulates Colitis by Targeting the Gut Microbiota

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:39945359

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA

A dissertation presented

Wen Zheng

The Division of Medical Sciences

in partial fulfillment of the requirements

for the degree of

Doctor of Philosophy

in the subject of

Biological and Biomedical Sciences

Harvard University

Cambridge, Massachusetts

December 2017

Dissertation Advisor: Prof. Dennis Kasper Wen Zheng

Abstract

The proteins that make up the immune effector system known as complement are synthesized by hepatocytes and are present at high levels in the bloodstream. Serum complement not only displays antimicrobial activities such as bacteriolysis and opsonization, but is also involved in boosting adaptive immune responses to foreign antigens. However, little is known about the presence or activity of complement on mucosal surfaces, including the gastrointestinal mucosa.

The studies described here provide new insights into complement function within the mouse intestinal mucosa. Specifically, we show that the level of complement component C3 in intestinal ontents c is dependent upon the presence of the gut commensal microbiota. -‐ Germ free animals are deficient in intestinal complement compared to conventionally raised animals. C3 is synthesized and secreted by epithelial cell lines when stimulated by bacteria. In situ hybridization detects C3 mRNA in intestinal cells, and C3 protein can be found in the intestinal lumen, where it coats bacterial cells. -‐ Using fluorescence activated cell sorting

(FACS) and next-‐generation sequencing (a method -‐ we call C3 SEQ), we howed s that many, but not all, bacterial types in the colon are coated with C3 under normal homeostatic conditions. We collected -‐ C3 coated and non-‐coated bacterial cells by

FACS, implanted the bacteria -‐ into germ free mice, and challenged the animals with dextran sodium sulfate. Compared to mice challenged with non-‐coated bacteria, the mice harboring -‐ C3 coated bacteria developed more severe colitis, with significant

iii weight loss and histologic damage. In addition, C3 was found to be important in the control of the -‐ non invasive enteric pathogen Citrobacter rodentium, opsonizing this organism within the intestine. Overall, our studies show that the complement system is active in intestinal ons, mucosal secreti where it modulates the gut microbiota and plays a critical role in maintaining intestinal homeostasis and health.

Table of Contents

Acknowledgements ...... vi List of Abbreviations ...... Error! Bookmark not defined. Chapter I. Introduction: Complement as a component of the innate immune system ...... 1 1.1 Complement pathways ...... 2 1.2 The commensal microbiome the and mucosal immune system ...... 12 1.3 Mucosal IgA in mucosal defense ...... 15 1.4 Antibodies and complement in host defense of mucosal surfaces...... 16 1.5 Overview of my research. thesis ...... 18 Chapter II. The intestinal microbiota and its role in induction of local complement production and biological activity...... 20 2.1 C3 levels in fecal contents are elevated by the presence of an intestinal microbiota . 20 2.2 Localization of C3 production in the mucosa and its up-‐regulation by the presence of the intestinal microbiota ...... 26 2.3 Complement C3 regulates local responses inflammatory in mice carrying an intact intestinal microbiota ...... 31 Chapter III. Commensal bacteria and -‐ a known non invasive enteric pathogen are coated with C3 ...... 37 3.1 Detection of C3 on the surface of intestinal bacteria by FACS analysis...... 37 3.2 C3 protects e mic from non-‐invasive, enteric mouse pathogen Citrobacter rodentium41 3.3 The role of antibody in the coating of intestinal bacteria with C3 ...... 44 Chapter IV. Identification of enteric bacterial species that are targeted by C3 and whose abundance is altered -‐ in C3 /-‐ mice ...... 47 4.1 Characterization of the gut microbiota of C3-‐/-‐ mice ...... 47 4.2 16S rRNA sequencing of GF mice -‐ cohoused with C3 /-‐ mice confirms that an altered microbiota contributes to DSS disease susceptibility...... 48 4.3 -‐ C3 SEQ: A new method for identifying C3-‐opsonized bacteria in complex ties communi of microbes ...... 51 Chapter V. Discussion ...... 55 Chapter VI. Conclusions and Future Studies ...... 64 References ...... 77

v Acknowledgements

The last ix s and half years have been a special journey in my life. Without my mentor, family, and friends, I could not possibly have gotten here by myself. My mentor Dr. Dennis er Kasp has been so supportive of my research and has continuously inspired me with his scientific advice and ideas. His optimism and -‐ laid back personality have been a stress releaser for . me All of the Kasper lab members have been wonderful mentors and friends at the same time. Dr. Meng Wu and Dr.

Xinyang Song have also been actively participating in my project. They have been so generous with their time and in discussing scientific ideas. I deeply appreciate their skills in the art of data presentation and all their other fantastic suggestions. Dr.

Francesca Gazzaniga and Dr. Lesley Pasman have been tremendous in providing me with lots of technical suggestions and critical discussion. As a botany enthusiast,

Lesley shares my passion for gardening, house—plants and succulents in particular.

We also volunteered in the Harvard Library community garden in the summer of

2016, which was a fun experience. Caring for plants has been a great way for me to relieve the pressures of life in the lab. Speaking of pressure release, I would like to thank everyone in the BBS program, my fellow students, instructors, and Kate

Hodgins and Danny Gonzalez for their advice, patience, and guidance. Special thanks also to my first scientific mentors Professors Ying Huang and Eric Rubin for their early scientific inspiration and training.

vi Having a life beyond the lab is so critical to my happiness so it should be no surprise that having John, my husband, and Meilee, my daughter, to come home at the end of the day has reat. been more than g Their love is pure energy! Not only has John been not only devoted to our ; family he has also always been engaged with my science. I have enjoyed our scientific discussions whenever we could squeeze them in between the challenges of family life and two research careers. I can't say enough about my dear child Mei Mei. She is such a joyful kid and her energetic and cheerful nature helped power me through the tough graduate school experience.

I'm also grateful that my parents were very supportive of my life decisions and have been so devoted to our family and . me They have always been here to help us during is th challenging period in my life. I love all of them very much.

vii Table of Figures

Figure 1. The three complement activation pathways...... 4 Figure 2. Covalent attachment of C3 via its reactive thioester to a cell surface...... 5 Figure 3. Complement C3 is regulated by commensal microbiota ...... 22 Figure 4. Colonic C3 levels are modulated by antibiotics and cohousing...... 25 Figure 5. Complement C3 expression by the epithelium is induced by the commensal microbiota...... 28 Figure 6. Complement C3 is preferentially secreted to the apical side of polarized cell...... 30 Figure 7. Complement C3 regulates the intestinal inflammation...... 33 Figure 8. C3 not derived from bone marrow cells is critical for the protection of local inflammation in the DSS colitis model...... 35 Figure 9. The commensal microbiota is opsonized with C3 -‐ in steady state conditions and in colonic inflammation...... 40 Figure 11. IgG antibody is partially required for e C3 deposition onto th commensal microbiota...... 46 Figure 12. Microbiota composition measured by 16S rRNA -‐ sequencing and C3 SEQ analysis...... 50 Figure 13. C3 coats colitogenic bacteria in vivo...... 54 Figure 14. Schematic illustration of experiments that showed that complement C3 coated bacteria are colitogenic in vivo...... 63

viii List of Abbreviations

C3 Complement component 3

C3-‐SEQ A new n tech ique that combines -‐ antibody based

bacterial cell sorting of + C3 cells and sequencing of

16S rRNAs of the sorted bacteria

CR1 Complement receptor 1

CR2 Complement receptor 2

CR3 Complement receptor 3

CR4 Complement receptor 4

CRIg Complement receptor uperfamily Ig s

CVF Cobra venom factor

DAF Decay-‐accelerating factor

DSS Dextran sodium sulfate

ELISA Enzyme-‐linked immunosorbent assay

FcRn Neonatal Fc receptor

GWAS Genome-‐wide association study

HSC Hematopoietic stem cell

IBD Inflammatory bowel disease

IFN-‐γ Interferon gamma

I/R injury Ischemia/reperfusion injury

LEfSe Linear discriminant analysis effect size

MAC Membrane attack complex

iv MAMP Microbe-‐associated molecular pattern

MASP-‐2 Mannan-‐binding lectin serine protease 2

MBL Mannose-‐binding lectin

MyD88 Myeloid differentiation primary response protein 88

OCT Optimal cutting temperature compound

PAMP Pathogen-‐associated molecular pattern

PCoA Principal coordinate analysis

PMN Polymorphonuclear leukocytes

RegIIIα Regenerating islet–derived protein 3 alpha

RegIIIγ Regenerating islet–derived protein 3 gamma

SFB Segmented filamentous bacteria

SLE Systemic lupus erythematosus

SPF Specific pathogen free

Th1 T helper cell type 1

Th2 T helper cell type2

Th17 T helper 17 cell

TNF-‐α Tumor necrosis factor

Treg Regulatory T cell

Chapter I. Introduction: Complement as a component of the innate immune system

Complement comprises a network of more than 50 plasma proteins and membrane receptors that function in a highly coordinated fashion as one of the first lines of defense against microbial pathogen invasion. The complement system links the innate and adaptive arms of the immune system through its modulation of inflammatory responses, leukocyte trafficking, and antigen collection, presentation and clearance (1). To avert microbial invasion and infection while simultaneously avoiding damaging inflammation; the host must carefully control the complement system especially when it is activated in the bloodstream. However, little is known about complement-‐dependent processes that occur on the apical side of epithelial barriers (e.g., in mucosal secretions of the respiratory, urinary, and gastrointestinal tracts) where some of the earliest encounters with invading pathogens are likely to take place.

Complement activation primarily occurs through three major pathways: the antibody-‐dependent classical pathway, -‐the lectin dependent pathway, and the alternative pathway (1, 2)(Figure 1). The classical way path was the first pathway studied and is activated by IgG or IgM antibodies in combination with their cognate antigens. The initiation protein C1q of the classical pathway can bind to the antigen-‐ antibody complex and triggers downstream component n. activatio The lectin pathway is activated after the recognition and binding of lectins to foreign carbohydrate structures typically displayed by pathogens (3). Three members of the

1 lectin pathway identified, mannose binding lectin (MBL), ficolin L, ficoln H (Fcn) as well as collectin-‐11 (CL-‐11) (4). MBL is -‐ a C type lectin and a member of the collectin family of proteins. Structurally MBL resembles the classical-‐pathway initiation protein C1q. However, the o six gl bular heads of MBL form carbohydrate recognition domains and -‐ bind N acetyl glucosamine and mannose, which are common decorations on polysaccharide components of microbes such as lipopolysaccharide and peptidoglycan (4, 5). Finally, the alternative pathway contrasts with both the classical and lectin pathways in that it is continuously turned on a low level because of spontaneous activation s and it promiscuous binding to a wide range of activator molecules (6).

1.1 Complement pathways

Although these three pathways require different initiation proteins, they all converge on the activation of the C3 component. Activated C3 generates other proteolytic cleavage products that act as opsonins, vascular permeability , mediators leukocyte chemoattractants, and regulators of other -‐ complement dependent processes such as attack of membrane attack through pore formation (1, 7, 8). The activation process involves cleavage of the C3 protein into the functional fragments C3a and C3b. C3a is a potent mediator of inflammation and C3b is an opsonin that covalently bonds with microbial surface components in iate the immed proximity to its site of generation (9).

C3b opsonization then promotes phagocytosis of bacterial cells coated with this complement component. Complement opsonization of bacteria is initiated by serine proteases including C1s in the classical pathway and MASP-‐2 in the lectin pathway which cleave C4 and C2 to generate the C4b2a complex on the bacterial surface (4,

2 10). This complex is a C3 convertase that cleaves C3 into the related C3a and C3b.

C3b spontaneously attaches covalently to the bacterial surface through a reactive thioester bond. This reactive thioester linkage is hidden within the C3 molecule but exposed upon its cleavage into C3b (Figure 2). The acyl group of the thioester moiety forms a covalent bond with hydroxyl or amino side chains of polysaccharides and proteins, which allows stable attachment of 3b C to the target ( surface 9, 11).

Classical pathway Lectin pathway Alternative pathway initiation

spontaneous

O O O O O O O O O O O O O O O O hydrolysis of C3

O O O O O O O O

C1q MBL Fcn CL-11 FP C3(H2O) C3

C1r and C1s MASPs FB and FD C3b FB and FD

C4 C2 Extrinsic

C4b2a proteases C3BbP C3(H2O)Bb (C3 convertase) C3 FP

C3bBb Alternative pathway C3a CR FB and FD ampliﬁcation C3b

RCA and FI CD35 and FI C4b2b3b C3bBb3b iC3b C3dg

C5 Extrinsic proteases Terminal pathway C5a

Association C6, C7, C8, C9 n Cleavage C5b MAC Transformation

Figure 1 . The three complement activation pathways.

Complement activation occurs through three distinct pathways: the classical, lectin and alternative pathways. The classical pathway involves antibody-‐mediated activation via the C1 complex composed of C1q, C1r and . C1s The lectin pathway is activated by lectins that recognize carbohydrate signature structures that are often found on microbial surfaces. The alternative pathway occurs by direct activation of C3 through direct surface binding or through interaction with the serum protein properdin, which stabilizes C3 convertases on cell surfaces. Figure and legend adapted from Ricklin et al., 2016 ( 12).

β C3 S S C O S α O H Cell R surface C3b β

α C3a S C O

β β C3b α Cell- α S C O H S C O + associated H2O C3b O R

Inactive β C3b α H S C O OH

Figure 2. Covalent attachment of C3 via its reactive thioester to a cell . surface

The C3 protein is composed of α and β chains, which fold together to bury a thioester bond. C3 convertases such b as C4 2a cleave C3 into C3a and C3b with consequent exposure of this highly reactive thioester bond. This thioester bond reacts with hydroxyl groups of polysaccharides near the site of C3 proteolytic . activation This activation typically occurs on microbial cell surfaces. Thus, a stable ester bond between C3b and these macromolecules is formed and covalently attaches C3b to the microbial cell. Reviewed in Noris and Remuzzi, 2013 (2).

Complement activation occurs in a sequential and highly coordinated manner and can be divided into four main steps: initiation of complement activation, C3 convertase activation and subsequent amplification by autocleavage, C5 convertase activation, and the assembly of the terminal complement complex-‐membrane attack complex (13). Complement activation products (effectors) have potent biological activities that affect the behavior of host cells such as monocytes and polymorphonuclear lymphocytes (PMNs) —e.g., attracting their migration and then directing phagocytosis of microbial cells or antigens that have C3b ligated to their surfaces.

Many receptors for complement effector molecules are displayed on host cells.

Five major membrane-‐bound effector receptors (CR1, CR2, CR3, CR4 ) and CRIg bind to C3b or C4b when deposited on the surface of the target cell or antigen and drive the component's effector function depending on the immune cell type that is engaged

(14). CR1 (CD35) is a multifunctional receptor that is expressed on the majority of peripheral blood cells but not on tissue macrophages and that binds with high affinity to C4b and C3b, as well as to iC3b, -‐ C3dg, C1q, and mannose binding protein. Binding of CR1 to the complement opsonin fragments serves to mediate both clearance of immune complexes and phagocytosis by neutro phils and monocytes (1).

CR2 (CD21) binds iC3b and C3dg and is the principal complement receptor that enhances humoral immunity. Uptake of -‐ C3d coated antigen by B cells results in enhanced signaling via the B cell antigen receptor, lowering the threshold for B cell activation and providing an important survival signal (15). CR3 and CR4 belong to the integrin family of receptors and recognize iC3b. They not only enhance

6 phagocytosis when bound to iC3b, but also play a role in leukocyte trafficking and migration (16). CRIg is the complement receptor of the immunoglobulin superfamily.

