DIVERSIDADE DO GÊNERO Halimeda J. V. LAMOUR (BRYOPSIDALES, CHLOROPHYTA) NO OCEANO ATLÂNTICO OCIDENTAL

CAROLINE FEIJÃO XIMENES

RECIFE 2019 ii

CAROLINE FEIJÃO XIMENES

DIVERSIDADE DO GÊNERO Halimeda J. V. LAMOUR (BRYOPSIDALES, CHLOROPHYTA) NO OCEANO ATLÂNTICO OCIDENTAL

Tese apresentada ao Programa de Pós-Graduação em Botânica da Universidade Federal Rural de Pernambuco, como requisito para a obtenção do título de Doutor em Botânica.

Orientadora: Profa. Dra. Sonia Maria Barreto Pereira Programa de Pós-Graduação em Botânica - UFRPE

Co-orientadoras: Dra. Maria de Fátima de Oliveira Carvalho Universidade Federal de Pernambuco

Profa. Dra. Valéria Cassano Universidade de São Paulo

RECIFE 2019 iii

DIVERSIDADE DO GÊNERO Halimeda J. V. LAMOUR (BRYOPSIDALES, CHLOROPHYTA) NO OCEANO ATLÂNTICO OCIDENTAL

CAROLINE FEIJÃO XIMENES

Tese defendida e ______em __/___/____.

Orientadora: ______Profa. Dra. Sonia Maria Barreto Pereira Universidade Federal Rural de Pernambuco – UFRPE

Examinadores: ______Profa. Dra. Mariana Cabral de Oliveira (titular) Universidade de São Paulo – USP

______Profa. Dra. Enide Eskinazi-Leça (titular) Universidade Federal de Pernambuco – UFPE

______Prof. Dr. Reginaldo de Carvalho (titular) Universidade Federal Rural de Pernambuco – UFRPE

______Profa. Dra. Margareth Ferreira de Sales (titular) Universidade Federal Rural de Pernambuco – UFRPE

______Prof. Dr. Watson Arantes Gama Júnior (suplente) Universidade Federal Rural de Pernambuco – UFRPE

______Prof. Dr. Rodrigo César Gonçalves de Oliveira (suplente) Universidade Federal de Pernambuco – UFPE

Dedico Aos meus pais Pedro e Rosário por todo apoio, amor e incentivo. Eu não estaria aqui sem vocês. v

“Tenho visto o trabalho que Deus deu aos filhos dos homens, para com ele os exercitarem. Tudo fez formoso em seu tempo; também pôs o mundo no coração do homem, sem que este possa descobrir a obra que Deus fez desde o princípio até ao fim. Já tenho entendido que não há coisa melhor para eles do que alegrar-se e fazer bem na sua vida; E também que todo o homem coma e beba, e goze do bem de todo o seu trabalho; isto é um dom de Deus. Eu sei que tudo quanto Deus faz durará eternamente; nada se lhe deve acrescentar, e nada se lhe deve tirar; e isto faz Deus para que haja temor diante dele.”

Eclesiastes 3:1-14 vi

AGRADECIMENTOS

A minha total gratidão a Deus pela oportunidade de ter vivido esses momentos. Ninguém faz um doutorado sozinho, esta tese contou com a colaboração direta e indireta de muitas pessoas e colaboração de várias instituições. Ao CNPq, pela bolsa concedida. A CAPES pelo financiamento parcial do projeto PNPD que custeou a coleta de amostras doadas para esse estudo. Ao Programa de Pós-Graduação em Botânica da Universidade Federal Rural de Pernambuco, pelo apoio acadêmico. As secretarias Kênia Muniz e Cynara Leleu, pelos atendimentos. A minha grande mentora e orientadora, profa. Dra. Sonia Maria Barreto Pereira, pelas trocas de conhecimento, pelo apoio profissional e pela amizade. A minha co-orientadora e amiga, Dra. Maria de Fátima de Oliveira-Carvalho, pelos ensinamentos e amizade, por sempre ter uma palavra positiva e generosidade em ajudar sempre que solicitada. A minha co-orientadora e também mentora, profa. Dra. Valéria Cassano, por viabilizar o projeto em muitas formas, através do networking com outros pesquisadores para obtenção das amostras, pela participação no planejamento do sequenciamento de DNA, disponibilidade no uso do Laboratório de Algas Marinhas da Universidade de São Paulo (LAM, USP) e na participação nos manuscritos, sempre que solicitada. Aos professores Abel Senties (Universidad Autônoma Metropolitana) e Lígia Collado-Vides (Florida Internacional University) pela coleta e envio das amostras do Caribe. Thanks so much you for this. Ao professor Heroen Verbruggen, pela sugestão do projeto e pela participação em um dos capítulos. I am very gratefull for your insights. A profa. Dra. Ana Benko, pela disponibilidade de uso do Laboratório de Genética e Biotecnologia Vegetal (LGBV, UFPE). As equipes dos laboratórios LABOFIC, LGBV e LAM, por onde andei nos últimos quatros anos, pelo suporte técnico. Aos professores Carmen Zickel, Ariadne Moura, Reginaldo de Carvalho, Teresa Buril e Ana Vírginia, coordenadores do PPGB dos últimos, pela disponibilidade aos atendimentos acadêmicos. Aos professores Mariana Cabral, Reginaldo de Carvalho, Enide Eskinazi-Leça, Margareth Sales, Rodrigo Oliveira e Watson Gama-Jr, por ter aceito compor a banca e pelas revisões do texto. vii

A minha família, pelo suporte emocional, em especial aos meus pais Pedro e Rosário, minha irmã, Jhaniciara e meus sobrinhos amados Ashley e João Pedro. Aos amigos com quem compartilhei momentos bons e ruins, prefiro não os listar para não correr a gafe de esquecer algum, mas vocês sabem quem vocês são.

viii

Lista de Figuras

Figure A - Map of the geographical distribution of Halimeda species (Chlorophyta) on the coast of Brazil. TWP, Tropical Warm Province; TZ, Transition Zone; Hs, H. simulans; Hi, H. incrassata; Hg, H. aff. gracilis; Hc, H. aff. cuneata (= H. jolyana); Hd, H. aff. discoidea; Ht, H. aff. tuna; Ho, H. opuntia...... 36 Figures B - Habit of the studied species. (2) H. tuna (3) H. opuntia (4) H. aff. discoidea (5) H. simulans (6) H. aff. gracilis (7) H. aff. cuneata (= holotype of H. jolyana) (8) H. incrassata. Scale bars = 1 cm ...... 41 Figura C - Consensus tree derived from Neighbour-Joining analyses of tufA sequences. Values above each branch refer to NJ (Neighbour-Joining), ML (maximum likelihood) bootstrap values and BI (Bayesian posterior probabilities), respectively. Brazilian samples generated in this study are in bold; – indicates lack of support; * indicates bootstrap support = 100%; LT indicates type locality...... 43 Figure D - Bayesian chronogram for the genus Halimeda resulting from the BEAST analysis, showing the relationship of species present in Brazil (grey boxes) with those from elsewhere. Branch support is given as Bayesian posterior probabilities (BEAST analysis, shown if > 0.90) and ML bootstrap values (RAxML analysis, shown if > 50)...... 46 Figure E - Habit of the new species Halimeda jolyana. Scale bars = 1 cm. Fig. 11. Patch of plants growing on a rocky shore in the low intertidal (HV05229, Espírito Santo, Marataizes, Praia da Cruz). Fig. 12. Dense plant growing in a rock pool in the mid- intertidal (HV05091, Espírito Santo, Ubu, Praia de Parati). Fig. 13. Appearance of live plant in field laboratory, showing common discoid segments (HV05086, Espírito Santo, Ubu, Praia de Parati). Fig. 14. In situ photograph showing very thickset appearance of segments (Espírito Santo, Marataízes, Praia da Cruz). Fig. 15. Live plant showing very thick segments (HV05221, Espírito Santo, Marataízes, Praia da Cruz)...... 47 Figure F- Gametangia of the new species Halimeda jolyana. Scale bars = 5 mm. Fig. 16. In situ photograph of a fertile branch with segments still green (HV05153). Fig. 17. Ghost thallus from which gametes have been released. Fig. 18. Gametangia lining distal segment edge and occurring in patches on the segment surface (HV05198). Figs 19–22. Detailed view of gametophore clusters. All material collected in Espírito Santo state (Anchieta, Praia dos Castelhanos). Scale bars = 500 µm...... 48 Figure G – Erros bars on the node ages of Bayesian chronogram for the genus Halimeda resulting from the BEAST analysis...... 60 Figure H - Consensus tree derived from Bayesian inference of tufA sequences...... 71 ix