CRIg expression is restricted to a subset of tissue resident macrophages. These include Kupffer cells in the liver, interstitial macrophages in the heart, synovial lining macrophages in the joint, foam cells in atherosclerotic plaques and intestinal resident macrophages (16). Whereas iC3b is the primary ligand for the integrin receptors CR3

(CD11b/CD18) and CR4 (CD11c/CD18), both iC3b and C3dg also interact with CR2

(CD21), which is part of the -‐ B cell co receptor complex and reduces the threshold of B cell activation (14, 17). Additional receptors for C3b/iC3b (i.e., CR of the Ig superfamily, CRIg) and r fo C1q (e.g., gC1qR) also participate in the recognition and elimination of opsonized cells. Moreover, C3a and C5a are potent anaphylatoxins generated by complement activation and these can trigger -‐ pro inflammatory and immune-‐regulatory responses, including enhanced leukocyte chemotaxis, neutrophil– endothelial cell adhesion, vascular permeability, granule content secretion (i.e., degranulation), and cytokine/chemokine release (7).

Given the multiple pathways of activation and the autocatalytic nature of the many amplifying steps, regulation of the complement system is essential to prevent host injury. Regulatory factors exist in the serum as well as in a membrane bound form on cells. Regulators such as decay-‐accelerating factor (DAF), factor , H C1q inhibitor and CD59 can protect host cells from inadvertent autologous attack by complement. The observation that some of these regulators mplement of co also participate in adaptive immunity d le to the general idea proposed by Fearon and

Carter that the complement system links the innate and adaptive immune responses

7 (5, 18). From an evolutionary standpoint, adaptive immune responses have been largely developed largely to protect against microbial pathogens rather than against endogenous diseases such as cancer. Nonetheless, the products of an adaptive immune response (e.g., antigen-‐antibody immune complexes) can also drive complement-‐dependent pathology that may exceed the damage being done by invading microbes. Therefore, proper harnessing of complement components is critical in avoiding host damage.

Diseases caused by defective complement functions mirror the central surveillance roles of complement in the human body. Both defective complement proteins and regulatory alterations -‐can cause hyper susceptibility to pathogens, spontaneous host cell , damage and accumulation of immunological debris with pathological consequences. Complement deficiencies have been linked to both susceptibility to infections and autoimmune diseases in genome-‐wide association

(GWAS) studies. For example, patients with C3 and C4 mutations are associated with recurrent bacterial infections (19, 20). MBL lectin deficiency increases susceptibility to infections caused by encapsulated bacteria such as Streptococcus and Neisseria species, as ll we as to fungal infections (21). Deficiencies in complement components can also cause a variety of disease states that probably even lack a microbial component. Most homozygous deficiencies for genes encoding components of the early classical pathway, including C1q, C1r and C1s as well as C2, C3 and C4, are strongly associated with lopment the deve of the autoimmune disease systemic lupus erythematosus (SLE) (22). Lack of C1q or C4 can result in defective clearance of self-‐ antigens or apoptotic particles and accumulation of cellular debris. This exposure to

8 self-‐antigen can cause inappropriate activation of self-‐reactive B and T cells (14, 20).

Mutations in the complement-‐regulatory protein C1 can result -‐ in over activation of complement resulting in angioedema and hemoglobinuria. A mutation that causes hyperactivity of the C4 component of complement was correlated with mental illness and schizophrenia in patients analyzed in a GWAS study (23). Excessive postnatal neural synapse trimming has been also correlated with elevated deposition of complement C4 onto neurons during brain maturation. Together these and other observations suggest that complement is not only important in pathogen defense but also plays a role in control of immunological and cell biological responses that go beyond the control of ectious inf microbial agents.

Given the role of complement as an early line of defense against microbial invasion, it is not surprising the microbes have evolved a multitude of microbial mechanisms to avoid or escape the recognition by complement or even to hijack the complement pathway for their colonization. The sialic acid containing capsular polysaccharide on group B Streptococcus can inhibit the activation of the alternative pathway by increasing the binding affinity of human factor , H a protein that can block complement activation as well as inhibit the insertion of -‐ the complement membrane attack complex (MAC) into the bacterial membrane, -‐ and C3 based opsonization/phagocytosis (24). Compared with -‐ non K1 strains, Escherichia coli containing K1 antigen, a homopolymer of sialic acid, exhibit decreased alternative pathway-‐mediated opsonization and enhanced resistance to phagocytosis compared to non-‐K1 strains of E. coli (24). Removal of sialic acid from sheep erythrocytes also prevents binding of Factor H to C3b and allows ; activation of complement these

9 results suggest that sialic acid on the surface of microbes is likely to play a role as regulator of complement activation in addition to being an antigenic mimic of host self-‐antigens (24). Some bacteria exploit the complement system to enhance their survival in the . host For example, Porphyromonas gingivalis can co-‐activate the complement C5a receptor (C5aR) and Toll-‐like receptor (TLR2) in neutrophils, and the resulting crosstalk leads to the ubiquitylation and proteasomal degradation of

TLR2 adaptor myeloid differentiation primary response protein 88 (MyD88), thereby inhibiting a host-‐protective antimicrobial response (25).

Cleavage of C5 releases the chemokine C5a that, together with C3a, attracts immune cells to sites of activation via binding to the anaphylatoxin receptors C5aR

(CD88) and C3aR, respectively. Anaphylatoxin receptors such as C3aR and C5aR are both found on myeloid , cells including granulocytes, mast cells, dendritic cells, monocytes, and macrophages, and -‐ on non myeloid cells, including neurons and intestinal epithelial cells (26). In inflammation, the release of anaphylatoxin induces production of cytokines, degranulation and chemotaxis of leukocytes, and vascular permeability (27). Given the role of inflammatory cells have in trafficking to the sites of bacterial infection, it is not surprising that microbes and their products modulate the activity of complement components. However, the role of microbes in regulating the expression of complement components in mucosal tissues is poorly understood.

It is well known that complement proteins are produced by the liver and secreted into the stream blood . For example, C3 can reach a level of approximately 1 mg/ml in the serum (28). Although synthesis is principally constitutive, during infection the release of interleukin IL ( -‐6) induces production of acute-‐phase proteins

10 which include certain complement components such as C3 (5). Notably, complement

C3 and C4 are also expressed by macrophages (29, 30). ro P -‐inflammatory cytokines such as -‐ IL 6, tumor necrosis r facto -‐alpha (TNF-‐α) and interferon-‐gamma (IFN-‐γ) stimulate macrophages to up-‐regulate these complement components (31). It has been postulated that macrophages could provide a source of components for assembly of activated C3 and coating of foreign , antigens particularly in extravascular sites such as peripheral lymph nodes, , deep tissues and skin.

Some work has been done to address the importance of complement components made ells by c of hematopoietic . origin To determine the relative importance of C3 and C4 production -‐ by bone marrow-‐derived cells, Verschoor and colleagues analyzed bone marrow chimeras defective in various components of complement (32). In these chimeras, stromal and liver -‐ cells were C3 /-‐ (or -‐ C4 /-‐), but bone marrow-‐derived cells were complement sufficient (normal chimeras) or vice versa (reverse chimeras). Both sets of chimeras responded to immunogens, both inert and infectious, when challenged intravenously. Thus, despite the presence of only negligible amounts of or C3 ( C4) in circulation, bone marrow-‐sufficientt, liver and stroma-‐deficient chimeras responded to immunization with T cell-‐dependent antigens with a near-‐normal antibody response (30). These results suggest that local production of C4 or C3 by cells derived from the bone marrow is sufficient to enhance humoral immunity. The same oup gr of investigators showed that C3-‐/-‐ mice with reconstituted wild-‐type (WT) bone marrow cells had normal levels of complement in the circulation but had an impaired immune response to a herpes simplex al vir infection when challenged intradermally (33). These experiments demonstrate a role

11 for local C3 synthesis in modulating immune responses to infectious agents. Both experiments show the importance of locally produced complement, which is critical for both enhancing adaptive immunity and protecting the host from infection.

Although hepatocytes are considered the major source of complement components and myeloid cells a secondary rce, sou some reports raise the possibility that complement components can also be synthesized by other tissues including the intestine. For example, biopsy samples from patients with inflammatory bowel disease (IBD) were found to be positive for 3 complement C mRNA synthesis. Biopsy of colonic and jejunal mucosa from patients with Crohn’s disease display evidence of complement deposition (34). Epithelial cell lines T84, Caco-‐2, and HT-‐29 also produce

C3 (35). In addition to constitutive production, stimulation of Caco-‐2 with cytokines such as IL-‐1β, TNF-‐α, -‐ IL 6, and IFN-‐γ increases the production of complement proteins (31). These observations suggest that these common microbial factors that induce cytokines activating the innate immune response could also induce the expression of complement components in mucosal epithelium.

1.2 The commensal microbiome and the mucosal immune system

The mammalian intestine is the habitat of trillions of commensal microorganisms and is also the frontline ense for def against gastrointestinal pathogens. The intestinal mucosal surface constantly encounters many relatively harmless or even beneficial bacteria, yet it is capable of responding appropriately to potential pathogens by triggering potent host ses. immune respon It seems unlikely that mucosal surfaces can fully differentiate commensal organisms from pathogens on the basis of pure chemical signatures such as microbe-‐associated molecular

12 patterns (MAMPs) since both symbionts and pathobionts make these molecules.

Rather, it seems likely that the mucosa s respond to the presence of any bacterial load that is detected in a sensitive location such as the intestinal crypts or the cytosol of epithelial cells. MAMPs detected by the host ight in such compartments m then trigger innate immune responses that could control commensals and pathogens alike

(36–38). Expression of complement components in the mucosa could serve as one example of a baseline mucosal defense especially when activated by the alternative and lectin pathways of complement. This line of defense could also be further enhanced through adaptive immune responses (e.g., the antibody-‐dependent classical activation pathway).

The intestinal microbiome has been recognized as a modulator of both innate and adaptive immune responses and individual bacterial species have been identified as elicitors of these responses (39–41). For example, the species Candidatus savagella

(commonly known as segmented filamentous ia bacter or SFB) is a commensal bacterium that displays strong immunomodulatory effects in mice that are mediated through induction of Th17 cells in the lamina propria of small intestine (42). In some cases, the microbial molecules that are critical for modulating regulatory T cell (Treg) responses have been identified. For instance, PSA is a capsular polysaccharide that is produced by the commensal organism Bacteriodes fragilis; during inflammation, this zwitterionic molecule can induce colonic Tregs that can protect mice from T cell transfer colitis (43–45). Clostridium species isolated from both humans and mice have the capability to induce colonic Tregs (46, 47). In addition, anaerobic respiration by

Bacteroides, Clostridium and other groups of microorganisms reportedly produce

13 short chain fatty , acids especially butyrate and propionate, that can induce colonic regulatory T cell development (48–50). In some es, cas the molecular mechanisms by which bacteria induce these local T cell responses have been identified with reverse or forward genetics. For example, screening of a whole-‐genome ot sh gun library of

SFB identified a peptide as an antigen that stimulates specifically Th17 cells in the lamina propria of small e intestin (51). Perhaps not surprisingly, there is considerable microbial specificity in the modulation of immune responses in the intestine by the commensal microbiota. For example, the level of T cell subsets induced in mice colonized with a conventional specific pathogen free (SPF) microbiota is not e th same as that induced in mice colonized with a human or rat commensal microbiota (37).

These observations have prompted n a extensive study aimed at cataloging the mouse

T cell subsets that are induced locally in the intestine upon exposure to specific bacterial species isolated from a very broad spectrum of the human commensal microbiota (52).

Commensal bacteria not only stimulate T cell responses but also can induce systemic and local humoral immune responses. Circulating IgG, , IgA and IgM antibodies specific for the commensal microbiota are detected in SPF mice but not detected in erm the g -‐free (GF) mice. The icrobiota m -‐specific IgG protects mice from systemic bacterial infections by targeting the conserved antigens on pathogens (53).

Large quantities of immunoglobulin IgA, IgM, and IgG can be measured in the intestinal lumen of mammalian ; species It is well known that complement fixing opsonic IgG and IgM protect against invasive pathogens, and even for non-‐invasive

14 mucosal pathogens such as V. cholerae (57, 58). However, it is not known whether IgG and IgM mediat ed protection involves complement fixation in the mucosal secretions.

1.3 Mucosal IgA in mucosal defense

Mucosal surfaces have direct contact with the external environment and therefore with many potentially pathogenic microbes. Mucosal secretions such as breast milk and ocular fluids contain large quantities , of IgA (and some IgG) and these antibodies have generally been considered to play a role in protecting infants from infectious diseases early in life (54). However, whether ies antibod in the mucosal secretions work with any other immune innate effectors is unclear.

Human adults excrete >2 g of IgA per day; thus IgA is the second most abundant antibody (after IgG) in serum (55). Most of this IgA is found within the gastrointestinal tract in the form of secretory IgA dimerized by the immunoglobulin J chain. Secretory IgA is thought to function by neutralizing bacterial virulence factors, agglutinating bacterial cells, and activating the IgA-‐dependent bactericidal activity of lymphocytes (56). However, IgA does not "fix" (i.e., activate) complement and is incapable of killing bacteria by the classical pathway of complement activation (56).

Nonetheless, secretory IgA directed gainst a noninvasive and invasive mucosal pathogens Vibrio ( cholerae and Salmonella typhimurium, respectively) can protect the host from bacteria colonization . and disease Besides secretory IgA, serum IgG was shown to be protective in these infections mucosal pathogen as well (57, 58).

Palm and colleagues reported that some commensal bacteria in the intestines of mice are coated with IgA and further showed that the IgA-‐coated bacterial species had colitogenic potential in dextran sodium sulfate DSS ( ) colitis model (59). In this

15 study IgA selectively marked known -‐ disease driving members of the intestinal microbiota that could transmit sensitivity to DSS colitis. These results are somewhat difficult to interpret but suggest that commensal microorganisms that interact with the host intimately might drive adaptive immune responses to themselves and whether the IgA coating the commensal bacteria has directly protective role in homeostatic and inflammatory conditions remains unclear. In this , regard it is interesting that, in a gut model of ischemia/reperfusion (I/R) injury, complement and antibody were deposited on the damaged intestinal tissues and antibiotic treatment decreased the tissue deposition of both C3 and IgM (60). ese Th results suggest that the commensal microbiota might modulate or enhance -‐ C3 dependent activities that occur locally in the intestine during conditions of intense inflammation. However, whether the microbiota plays a role regulating -‐ complement in steady state conditions is unclear.

1.4 Antibodies and complement in st ho defense of mucosal surfaces.

It is important to note that IgA deficiency is generally asymptomatic in humans and this fact suggests that other lasses immunoglobulin c (e.g., IgM and IgG) can replace or compensate the mucosal functions of secretory IgA. Thus the functions of various immunoglobulins in the gastrointestinal tract remain , unclear and it is possible that complement-‐fixing antibodies such as IgG and IgM play an under-‐appreciated role in host defense on mucosal hether surfaces. W complement components also play a protective role in mucosal secretions and in the intestinal lumen under both homeostatic and disease conditions remains a poorly explored topic. Some observations might suggest that antibodies and complement can work

16 together in the lumen of the intestine to control pathogens. For , example during intestinal infection the gut's barrier function can be compromised and the paracellular tight junction between epithelial cells disrupted by even by non-‐invasive pathogens such as Citrobacter rodentium and Vibrio cholerae (61). Epithelial barrier dysfunction could, in theory, allow complement and antibody to passively enter the lumen and thereby play a role in pathogen defense. There is also evidence that the neonatal Fc receptor (FcRn) is the major transporter of IgG from the submucosa to the apical side of the intestines. Mice deficient in FcRn have much lower IgG levels in the intestinal lumen and have a compromised ability to combat infections as well (62).

Furthermore, enteric bacteria such as E. coli carry virulence plasmids (e.g., ColV) that encode serum/complement resistance (63). Because commensal E. coli seldom breaches the epithelial barrier, the presence of complement resistance genes within this enteric species suggests that complement may be a common innate immune defense factor present in gut mucosal secretions. Mutations that sensitize V. cholerae to complement killing also show profound intestinal colonization defects (63). The oral mucosal pathobiont, P. gingivalis has specific immune evasion strategies that involve the use of proteases to degrade C3 and , C5 thereby preventing the deposition of C3b on the surface of the bacteria (64). Another immune evasion strategy used by

P. gingivalis is adherence to erythrocytes via CR1 which enables e th bacteria to evade phagocytes and provides a potential transport mechanism of P. gingivalis via the systemic circulation (65). All se the observations suggest that the mucosa and its commensal microbiota probably interact in a "yin-‐yang'" relationship. That is, complement likely participates in the mucosal barrier function when the epithelium

17 is exposed to pathogenic or commensal microbiota components, while a commensal microbiota may have evolved to adapt to and modulate complement function.

Together, these responses would protect both host and bacterial commensals by avoiding the induction of damaging immune responses such as inflammation in the absence of aggressive bacterial invasion of the mucosa.

1.5 Overview of my thesis research.

In the studies described below, I have addressed the following questions that related to the general topic of the role of complement in the intestinal mucosa and its effects on commensal microorganisms and local inflammatory responses in the intestine:

(1) Is C3 made in the intestinal mucosa? (See Chapter II).

(2) Is mucosal complement induced by the presence of microbes? (See Chapter

II).

(3) Are commensal microbes opsonized by complement? (See C hapter III).

(4) Does complement protect the host from a non-‐invasive enteric pathogen as well as intestinal inflammation? (See C hapter III).

(5) Does complement have an impact on the microbiota's composition and if , so do the changes in the commensal ta microbio have functional significance in the host's response to inflammatory conditions? (See C hapter III).

(6) Which members of the commensal microbiota are coated with C3 and does complement opsonization of the commensal microbiota have functional significance?

(See C hapter ) IV .

18 Here we describe studies establishing that the transcription of complement component C3 occurs in the mucosa and that expression of C3 mRNA and protein are dramatically induced by the presence of a commensal gut microbiota. A combination of ex vivo and in vivo analysis suggests that the C3 produced in the intestinal mucosa is derived from local epithelial cells. Commensal bacterial organisms recovered from the intestinal lumen are coated ; with C3 this observation suggests that opsonization might play a role in modulating the composition of the intestinal microbiota.

Characterization of the intestinal microbiota in WT -‐ and C3 deficient mice suggests that locally produced complement influences the composition of the commensal microbiota's community structure. Finally, susceptibility to an enteric pathogen as well as another inflammatory stimulus is dramatically modulated by the presence or absence of C3, suggesting that complement can have either a direct or an indirect effect on pathobiological processes that occur in the intestinal mucosa. C3-‐coated bacteria from WT mice are colitogenic after an inflammatory stimulus (i.e., DSS colitis); thus it is possible that complement C3 restricts -‐ pro inflammatory pathobionts in vivo. My experimental results support a role for locally produced complement that includes the control of robial inflammation, mic infection, and the composition of the intestinal microbiota.

19 Chapter II. The intestinal microbiota and its role in induction of local complement production and biological activity

The mouse intestinal microbiota clearly is capable of altering the innate and adaptive immune system in mice. The microbiota can induce T cell subclasses such as

Tregs and Th17 cells (42, 46, 66), stimulate production of antimicrobial peptides such as defensins (67) and C-‐type lectins including regenerating islet-‐derived protein 3 gamma (RegIIIγ) and RegIIIβ (68, 69). Although secretory IgA production is induced by a commensal microbiota (70–72), this antibody cannot fix complement. Given the major role of complement as a component of the innate and adaptive immune system within the bloodstream, we were curious whether the mouse commensal microbiota regulates complement production, secretion, or activity in mucosal secretions.

2.1 C3 levels in fecal contents are elevated by presence the of a n intestinal microbiota

To address the question of whether complement production is modulated by the intestinal microbiota, we elected to measure the level of complement component

C3 in the intestinal luminal contents of , GF conventional (SPF) and other colonized mice including HMB mice (gnotobiotic mice colonized with human microbiota and bred in isolators) and MMB mice (gnotobiotic mice colonized with a mouse microbiota and bred in isolators) mice. Both small-‐intestinal contents eces and f were collected from age-‐matched (7-‐8 weeks ) old GF Swiss Webster (SW) mice, HMB SW mice, MMB SW mice and conventional SW mice. Small-‐intestinal and ecal f samples were analyzed in a mouse C3 enzyme-‐linked immunosorbent assay LISA (E ). SPF mice as well as HMB and MMB mice were found to have much higher levels of C3 in

20 their colonic contents compared to GF mice (Figure 3B). However, unlike the MMB, the HMB did not induce C3 production in the small intestine (Figure 3A). This observation is consistent with our laboratory's previous work, in which an HMB did not induce T cells (CD4+ or CD8+) in the small-‐intestinal lamina propria, while an

MMB was a strong elicitor of T cells (37). We also analyzed feces from GF B6 mice and conventional SPF B6 mice. Colonization by a SPF microbiota induced higher levels of C3 in B6 mice colonic contents (Figure 3E). Nonetheless, our results strongly suggest that the microbiota present in SPF mice influences the level of C3 in the intestinal luminal contents.

A. B. C. * ** ** 5 * 4 ** 4 s s e e c c 4 e e 3 3 f f m o o

3 r m m e a a 2 s 2

r r n i

2 r r l m pe pe /

1 1 1 m

0 0 0 F B B F F B B F F B B F G G SP G HM MM SP HM MM HM MM SP

D. E. F.

5 2.5 ** 2.0 s s e m e c c 4 u 2.0 r e e

e 1.5 f f o o sa

3 1.5 n m m i

a a l r r 1.0

2 ma r

r 1.0 / pe pe

m 0.5 1 0.5

0 0.0 0.0 F F F F F F G G SP SP G SP

Figure 3 . Complement C3 is regulated by commensal microbiota

A. Small intestinal C3 level of GF, HMB, MMB and SPF of Swiss Webster mice. *p<0.05; (One way ANOVA). Indicated are median with range. B. Colonic C3 concentration of GF, HMB, MMB, SPF of Swiss Webster mice. ** p<0.01 One ( way ANOVA). Indicated are median with range. C. Serum C3 level of GF, HMB, MMB and SPF of Swiss Webster mice. Indicated are median with range. D. Small intestinal C3 level of GF and SPF of B6 mice. E. Colonic C3 concentration of GF and SPF of B6 mice. ** p<0.01 (Wilcoxon-‐rank sum test). Indicated are median with range. F. Serum C3 level of GF and SPF of B6 mice.

The presence of a commensal microbiota is known to induce the production of antimicrobial peptides and other innate immune molecules, such as RegIIIγ and defensins in the murine gut (68, 73). Because the regulation of such innate immune parameters is often reversible, we wondered whether removing the microbiota from conventional mice would cause the fecal C3 level to revert back to that in GF mice. To address this question, we used antibiotic treatment to deplete the gastrointestinal microbiota. After two weeks of treatment with a broad-‐spectrum antibiotic cocktail

(given in drinking water), we onfirmed c that the feces of SPF mice were culture negative when analyzed on appropriate microbiological media, which were incubated both aerobically and anaerobically. We found that this antibiotic treatment regimen reduced C3 levels in feces to those documented in GF mice Figure ( B 4 ). We also tested whether colonization of GF mice with the normal microbiota from SPF mice could reverse the C3 production defect observed in the feces of GF mice. Because mice are coprophagic, this experiment was done o by simply c -‐housing GF mice with conventional SPF mice for 2 . weeks We found that this protocol induced significantly higher complement C3 levels in the feces of the previously Figure GF mice ( 4B).

Because the transfer of the microbiota of SPF mice to GF mice probably was not complete in these experiments, the fecal level of C3 in the cohoused GF mice was not fully reconstituted to the same magnitude found in the feces of SPF mice. It is possible that oral gavage of freshly collected feces would result in a more complete transfer of the commensal microbiota than the co-‐housing approach we used.

Nonetheless, these reciprocal experiments strongly support the conclusion that the

23 intestinal microbiota influences the production and/or secretion of C3 into the intestinal lumen.

24 A. B. 2.0 1.5 **

1.5 s ** e c

on 1.0 i e

f ** ss g

ea 1.0 r pe p

l x e m

/ 0.5

C3 0.5

0.0 0

F F F X F F G G SP AB SP

GFCOSP C. ** ** 2.5 **

s ** e

c 2.0 e f o

a 1.5 m a ra g

r 1.0 pe

g µ 0.5

0.0

T T F 8 1 1 M cW µ TRI a casp T MyD8 Dectin

Figure 4 . Colonic C3 s level are modulated by antibiotics and . cohousing

A. Liver C3 expression in B6 GF and SPF B6 mice. mRNA level normalized to house keeping gene GAPPH. B. Colonic C3 is modulated by antibiotic treatment and cohousing. ABX: antibiotics cocktail treatment; GFCOSPF: GF mice cohoused with conventional SPF. ** p<0.01 One ( -‐way ANOVA test). C. Colonic C3 is different across the different . genotypes. ** p<0.01 (One-‐way ANOVA test). In B and C median with range are shown

Because complement is thought to be produced largely by the liver (8, 15, 28), we tested whether the presence of a microbiota influences circulating levels of C3 level as well as the level of C3 mRNA in the liver. The C3 levels in the serum of SW and

B6 mice (both SPF and GF) were comparable (Figures 3C and 3F). In addition, C3 mRNA levels in the livers of GF and SPF in B6 mice were comparable (Figure 4A). We conclude from these studies that the influence of the microbiota on C3 levels in the intestinal lumen is likely due to a local effect (i.e., C3 production and/or apical secretion is different in these groups of mice as a result of a process that occurs within the intestinal mucosa).

2.2 Localization of C3 production in the mucosa and -‐ its up regulation by the presence of the intestinal microbiota

Our preliminary results suggested that C3 might be produced locally in the intestinal mucosa of mice that carried an SPF microbiota. To address this possibility we performed an immunofluorescence analysis on frozen cryo-‐sections of small intestines of GF and SPF mice, and probed these sections with an antibody to Muc2

(to visualize the mucus layer) and an antibody to C3. Sections derived from small-‐ intestinal tissue from GF mice displayed detectable but low levels of C3 (Figure 5A) and most of this signal was localized to the basolateral muscle layer and potentially in the intestinal crypts. In contrast, the intestinal slices from SPF mice showed high levels of C3, clearly localized to the small-‐intestinal villi Figure ( 5A). These data suggest that C3 production is occurring locally within the intestinal mucosa.

However, we could not rule out the possibility in these experiments that circulating

26 C3 in the serum was being selectively secreted by the intestinal mucosa in responses to signals derived from the gut microbiota.

To investigate the origin of C3 locally in the intestinal mucosa of SPF mice, we utilized RNA-‐scope analysis, a recently developed RNA in-‐situ hybridization technology, on formalin-‐fixed paraffin-‐embedded tissue samples (74). This approach allowed us to localize C3 mRNA by its ability to hybridize with a C3-‐ specific anti-‐ sense probe. T issues derived from WT SPF mice demonstrated stronger C3 RNA signals within intestinal epithelial cells than did tissue from GF mice (Figure 5B). The presence of mRNA specific for C3 from epithelial cells of SPF mice strongly suggests that these cells are the origin of the C3 protein we observed within the luminal contents (i.e., the feces) of SPF mice. Furthermore, -‐ RNA scope analysis confirmed that GF mice had very low levels of C3 mRNA in epithelial cells (Figure B 5 ), a result consistent with our previous observations that these mice do not produce high levels of secreted C3 protein in their feces.

Figure 5. Complement C3 expression by the epithelium is induced by the commensal microbiota.

A. Immunofluorescence of frozen sections (8 µm thick) of small intestine from GF and SPF mice. Green: antibody to Muc2; red: antibody to C3. B. C3 mRNA expression ions in sect (5 µm thick) of small intestine from GF and SPF mice analyzed by RNA-‐scope.

To verify that epithelial cells can produce C3, we used an in vitro culture system that produces a polarized monolayer of cells on a membrane (i.e., a transwell system) and tested whether secretion of C3 occurred in a manner consistent with its localization in the feces of SPF mice. Indeed, both -‐ polarized T84 and Caco 2 epithelial cell lines produced human C3. At 24 h, C3 was preferentially secreted to the apical side (rather than the basolateral side) of monolayers in the same well (Figures 6A and

6B). Because we observed that the presence of an intestinal microbiota stimulates production of C3 detectable in mucosal samples in vivo, we tested whether fecal bacterial products can also induce epithelial cells to produce higher levels of C3.

Formalin-‐fixed fecal bacteria were added to Caco2 cells, and the level of C3 in culture supernatant was measured at 6 h and 24 h. At 6 h, C3 was not detected by

ELISA across all bacterial doses. At 24 h, C3 production was significantly enhanced by stimulation with fixed fecal bacterial cells, and this response occurred in a dose-‐ dependent manner (Figure 6C). These results at indicate th (1) C3 can be constitutively produced by cultured epithelial cells; (2) C3 is preferentially secreted to the apical side of polarized epithelial monolayers (which corresponds to the lumen of the intestinal epithelium); and (3) C3 production by cultured epithelial cells can be enhanced by exposure to bacterial products.

A. B.

4 40 **

3 30 l

l m / m /

ng 20

2 ng

3 3 C C 1 10

0 0 l l l Apica Apical

Basolatera Basolatera C.

15 Medium 106 CFU 7 10 10 CFU

culture 108 CFU n i

l m / 5 ng

3 C

0 8h 24h

Figure 6. Complement C3 is preferentially secreted to the apical side of polarized cell. A, B. Apical versus basolateral C3 concentration on A a T84 monolayer ( ) and a Caco2 monolayer B ( ) in the same well at 24 h. ** p<0.01 (Wilcoxon-‐rank sum test). Indicated are median with range C. Formalin-‐fixed fecal bacteria enhance C3 secretion by Caco2 cells in a dose-‐dependent manner. Experiments were done in triplicate; data shown are representative of two independent experiments.