Figure I - Consensus tree derived from Bayesian inference of rbcL sequences...... 72 Figure J - Halimeda soniae Ximenes, Oliveira-Carvalho, M.E. Bandeira-Pedrosa et Cassano sp. nov. (3) Holotype specimen (PEUFR 52084). Scale bar = 1 cm. (4) Isotype specimen (SPF58088 A). Scale bar = 1 cm. (5) Primary utricles on surface view. Scale bar = 50 µm. (6) Nodal fusion complete by two filaments. Scale bar = 100 µm. (7) Primary and secondary utricles on frontal view, secondary utricles with clavate shape. Scale bar = 25 µm...... 75 Figura K - Árvore consenso de Inferência Bayesiana não enraizada construída para as 62 sequências do tufA de diferentes amostras de Halimeda. As sequências das espécies pertencentes a seções Rhipsalis, Micronesicae, Opuntia e Pseudo-opuntia foram omitidas para melhor visualização da árvore. Apenas valores acima de 70% de boostrap ou 0,7 de probabilidade a posteiori estão indicados nos ramos, na ordem NJ/ML/BI. Sequências em negrito foram obtidas neste estudo. (*) Indica suporte máximo do ramo...... 92 Figura L - Árvore consenso de Inferência Bayesiana não enraizada construída para as 66 sequências concatenadas do tufA, rbcL e 18S-ITS1-5.8S-ITS2-28S de diferentes amostras de Halimeda. As sequências das espécies pertencentes a seções Rhipsalis, Micronesicae, Opuntia e Pseudo-opuntia foram omitidas para melhor visualização da árvore. Apenas valores acima de 70% de boostrap ou 0,7 de probabilidade a posteiori estão indicados nos ramos, na ordem ML/BI. Sequências em negrito foram obtidas neste estudo. (*) Indica suporte máximo do ramo...... 93 Figura M – Halimeda americana sp. nov. Ximenes, Oliveira-Carvalho, V. Cassano & S.M.B. Pereira. (3) Isótipo (PEUFR 52109). Escala = 1 cm. (4) Vista superficial dos utrículos. Escala = 100 µm. (5) Padrão de fusão nodal completa por dois filamentos. Escala = 100 µm. (6) Espécime de H. americana de Cuba (SPF 58281). Escala = 1 cm. (7) Exemplar de H. americana de infralitoral. (PEUFR 4451). (8) Vista frontal do utrículos primários e secundários. Escala = 100 µm. (9) Holótipo (PEUFR 52110). Escala = 1 cm. (10) Espécime de H. americana densamente ramificado. Escala = 1 cm...... 97

Lista de Tabelas

Tabela 1 - Sinopse das Seções do gênero Halimeda com suas respectivas sinapomorfias e espécies, segundo Verbruggen e Kooistra (2004)...... 16 Tabela 2 - Lista dos táxons ocorrentes no Oceano Atlântico Ocidental...... 17 Tabela 3 – Sequências dos primers utilizados em estudos taxonômicos do gênero Halimeda 22 Table 4. Summary of morphoanatomical characteristics of Halimeda species from Brazilian coasts ...... 42 Table 5. Levels of intraspecific genetic variation (in percentage, diagonal in bold and gray), interspecific variation (in percentage, under the diagonal), and number of divergent base pairs (over the diagonal) for tufA sequences, based on uncorrected p-distance between Halimeda clades. - Absent values...... 72 Table 6. Percentage of genetic divergence (under the diagonal) and number of divergent base pairs (over the diagonal) for rbcL sequences, based on uncorrected p-distances between Halimeda species...... 73 Table 7. Comparison of diagnostic morphoanatomical features of Halimeda species belonging to Pseudo-opuntia Section with the authors and locality on the study was done...... 76 Tabela 8 - Comparação das características morfológicas de Halimeda tuna e H. americana sp. nov...... 98

Sumário 1. INTRODUÇÃO GERAL ...... 13 2. REVISÃO DE LITERATURA ...... 15 2.1. Breve Histórico do Gênero, Classificação das Seções e Diversidade do Atlântico Ocidental ...... 15 2.2. Histórico da Classificação do Gênero Halimeda ...... 20 2.3. O Uso de Marcadores Moleculares nos Estudos Taxonômicos de Halimeda ...... 21 3. MATERIAIS & MÉTODOS ...... 24 3.1. Área de Estudo ...... 24 3.2. Obtenção de Amostras ...... 24 3.3. Análises Morfológicas ...... 24 3.4. Análises Moleculares ...... 25 REFERÊNCIAS BIBLIOGRÁFICAS ...... 27 4. RESULTADOS ...... 33 Artigo 1: Systematics of the genus Halimeda (Bryopsidales, Chlorophyta) in Brazil including the description of Halimeda jolyana sp. nov...... 33 Introduction ...... 34 Material And Methods ...... 35 Results ...... 38 Morphological Analyses ...... 38 Molecular Species Delimitation (Tufa Alignment) ...... 38 Molecular Phylogeny (Concatenated Alignment) ...... 40 Taxonomic Changes ...... 44 Morphology And Anatomy ...... 44 Ecology ...... 45 Discussion ...... 48 Species Diversity In Brazil...... 48 Biogeographic Considerations ...... 50 Acknowledgements ...... 52 Supplementary Data ...... 53 References ...... 61 Artigo 2 - Updates on Section Pseudo-opuntia of Halimeda: H. soniae sp. nov. (Bryopsidales, Chlorophyta) is revealed by phylogenetic analyses for the Brazilian coast...... 65 Abstract ...... 66 xii

Introduction ...... 67 Morphological analysis ...... 73 Discussion ...... 78 Acknowledgements ...... 79 Supplementary Material ...... 81 References ...... 82 Artigo 3 – Inferências filogenéticas revelam uma nova espécie de Halimeda J. V. Lamour., H. americana sp. nov. para o Atlântico Sul americano e Caribe ...... 87 Resumo ...... 88 Introdução ...... 89 Material & Métodos ...... 90 Resultados ...... 91 Descrição ...... 94 Discussão ...... 99 Agradecimentos...... 101 Referências Bibliográficas ...... 101 Material Suplementar ...... 105 CONSIDERAÇÕES FINAIS ...... 108 NORMAS DA REVISTA ...... 109

1. INTRODUÇÃO GERAL As macroalgas do gênero Halimeda J. V. Lamour. pertencem a ordem Bryopsidales (Chlorophyta), atualmente representadas por 47 táxons infragenéricos, distribuídas nos mares tropicais e subtropicais do médio ao infralitoral (GUIRY; GUIRY, 2018). Com base em padrões morfológicos e filogenéticos, as espécies deste gênero são agrupadas em cinco Seções: Halimeda J. Agardh ex De Toni, Micronesicae Hillis, Opuntia J. Agardh ex De Toni, Pseudo- opuntia J. Agardh ex De Toni e Rhipsalis J. Agardh ex De Toni (KOOISTRA; COPPEJANS;

PAYRI, 2002) . São caracterizadas por apresentar talo calcificado constituído por segmentos conectados entre si por sifões medulares em junção nodal não calcificada (HILLIS, 1959; HILLIS-

COLINVAUX, 1980). A estrutura interna é constituída por filamentos ou sifões medulares que se ramificam até o córtex, terminando em utrículos periféricos. Podem crescer em substratos arenoso-lamosos, fixas por um apressório bulboso maciço de filamentos não organizados, circundados por areia, ou em substrato rochoso ou arenoso presas por filamentos frouxos ou emaranhados que saem da região medular do talo (HILLIS-COLINVAUX, 1980). Estas algas desempenham um importante papel ecológico na manutenção dos ambientes recifais, devido à arquitetura do talo que fornece abrigo e proteção a pequenos invertebrados até larvas de importantes recursos pesqueiros, e por possuírem carbonato de cálcio impregnado sob forma de aragonita, o qual se deposita na plataforma continental formando sedimento calcário (RIES, 2009). Por serem fósseis vivos, também carregam informações acerca da diversidade e evolução de algas verdes desde o período Cretáceo da era Mesozoica