30 2.3 Complement C3 regulates local inflammatory responses in mice carrying an intact intestinal microbiota

Having established that SPF mice colonized with commensal microbiota produce more mucosal C3 than their GF counterparts, we wondered whether C3 plays a role in local inflammatory diseases or . responses to infection We addressed the first part of this question in the DSS colitis model, which relies particularly strongly on innate immune components to induce inflammation (75, 76). By adding

DSS to drinking water for , a short period one can induce very consistent levels of acute inflammation limited to the distal colonic epithelium. The clinical symptoms are weight loss, diarrhea, bloody stool, lack of grooming, hunched back, and death. The typical pathological features are ulcers, loss of crypts, and infiltration of PMNs into the intestinal lumen. This mouse model is frequently used to assess the role of various host innate immune components in intestinal inflammation and has pathological features that resemble inflammatory bowel disease (IBD) in humans

(76). Because GF mice are hypersusceptible to DSS and generally die from pathological events (e.g., internal bleeding) that are not related to mucosal inflammation (77), we opted to compare WT mice and -‐ genetically C3 deficient mice that each carry their natural . microbiota When challenged with -‐ DSS, C3 /-‐ mice developed colitis that was much more severe as judged by greater weight loss throughout the disease course and higher histopathology scores as well as more pronounced colon shortening Figures ( – 7A C).

To confirm that locally produced C3 was providing a protective effect in the

DSS colitis model, we utilized cobra venom factor (CVF) to ; deplete serum C3 CVF

31 does not efficiently deplete mucosally secreted C3 (78). We injected 10 μg of CVF intraperitoneally into -‐ 8 week-‐old WT mice every 4 days and then measured C3 levels daily by ELISA in both serum and feces collected from the treated . mice Although C3 was efficiently depleted in the serum of CVF-‐treated mice, C3 in fecal samples derived from -‐ CVF treated mice decreased only partially from levels in their pretreatment samples. However, CVF-‐treated mice did not develop more evere s disease than untreated mice when challenged Figure with DSS ( A) 7 . This observation suggests that the residual level of mucosal C3 -‐ present in CVF treated mice was likely sufficient to protect the animals against DSS colitis.

32 A.. B. 8 110 ** ) ) 6

% NS (

100 (cm t h t 4 eigh

90 eng l

W ** y WT on l o od 80 WTCVF ** 2 c

B ** C3-/- ** 70 0 1 2 3 4 5 6 7 8 9 0 Days of DSS Treatment WT C3-/- C. D.

4 ** e r o 3 sc

y og l 2 ho t opa t 1 s Hi

0 WT C3-/- WT C3-/-

E. F. 110 105 ) ) % % 100 ( ( 100 t

90 eigh 95 W

weight WT GF co WT y C3-/- y GF co C3-/- od 80 od 90 B B * * * * * 70 85 * * 0 1 2 3 4 5 6 7 8 9 10 0 1 2 3 4 5 6 7 8 9 10 Days of DSS Treatment Days of DSS treatment

GFcohoused WT GFcohoused C3-/-

Figure 7. Complement C3 regulates the intestinal inflammation.

A. Weight loss dian (me with interquartile range ) in WT mice, C3-‐/-‐ mice, and WT mice treated with cobra venom factor (WTCVF) after challenge with 2.5% DSS. **p<0.01 One ( -‐way ANOVA test) B. Colon length for WT and C3-‐/-‐ mice at day 10 of C. DSS colitis. Histology score for WT -‐ and C3 /-‐ mice at day 10 of DSS colitis. B In –C, **p<0.01 (Wilcoxon -‐ rank sum test). D. Representative histology pictures from hematoxylin and – eosin stained colons of WT and C3-‐/-‐ mice after DSS challenge. E. Weight loss (median with interquartile range ) in littermates of WT and C3-‐/-‐ mice with DSS colitis. F. Weight loss (median with interquartile range ) in GF mice cohoused with WT and C3-‐/-‐ mice in DSS colitis. In E and F, *p<0.05 (One -‐way ANOVA). G. Representative histology pictures from hematoxylin and eosin– stained colons of GF mice cohoused -‐ with WT and C3 /-‐ mice after DSS challenge.

To further demonstrate the importance of the epithelium as a source of C3, we performed a bone marrow transfer study examining the role of mucosa-‐derived C3 in intestinal inflammation. WT -‐ and C3 /-‐ mice were used as reciprocal donors and recipients with different congenic markers (CD45.1 and CD45.2). After lethal irradiation, recipient mice were given 7 ~10 bone marrow cells and 2 weeks of antibiotic treatment; -‐ a 6 week resting period was followed by cohousing of WT conventional mice with antibiotic-‐treated recipients for 2 weeks, allowing time for recipients to acquire the microbiota. ice M that survived bone marrow transplantation were then challenged with 2.5% DSS in their drinking water. C3-‐/-‐ mice that received bone marrow from WT mice displayed more severe disease symptoms than WT recipients of C3-‐/-‐ bone marrow. In -‐ the C3 /-‐ recipients, WT bone marrow cells did not reconstitute epithelial C3 production sufficient to confer protection in the DSS colitis model (Figures 8A–8C). Thus, we conclude that the C3 that is important in this model of mucosal inflammation protection is not of hematopoietic stem cell (HSC) origin. Taken together, these data suggest that local – epithelial cell derived C3 plays an important role in protecting mice from inflammation in the DSS colitis model.

However, the mechanism underlying this protection is not clear; C3 could protect animals directly by participating in the resolution of tissue damage caused by DSS or indirectly by promoting changes in the microbiota that then modulate disease severity.

34 A. B. 105

100 CD45.1 to CD45.2 (n=5) CD45.1 to KO (n=4) 4 * 95 * KO to CD45.1 (n=6) ** ***

) ** 3 %

90 e ( r t o sc

y 2 eigh ** W og

l y

80 o t s od i 1 h B 75 * p < 0.05, ** p < 0.01, *** p < 0.001 70 0 0 1 2 3 4 5 6 7 8 9 Recipient WT C3-/- Days of DSS Treatment Donor C3-/- WT

C. D. 8 * ) 6 * (cm

h t 4 eng l

on l o

c 2

0 Recipient WT WT C3-/- WT to C3-/- C3-/- to WT Donor WT C3-/- WT

Figure 8. C3 not derived from bone marrow cells is critical for the protection of local inflammation in the DSS colitis model.

A. Weight loss dian (me with interquartile range) in WT to WT (CD45.1 to CD45.2), WT to C3-‐/-‐ (CD45.1 to CD45.2), and C3-‐/-‐ to WT (CD45.1 to CD45.2) mice. *p<0.05; **p<0.01; ***p<0.001 (One-‐ way ANOVA ). test B. Histopathology scores indicated ( are median with range) in WT to C3-‐/-‐ mice and C3-‐/-‐ to WT mice. *p<0.05 (Wilcoxon rank-‐rum test). C. Colon length at day 9. Indicated are median with range. *p<0.05 One ( -‐way ANOVA). D. Representative histology pictures om fr hematoxylin and eosin–stained colons after DSS challenge at day . 10

Complement has many antibacterial activities including activation of the MAC, recruitment of phagocytes, and opsonization of bacterial cells. Thus, our results might be explained if the intestinal microbiota modulates colitis severity and if its composition is altered by the presence or absence -‐ of C3 in WT vs. C3 /-‐ mice. To determine whether the difference in susceptibility -‐ of C3 /-‐ mice was due to an altered microbiota, we cohoused GF mice with SPF WT and C3-‐/-‐ mice separately for 2 weeks before subjecting them to DSS challenge. GF mice cohoused with C3-‐/-‐ mice developed more severe disease symptoms (e.g., greater weight loss, watery diarrhea, and higher histopathology scores) than GF mice cohoused with WT mice (Figures 7E and 7F). Although the difference in histopathology , score (p=0.0326 Wilcoxon rank-‐ sum test) was not as pronounced as the difference -‐ between WT and C3 /-‐ mice, this cohousing experiment nonetheless suggests that host genetics (i.e., C3 deficiency) can play a role in shaping the microbiota's composition in a way that can influence the severity of an intestinal inflammatory disease. Thus, either the microbiota that develops in the absence of intestinal C3 is not as protective as the WT intestinal microbiota or the dysbiotic C3-‐/-‐ microbiota exacerbates DSS disease, perhaps by being more -‐ pro inflammatory, invasive, or virulent to the host.

36 Chapter III. Commensal bacteria and a known non-‐invasive enteric pathogen are coated with C3

Pathogenic bacteria that invade the bloodstream can be opsonized by C3. This process involves the formation of a stable, covalent ester linkage between this protein and cell surface molecules (e.g., polysaccharides) that display nucleophile residues

(e.g., hydroxyl groups) (Figure 2). Opsonization—the attachment of C3 — to bacteria is a coating process that can trigger other complement components to react with the bacterial cell surface and cause cell lysis or enhanced ages, phagocytosis by macroph neutrophils, and dendritic cells. Opsonization also modulates the adaptive immune response, probably through -‐ antigen C3d (dendritic cell)–CR2 (B cell) interactions that stimulate B cell responses (79). Our earlier studies left unanswered the following question: Can C3 secreted into the intestinal lumen opsonizes commensal bacterial species and non-‐invasive pathogenic bacteria? This chapter describes experiments addressing this question by direct ement measur of C3 coating of bacterial cells harvested from intestinal , contents including commensal organisms as well as a non-‐ invasive intestinal pathogen, Citrobacter rodentium.

3.1 Detection of C3 on the surface of intestinal bacteria by FACS analysis

To determine whether bacterial components of the commensal microbiota are opsonized with C3, we purified fecal bacteria from both the small intestine and the colon of mice, stained the organisms with body anti to C3, and analyzed them by fluorescence-‐activated cell sorting (FACS). FACS analysis indicated that, unlike bacteria stained with a nonspecific antibody isotype control, anti-‐C3-‐stained bacterial

37 cells in the commensal microbiota from both sites in WT mice were coated with C3

(Figure 9A and ) B . Because C3 opsonization produces covalent ester bonds between

C3 and cellular components, we reasoned that the C3 coating we were observing reflected the formation of covalently -‐ cross linked products that would be sufficiently stable to be detected by sodium dodecyl – sulfate polyacrylamide gel electrophoresis

(SDS-‐PAGE) and western blot . analysis Accordingly, bacteria were purified from feces of -‐ C3 /-‐ and WT mice, lysed in -‐ reducing SDS PAGE sample buffer ° at 100 C, and subjected to western blot analysis body using anti to C3 (Figure 9C). This analysis revealed broad bands (i.e., smeared bands) that -‐ reacted with anti C3 that migrated with a much higher molecular . weight than C3 These smeared bands appeared in WT samples but—critically—not in GF samples, a result suggesting that these bands were associated with the presence of the commensal . microbiota Because some bacterial surface components such as capsules and lipopolysaccharides -‐ can migrate on SDS

PAGE gels as -‐ high molecular-‐weight molecules of variable molecular size, C3 detectable in this analysis was likely covalently attached to bacterial . surface products

We so al analyzed fecal bacteria derived from mice with DSS-‐induced colitis that were defective in either C3 or antibody production (the latter being μMT mice) for C3 deposition by western . blot analysis Opsonization of the gut microbiota was documented in ce WT mi but not -‐ in C3 /-‐ mice; C3 opsonization of commensal bacteria for antibody-‐deficient μMT mice fell between those for C3-‐/-‐ and WT mice

(Figure 9D). ese Th findings suggest that C3 opsonization of the commensal microbiota is partially dependent on mucosal antibody and complement classical pathway. It’s likely that the other two pathways -‐ alternative pathway and lectin

38 pathway, which do not require antibody for activation, can still contribute to the commensal microbiota opsonization by complement C3. From these results, we conclude that the C3 detectable -‐ in gut derived samples is active and capable of reacting with commensal bacteria present in the gastrointestinal tract and feces of mice. However, the functional significance of this observation requires further investigation; the identity of the bacterial components that were coupled to C3 and the bacterial species that produced them was not revealed . by this analysis

Figure 9. The ommensal c microbiota is opsonized with -‐ C3 in steady state conditions and in colonic inflammation.

A. Colonic bacteria are coated with C3. B. Small-‐intestinal bacteria are coated with C3. C. Western blot analysis of fecal bacteria from GF, C3-‐/-‐ and WT mice. D. At day 8 of DSS colitis, fecal bacteria were purified and analyzed for C3 deposition.

40 3.2 C3 protects mice -‐ from non invasive, enteric mouse pathogen Citrobacter rodentium

To address whether enteric pathogens are also s recognized by muco al complement 3 C , we used C. rodentium , a natural bacterial pathogen of mice (80). This organism is considered a surrogate for enteropathogenic and enterohemorragic E. coli (EPEC and EHEC, respectively) — human pathogens that include serious primary pathogens such as E. coli O157:H7 strains (61). C. rodentium is similar to both EPEC and EHEC strains in that it carries a homolog of the LEE pathogenicity island which encodes a type III secretion system and other gene products that evoke attaching and effacing (A/E) lesions during EPEC and eric EHEC ent infection. Citrobacter has been used to study the molecular basis for A/E lesion formation in mice because it is the only known LEE-‐positive organism that is naturally pathogenic for rodents (81).

Approximately 5 × 108 colony-‐forming units (CFU) of C. rodentium were given by the oral/gastric route to WT and C3-‐/-‐ mice, and the health, weight loss, and colonization status of the animals were monitored daily for ~3 weeks. WT mice were generally more resistant to Citrobacter infection than -‐ C3 /-‐ mice and showed minimal weight loss (Figure 10C) and much less severe diarrheal disease symptoms (e.g., overt watery ). stools In contrast, C3-‐/-‐ mice developed disease after 1 week with disease symptoms peaking at 2 weeks post infection. The difference in disease susceptibility was clearly apparent from the survival rate (Figure 10A), the amount of weight loss (Figure 10C), or the level of C. rodentium in the stool of infected mice

(Figures 10B and D). 10 To confirm the role of intestinal C3 in Citrobacter infection,

CVF (10 µg) was injected into WT mice every 4 days to deplete circulating C3;

41 previously, we found that this treatment only partially depletes . mucosal C3 After CVF treatment, mice were challenged with C. rodentium and monitored for . symptoms As shown in Figure 10C and 10D, CVF treatment did not compromise resistance to

Citrobacter infection in WT mice, measured by weight loss and bacterial burden.

These results indicate that the residual mucosal C3 remaining after CVF treatment is sufficient to confer resistance infection to with this non-‐invasive enteric pathogen.

To assess whether intestinal C3 can opsonize this non-‐invasive pathogen in situ, we infected mice with C. rodentium that constitutively expresses -‐ a plasmid encoded GFP gene and then measured C3 binding on GFP+ bacterial cells recovered from fecal material. After 7 days of infection, bacteria were purified from the feces of

C3-‐/-‐ and WT mice, stained body with anti to C3, and analyzed by FACS. This analysis clearly showed that + GFP bacterial cells were indeed coated with C3, whereas GFP+

Citrobacter cells from -‐ C3 /-‐ mice were not opsonized Figures by C3 ( E 10 and 10F).

We conclude that C. rodentium is a target for ization C3 opson within the intestinal milieu during active enteric infection. Our results are consistent with the hypothesis that C3 produced by intestinal epithelial cells is functional in controlling this noninvasive enteric bacterial pathogen.

Figure 10. C3 is critical for protection -‐ from a non invasive pathogen. A. Survival curve of WT and C3-‐/-‐ mice over the course of WT Citrobacter rodentium infection. B. Counts of C. rodentium at day 16 in feces of WT and -‐ C3 /-‐ mice. Indicated are median with range. *p<0.05 (Wilcoxon -‐ rank sum test). C. Weight loss in WT -‐ mice, C3 /-‐ mice, and WT mice treated with cobra venom factor (WTCVF) during infection. Indicated are median with interquartiles. *p<0.05, **p<0.01 One ( -‐way ANOVA). D. Counts (median with range) of C. rodentium at day 11 in feces of WT, C3-‐/-‐, and WTCVF mice. **p<0.01 (One-‐way ANOVA). E. FACS analysis of C3 opsonization of GPF+ Citrobacter at day 7. F. Mean fluorescence index ) (MFI (median with ) range of GFP+ Citrobacter from feces of WT and C3-‐/-‐ mice. * p<0.05 (Wilcoxon rank-‐sum test).