(BUCUR, 1994; DRAGASTAN; HERBIG, 2007). Estas espécies são identificadas morfologicamente analisando-se caracteres externos e internos de acordo com Hillis (1959); Hillis-Colinvaux (1980); Bandeira-Pedrosa; Pereira e Oliveira (2004), contudo Halimeda apresenta grande diversidade de formas e habitat, além de marcado polimorfismo, dificultando a identificação e delimitação das espécies (VERBRUGGEN et al., 2005b; VERBRUGGEN et al., 2005c; DIJOUX et al., 2012). Concomitantemente, o gênero apresenta espécies crípticas (KOOISTRA; COPPEJANS; PAYRI, 2002; VERBRUGGEN et al., 2005b;

VERBRUGGEN et al., 2005c; PONGPARADON et al., 2015; XIMENES et al., 2017). Devido a esta plasticidade morfológica, estudos moleculares têm sido empregados para auxiliar a delimitação das espécies (KOOISTRA; COPPEJANS; PAYRI, 2002; VERBRUGGEN et al.,

2005c; VERBRUGGEN; LITTLER; LITTLER, 2007; DIJOUX et al., 2012; XIMENES et al., 2017). Esses estudos têm ajudado na compreensão das relações evolutivas entre espécies, na descoberta de espécies novas e no diagnóstico de espécies crípticas (VERBRUGGEN et al., 14

2005b; VERBRUGGEN et al., 2005c). No entanto, sabe-se que há diferenças genéticas entre as espécies crípticas do Indo-Pacífico e as do Atlântico, as quais são atribuídas a vicariância provocada pelo estabelecimento do Istmo do Panamá (KOOISTRA; COPPEJANS; PAYRI, 2002). Apesar de alguns estudos terem ajudado a esclarecer a taxonomia do grupo como um todo (VERBRUGGEN et al., 2005c; DIJOUX et al., 2012; KOJIMA; HANYUDA; KAWAI, 2015;

XIMENES et al., 2017), as espécies presentes no Atlântico ainda são pobremente estudadas. São citados 19 táxons infragenéricos ocorrendo no Atlântico ocidental, do Brasil até o Golfo do México, sendo a maioria das citações baseada em análises morfológicas (LITTLER;

LITTLER, 2000). Ximenes et al. (2017) identificaram quatro espécies crípticas para o Brasil com base em DNA barcode, três delas com status taxonômico incerto (i.e. H. aff. tuna (J. Ellis & Sol.) J.V. Lamour., H. aff. discoidea Decne, H. aff. gracilis Harv. ex J. Agardh e H. jolyana Ximenes, Bandeira-Pedrosa, Cassano, Oliveira-Carvalho, Verbruggen & S.M.B.Pereira), sendo as duas últimas, endêmicas. Ximenes et al. (2017) observaram ainda que das sete espécies filogeneticamente delineadas na seção Halimeda com base em dados moleculares, cinco tinham distribuição até o Mar do Caribe, que é conhecido por abrigar até

81% das macroalgas bentônicas do Oceano Atlântico (DÍAZ-PIFERRER, 1969). Com os avanços da biologia molecular na delimitação de táxons, técnicas como DNA barcoding têm sido aplicadas para resolver problemas de identificação de eucariontes

(RAMADAN; BAESHEN, 2012), como espécies de macroalgas, principalmente espécies crípticas e pseudo-crípticas (DIJOUX et al., 2012). No entanto, essa ferramenta não deve ser empregada isoladamente, uma vez que esta assume que cada clado monofilético é uma espécie diferente, não definindo claramente clados de espécies relativamente próximas (LELIAERT et al., 2014). Com isso, é recomendado uso de diversos marcadores moleculares concatenados, juntando sequências de genes diferentes, dando uma maior confiabilidade na distinção dos clados

(LELIAERT et al., 2014). Diante do exposto, o objetivo deste trabalho foi analisar a diversidade de espécies de Halimeda do litoral oeste do Oceano Atlântico, sob perspectivas morfológicas e moleculares, para fornecer informações mais atualizadas acerca do grupo.

2. REVISÃO DE LITERATURA

2.1. BREVE HISTÓRICO DO GÊNERO, CLASSIFICAÇÃO DAS SEÇÕES E DIVERSIDADE DO ATLÂNTICO OCIDENTAL

O gênero Halimeda foi proposto por Lamouroux (1816) para agrupar as espécies de clorofíceas calcificadas anteriormente alocadas no gênero de rodofíceas Corallina J.V. Lamour. Maiores detalhes a cerca da sistemática antes do estabelecimento de Halimeda é dada por Hillis (1959); Hillis-Colinvaux (1980); Bandeira-Pedrosa (2001); Verbruggen (2005). Após os primeiros estudos taxonômicos baseados em caracteres morfológicos, Agardh (1887) dividiu as espécies em quatro grupos informais, os quais foram reconhecidos por De Toni (1889) como as Seções aceitas atualmente. As espécies foram agrupadas por compartilhar a aparência do talo e a morfologia dos segmentos. Revisões taxonômicas importantes foram realizadas por Barton (1901); Hillis (1959); Hillis-Colinvaux (1980), este último tendo descrições com características morfoanatômicas para a grande maioria de espécies atualmente reconhecidas. Hillis-Conlivaux (1980) delineou uma nova circunscrição para as Seções, que foram baseadas no tipo de fusão nodal compartilhado por algumas espécies: Halimeda (fusão nodal longa), Opuntia (fusão nodal curta), Rhipsalis (fusão nodal com poros), Micronesicae (filamento uniaxial sem fusão), Crypticae (filamentos multiaxiais sem fusão). Essas Seções foram revisadas por Kooistra; Coppejans e Payri (2002); Verbruggen e Kooistra (2004) por morfologia e filogenia molecular com base em sequências parciais de SSU nrDNA, ITS-1, 5.8S rDNA. A tabela 1 contém a classificação atualmente aceita para o gênero Halimeda com as respectivas sinapomorfias e espécies de cada Seção, conforme Verbruggen e Kooistra (2004) e atualizada com os dados de Verbruggen; Littler e Litter (2007), Cremen et al. (2016), Kojima et al. (2015) e Ximenes et al. (2017). No entanto, algumas espécies como H. bikiniensis Taylor, H. cereidesmis Kraft, H. howensis Kraft & J.M.Noble, H. nervata Zanardini, H. papyracea Zanardini, H. rectangularis J.Agardh e H. sertolara (Bertoloni) Zanardini permanecem com seu status taxonômico incerto devido a ausência dos dados moleculares. Os 47 táxons infragenéricos atribuídos a Halimeda se distribuem na faixa tropical e subtropical dos Oceanos Atlântico, Índico e Pacífico, e vem passando por constantes revisões no intuito de atualizar as distribuições conforme novas espécies são descobertas com o advento das filogenias moleculares (GUIRY; GUIRY, 2018). Desses, o Atlântico Oeste contém 19 táxons infragenéricos distribuídos desde o Golfo do México até o litoral sudeste do Brasil 16

(Tabela 2). No Brasil, o gênero foi revisado sob uma perspectiva morfoanatômica por Bandeira-Pedrosa; Pereira e Oliveira (2004) e por análises filogenéticas moleculares por Ximenes et al. (2017). Para os demais países que compõe a costa americana do Atlântico, há apenas trabalhos de florística, dos quais pode-se destacar Taylor (1972) e Littler e Littler (2000) que compilam dados publicados.

Tabela 1 - Sinopse das Seções do gênero Halimeda com suas respectivas sinapomorfias e espécies, segundo Verbruggen e Kooistra (2004). Seção Sinapomorfia Espécies Rhipsalis J. Agardh ex De Toni Filamentos interconectados com H. borneensis W.R. Taylor presença de poros e segmentos H. cylindracea Decne. aglutinados na região basal do H. favulosa M. Howe talo H. incrassata (J. Ellis) J.V. Lamour. H. heteromorpha N'Yeurt H. kanaloana Vroom H. macroloba Decne. H. melanesica Valet H. monile (J. Ellis & Sol.) J.V. Lamour. H. simulans M. Howe H. stuposa W.R. Taylor Micronesicae Hillis-Colinvaux Ausência de fusão nodal, H. cryptica Hillis-Col. & E.A. filamentos continuam inteiro Graham entre os segmentos H. fragilis W.R. Taylor H. micronesica Yamada H. pumila Verbruggen, D.S. Littler & Littler H. pygmaea Verbruggen, D.S. Littler & Littler Halimeda J. Agardh ex De Toni Fusão nodal longa aos pares ou H. cuneata K. Hering em trio de filamentos medulares H. discoidea H. gigas W.R. Taylor H. hummii D.L. Ballant. H. jolyana H. lacunalis W.R. Taylor H. macrophysa Askenasy H. magnidisca Noble H. ryukyuensis Kojima, Hanyuda & Kawai H. scabra M. Howe H. taenicola W.R. Taylor H. tuna (J. Ellis & Sol.) J.V. Lamour. H. versatilis J. Agardh H. xishaensis Tseng & Dong Pseudo-opuntia J. Agardh ex De Utrículos secundários H. gracilis Toni expandindo no ápice H. lacrimosa M. Howe Opuntia J. Agardh ex De Toni Fusão nodal curta aos pares ou H. copiosa Goreau & E. A. Graham em trio H. distorta (Yamada) Colinvaux H. goreauii Taylor H. howensis Kraft & Noble H. minima (W.R. Taylor) Hillis- Col. H. opuntia (L.) J.V. Lamour. H. renschii Hauck H. velasquezii W.R. Taylor 17

Dentre os 19 táxons ocorrentes no Atlântico Ocidental, H. jolyana e H. aff. gracilis são restritas ao litoral brasileiro. H. jolyana foi primeiramente reconhecida na costa atlântica como H. cuneata por Bandeira-Pedrosa et al. (2004) e depois descrita como uma nova espécie para o gênero por Ximenes et al. (2017). Algumas espécies crípticas foram reportadas para o Atlântico, como H. tuna, H. discoidea e H. aff. gracilis, as quais são morfologicamente iguais a espécies registradas para o Indo-Pacifíco, mas que são polifiléticas (aparecem dispersas em mais de dois clados) em filogenias moleculares do gênero Halimeda (VERBRUGGEN et al.,

2005c; XIMENES et al., 2017). Cuba e Bahamas são os países que concentram a maioria das espécies de Halimeda do Atlântico, 16 táxons infragenéricos, enquanto a Colômbia registra apenas quatro táxons, sendo um dos litorais com menor riqueza específica. Dentre os táxons citados apenas para um país no Atlântico temos: H. copiosa Goreau & E. A. Graham f. elongata (E.S.Barton) Hillis- Colinvaux registrada apenas na Venezuela por Díaz-Piferrer (1969), Web Ficoflora Venezuela (2018), H. lacrimosa var. globosa Dawes & Humm ex Dawes nas Bahamas citada por Blair e Norris (1988) e Littler e Littler (2000) e H. pygmaea citada para Cuba por Suárez et al. (2014). Desta forma, observamos que o litoral do Atlântico Oeste contém quase a metade dos táxons infragenéricos atualmente reconhecidos para o gênero Halimeda, representando as cinco Seções, mas foram listados em sua maioria com base em dados morfológicos - com exceção das espécies do Brasil - e outras que foram incluídas em estudos em nível mundial.

Tabela 2 - Lista dos táxons ocorrentes no Oceano Atlântico Ocidental.

Táxon Local de Referência ocorrência Halimeda copiosa Bahamas Taylor (1972); Díaz-Piferrer (1969); Norris e Belize Bucher (1982); Blair e Norris (1988); Littler e Cuba Littler (2000); Wysor e Kooistra (2003); Jamaica González et al. (2014); Guiry e Guiry (2018) Panamá Porto Rico Venezuela H. copiosa f. elongata Venezuela Guiry e Guiry (2018) H. cryptica Bahamas Ballantine (1982); Blair e Norris (1988); Martinique Littler e Littler (2000); Delnatte e Wynne Porto Rico (2016); Guiry e Guiry (2018) H. cryptica var. acerifolia Cuba Ballatine (1982); Littler e Littler (2000); D.L.Ballantine Porto Rico Delnatte e Wynne (2016); Guiry e Guiry (2018) H. discoidea Bahamas Taylor (1972;1976); Norris e Bucher (1982); Belize Blair e Norris (1988); Wysor e Kooistra Brasil (2003); Bandeira-Pedrosa; Pereira e Oliveira Colômbia (2004); González et al. (2014); Santos e Costa Rica Nunes (2015); Guiry e Guiry (2018) 18

Tabela 2 - Lista dos táxons ocorrentes no Oceano Atlântico Ocidental.

Táxon Local de Referência ocorrência Cuba Flórida (EUA) Jamaica México Panamá Porto Rico Texas (EUA) Venezuela H. favulosa Bahamas Taylor (1972); Guiry e Guiry (2018) Cuba Venezuela H. gracilis Bahamas Taylor (1972); Blair e Norris (1988); Littler e Barbados (EUA) Littler (2000); Wysor e Kooistra (2003); Brasil Bandeira-Pedrosa et al. (2004); Santos e Cuba Nunes (2015); Wynne (2009); Guiry e Guiry Flórida (EUA) (2018) Jamaica Panamá Porto Rico Texas (EUA) H. goreaui Bahamas Norris e Bucher (1982); Littler e Littler Belize (2000); Wysor e Kooistra (2003); Guiry e Cuba Guiry (2018) Jamaica Panamá Porto Rico H. incrassata Porto Rico Taylor (1972); Díaz-Piferrer (1969); Taylor Bahamas (1976); Norris e Bucher (1982); Wysor e Belize Kooistra (2003); Bandeira-Pedrosa; Pereira e Brasil Oliveira (2004); Verbruggen et al. (2005b); Colômbia Wynne (2009); Collado-Vides et al. (2011); Cuba González et al. (2014); Santos e Nunes Flórida (EUA) (2015); Ximenes et al. (2017); Guiry e Guiry Jamaica (2018) México Panamá Porto Rico Venezuela Texas (EUA) H. jolyana Brasil Ximenes et al. (2017); Guiry e Guiry (2018) H. lacrimosa Bahamas Blair e Norris (1988); Littler e Littler (2000); Cuba Guiry e Guiry (2018) Flórida (EUA) H. lacrimosa var. globosa Bahamas Blair e Norris (1988); Littler e Littler (2000); Guiry e Guiry (2018) H. monile Bahamas Taylor (1972); Littler e Littler (2000); Wysor Cuba e Kooistra (2003); Verbruggen et al. (2005a); Flórida (EUA) Guiry e Guiry (2018) Jamaica México Panamá Porto Rico Venezuela 19

Tabela 2 - Lista dos táxons ocorrentes no Oceano Atlântico Ocidental.

Táxon Local de Referência ocorrência H. opuntia Bahamas Taylor (1972, 1976); Norris e Bucher (1982); Belize Littler e Littler (2000); Bandeira-Pedrosa et Brasil al. (2004); González et al. (2014); Sissini et Colômbia al. (2014); Ximenes et al. (2017); Guiry e Costa Rica Guiry (2018); Cuba Flórida (EUA)

Jamaica México Panamá

Porto Rico Venezuela

H. pygmaea Cuba Guiry e Guiry (2018)

H. pumila Bahamas Verbruggen; Littler e Littler (2007); Cuba Ballantine; Athanasiadis e Ruiz (2011); Guiry Porto Rico e Guiry (2018) H. scabra Bahamas Diaz-Piferrer (1969); Littler e Littler (2000); Cuba González et al. (2014); Delnatte e Wynne Flórida (EUA) (2016); Guiry e Guiry (2018) Martinique Venezuela H. simulans Bahamas Littler e Littler (2000); Wysor e Kooistra Brasil (2003); Bandeira-Pedrosa; Pereira e Oliveira Flórida (EUA) (2004); Verbruggen et al. (2005b); Santos e Jamaica Nunes (2015); Ximenes et al. (2017) Martinique México Panamá H. tuna Bahamas Taylor (1972, 1976); Diaz-Piferrer (1969); Belize Norris e Bucher (1982); Blair e Norris (1988); Colômbia Wysor e Kooistra (2003); Bandeira-Pedrosa et Costa Rica al. (2004); González et al. (2014); Santos e Cuba Nunes (2015); Guiry e Guiry (2018) Jamaica México Panamá Porto Rico Venezuela