3.3 The role of antibody in the coating of intestinal bacteria with C3

The adaptive immune system produces potent specific effectors such as IgA antibody that can be found in mucosal secretions (82). Because luminal secretory IgA cannot activate complement, most experts believe that this class of antibody confers protection via mechanisms such as bacterial agglutination within the lumen, toxin neutralization, or blocking of adhesins that trigger bacterial binding to intestinal epithelial cells. However, our data showed that IgG and IgA are equally abundant in the intestinal lumen (Figures 11A and 11B). Because omplement c is activated by IgM and IgG antibodies, it is reasonable to speculate that intestinal complement might be activated by luminal antibody of these two classes directed at enteric bacterial species, including commensal organisms.

To address this possibility, we used μMT mice, which are completely deficient in B cells (and thus in antibody of all classes), investigating whether these knockout mice carry intestinal bacteria coated . with C3 FACS analysis comparing fecal bacteria derived from µMT mice with fecal bacteria derived from congenic WT mice showed a substantial decrease in the fraction of bacterial cells coated with C3 in µMT mice

(Figure 11C). Because the levels of C3 in serum and mucosal samples from μMT mice were similar to those in WT mice, we tentatively conclude that antibody production does affect the magnitude of C3 coating of the . commensal microbiota This conclusion implies that the classical pathway of complement activation is likely active on the mucosal surface. Thus, IgM or IgG antibodies to members of the intestinal microbiota might target these organisms for either C3 opsonization or killing by the lytic

44 pathways of complement. These experiments were subject to some variation that discouraged us from conducting a deeper analysis of this apparent antibody dependence of C3 deposition onto the surface of enteric bacterial cells. We , did however, measure levels of IgG and IgA in fresh fecal material collected from normal healthy mice and found substantial levels of both types of antibody in these luminal samples Figures ( 11A and 11B). Although IgA is the more dominant immunoglobulin class in the feces, fecal IgG are similar in magnitude to IgA in the feces in conventional

WT mice. The significant amount of IgG in the mucosal secretions (more than μ 10 g/g fece) could possibly contribute to the gut immunity at the local tissue. Thus, the classical pathway of complement activation may be operative in the intestinal mucosa, and C3 coating of luminal bacteria may depend in part on antibody–antigen recognition processes. In the -‐ FcRn /-‐mice (purchased from Jackson Laboratory), both IgG and IgA are very low compared to cRn WT mice, indicating that F might be responsible for transporting both IgG and IgA from sub-‐mucosa to the intestinal lumen. However, these results were not compared in the littermates control mice, it might also be possible that in the Jackson Laboratory -‐ purchased FcRn /-‐ mice ffers di from WT mice in less amount of IgA inducing bacteria, or presence of IgA-‐degrading bacterial members in their gut (83) .

Figure 11. IgG antibody is partially required for C3 deposition onto the commensal microbiota.

A. Fecal IgA concentration in different genotypes . of mice Indicated are medians with range. *p<0.05 (One-‐way ANOVA test). B. Fecal IgG concentration in different genotypes Indicated of mice. are medians with range. ***p<0.0001 * (One-‐way ANOVA test). C. C3 deposition on fecal bacteria from WT,mice, -‐ C3 /-‐ mice, μ MT mice μ and MT mice i ntraperitoneally i.p. ( ) injected with 2μg IgG (feces collected at 16hour post . infection)

46 Chapter IV. Identification of enteric bacterial species that are targeted by C3 and whose abundance is altered in C3 -‐ /-‐ mice

This chapter results from the collaborative work with Dr. Meng Wu (Harvard Medical

School, Department of Microbiology and Immunobiology, Kasper . laboratory)

The detection of intestinal bacterial ated cells that are co with C3 raises a number of interesting questions. Which bacterial species (or groups) are coated with

C3? Are the relative abundances of these bacterial -‐ species altered in C3 /-‐ mice? Are there species/groups of bacteria that are abundant only in C3-‐/-‐ mice? To address these questions, we applied an established technique—population-‐based 16S rRNA profiling—to grossly characterize populations of cells in genetically different mice, and we developed a new analytical technique (C3-‐SEQ) that allows the identification of bacterial species/groups that are specifically coated with intestinal C3.

4.1 Characterization of the gut microbiota -‐ of C3 /-‐ mice

To determine the composition of the -‐ microbiota in C3 deficient mice, we collected fecal samples -‐ from 7 to 8-‐week-‐old -‐ C3 /-‐ animals and from -‐ age matched

WT mice n ( = 10 per group) and then extracted DNA. The V4 region of the 16S rRNA was amplified with -‐ paired end 16S primers 515F and 816R (84) and ~390bp amplicons were purified and sequenced with an Illumina -‐ Mi Seq machine. Sequence reads were analyzed with QIIME and s QIIME2 pipeline (84). Principal coordinate analysis (PCoA) of unweighted pairwise ac UniFr distance found that microbial diversity of the two genotypes fell -‐ into two well separated clusters (p=0.001,

47 PERMANOVA) (Figure 12A) on PCoA1, which represents 42.89% of variance in the microbial community structure. Using linear discriminant analysis effect size (LEfSe)

(85), we identified the taxa with significantly greater abundance in WT SPF mice than in -‐ C3 /-‐ mice, such as Turicibacter at the genus level, which belongs to the family

Turicibacteraceae in the class Bacilli; an undefined genus in the order RF39; two genera in the family Ruminococcaceae; and Coprococcus at the genus level 0.05, (p<

Kruskal-‐Wallis rank-‐sum test) (Figure 12B). No specific taxa at the genus rank or above were identified as enriched in C3-‐/-‐ mice; this result suggested that C3 deficiency did not cause a detectable bloom of any organism at the genus rank or above. In fact, overall microbial diversity was significantly -‐ reduced in the C3 /-‐ mice from that in WT mice (p<0.01, Kruskal-‐Wallis rank-‐sum test) (Figure -‐ 12C E). One challenge in studying the microbial community with 16S rRNA is the lack of resolution at the cies/strain spe level. Using the feature in QIIME2, we could look at

16S sequences at the strain level and further identify strains with differential abundances in C3-‐deficient and WT mice. In total, six unique representative sequences (taxa) were shown to differ significantly in abundance: five were enriched in C3-‐/-‐ mice, and one was enriched in WT mice (p<0.05, ANCOM).

4.2 16S rRNA sequencing of GF mice -‐ cohoused with C3 /-‐ mice confirms that an altered microbiota contributes to DSS disease susceptibility

16S rRNA sequencing -‐ of C3 /-‐ and WT mice suggests that mice lacking C3 harbor a different microbiota. As shown in -‐ chapter III, C3 deficient mice have more significant weight loss, bloody diarrhea, and worse histopathology scores during DSS challenge than do WT mice. To study the role of the microbiota in this process, we

48 performed a microbiota transfer experiment based on the fact that mice are coprophagous. C57BL/6 GF mice were cohoused -‐ with C3 /-‐ mice or SPF mice in separate cages. Fecal samples were ted collec from the formerly GF mice after 2 weeks of cohousing (the time point preceding DSS treatment) and were subjected to 16S rRNA sequencing. Cohoused ex-‐GF mice harbored a microbiota very similar to that of their cage mates, measured by unweighted UniFrac distance (Figure F 12 ; p<0.05,

PERMANOVA). As shown in Chapter III, GF mice cohoused with C3-‐/-‐ mice also develop more severe DSS colitis than GF mice — cohoused with WT mice a trend similar to that documented -‐ for C3 /-‐ and WT mice in DSS colitis. Therefore, the intestinal microbiota -‐ of C3 /-‐ could be transmitted into GF mice, and mice colonized with the altered microbiota were more susceptible to DSS colitis; this finding suggested that -‐ C3 /-‐ mice harbor a more colitogenic intestinal microbiota. To fully elucidate the role of C3 in driving these changes in the intestinal microbiota community structure, a technique for identification of bacterial cells coated with C3 at the 16S rRNA level was needed.

Figure 12. Microbiota composition measured by 16S rRNA sequencing and C3-‐ SEQ analysis.

A. Unweighted UniFrac PCoA plot of 16S rRNA sequencing of fecal -‐ bacteria from WT and C3 /-‐ mice. p=0.001 (PERMANOVA). B. Cladograms reporting the taxa (highlighted by small circles and by shading) and showing different abundance values (according to LEfSe) in feces from WT mice. p<0.05 (Kruskal-‐Wallis rank-‐sum ).test C-‐E. Overall fecal microbial diversity -‐ of C3 /-‐ mice and WT mice. p<0.01 (Kruskal-‐Wallis rank-‐sum test). F. PCoA plot of the microbial community of previously GF mice cohoused with -‐ C3 /-‐ mice or WT mice. p<0.05 (PERMANOVA). G. FACS confirmation of C3+ and C3-‐ sorted fecal bacteria from WT mice. H. PCoA plot of unweighted UniFrac distance of sorted C3+ and C3-‐ bacterial portions. p<0.05 (PERMANOVA)

50 4.3 C3-‐SEQ: A new method for -‐ identifying C3 opsonized bacteria in complex communities of microbes

To identify the microbial taxa that are coated by C3 in the mouse intestinal lumen, we developed a new med technique ter -‐ C3 SEQ, which combines -‐ antibody based bacterial cell sorting and sequencing of 16S rRNAs of the sorted bacteria.

Similar methods (e.g., IgA-‐SEQ) have been used to identify intestinal bacterial groups coated with IgA in humans and mice under different health conditions, such as IBD

(86), malnutrition (87) and childhood development (88). Because of the covalent linkage which C3 opsonizes bacterial cells, we predicted that C3 would be at least as stable as IgG antibody -‐ during C3 SEQ analysis. In brief, bacteria in the feces were stained with antibody to -‐ C3. C3 coated and noncoated bacteria were sorted by flow cytometry and considered + as the C3 and C3-‐ portions, respectively. Both portions were collected and subjected to 16S rRNA cribed sequencing as des previously. To ensure that our separation was -‐ optimal, we re analyzed sorted bacteria to confirm that the C3+ and C3-‐ groups were cleanly separated before amplification and sequence analysis (Figure 12D). After 16S rRNA gene sequencing, microbial compositions were compared and visualized by means of PCoA of unweighted UniFrac distances (Figure

12E). The + C3 portion was significantly different from both the initial population and the C3-‐ portion (p<0.05, PERMANOVA); this difference suggested oating that C3 c of intestinal bacteria is selective -‐ and that C3 coated bacteria represent a distinct population.

Although -‐ C3 SEQ identified the taxonomic groups that were enriched in the

C3+ portion but not in -‐ the C3 portion of the fecal bacterial population, the biological significance of coating of microbial cells with C3 in the intestine remained unclear.

Therefore, I decided + to use C3 and C3-‐ bacteria recovered from WT SPF mice to colonize GF mice and t then to tes the colonized animals for their susceptibility to DSS colitis. GF mice at 4 weeks of age were orally gavaged with FACS-‐sorted pools + of C3 and -‐ C3 bacteria recovered from SPF B6 mice. Mice were subsequently raised in separate isolators for 5 weeks. Feces were collected for microbial community analysis before mice were exposed to 2.5% DSS in drinking water for 5 days. Body weight and clinical symptoms were monitored throughout the exposure period and until day 10, when all mice were sacrificed. Mice that were given + C3 bacteria lost more weight

(Figure 13B) and had more severe signs of intestinal inflammation (i.e., colon shortening (Figure 13C) and high histopathology score (Figures 13D and 13E) than mice colonized with -‐ C3 bacteria. These results suggest that the bacterial species targeted by C3 are colitogenic; at least in previously GF colonized mice. Complement opsonization of the colitogenic commensal microbiota is further speculated to be protective in conventional mice.

I also applied the Qiime 2 pipeline to analyze + C3 and -‐ C3 bacteria in feces from colonized mice. Microbial compositions were compared and visualized with a heat map (Figure 13A). Rather than a random sampling of + all intestinal bacteria, C3 bacteria represented a distinct sub-‐community within the intestinal microbiota, although the overall diversity of both groups was much reduced from that in feces

52 from WT -‐ C3 /-‐ mice and from that of FACS-‐sorted C3+ and -‐ C3 bacteria. These data demonstrate that C3 coating of the intestinal ta microbio is selective across microbial taxa and that -‐ C3 coated bacteria represent a taxonomically distinct subset of intestinal bacteria in mice.

A. 0.00 15.00 C3 positive C3 negative # OTU ID Taxonomy 1 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__; g__; s__ 2 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__; g__; s__ 3 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Ruminococcaceae; g__Oscillospira; s__ 4 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales 5 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales 6 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Ruminococcaceae; g__Ruminococcus; s__ 7 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__; g__; s__ 8 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__; g__; s__ 9 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Lachnospiraceae; g__; s__ 10 k__Bacteria; p__Firmicutes; c__Erysipelotrichi; o__Erysipelotrichales; f__Erysipelotrichaceae; g__; s__

B. C. 9 110 2.5% DSS * )

105 )

% 8 ( t (cm h 100 t

eigh 7 eng W l

y 95 on l od * o B C3+ col mice 6 * c 90 * C3- col mice * 85 5 0 1 2 3 4 5 6 7 8 9 10 GFcolC3+ GFcolC3- Days of DSS treatment D. E. 4 * e r

o 3 sc

y og l 2 ho t opa t 1 s Hi

0 GFcolC3+ GFcolC3- C3- bacteria colonized mice C3+ bacteria colonized mice

Figure 13. C3 coats colitogenic bacteria in vivo.

A. Heat map + of C3 and C3-‐ bacteria from the feces of colonized ex-‐GF mice with statistical significance p=0.0001 (Paranova). B. Weight loss median ( with interquartile ) range during DSS colitis in formerly GF mice colonized with C3+ and C3-‐ bacteria. *p<0.05 One ( -‐way ANOVA). C. Colon length median ( with range) in ex-‐GF mice colonized with C3+ and C3-‐ bacteria at day 10 of DSS colitis. *p<0.05 (Wilcoxon rank-‐sum test). D. Histopthology scores median ( with ange r ) of mice colonized with C3+ and C3-‐ bacteria at day 10 of <0.05 DSS colitis. *p (Wilcoxon -‐ rank sum test). E. Representative histology pictures from hematoxylin and eosin–stained colons of mice colonized + with C3 and C3-‐ bacteria after DSS challenge.

54 Chapter V. Discussion

Complement is a well-‐known effector system for nate the in immune response, particularly in the bloodstream and in local tissues such as mucosal surfaces. Less is known about the role of complement outside the epithelial barrier, but the presence of its components in secretions, particularly y under inflammator conditions, suggests that complement may well play a role in defense against mucosal pathogens. The experiments presented here were designed to explore questions including (1) the source of the key complement component C3 in samples derived from mouse intestinal contents, (2) whether commensal bacteria control C3 expression locally in the intestine, and (3) whether locally produced complement plays a role in the regulation f o intestinal inflammation, microbial protection, and the composition of the intestinal microbiota.