2.2. HISTÓRICO DA CLASSIFICAÇÃO DO GÊNERO HALIMEDA

Barton (1901) incluiu o gênero Halimeda na ordem Siphonae, dentro da classe Chlorophyceae, cuja ordem tinha sido proposta por Greville (1830) contendo os gêneros Codium Stackh., Vaucheria De Candolle, Bryopsis J.V.Lamour. e Botrydium Wallroth. Blackman e Tansley (1902) estabeleceram a “série” Siphonales dentro da Classe Chlorophyceae para as algas verdes com talo cenocítico e incluíram Halimeda na família Codiaceae Kütz. (1843), devido à presença de carbonato de cálcio, juntamente com os gêneros Codium, Avrainvillea Decne., Penicillus Lam., Rhipocephalus Kütz., Callipsygma J.Agardh, Udotea J.V.Lamour. e Pseudocodium Weber Bosse. Siphonales foi validada como ordem por Oltmanns (1905) contendo as famílias Codiaceae, Bryopsidaceae Bory 1829, Caulerpaceae Kütz. 1843 e Vaucheriaceae Dumortier 1822. Schaffner (1922) reclassificou as algas verdes incluindo as famílias Derbesiaceae Hauck (1884), Bryopsidaceae, Caulerpaceae, Phyllosiphonaceae Wille (1890) e Codiaceae em uma nova ordem, Bryopsidales, incluindo as macroalgas majoritariamente marinhas com reprodução sexuada desconhecida ou isogâmica e com presença de zoósporos com flagelos iguais. Silva (1980) adotou a família Halimedaceae Link (1832) em detrimento a Codiaceae devido à prioridade de publicação. No entanto, essa mudança não imediatamente acatada por Hillis-Conlivaux (1980) que realocou os gêneros Caulerpa J.V.Lamour., Udotea e Halimeda na ordem Caulerpales, dentro de Udoteaceae, devido à presença de amiloplastos, xilano na parede celular do filamento e reprodução holocárpica, conforme proposto por Feldmann (1946). Hillis-Colinvaux (1984) reestabeleceu a ordem Bryopsidales (Ulvophyceae) e propôs duas subordens baseadas em caracteres ultraestruturais (por exemplo, a presença de amiloplastos) e reprodutivos, na qual Halimeda ficou posicionada em Halimedineae. Essa classificação foi mantida por Vroom; Smith e Keeley (1998) por meio de análises cladistícas dentro da ordem Bryopsidales, com Halimeda permanecendo dentro da família Udoteaceae. Esses resultados foram corroborados com filogenia de SSU-ITS para esta família, mostrando também a monofilia de Halimeda, proposta por Kooistra (2002). Lam e Zechman (2006) revalidaram a família Halimedaceae como monofilética e monogenérica por meio de filogenia do gene rbcL e essa classificação é a atualmente aceita. Verbruggen et al. (2009a) fez uma filogenia concatenada de cinco genes (tufA, rbcL, atpB, 16S e 18S) com relógio molecular com as algas sifonáceas das ordens Bryopsidales e Dasycladales. Os autores observaram a separação de três clados dentro da ordem Bryopsidales correspondendo as subordens Bryopsidineae, Halimedineae e o gênero Ostreobium Bornet & 21

Flahault, mantendo Halimeda conforme Lam e Zechman (2006). Esse posicionamento foi também corroborando com análises filogenômicas de 71 genes do cloroplasto proposta por Cremen et al. (2018), a qual foi proposta uma nova circunscrição para a família Halimedaceae: Talo variando de um único sifão dimuto a estruturas multiaxiais complexas incluindo espécies calcificadas e não calcificadas. Para a tribo monogenérica Halimedeae Konishi 1961, Cremen et al. (2018) ampliaram a circunscrição: Talo sifonáceo, multiaxial, macroscópico, composto de segmentos numerosos, calcificados, achatados ou circulares, conectados por nós estreitados não calcificados; segmentos compostos de filamentos medulares e córtex de utrículos inflados, enquanto os nós são compostos de sifões medulares paralelos.

2.3. O USO DE MARCADORES MOLECULARES NOS ESTUDOS TAXONÔMICOS DE HALIMEDA

A primeira filogenia molecular apresentada para o gênero foi proposta por Hillis; Engman e Kooistra (1998) com o marcador nuclear 18S-5.8S e região espaçadora ITS-1 e ITS-2 até o 28S, com alguns primers propostos por White et al. (1990) para fungos, protistas, algas verdes e vermelhas e outros primers desenhados para esse trabalho. A árvore de máxima parcimônia enraizada com Flabellia petiolata (Turra) Nizamuddin (Udoteaceae), mostrou o grupo monofilético com baixo suporte e baixa resolução das Seções. Kooistra; Coppejans e Payri (2002) modificaram os primers desses marcadores, aumentando a cobertura dos marcadores, gerando sequências maiores e obtiveram alto suporte dentro do gênero e das Seções, rearranjando-as e observando a separação das linhagens do Indo-Pacífico versus Atlântico. Os primers desenhados por Kooistra; Coppejans e Payri (2002) continuaram sendo utilizados para amplificar os marcadores nucleares SSU, LSU e região espaçadora interna (ITS) por Verbruggen e Kooistra (2004); Verbruggen et al. (2005a); Verbruggen et al. (2005b); Verbruggen et al. (2005c). Devido à alta taxa de variação intra-individual e a inespecificidade do ITS, Provan; Murphy e Maggs (2004) propuseram oito marcadores plastidiais universais para Chlorophyta (UCP) e para Rhodophyta (URP). A partir de então, Verbruggen et al. (2005b); Verbruggen et al. (2005c) passaram a incluir o marcador UCP7 nos estudos taxonômicos além dos marcadores nucleares, os quais permitiram inferir relações entre as espécies bem como sobre a filogeografia dentro das Seções Rhipsalis e Halimeda e Verbruggen et al. (2009b) utilizaram o UCP3 para compor uma análise multiloci com mais cinco marcadores para investigar aspectos biogeográficos das espécies de Halimeda. 22

Hanyuda; Arai e Ueda (2000) compararam as sequências do marcador plastidial rbcL na ordem Caulerpales (= Bryopsidales), observando a existência de íntrons, mostrando a eficiência na separação dos gêneros. Esse mesmo gene foi utilizado nos estudos de filogenéticos dentro da ordem Bryopsidales por Lam e Zechman (2006) e Curtis; Dawes e Pierce (2008). Famà et al. (2002) iniciaram o uso do marcador plastidial tufA nos estudos específicos do gênero Caulerpa, o qual foi estabelecido como marcador DNA barcode para algas verdes por Saunders e Kucera (2010), devido a sua fácil amplificação, baixa taxa de contaminação e obtenção de sequências de boa qualidade. O tufA passou a ser bastante útil nos estudos de diversidade das espécies de Halimeda, juntamente com o rbcL na inferência

das relações filogenéticas (VERBRUGGEN; LITTLER E LITTLER, 2007; DIJOUX ET AL., 2012;

KOJIMA; HANYUDA E KAWAI, 2015; PONGPARADON ET AL., 2015; CREMEN ET AL., 2016;

XIMENES ET AL., 2017). Cremen et al. (2016) utilizaram além do tufA, o marcador nuclear HSP90 para estudos taxonômicos de Halimeda da Austrália e observaram que HSP90 também é um bom marcador para separação de espécies crípticas no gênero. A Tabela 3 contém as sequências dos primers utilizados em estudos do gênero Halimeda ou que utilizaram sequências de Halimeda para inferências filogenéticas, com o nome, o sentido e a referência que o propôs.