We found that intestinal epithelial cells are an important source of the complement protein C3 in the intestinal lumen and that inal the presence of intest microbiota modulates the local production of this protein. Remarkably, C3 levels in the feces from conventional (SPF) SW mice was much higher than that in feces from gnotobiotic GF . mice Furthermore the colonization of GF SW mice with a mouse intestinal microbiota both ( MMB and SPF ) mice corrected this C3 production defect and the effect of the intestinal microbiota on local C3 production was also reversed by elimination of the microbiota from SPF mice by means of treatment with a cocktail of broad-‐spectrum antibiotics. These reciprocal experiments strongly support the conclusion that the intestinal microbiota influences the level of mucosal C3

55 production in feces, at least when detected at the protein level by C3 ELISA. Our data parallel similar vations obser that have been made for other -‐ antimicrobial host derived peptides such as RegIIIγ and defensins: it has been reported that the intestinal microbiota greatly stimulates their local mucosal ( production 68, 73).

Interestingly, a biota micro derived from human intestinal samples (HMB) did not share this capacity to reverse the C3 production defect in GF mice in small intestine contents. This observation is remarkably similar to our previously reported observations that HMB was unable to induce T cells in the small-‐intestine lamina propria of gnotobiotic mice, whereas MMB could readily do so (37). Collectively, these data suggest that there is profound specificity to how the microbiota modulates the expression of innate defense molecules such as complement and antimicrobial peptides in the gut. Understanding the nature of this specificity will be enlightening and should be explored at multiple levels. For example, it is possible that MMB flora produce signaling molecules that are not produced by members of the HMB flora.

The relative potency of different host signaling molecules such as TLR agonists (e.g., lipopolysaccharides) and bacterial sphingolipids is not well understood in the context of different isolates n of eve the same microbial taxa. Alternatively, rganisms o from the MMB that induce C3 production might form intimate associations with the epithelium that are not observed for members of the HMB microbiota. Bacteria such as SFB for intimate associations with the epithelium (42), while other organisms are confined to the mucus layer such as Akkermansia muciniphila (89) or even excluded out of mucus . layer The difference in the distribution of bacteria into otherwise sterile sites such as the intestinal crypts has been suggested previously as an

56 explanation for their ability to be ry more stimulato to the host immune response. It is clear the microbial communities of different animal species are very different but what shapes the composition of these communities is not well understood. Our results suggest that differences in the ce ability to indu innate immune factors such as complement in the gut might not only affect host immune function but also the composition of the microbiota.

Previous work has established omplement that c components are largely produced by the liver (8, 15, 28). Although it was formally possible that SPF and MMB microbiota affected the level of C3 in the feces by affecting its level in the serum, our data instead provides strong evidence that that elevated C3 levels in feces is likely due to enhanced local production and/or secretion by the intestinal osa. muc In addition to visualizing C3 protein and C3 mRNA signals within the intestinal mucosa, we showed that polarized, in vitro–cultured cell monolayers d secrete C3 at elevated levels apically when exposed fixed bacterial . cells These data suggest he that t stimulation of mucosal C3 production we observed in vivo in SPF mice but not in GF mice is recapitulated by this – in vitro cultured epithelial cell . system If so, the receptors and their bacterial ligands, as well as the signal transduction pathway that mediates the activation of C3 expression and secretion, could be defined with this in vitro system in future studies.

C3 is known to covalently attach to macromolecules on the surface of bacteria through a stable ester bond (1, 2, 5, 9, 90). This action re loads C3 onto the bacterial surface where it can then drive other complement effector functions such as cell lysis and opsonization by phagocytes. Thus, C3 on the surface of bacteria is a surrogate

57 marker for downstream C3 effector functions. We were able to C3 is attached to bacterial cells derived from both the small intestine and the . colon of WT mice

These data support the conclusion that complement is active in the gut lumen and that activated C3 is capable of reacting with commensal bacterial cells in the gastrointestinal tract of mice. Whether the attachment of C3 to commensals in the gut has biological consequences for these bacterial species could not be addressed with this experimental approach. In addition, this biochemical analysis did not identify the bacterial species that were the targets . for C3 ligation

In contrast our studies with the primary enteric pathogen, Citrobacter rodentium (91), provided strong evidence that complement -‐ had anti bacterial effector function in the intestine. This noninvasive bacterium was largely controlled in WT mice but not in C3-‐/-‐ mice. The severity of disease -‐ in C3 /-‐ mice correlated with a much higher bacterial load in feces and this finding suggests that C3 might have an antibacterial effect locally in WT animals. However, because C3 deficiency also changes the composition of the intestinal microbiota, and because these changes, in turn, might affect C. rodentium disease susceptibility, we sought evidence that this bacterium was a direct target for C3 opsonization. Our analysis clearly showed that C. rodentium is a target for C3 surface ligation within the intestinal lumen and that this opsonization reaction might be responsible for controlling the level of intestinal replication/survival of C. rodentium in WT . mice It remains to be determined whether C3 coating of C. rodentium activates effector functions such as bacteriolysis in the intestine or oposonization and phagocytosis of this pathogen by lumenal neutrophils and macrophages in the intestine.

58 Intestinal epithelial cells can also secrete IgA and IgM into the intestinal lumen; however, the former secretory ( IgA) does not have the ability to activate complement. IgM and IgG are potent activators of the classical pathway of complement when bound to target , antigens and both classes of antibodies are readily detected in i mouse lum nal contents and feces of . healthy mice Thus it is reasonable to speculate that intestinal complement might be activated by antibody that targets enteric bacterial species such as commensal . organisms Our data support the latter hypothesis in that fecal bacteria derived -‐ from antibody deficient μMT mice show profoundly less C3 coating than WT mice. These results suggest that the classical pathway of complement activation may be active on the intestinal mucosal surface and that a substantial portion of C3 found on commensal organisms is deposited through this . pathway Recently, Palm and colleagues reported that IgA can be found bound to the surface of commensal organisms recovered from intestinal contents (86). Interestingly, we detected substantial levels of IgG in fecal samples from healthy SPF mice that were comparable to the IgA levels we also observed.

Future studies might address whether the IgG detected in luminal contents is directed at the same commensal organisms that are coated with C3. Such a result would further implicate the classical pathway of complement activation ve as being acti in luminal secretions and as being responsible for C3 deposition on bacteria targeted by

IgG-‐mediated antigen recognition. Such a result might have implications for the mechanisms of protection of certain vaccines such as polysaccharide conjugate vaccines (e.g., pneumococcal and haemophilus vaccines) which are known to induce high levels of IgG but insignificant levels of IgA. These parenterally administered

59 vaccines may indeed protect the host by using IgG and complement-‐dependent pathways to control bacterial colonization by opsonophagocytosis or bacteriolysis within the milieu of mucosal . secretions

The work presented here also provided strong evidence that the composition of the gut microbiota is dramatically influenced by the expression of complement.

Both population-‐based 16S rRNA ling profi , as well as the new method we developed called -‐ C3 SEQ analysis, documented significant changes in the community structure of the intestinal microbiota that are linked to the presence or absence of C3. For example, bacteria such as Turicibacter, Ruminococcus, and Coprococcus were abundant in WT mice and notably undetectable -‐ in C3 /-‐ mice. Furthermore, there was no detectable replacement of these organisms by another unique bacterial group in

C3-‐/-‐ mice suggested that C3 is not likely to be involved in eliminating a separate group of organisms that competes with Turicibacter, Ruminococcus, and Coprococcus for the same intestinal niche. Through our -‐ C3 SEQ analysis we were further able to establish that distinctly different bacteria groups appear to be coated with C3 as well.

However, there was not a clear statistical correlations between these two data sets and this prevents us from concluding that C3 coating per se of specific organisms is directly responsible for the modulation of their relative abundance. It would also be exciting to know if the biology of commensal groups is affected when they are targeted by the C3 complement component. In this regard, it is interesting that the

Gram-‐negative species, Porphyromonas gingivalis, is thought to exploit complement receptor CR3 to invade phagocytic cells and increase its fitness in the oral mucosa, especially in the presence of neutrophils (92). Given that C3 is a potent opsonin, it

60 might possibly promote eukaryotic cell invasion by some facultative intracellular commensals. However, little is known about the in vivo -‐ habitat of C3 coated bacteria in mammals and whether these bacteria might survive or replicate within host phagocytic cells.

While we could not address the role of C3 in the biology of commensal taxa, we were able to show that C3 coated bacteria were more colitogenic. These experiments also parallel the results of Palm and colleagues for IgA (86). These investigators found that IgA coats bacteria species that were pathogenic and capable of driving disease severity in the DSS colitis model. They also observed that enteric bacteria recovered from IBD colitis patients were also more often the targets of IgA antibody.

Because IgA does not fix complement, it would be interesting to know if the same or different bacterial taxa are coated by C3 and IgA. Through direct transplantation experiments we showed that complement C3 coats colitogenic bacterial species and that these bacteria can exacerbate DSS colitis when transplanted into WT GF mice, at least as a mixed population. Unlike a classic pathogen, the C3-‐coated commensal bacteria we harvested from WT mice were unable to directly cause disease in homeostatic conditions probably due to WT mice’s capability of opsonizing these colitogenic bacteria within the total population. We speculate that when GF mice are challenged with enriched C3-‐coated colitogenic bacteria, the endogenous complement C3 in GF mice is not be sufficient to control the disbiotic colitogenic bacteria population. A imilar s situation has been observed in the case of human colitis caused by the potential pathobiont Clotstridium difficile. C. difficile is a member of the commensal microbiome of many healthy human individuals. Its level is usually kept

61 in check by intact commensal microbiome. However, when patients are treated with antibitiocs, the balance between healthy symbionts and pathobionts is disrupted and the blooming of a potential pathobiont such as C. difficile subsequently causes colitis.

It will be interesting to examine -‐ whether C3 coated bacteria drive even stronger pathological inflammatory responses 3 in GF C -‐/-‐ mice.

Figure 14. Schematic illustration of experiments that showed that complement C3 coated bacteria are colitogenic in vivo.

In conventional (SPF) m mice, icrobiota comprises healthy commensals and a small portion of potentially pathogenic pathobionts. A portion of commensal microbiota is selectively opsonized by complement component C3 C3. coating selectively marks the potential disease-‐driving pathobionts in mice. In healthy mice, the level pathobionts of is kept due low to the complement ation opsoniz and competition with other innocuous commensal microbes. When disease -‐driving, pathobionts are purified by FACS of sorting C3 coated microbes and then used to colonize Germ an free mice, imbalance occurs and these pathobionts become dominant in the microbiota transplated mice. Consequently, these colitogenic bacteria exacerbate the intestinal inflammation.

Chapter VI. Conclusions and Future Studies

Our studies provide insights into the production, regulation, and expression of

C3 within the environment of the murine intestine. We found that this component of complement is likely made by intestinal epithelium and is apparently secreted into the gut men, lu where it can react with commensal and pathogenic bacterial species.

The fate of bacterial cells -‐ that had surface accessible ligated C3 was not addressed directly in our studies. We did see that C3 had a protective role in controlling

Citrobacter rodentium. However, these experiments -‐ used C3 /-‐ mice that are defective in C3 production not only in the intestinal mucosa but also in the bloodstream. It is formally possible that the protective effects we observed derive from C3 produced by the -‐ liver. Blood or lymphocyte-‐derived C3 might have a protective role in the gut, leaking from the basolateral side of the epithelium (i.e., serosa) into the apical side if the integrity of the epithelial barrier is compromised by

C. rodentium infection. This possibility seems unlikely because this organism -‐ is a non invasive pathogen, but it remains a potential topic for investigation in future studies.

For example, mice with epithelial C3 expression specifically deleted (Villin-‐Cre C3 floxed mice) can be used ress to add this matter. To this end, mice that have their C3 gene flanked by loxP sites would need to be bred with mice that express the Cre recombinase under the villin gene promoter. The F2 progeny of this cross would presumably have the C3 gene knockout only in intestinal epithelial cells that express the villin gene. The use of such mice would permit measurement of the relative contributions of epithelium-‐produced C3 and systemically derived C3 -‐ (e.g., liver or

64 lymphocyte-‐produced C3) to the protective s effect of this complement component.

This genetic system might also be useful in investigating whether the changes in intestinal microbiota that we observed in WT -‐ vs. C3 /-‐ mice are driven by local or systemically derived C3 (see below).

The data presented in this thesis support the conclusion that the intestinal microbiota can stimulate production of C3 by the intestinal epithelium. Future studies might define the mechanism of this interesting phenomenon. For example, it is reasonable to assume that unique components of the bacterial cell might trigger this response in the epithelium. A working hypothesis that might be explored is that one of the innate immune pathways that -‐ recognize pathogen associated and microbial-‐ associated molecular patterns (PAMPs and MAMPs) is involved in regulating expression and/or secretion of complement C3. PAMP is clearly a misnomer, in that many PAMPs are made by commensal (nonpathogenic) organisms. MAMP is a more general term for molecules produced al by commens microbes that can trigger changes in homeostatic gene expression in the host (93). Because innate immune pathways that recognize P AMPs and MAMPs are involved in regulating the expression and/or secretion of -‐ many anti microbial peptides, this looks to be a reasonable hypothesis to pursue. Numerous innate immune knockout mice would be appropriate to use in a search for a signal transduction pathway that is utilized to activate C3 expression and provide information about the receptors mediating this response and the potential bacterial agonists that are recognized. Among these knockout mice are those defective in NF-‐κB, MyD88, Raf1, SyK, Traf6, various TLRs, and STING. Ideally, each of the knockout lines would available in both GF and SPF versions; in that case,

65 one could quickly assess whether C3 levels in the feces were affected by an intestinal microbiota in a given genetic background. For example, if STING defective GF and SPF mice showed no difference between their epithelial cell C3 mRNA levels and fecal C3 protein levels, then one might conclude di-‐cyclic nucleotides (the microbial MAMP recognized by STING) were the agonists mediating activation of C3 gene expression.

Since mutant alleles of STING that are -‐ blind to microbial di cyclic nucleotides but sensitive to the product of cGAS exist, it might be possible (though the use of corresponding mouse lines) to implicate endogenous enzymes like cGAS as the sensor of microbial DNA derived from commensal microorganisms. It might also be possible to use mammalian cell lines to gain insights into the C3 induction pathway. For example, we observed that the epithelial cell line Caco-‐2 responded to bacterial extracts with -‐ up regulation of C3 production. -‐ CRISPR based genetics could be used with the right cell line to learn more about the signal transduction pathway that leads to up-‐regulation of C3. uld One co envision using such a cell line, knocking out genes in pathways of interest (for example, the various TLRs, MyD88, TRIF, IRF3, JAK3, etc.), and then testing the knockouts for bacterial product–dependent induction of C3.

Small molecule drugs that pharmacologically block pathways of interest in cell lines

(for example, rapamycin inhibition of mTOR or tofacatinib inhibition of JAK3, etc.) might also be systematically tested for their ability block induction of C3 after exposure to bacterial products.

Another interesting conclusion that emerged from my thesis research is that

C3 can alter the composition of the intestinal microbiota and that this alteration can have measurable effects on inflammatory disease outcomes. This result is in line with

66 many other studies that have implicated changes in the microbiota as the underlying reason that some genetic defects show phenotypic consequences. Mechanistically, little is known about these phenomena, which therefore remain a fertile area for future investigation.