Tabela 3 – Sequências dos primers utilizados em estudos taxonômicos do gênero Halimeda

Nome do Sentido Sequência (5’-3’) Marcador Referência primer (Direto / Reverso) TW5 Direto AACTTAAAGGAATTGACGGAA SSU White et al. (1990) TW7 Direto GAGGCAATAACAGGTCTGTGATGC SSU White et al. (1990) H3R Reverso AGTCTAGCCCAGTCACGTAGCG SSU Hillis et al. (1998) H2R Reverso ATAATGATCCTTTCGCAGGT SSU Hillis et al. (1998) ITS2 Reverso GCTGCGTTCTTCATCGATGC ITS White et al. (1990) ITS4 Reverso TCCTCCGCTTATTGATATGC ITS White et al. (1990) TW3 Direto GCAAGTCTGGTGCCAGCATCT SSU Kooistra; Coppejans e Payri (2002) TW5 Direto AACTTGAAGGAATTGACGGAAG SSU Kooistra; Coppejans e Payri (2002) TW6 Reverso GCATCACAGATCTGTTATTGCCTC SSU Kooistra; Coppejans e Payri (2002) TW7 Direto GAGGCAATAACAGATCTGTGATGC SSU Kooistra; Coppejans e Payri (2002) H1R Reverso TCTACGTGCGAAGGTTCAGAG SSU Kooistra; Coppejans e Payri (2002) H1F Direto CTCTGAACCTTCGCACGTAGA SSU Kooistra; Coppejans e Payri (2002) ITS2 Reverso GCTACGTCCTTCATCGACGC ITS Kooistra; Coppejans e Payri (2002) ITS3 Direto GCGTCGATGAAGGACGTAGC ITS Kooistra; Coppejans e Payri (2002) WKR Reverso TTTCCTCGCCGACGACATCGC LSU Kooistra; Coppejans e Payri (2002) 23

Tabela 3 – Sequências dos primers utilizados em estudos taxonômicos do gênero Halimeda

Nome do Sentido Sequência (5’-3’) Marcador Referência primer (Direto / Reverso) tufAF Direto TGAAACAGAAMAWCGTCATTATGC tufA Famà et al. (2002) tufAR Reverso CCTTCNCGAATMGCRAAWCGC tufA Famà et al. (2002) tufA-HAL1 Reverso CTCGRTCNCCWGGCATNACCATACG tufA Cremen et al. (2016) UCP3F Direto CGWATTTTVCCDGAGATATGGGC UCP3 Provan et al. (2004) UCP3R Reverso ATGTATGCKTTTTTAGATCGT UCP3 Provan et al. (2004) UCP7F Direto ATWTCDGCDCCATTWAGDCKVCC UCP7 Provan et al. (2004) UCP7R Reverso ATGGTWGGWCAWAAATTDGGTGAGTTT UCP7 Provan et al. (2004) Rbc1 Direto CCAMAAACWGAAACWAAAGC rbcL Hanyuda et al. (2000) U1-l Direto TCCAAAAACTGAAACTAAAGCAGG rbcL Hanyuda et al. (2000) 1U Direto TCTTCTACWGGWACATGGAC rbcL Hanyuda et al. (2000) 2U Reverso TTGGTWACWGAACCTTCTTC rbcL Hanyuda et al. (2000) Rbc5 Reverso GCTTGWGMTTTRTARATWGCTTC rbcL Hanyuda et al. (2000) nP2R Reverso TCAATAACCGCATGCATGC rbcL Hanyuda et al. (2000) 3U Reverso GGCATATGCCAWACRTGRATACC rbcL Hanyuda et al. (2000) U3-2 Reverso TCTTCCAAACTTCACAAGC rbcL Hanyuda et al. (2000) 3-2 Reverso CCATACTTCACAAGCAGCAGCTAGTTC rbcL Hanyuda et al. (2000) rbcL427-449 Direto GCTTATGCWAAAACATTYCAAGG rbcL Lam e Zechman (2006) rbcL1396–1372 Reverso AATTTCTTTCCAAACTTCACAAGC rbcL Lam e Zechman (2006) rbcL1 Direto AAAGCNGGKGTWAAAGAYTA rbcL Curtis et al. (2008) rbcL2 Reverso CCAACGCATARADGGTTGWGA rbcL Curtis et al. (2008) HSP90-HAL1 Direto CTSAARGTSGTSAAGAAAAACATYGTC HSP90 Cremen et al. (2016) HSP90-HAL1 Reverso CCGAAGGTATTGGGCTCTTCC HSP90 Cremen et al. (2016)

3. MATERIAIS & MÉTODOS

3.1. ÁREA DE ESTUDO

O presente estudo foi desenvolvido na costa americana do Atlântico, nas regiões tropical e subtropical, do litoral sudeste do Brasil até a Flórida (EUA). O litoral brasileiro tem 7.491 km de costa, estendendo-se do início da foz do Rio Oiapoque (AP) ao Arroio Chuí (RS), dividido em duas províncias ficoflorísticas e uma zona de transição, estabelecidas de acordo com o padrão de distribuição de macroalgas e fisionomia geográficas semelhantes, denominadas: província Tropical Quente (compreendendo o litoral Nordeste do Brasil), Zona de Transição (Litoral do Espírito Santo) e província Temperada Quente (Litoral Sul e Sudeste do Brasil) (HORTA et al., 2001). Além disso, a costa brasileira apresenta quatro Ilhas Oceânicas: Atol das Rocas, Fernando de Noronha, Arquipélago São Pedro São Paulo, Complexo Insular de Trindade e Martim Vaz e Abrolhos, alguns dos quais são reserva biológica, como o Atol das Rocas, e outros conhecidos pela grande exploração turística, como

Fernando de Noronha (VILLAÇA et al., 2006). O Mar do Caribe está localizado no continente Americano, desde a costa da Flórida até parte da Venezuela. É dividido em sete regiões: Golfo do México, Flórida, Bahamas, Antilhas Maiores, Antilhas Menores, Caribe Oeste e Caribe Sudeste. Este sistema é banhado pela Corrente Equatorial Norte, acompanhado da Corrente Quente da Guiana que flui a partir da costa brasileira, passando pelas Antilhas (SMITH; RINCONES, 1998).

3.2. OBTENÇÃO DE AMOSTRAS

Foram obtidas 89 amostras em pontos da costa americana do Atlântico desde o litoral do Espírito Santo (Brasil) até o Golfo do México (EUA) da zona entremarés até 24m de profundidade, do período de 2009 a 2016. Os espécimes coletados foram preservados em etanol absoluto ou secos em sílica gel para as análises morfológicas e moleculares.

3.3. ANÁLISES MORFOLÓGICAS

As análises morfológicas foram realizadas no Laboratório de Ficologia da Universidade Federal Rural de Pernambuco (LABOFIC/UFRPE) seguindo bibliografia especializada. Os espécimes foram analisados externamente observando o aspecto geral do talo, hábito, apressório, formato dos segmentos e tipo de ramificação. Foram tiradas medidas 25 do comprimento total do talo desde o segmento mais basal até o apical e medidas dos segmentos medianos conforme recomendação de Verbruggen et al. (2005). Para observação dos filamentos, foram separados segmentos medianos, os quais foram descalcificados com ácido clorídrico (HCl) 20%, e os filamentos foram dissociados com auxílio de agulha de seringa utilizando estereomicroscópio para visualização. As lâminas foram montadas e observadas em microscópio ótico com lente micrometrada, onde foi observado o padrão de fusão nodal, quantidade de camadas de utrículos, formato e ramificação dos utrículos. Foram obtidas medidas dos utrículos primários em vista frontal e superficial e dos utrículos secundários em vista superficial. Também foram analisados tipos depositados no Herbário de Nova Iorque (NYBG) para fins comparativos. Os espécimes de Halimeda analisados nesse estudo foram herborizados e incorporados aos acervos do Herbário Professor Vasconcelos Sobrinho (PEURF/UFRPE) e Herbário da Universidade de São Paulo (SPF/USP).

3.4. ANÁLISES MOLECULARES

As análises moleculares ocorreram no Laboratório de Algas Marinhas da Universidade de São Paulo (LAM/USP) e no Laboratório de Genética e Biotecnologia Vegetal da Universidade Federal de Pernambuco (LGBV/UFPE). Para isto, foram retirados fragmentos dos ápices dos talos das amostras coletados, que foram limpos com escova de cerdas sintéticas para a remoção de epífitas. Para a extração do DNA total, esses fragmentos foram macerados com nitrogênio líquido até a obtenção de pó fino e seguiram o protocolo manual do CTAB (Brometo de Cetiltrimetilamonio) descrito em Oliveira-Carvalho et al. (2012). Foram amplificados os marcadores plastidiais tufA e rcbL e nucleares da região do 18S-ITS-28S (SSU-LSU), através da reação da cadeia polimerase (PCR) no termociclador Techne TC-4000 (Bibby Scientific Ltd, Staffordshire, UK). As condições de PCR e os primers utilizados para o tufA e rbcL estão descritas em Ximenes (2015) e Ximenes et al.