In the end, some of the same answers may apply to different questions. Thus, a unique microbial agonist might be responsible for inducing C3 expression in the intestine, altering immune homeostasis, and thus modulating inflammation in positive or e negativ ways. For example, the zwitterionic polysaccharide PSA of

Bacteroides fragilis is known to induce changes in the -‐ Th1/Th2 effector T cell ratio in mice that can influence the outcome and resolution of highly inflammatory intestinal abscesses. PSA is a TLR2 agonist, and this pharmacological activity appears to be involved in these immunomodulatory effects (94). Another bacterial group

(Akkermansia) has been reported to produce a lipoprotein called Amuc1100 that is also a TLR2 agonist and that this protein, in the context of pasteurized bacterial cells, is at least partially responsible for the positive effects that this organism has in mouse obesity models that includes improved intestinal barrier function (95). One wonders if all TLR2 agonists when delivered mucosally can cause positive effects on metabolic parameters associated with obesity or protect against inflammatory states by altering the Th1/Th2 balance or intestinal barrier . function The immunomodulatory effects of

B. fragilis PSA have also been found to be protective in a T cell transfer colitis model

(i.e., Rag-‐/-‐ mice colonized with Helicobacter hepaticus with T cell transfer). Thus, it would be interesting to see whether PSA or pasteurized A. muciniphila has a protective effect -‐ in Rag /-‐ mice or -‐ in C3 /-‐ mice challenged with H. hepaticus. This

67 line of work might help determine whether specific members of the microbiota, such as Bacteroides and Akkermansia species, use common or distinct s pathway to modulate the immune system and other disease states (e.g., morbid metabolic syndromes) that might be associated with obesity, diabetes, and cardiovascular disease.

Despite many efforts to address the role of the microbiota and its relationship to e th host immune system, the individual variability of the microbiota across different facilities, different genotypes, different diets, and even different cages can make these studies challenging. The reproducibility of experimental results that have been tributed at to the influence of the microbiota on the host is also troublesome for investigators in this field. Sometimes the microbiota's modulatory effects can be traced to a key organism. For example, SFB is present in Taconic Farms B6 mice but not in son Jack Laboratory B6 mice. SFB contributes to the differences in the Th17 cell population in the small-‐intestinal lamina propria that are evident in these two sources of presumably identical B6 mice. Our recent microbiome sequencing results

(unpublished observations of the Kasper laboratory) showed that even the same mouse genotype—in this case, -‐ Dectin deficient mice obtained from two sources (the

Harvard Medical School SGM facility and Jackson Laboratory)—display opposite phenotypes in regard to colonic Treg levels present in colonic samples. Through 16S rRNA sequencing analysis, it was shown that the compositions of the microbiota in these two groups of mice were distinctively different. If researchers had attempted to compare the Treg population in ctin WT and De -‐deficient mice, they could have drawn opposite conclusions depending on what source of mice they used.

68 In conclusion, the research reported in this thesis will provide important clues about the role of complement in shaping the mmensal composition of the co gut microbiota. The recent recognition that differences in the human gut microbiota might affect chronic diseases as well as the effectiveness of groundbreaking immunotherapies for cancer underscores our hope that these studies might someday translate into improvements in human health.

Material and Methods

Fecal and serum C3 measurement

Colonic contents were collected from intestines that were harvested from mice shortly after sacrifice. Contents were weighed and normalized to a concentration of 100 mg/ml to produce fecal suspensions. Fecal suspensions were clarified by centrifugation, and the corresponding fecal supernatant fluids were assayed for C3 content with a commercial ELISA kit (abcam Cat. No. ab 157711).

Only fecal supernatants that had a concentration range of 10–50 mg/ml were used for ELISA analysis. Serum was collected from heart blood at the time of sacrifice and typically diluted 50,000-‐fold before use in the same C3 ELISA assay employed for fecal pernatants. su All concentrations of C3 in the feces were calculated as μg/g, based on the C3 standard provided by the commercial vendor.

Mouse antibiotic treatment and cohousing experiments

B6 mice – (7 10 weeks old, Taconic Farms) were treated -‐ with a four antibiotic cocktail containing ampicillin (1 g/L), vancomycin (0.5 g/L), neomycin (1 g/L), and metronidazole (1 g/L), supplied in drinking water for 2 weeks. Fecal bacterial counts (CFU) were determined on TSA agar (with sheep blood) under aerobic conditions and on Brucella agar (with sheep blood) under anaerobic conditions.

Mice that were fecal CFU negative under both aerobic and anaerobic conditions were considered to have received effective treatment and were used in the

70 antibiotic-‐treated group for fecal C3 level comparison. At the same time, B6 GF mice from our facilities were cohoused (3:1) with conventional Taconic Farms B6 mice for 2 weeks. Colonic contents were collected nalysis. for fecal C3 a Feces -‐ were re suspended in ELISA reagent diluent to a final concentration of 20 mg/ml. Fecal C3 was back-‐calculated as μg/g of feces.

Immunofluorescence

Intestinal tissue (~2 cm) was collected and immediately fixed in 2% formalin for 2 m h at roo temperature. I then used OCT (optimal cutting temperature compound) to freeze tissue on dry ice. Once tissue was totally frozen, it was stored at -‐80°C for later use or sectioned immediately at a thickness of 8 μm. Intestinal tissue was stained with antibody to C3 (alpha diagnostics C311-‐BTN), typically after a 1:100 dilution. The secondary antibody, streptoavidin-‐647, was used at a 1:500 dilution. Mowiol with DABCO mounting medium was used for slide preparation and a Zeiss Imager M1 fluorescence pe microsco for imaging analysis.

RNAscope

Intestinal tissue was cut open longitudinally, and thecontents were washed out and collected before tissue was fixed in 10% formalin for 24 h. Tissue was then dehydrated in 70% ethanol, embedded in paraffin, d and sectione into 5-‐μm slices. A custom probe for mouse C3 was designed and -‐ used to probe paraffin embedded tissue slices. The hybridization protocol used according to the manufacturer's manuals for RNAscope 2.5 — HD assay Brown (ACDbio).

16S rRNA profiling of robiota the mic in WT -‐ and C3 /-‐ mice

Fecal pellets were collected; DNA was extracted and then measured with two commercial kits (Qiagen stool DNA kit catalog No./ID: 5150 and the Oubit kit from

Invitrogen). Purified DNA was adjusted to a concentration of 6 ng/ml before being subjected to PCR amplification with barcoded -‐ 16S rRNA 515f 806r primer pairs, as previously described (84). In brief, samples were amplified in quadruplicate; i.e., each sample was amplified in four replicate -‐ 20 µL PCR reactions on four different

PCR machines. The primers used were as follows:

515f PCR forward primer:

AATGATACGGCGACCACCGAGATCTACACGCTTATGGTAATTGTGTGCCAGCMGCCGCG

GTAA;

806r PCR primer:

CAAGCAGAAGACGGCATACGAGATXXXXXXXXXXXXAGTCAGTCAGCCGGACTACHVGGG

TWTCTAAT (in which XXXXXXXXXXXX represents the r manufacture 's barcodes).

The conditions for PCR using 96-‐well thermocyclers were as ( follows: 1) 94°C, 3 min; (2) 94°C, 45 sec; (3) 50°C, 60 sec; (4) 72°C, 90 sec; (5) repeat steps – 2 4, 35 times; (6) 72°C, 10 min; and (7) 4°C hold. The quadruplicate PCR reactions for each sample were combined into a single volume. Samples were evaluated by agarose gel electrophoresis for a band of ~390 bp, , and if present, DNA was purified and measured with AMpure beads and Qubit (Invitrogen) kits according to the manufacturer's protocols. Purified DNA product samples were analyzed for quality

72 control with sequence primers before the same quantity was loaded onto the MiSeq instrument as follows: read 1 sequencing primer:TATGGTAATTGTGTGCCAGCMGCC

GCGGTAA; read 2 sequencing primer: AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT; index sequence primer: ATTAGAWACCCBDGTAGTCCGGCTGACTGACT. Samples that passed quality-‐control analysis were analyzed with a -‐ Mi Seq V3 600 per the standard manufacturer's protocol, with 30% phage PhiX DNA spiked into sequencing reactions to increase the complexity of the library and as an internal control.

Construction of chimeric mice with WT and -‐ C3 /-‐ bone marrow and testing in the DDS colitis model

Differentially congenic marked recipient B6 -‐ WT and C3 /-‐ mice were used as reciprocal donors and . recipients Mice in the two groups were lethally irradiated with 1000 Gy 24 h before -‐ retro orbital intravenous transplantation 7 of 10 whole bone marrow cells harvested -‐ from 6 to 8-‐week-‐old WT -‐ or C3 /-‐ mice. Mice were given Baytril (0.1 mg/L) in drinking water for 2 weeks to prevent infections and were rested for another 6 weeks before being cohoused with WT conventional mice for 2 . weeks At 10 weeks after transplantation, the bone marrow chimeras that survived were challenged by the standard procedure for inducing DSS colitis. Mice in both groups were scored histologically for degree of colitis and level of epithelial localized C3, as described above.

Flow cytometry analysis of C3-‐coated fecal bacteria

73 Prior to collection of samples, the concentration of viable fecal bacteria was determined by measuring CFU/g of fecal material collected ; from WT B6 SPF mice direct plating on TSA sheep blood agar under aerobic conditions and by Brucella sheep blood agar under anaerobic conditions was used. A dilution that allowed ~107 viable cells in samples for FACS analysis was determined. Fecal pellets were then collected and resuspended in PBS containing a Roche proteinase inhibitor cocktail

(Roche Cat. No. 04693159001) at the predetermined approximate level of CFU/ml.

Cell suspensions were centrifuged at 50 × g for 10 min at 4°C in order to pellet large particulate material. The supernatant fluids were filtered -‐ through a 40 μm filter, and the flow-‐through was centrifuged to collect the bacterial cell pellet. Fecal bacteria were then "washed" by resuspension of the pellet and re-‐centrifuged in PBS with the proteinase inhibitor; both steps were then repeated. The washed l bacteria cells were resuspended in PBS containing 2% BSA and incubated for 30 min at 4°C before the addition of 1:10 volume of rabbit body anti to mouse C3 -‐ (sc 20137). After incubation at ° 4 C for 1 h, bacterial cells were washed twice and resuspended in PBS containing 1:10,000-‐diluted goat -‐ anti rabbit IgG-‐647 antibody (Invitrogen). After 30 min at ° 4 C, bacterial cells were washed again and resuspended in PBS before being analyzed on a Macquant FACS instrument (Miltenyi Biotec).

FACS collection of C3+ and C3-‐ fecal bacteria for microbiota transplantation and 16S sequence analysis

Bacteria were collected from fecal samples from WT B6 SPF mice as described in the previous , section except that the first antibody used before FACS

74 analysis and cell fraction collection was an anti-‐C3 FITC antibody (Biolegend -‐ sc

28294) at a dilution of ~1:20. After incubation for 1 h, bacteria were washed twice and resuspended in PBS. Cells were then sorted on a FACSAria cell sorter (BD) and pooled into + C3 and -‐ C3 fractions. Sorted cells were plated onto TSA and Brucella agar to check for viability and were also checked (by FACS analysis on a

MACSQUANT instrument) for purity with regard to their C3+ positive or C3-‐ status.

DNA was extracted from C3+ and -‐ C3 bacteria for 16S rRNA sequencing analysis with

515F and -‐barcoded 806R primers, as described above. C3+ and -‐ C3 bacteria were transplanted into B6 GF mice at 4 weeks of age. Mice with transplanted C3+ and -‐ C3 bacteria were raised in separate isolators for 5 weeks before feces were collected for microbial community analysis or before the animals were tested for sensitivity in the DSS colitis model.

DSS colitis model

Colitis was induced in mice with the well-‐established DSS colitis model (75,

76). In brief, 2.5% DSS (Cat. No. MP 0216011080) was added to drinking water for 5 days before a switch back to regular water for . another 5 days The animals' weight loss and general health were monitored during -‐ the 10 day experimental protocol. At day 10, animals a were s crificed, and the length of distal colon tissues (an indication of inflammation) was measured. These tissues were subsequently fixed n i Bouin’s solution and used for calculation of blind histopathology scores by the Harvard

Rodent Histology Core facility.

75 Citrobacter rodentium infection model

WT B6 -‐ and C3 /-‐ mice (~8–9 weeks old) were purchased from Jackson

Laboratory and used in C. rodentium challenge infections as follows: C. rodentium was grown o at 37 C in LB medium for 16 h before being harvested by centrifugation and resuspended. C. rodentium (~5×108 CFU in 100 µl of PBS buffer) were administered to mice by oral gavage. Animals' survival, weight, and disease symptoms were monitored daily for 3 weeks. Fecal burden (represented by CFU/g of feces) was monitored from day 10 . to day 21 For C3 deposition analysis, -‐ age matched WT and -‐ C3 /-‐ mice were oral infected with 5×108 CFU of a C. rodentium strain carrying a plasmid that constitutively expresses GFP (78). At day 7, fecal pellets were collected, and fecal bacteria were isolated as described earlier and stained with rabbit body anti to mouse C3 (Santa ruz C -‐ sc 20137) followed by goat anti-‐rabbit IgG-‐647. GFP+ C. rodentium cells ere w as identified + as FITC by flow cytometry on a MACSQUANT instrument.

References

1. J. R. Dunkelberger, -‐ W. C. Song, Complement and its role in innate and adaptive immune responses. Cell Res. 20, – 34 50 (2010).

2. M. Noris, G. Remuzzi, Overview of Complement Activation and Regulation. Semin. Nephrol. 33, 479–492 (2013).

3. D. Ricklin, S. E. Reis, J. D. Lambris, Complement in disease: a defence system turning offensive. Nat. Rev. Nephrol. 12, 383–401 (2016).

4. T. Fujita, M. Matsushita, Y. Endo, The lectin-‐complement pathway – its role in innate immunity and evolution. Immunol. Rev. 198, 85 1 –202 (2004).

5. M. C. Carroll, The complement system in regulation of adaptive immunity. Nat. Immunol. 5, 981–6 (2004).

6. P. J. Lachmann, P. Nicol, Reaction mechanism of the alternative pathway of complement fixation. Lancet, 465–467 (1973).

7. M. M. Markiewski, J. D. Lambris, The role of complement in inflammatory diseases from behind the scenes into Am. the spotlight. J. Pathol. 171, 715–27 (2007).

8. M. Ogundele, Role and significance of the complement system in mucosal immunity: Particular reference to the human breast milk complement. Immunol. Cell Biol. 79, – 1 10 (2001).

9. S. K. Law, N. A. Lichtenberg, Covalent binding and hemolytic activity of complement proteins. Proc. Natl. Acad. Sci. 77, 7194–7198 (1980).

10. H. D. Pettigrew, S. S. Teuber, M. E. Gershwin, Clinical significance of complement deficiencies. Ann. N. Y. Acad. Sci. 1173, 108–23 (2009).

11. E. T. M. Berends, A. Kuipers, M. M. Ravesloot, R. T. Urbanus, S. H. M. Rooijakkers, Bacteria under stress by complement FEMS and coagulation. Microbiol Rev. 38, 1146–1171 (2014).

12. D. Ricklin, E. S. Reis, J. D. Lambris, Complement in disease: a defence system turning offensive. Nat. Rev. Nephrol. 12, 383–401 (2016).

13. D. T. and Fearon, K. F. Austen, Activation of t the alternative complemen pathway with rabbit erythrocytes by circumvention of the regulatory action

77 of endogenous control proteins. J. Exp. Med. 146, – 22 33 (1977).