(2017). Para a região do 18S-ITS-28S, foram utilizados os primers SSU1400F (HOEF-EMDEN;

MELKONIAN, 2003) + 28SR (BELLORIN; OLIVEIRA; OLIVEIRA, 2002) nas condições descritas por Hoef-Emden; Marin e Melkonian (2002) e os primers TW5F + TW6R e TW7F + HIR com condições descritas por Kooistra; Calderón e Hillis (1999). Os produtos obtidos foram purificados com o kit Illustra GFX PCR DNA and Gel Band Purification (GE Healthcare, Buckingamshire, UK) seguindo instruções do fabricante e seguiram para o sequenciamento utilizando o kit BigDye Terminator Cycle Sequencing Ready Reaction (Applied Biosystems, 26

Foster City, California, USA) nos sequenciadores automáticos ABI PRISM 3100 ou ABI PRISM 3730 (Applied Biosystems). As sequências consenso, as matrizes finais para cada gene e as análises de bioinformáticas foram realizadas no programa Geneious 10.1.3 (KEARSE et al., 2012). Os detalhes das análises constam nos três artigos da tese bem como as sequências utilizadas para cada um dos artigos: (1) “Systematics of the genus Halimeda (Bryopsidales, Chlorophyta) in Brazil including the description of Halimeda jolyana sp. nov.” publicado na revista Phycologia, (2) “Updates on Section Pseudo-opuntia of Halimeda: H. soniae sp. nov. (Bryopsidales, Chlorophyta) is revealed by phylogenetic analyses for the Brazilian coast” submetido a revista Botanica Marina e aceito com modificações e (3) “Inferências filogenéticas revelam uma nova espécie de Halimeda J. V. Lamour. para o litoral do Atlântico Sul” a ser submetido a revista Botanica Marina.

REFERÊNCIAS BIBLIOGRÁFICAS

AGARDH, J. G. Till algernes systematic. Nya bidrag.(Femte afdelningen.). Lunds. Univ. Arsskr., v. 23, p. pls. 1-5, 1887.

BALLANTINE, D. L. Halimeda hummii sp. nov., Halimeda cryptica v. acerifolia var. nov. (Caulerpales, Chlorophyta), and additional records of Halimeda species from: Puerto Rico Journal of Phycology, v. 18, n. 1, p. 86-91, 1982.

BALLANTINE, D. L.; ATHANASIADIS, A.; RUIZ, H. Notes on the benthic marine algae of Puerto Rico. X. Additions to the flora. Botanica Marina, v. 54, n. 3, p. 293-302, 2011.

BANDEIRA-PEDROSA, M. E. Revisão taxonômica do gênero Halimeda Lamouroux (Bryopsidales, Chlorophyta) para a costa brasileira. 2001. (Doutorado em Botânica). Universidade Federal de Pernambuco, Recife

BANDEIRA-PEDROSA, M. E.; PEREIRA, S. M. B.; OLIVEIRA, E. C. Taxonomy and distribution of the green algal genus Halimeda (Bryopsidales, Chlorophyta) in Brazil. Brazilian Journal of Botany, v. 27, n. 2, p. 363-377, 2004.

BARTON, E. S. The genus Halimeda. EJ Brill, 1901.

BELLORIN, A. M.; OLIVEIRA, M. C.; OLIVEIRA, E. C. Phylogeny and systematics of the marine algal family Gracilariaceae (Gracilariales, Rhodophyta) based on small subunit rDNA and ITS sequences of Atlantic and Pacific species. Journal of Phycology, v. 38, n. 3, p. 551- 563, 2002.

BLACKMAN, F. F.; TANSLEY, A. G. A revision of the classification of the green algae. New Phytologist, v. 1, n. 6, p. 133-144, 1902.

BLAIR, S. M.; NORRIS, J. N. The deep-water species of Halimeda Lamouroux (Halimedaceae, Chlorophyta) from San Salvador Island, Bahamas: species composition, distribution and depth records. Coral Reefs, v. 6, n. 3-4, p. 227-236, 1988.

BUCUR, I. I. Lower Cretaceous Halimedaceae and Gymnocodiaceae from southern Carpathians and Apuseni Mountains (Romania) and the systematic position of the Gymnocodiaceae. Beiträge zur Paläontologie, v. 19, p. 13-37, 1994.

COLLADO-VIDES, L.; MAZZEI, V.; THYBERG, T.; LIRMAN, D. Spatio-temporal patterns and nutrient status of macroalgae in a heavily managed region of Biscayne Bay, Florida, USA. Botanica Marina, v. 54, n. 4, p. 377-390, 2011.

CREMEN, M. C. M.; HUISMAN, J. M.; MARCELINO, V. R.; VERBRUGGEN, H. Taxonomic revision of Halimeda (Bryopsidales, Chlorophyta) in south-western Australia. Australian Systematic Botany, v. 29, n. 1, p. 41-54, 2016.

CREMEN, M. C. M.; LELIAERT, F.; WEST, J.; LAM, D. W.; SHIMADA, S.; LOPEZ- BAUTISTA, J. M.; VERBRUGGEN, H. Reassessment of the classification of Bryopsidales (Chlorophyta) based on chloroplast phylogenomic analyses. Molecular Phylogenetics and Evolution, 2018.

CURTIS, N. E.; DAWES, C. J.; PIERCE, S. K. Phylogenetic analysis of the large subunit rubisco gene supports the exclusion of Avrainvillea and Cladocephalus from the Udoteaceae (Bryopsidales, Chlorophyta) Journal of Phycology, v. 44, n. 3, p. 761-767, 2008.

DE TONI, G. B. Sylloge algarum omnium hucusque cognitarum. Vol. I. Chlorophyceae. Patavii (Padova), 1889.

DELNATTE, C.; WYNNE, M. J. A revised checklist of marine algae and seagrasses of Martinique, French West Indies. Nova Hedwigia, v. 103, n. 3-4, p. 415-440, 2016.

DÍAZ-PIFERRER, M. Distribution of the marine benthic flora of the Caribbean Sea. University of Puerto Rico, Institute of Caribbean Science, 1969.

DIJOUX, L.; VERBRUGGEN, H.; MATTIO, L.; DUONG, N.; PAYRI, C. Diversity of Halimeda (Bryopsidales, Chlorophyta) in New Caledonia: a combined morphological and molecular study. Journal of Phycology, v. 48, n. 6, p. 1465-1481, 2012.

DRAGASTAN, O. N.; HERBIG, H.-G. Halimeda (green siphonous algae) from the Paleogene of (Morocco)–Taxonomy, phylogeny and paleoenvironment. Micropaleontology, v. 53, n. 1-2, p. 1-72, 2007.

FAMÀ, P.; WYSOR, B.; KOOISTRA, W. H.; ZUCCARELLO, G. C. Molecular phylogeny of the genus Caulerpa (Caulerpales, Chlorophyta) inferred from chloroplast tufA gene. Journal of phycology, v. 38, n. 5, p. 1040-1050, 2002.

FELDMANN, J. Sur l'heteroplastie de certaines Siphonales et leur classification. CR Acad. Sc. Paris, v. 222, p. 752-753, 1946.

GONZÁLEZ, Á. M.; FUJII, M. T.; GARCÉS, R. F.; BATISTA, M. G.; PÉREZ, Á. L.; MARTÍNEZ-DARANAS, B.; ALFONSO, A. M. S. Chlorophyta bentónicas del litoral arrecifal de la provincia de Cienfuegos, Cuba. Revista de Investigaciones Marinas, v. 34, n. 1, p. 9-17, 2014.

GREVILLE, R. K. Algae britannicae, or descriptions of the marine and other inarticulated plants of the British islands, belonging to the order Algae: with plates illustrative of the genera. MacLachlan & Stewart, 1830.

GUIRY, M. D.; GUIRY, G. M. AlgaeBase. 2018. Disponível em: < http://www.algaebase.org >. Acesso em: 24 de outubro.

HANYUDA, T.; ARAI, S.; UEDA, K. Variability in the rbcL introns of Caulerpalean algae (Chlorophyta, Ulvophyceae). Journal of Plant Research, v. 113, n. 4, p. 403-413, 2000.

HILLIS-COLINVAUX, L. Ecology and taxonomy of Halimeda: primary producer of coral reefs. In: (Ed.). Advances in marine biology: Elsevier, v.17, 1980. p.1-327.

______. Systematics of the Siphonales. 1984.

HILLIS, L. W. A revision of the genus Halimeda (order Siphonales). Publications of the Institute of Marine Sciences, v. 6, p. 321-403, 1959.

HILLIS, L. W.; ENGMAN, J. A.; KOOISTRA, W. H. C. F. Morphological and molecular phylogenies of Halimeda (Chlorophyta, Bryopsidales) identify three evolutionary lineages. Journal of Phycology, v. 34, n. 4, p. 669-681, 1998.