14. P. F. Zipfel, C. Skerka, Complement regulators and Nat. inhibitory proteins. Rev. Immunol. 9, 729–40 (2009).

15. M. Kolev, G. Le Friec, C. Kemper, Complement — tapping into new sites and effector systems. Nat. Rev. Immunol. 14, 811–820 (2014).

16. R. B. Sim, S. A. Tsiftsoglou, Design of Inhibitors for Proteolytic Cascades Proteases of the complement Bio system. chem. Soc. Trans. 32, – 21 27 (2004).

17. S. R. Barnum, Complement biosynthesis in the central nervous sytem. Crit Rev Oral Biol . Med 6, 132–146 (1995).

18. J. Rossbacher, M. J. Shlomchik, The B Cell Receptor Itself Can Activate Complement to Provide omplement the C Receptor 1/2 Ligand Required to Enhance B Cell Immune Responses In Vivo. J. Exp. Med. 198, 591–602 (2003).

19. S. E. Degn, J. C. Jensenius, -‐ S. Thiel, Disease Causing Mutations in Genes of the Complement System. Am. J. Hum. Genet. 88, 689–705 (2011).

20. C. Schulze et al., Clearance deficiency—A potential link between infections and autoimmunity. Autoimmun. Rev. 8, – 5 8 (2008).

21. S. Ram, L. A. Lewis, P. A. Rice, Infections of People with Complement Deficiencies and Patients Who Have plenectomy. Undergone S Clin. Microbiol. Rev. 23, 740–780 (2010).

22. K. E. Sullivan, Complement deficiency and autoimmunity. Curr. Opin. Pediatr. 10, 600–6 (1998).

23. A. Sekar et al., Schizophrenia risk from complex variation of complement component 4. Nature. 530, 177–83 (2016).

24. M. S. Edwards, D. L. Kasper, H. J. Jennings, C. J. Baker, A. Nicholson-‐Weller, Capsular sialic acid prevents activation of the alternative complement pathway by type III, group B J. streptococci. Immunol. 128, 1278–1283 (1982).

25. G. Hajishengallis, Periodontitis: from microbial immune subversion to systemic inflammation. Nat. Rev. Immunol. 15, – 30 44 (2015).

26. A. Klos et al., The Role of the Anaphylatoxins in Mol. Health and Disease. Immunol. 46, 2753–2766 (2009).

78 27. M. M. Markiewski, J. D. Lambris, The Role of Complement in Inflammatory Diseases From Behind the Scenes into Am. the Spotlight. J. Pathol. 171, 715– 727 (2007).

28. C. A. Alper, A. M. Johnson, A. G. Birtch, F. D. Moore, Human C’3: Evidence for the Liver as the Primary Site of Synthesis. Science. 163, 286–288 (1969).

29. M. Gadjeva et al., Macrophage-‐derived complement C4 can restore humoral immunity in -‐ C4 deficient mice. J Immunol. 169, 5489–5495 (2002).

30. N. C. H. and M. C. Michael a, B. Fischer, Minghe M Carroll, Local Synthesis of C3 Within the Splenic Lymphoid Compartment Can Reconstitute the Impaired Immune Response -‐ in C3 Deficient Mice. J Immunol. 160, 2619–2625 (1998).

31. A. Andoh, Y. Fujiyama, T. Bamba, S. Hosoda, Differential n cytokine regulatio of complement C3, C4, and factor B synthesis in human intestinal epithelial cell line, Caco-‐2. J Immunol. 151, 4239–4247 (1993).

32. A. Verschoor, M. A. Brockman, D. M. and Knipe, M. C. Carroll, Cutting Edge: Myeloid Complement C3 Enhances the esponse Humoral R To Peripheral Viral Infection. J Immunol. 167, 2446–2451 (2001).

33. D. M. K. and M. C. C. Admar Verschoor, Mark A. Brockman, Mihaela Gadjeva, J, Myeloid C3 Determines Induction of Humoral Responses to Peripheral Herpes Simplex Virus Infection. J Immunol . 171, 5363–5371 (2003).

34. H. R. Ahrenstedt O, Knutson L, Nilsson -‐ B, Nilsson Ekdahl K, Odlind B, Enhanced local production of complement components in the small intestines of patients with Crohn’s N disease. Engl . J Med 322, 1345–1349 (1990).

35. A. Andoh, Y. Fujiyama, T. Bamba, S. Hosoda, Differential cytokine regulation of complement C3, C4, and factor B synthesis in human intestinal epithelial cell line, Caco-‐2. J Immunol. 151, 4239–4247 (1993).

36. Y. Belkaid, T. W. Hand, Role of the Microbiota in Immunity and Inflammation. Cell. 157, 121–141 (2014).

37. H. Chung et al., Gut immune maturation depends on colonization with a host-‐ specific microbiota. Cell. 149, 1578–93 (2012).

38. J. C. Clemente, L. K. Ursell, L. W. Parfrey, R. Knight, The impact of the gut microbiota on human health: an integrative view. Cell. 148, 1258–70 (2012).

39. J. L. R. and S. K. Mazmanian, The gut microbiota shapes intestinal immune responses during health and disease. Nat. Rev. Immunol. 9, 313–324 (2009).

79 40. Y. K. Lee, S. K. Mazmanian, Has the Microbiota Played a Critical Role in the Evolution of the Adaptive Immune System? Science. 330, 1768–1773 (2010).

41. L. V Hooper, D. R. Littman, A. J. Macpherson, Interactions between the microbiota and the immune system. Science. 336, 1268–73 (2012).

42. I. I. Ivanov et al., Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell. 139, 485–98 (2009).

43. S. K. Mazmanian, J. L. Round, D. L. Kasper, A microbial symbiosis factor prevents intestinal inflammatory disease. Nature. 453, 620–5 (2008).

44. J. L. Round, S. K. Mazmanian, Inducible -‐ Foxp3 + regulatory T cell development by a commensal bacterium of the intestinal microbiota. Proc. Natl. Acad. Sci. 107, 12204–12209 (2010).

45. J. L. Round et al., The -‐ Toll like receptor 2 pathway establishes colonization by a commensal of the human microbiota. Science. 332, 974–7 (2011).

46. K. Atarashi et al., Induction of colonic regulatory T cells by indigenous Clostridium species. Science. 331, 337–41 (2011).

47. K. Atarashi et al., T reg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature. 500, 232–238 (2013).

48. Y. Furusawa et al., Commensal microbe-‐derived butyrate induces the differentiation of colonic regulatory Nature T cells. . 504, 446–450 (2013).

49. P. M. Smith et al., The Microbial Metabolites, Short-‐Chain Fatty Acids, Regulate Colonic Treg Cell Homeostasis. Science. 4, – 1 3 (2013).

50. N. Arpaia et al., Metabolites produced by commensal bacteria promote peripheral regulatory -‐ T cell generation. Nature . 504, 451–455 013). (2

51. Y. Yang et al., Focused Specificity of Intestinal Th17 Cells towards Commensal Bacterial Antigens. Nature. 510, 152–156 (2014).

52. N. Geva-‐Zatorsky et al., Mining the Human Gut Microbiota for Immunomodulatory Organisms. Cell. 168, 928–943 (2017).

53. M. Y. et Zeng al., Gut Microbiota-‐Induced Immunoglobulin G Controls Systemic Infection by Symbiotic Bacteria and Pathogens. Immunity. 44, 647–658 (2016).

54. P. Van De Perre, Transfer of antibody Vaccine via mother’s milk. . 21, 3374–

80 3376 (2003).

55. J. M. Woof, M. A. Ken, The function of immunoglobulin A in immunity. J. Pathol. 208, 270–282 (2006).

56. N. J. Mantis, N. Rol, B. Corth, Secretory IgA’s complex roles in immunity and mucosal homeostasis in the gut. Mucosal Immunol. 4, 603–611 (2011).

57. L. Winner et al., New Model for Analysis of Mucosal Immunity: Intestinal Secretion of Specific Monoclonal Immunoglobulin A from Hybridoma Tumors Protects against Vibrio cholerae Infect. Infection. Immun. 59, 977–982 (1991).

58. E. W. Rogier et al., Secretory antibodies in breast milk -‐ promote long term intestinal homeostasis by regulating the gut microbiota and host gene expression. Proc. Natl. Acad. Sci. 111, 3074–3079 (2014).

59. N. W. Palm et al., Immunoglobulin A Coating Identifies Colitogenic Bacteria in Inflammatory Bowel Disease. Cell. 158, 1000–1010 (2014).

60. K. Yoshiya et al., Depletion of gut commensal bacteria attenuates intestinal ischemia / reperfusion injury. Am. J. Physiol. Gastrointest. Liver Physiol. 301, 1020–1030 (2011).

61. J. A. Guttman, B. B. Finlay, Tight junctions as targets of infectious agents. Biochim. Biophys. . Acta 1788, 832–841 (2009).

62. M. Yoshida et al., Neonatal Fc receptor for IgG regulates mucosal immune responses to luminal bacteria. J. Clin. Invest. 116, 142 2 –2151 (2006).

63. C. Parsot, E. Taxman, J. J. Mekalanost, ToxR regulates the production of lipoproteins and the expression of serum resistance in Vibrio cholerae. Immunology. 88, 1641–1645 (1991).

64. M. Potempa, J. Potempa, -‐ Protease dependent mechanisms of complement evasion by bacterial pathogens. Biol. Chem. 393, 873–888 (2012).

65. D. Belstrøm et al., The Atherogenic Bacterium Porphyromonas gingivalis Evades Circulating Phagocytes by Adhering to Infect. Erythrocytes. Immun. 79, 1559–1565 (2011).

66. E. Sefik et al., Individual intestinal symbionts induce a distinct population of RORγ+ regulatory T cells. Science . 349, 993–997 (2015).

67. T. Ayabe et al., Secretion of microbicidal α-‐defensins by intestinal Paneth cells in response to bacteria. Nat . Immunol. 1, 113–118 (2000).

81 68. H. L. Cash, Symbiotic Bacteria Direct Expression of an Intestinal Bactericidal Lectin. Science. 313, 1126–1130 (2006).

69. L. L. et Korn al., Regulatory T Cells Occupy an Isolated Niche in the Intestine that Is Antigen Independent. Cell Rep. 9, 1567–1573 (2014).

70. M. C. Moreau, R. Ducluzeau, -‐ D. Guy Grand, A. M. C. Muller ’, Increase in the Population of Duodenal Immunoglobulin A Plasmocytes in Axenic Mice Associated with Different Living or Dead Bacterial Strains of Intestinal Origin. Infect. Immun. 21, 532–539 (1978).

71. J. Benveniste, G. Lespinats, C. Adam, J. . Salomon, Immunoglobulins in Intact, Immunized, and Contaminated Axenic Mice: Study of Serum IgA. J Immunol. 107, 1647–1655 (1971).

72. J. Benveniste, G. Lespinats, J. Salomon, Serum and secretory IgA in axenic and holoxenic mice. J Immunol. 107, 1656–1662 (1971).

73. C. L. Bevins, N. H. Salzman, Paneth cells, antimicrobial peptides and maintenance of intestinal homeostasis. Nat. Rev. Microbiol. 9, 356–369 (2011).

74. F. Wang et al., RNAscope: A Novel in Situ RNA Analysis Platform for Formalin-‐ Fixed, Paraffin-‐Embedded Tissues. J. Mol. Diagnostics. 14, – 22 29 (2012).

75. H. S. Cooper, S. N. Murthy, R. S. Shah, D. J. Sedergran, Clinicopathologic study of dextran sulfate sodium experimental murine colitis. Lab. Invest. 69, 238–49 (1993).

76. L. A. Dieleman et al., Dextran sulfate sodium-‐induced colitis occurs in severe combined immunodeficient mice. Gastroenterology. 107, 1643–1652 (1994).

77. C. Hernández-‐Chirlaque et al., Germ-‐free and Antibiotic-‐treated Mice are Highly Susceptible to Epithelial Injury in J. DSS Colitis. Crohn’s Colitis, 1324– 1335 (2016).

78. C. Belzer, Q. Liu, M. C. Carroll, L. Bry, The role of specific IgG and complement in combating a primary mucosal infection of the gut epithelium. Eur. J. Microbiol. Immunol. (Bp). 1, 311–318 (2011).

79. A. Cherukuri, P. C. Cheng, S. K. Pierce, The Role of the CD19/CD21 Complex in B Cell Processing and Presentation of Complement-‐Tagged Antigens. J Immunol. 167, 163–172 (2001).

80. R. Mundy, T. Donald, T. Mac G. Dougan, G. Frankel, S. Wiles, Citrobacter rodentium of mice and man. Cell. Microbiol. 7, 1697–1706 (2005).

82 81. S. A. Luperchio, D. B. Schauer, Molecular pathogenesis of Citrobacter rodentium and transmissible murine colonic hyperplasia. Microbes Infect. 3, 333–340 (2001).

82. Lora V. Hooper and Andrew J. Macpherson, Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat. Rev. Immunol. 10, 159–169 (2010).

83. C. Moon et al., Vertically transmitted faecal IgA levels determine extra-‐ chromosomal phenotypic variation. Nature . 521, – 90 95 (2015).

84. J. G. Caporaso et al., Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc. Natl. Acad. Sci. 108, 4516–4522 (2011).

85. N. Segata et al., Metagenomic biomarker discovery and explanation. Genome Biol. 12, – 1 18 (2011).

86. N. W. Palm et al., Immunoglobulin A Coating Identifies Colitogenic Bacteria in Inflammatory Bowel Disease. Cell. 158, 1000–1010 (2014).

87. A. L. Kau et al., Functional characterization of IgA-‐targeted bacterial taxa from undernourished Malawian children that produce -‐ diet dependent enteropathy. Sci. Transl. Med. 7, – 1 15 (2015).

88. J. D. Planer et al., Development of the icrobiota gut m and mucosal IgA responses in twins and gnotobiotic mice. Nature. 534, 263–266 (2016).

89. A. Everard et al., Cross-‐talk between Akkermansia muciniphila and intestinal epithelium controls diet-‐induced obesity. Proc. Natl. Acad. Sci. 110, 9056– 9071 (2013).

90. B. F. Tack, R. A. Harrison, J. Janatova, M. L. Thomas, J. W. Prahl, Evidence for presence of an internal thiolester bond in third component of human complement. Proc. Natl. Acad. Sci. 77, 5764–5768 (1980).

91. K. L. Mohawk, A. D. O’Brien, A. D. Brien, Mouse models of Escherichia coli O157:H7 infection and shiga toxin injection. J. Biomed. Biotechnol. 2011, – 1 17 (2011).

92. I. Olsen, J. D. Lambris, G. Hajishengallis, Porphyromonas gingivalis disturbs host–commensal homeostasis by changing mplement co function. J. Oral Microiology. 9, – 1 11 (2017).

93. T. Boller, G. Felix, A Renaissance of Elicitors: -‐ Perception of Microbe

83 Associated Molecular Patterns and Danger Signals -‐ by Pattern Recognition Receptors. Annu. Rev. Plant . Biol 60, 379–406 (2009).

94. S. K. Mazmanian, C. H. Liu, A. O. Tzianabos, D. L. Kasper, An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell. 122, 107–18 (2005).

95. H. Plovier et al., A purified membrane protein from Akkermansia muciniphila or the pasteurized bacterium improves metabolism in obese and diabetic mice. Nat. Med. 23, 107–113 (2017).