HOEF-EMDEN, K.; MARIN, B.; MELKONIAN, M. Nuclear and nucleomorph SSU rDNA phylogeny in the Cryptophyta and the evolution of cryptophyte diversity. Journal of molecular evolution, v. 55, n. 2, p. 161-179, 2002.

HOEF-EMDEN, K.; MELKONIAN, M. Revision of the genus Cryptomonas (Cryptophyceae): a combination of molecular phylogeny and morphology provides insights into a long-hidden dimorphism. Protist, v. 154, n. 3-4, p. 371-409, 2003.

HORTA, P.; AMANCIO, E.; COIMBRA, C.; OLIVEIRA, E. Considerações sobre a distribuição e origem da flora de macroalgas marinhas brasileiras. Hoehnea, v. 28, n. 3, p. 243-265, 2001.

KEARSE, M.; MOIR, R.; WILSON, A.; STONES-HAVAS, S.; CHEUNG, M.; STURROCK, S.; BUXTON, S.; COOPER, A.; MARKOWITZ, S.; DURAN, C. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, v. 28, n. 12, p. 1647-1649, 2012.

KOJIMA, R.; HANYUDA, T.; KAWAI, H. Taxonomic re‐examination of Japanese Halimeda species using genetic markers, and proposal of a new species Halimeda ryukyuensis (Bryopsidales, Chlorophyta). Phycological research, v. 63, n. 3, p. 178-188, 2015.

KOOISTRA, W. H. C. F. Molecular phylogenies of Udoteaceae (Bryopsidales, Chlorophyta) reveal nonmonophyly for Udotea, Penicillus and Chlorodesmis. Phycologia, v. 41, n. 5, p. 453-462, 2002.

KOOISTRA, W. H. C. F.; CALDERÓN, M.; HILLIS, L. W. Development of the extant diversity in Halimeda is linked to vicariant events. Sixteenth International Seaweed Symposium, 1999, Springer. p.39-45.

KOOISTRA, W. H. C. F.; COPPEJANS, E.; PAYRI, C. Molecular systematics, historical ecology, and phylogeography of Halimeda (Bryopsidales). Molecular Phylogenetics and Evolution, v. 24, n. 1, p. 121-138, 2002.

LAM, D. W.; ZECHMAN, F. W. Phylogenetic analyses of the Bryopsidales (ulvophyceae, chlorophyta) based on rubisco large subunit gene sequences Journal of Phycology, v. 42, n. 3, p. 669-678, 2006.

LAMOUROUX, J. V. F. Histoire des polypiers coralligènes flexibles, vulgairement nommés zoophytes. Imprimerie de F. Poisson, 1816.

LELIAERT, F.; VERBRUGGEN, H.; VANORMELINGEN, P.; STEEN, F.; LÓPEZ- BAUTISTA, J. M.; ZUCCARELLO, G. C.; DE CLERCK, O. DNA-based species delimitation in algae. European journal of phycology, v. 49, n. 2, p. 179-196, 2014.

LITTLER, D. S.; LITTLER, M. M. Caribbean reef plants: An identification guide to the reef plants of the Caribbean, Bahamas, Florida and Gulf of Mexico. Washington: 2000. 1-542.

NORRIS, J. N.; BUCHER, K. E. Marine algae and seagrasses from Carrie Bow Cay, Belize. Smithsonian Contribution Marine Science, v. 12, p. 167-223, 1982.

OLIVEIRA-CARVALHO, M. D. F.; OLIVEIRA, M. C.; PEREIRA, S. M. B.; VERBRUGGEN, H. Phylogenetic analysis of Codium species from Brazil, with the description of the new species C. pernambucensis (Bryopsidales, Chlorophyta). European journal of phycology, v. 47, n. 4, p. 355-365, 2012.

OLTMANNS, F. Morphologie und biologie der algen. G. Fischer, 1905.

PONGPARADON, S.; ZUCCARELLO, G. C.; PHANG, S.-M.; KAWAI, H.; HANYUDA, T.; PRATHEP, A. Diversity of Halimeda (Chlorophyta) from the Thai–Malay Peninsula. Phycologia, v. 54, n. 4, p. 349-366, 2015.

PROVAN, J.; MURPHY, S.; MAGGS, C. A. Universal plastid primers for Chlorophyta and Rhodophyta. European Journal of Phycology, v. 39, n. 1, p. 43-50, 2004.

RAMADAN, H. A.; BAESHEN, N. A. Biological identifications through DNA barcodes. In: (Ed.). Biodiversity conservation and utilization in a diverse world: InTech, 2012.

RIES, J. B. Effects of secular variation in seawater Mg/Ca ratio (calcite–aragonite seas) on CaCO3 sediment production by the calcareous algae Halimeda, Penicillus and Udotea– evidence from recent experiments and the geological record. Terra Nova, v. 21, n. 5, p. 323- 339, 2009.

SANTOS, G. D. N.; NUNES, J. M. D. C. O gênero Halimeda (Bryopsidales, Chlorophyta) no litoral do estado da Bahia, Brasil. Sitientibus série Ciências Biológicas, v. 15, p. 1-17, 2015.

SAUNDERS, G. W.; KUCERA, H. An evaluation of rbcL, tufA, UPA, LSU and ITS as DNA barcode markers for the marine green macroalgae. Cryptogamie Algologie, v. 31, n. 4, p. 487, 2010.

SCHAFFNER, J. H. The Classification of Plants. XII. 1922.

SILVA, P. C. Names of classes and families of living algae, with special reference to their use in the Index Nominum Genericorum (Plantarum). 1980.

SISSINI, M. N.; LONGO, G. O.; MARTINS, C. D. L.; FLOETER, S. R.; PEREIRA, S. B.; HORTA, P. A. First record of the green alga Halimeda (Bryopsidales: Chlorophyta) at Rocas Atoll—natural dispersion or anthropogenic causes? Marine Biodiversity Records, v. 7, 2014.

SMITH, A.; RINCONES, R. E. The seaweed resources of the Caribbean. Seaweed Resources of the World. JICA, Japan, p. 324-330, 1998.

SUÁREZ, A. M.; MARTÍNEZ-DARANAS, B.; BERMEJO, M. G.; VOLTA, R. Macroalgas del golfo de Ana María, SE de Cuba/Macroalgae of Ana Maria Gulf, SE Cuba. Revista de Investigaciones Marinas, v. 33, n. 2, p. 1-6, 2014.

TAYLOR, W. R. Marine algae of the eastern tropical and subtropical coasts of the Americas. University of Michigan., 1972.

______. A check-list of Venezuelan marine algae. Bol. Soc. Ven. Cienc. Nat, v. 32, n. 132/133, p. 71-101, 1976.

VERBRUGGEN, H. Resegmenting Halimeda. Molecular and morphometric studies of species boundaries within a green algal genus. 2005. Ghent University

VERBRUGGEN, H.; ASHWORTH, M.; LODUCA, S. T.; VLAEMINCK, C.; COCQUYT, E.; SAUVAGE, T.; ZECHMAN, F. W.; LITTLER, D. S.; LITTLER, M. M.; LELIAERT, F. A multi-locus time-calibrated phylogeny of the siphonous green algae. Molecular phylogenetics and evolution, v. 50, n. 3, p. 642-653, 2009a.

VERBRUGGEN, H.; DE CLERCK, O.; COCQUYT, E.; KOOISTRA, W. H.; COPPEJANS, E. Morphometric taxonomy of siphonous green algae: A methodological study within the genus Halimeda (Bryopsidales) Journal of Phycology, v. 41, n. 1, p. 126-139, 2005a.

VERBRUGGEN, H.; DE CLERCK, O.; KOOISTRA, W. H.; COPPEJANS, E. Molecular and morphometric data pinpoint species boundaries in Halimeda section Rhipsalis (Bryopsidales, Chlorophyta). Journal of Phycology, v. 41, n. 3, p. 606-621, 2005b.

VERBRUGGEN, H.; DE CLERCK, O.; SCHILS, T.; KOOISTRA, W. H. C. F.; COPPEJANS, E. Evolution and phylogeography of Halimeda Section Halimeda (Bryopsidales, Chlorophyta). Molecular Phylogenetics and Evolution, v. 37, n. 3, p. 789- 803, 2005c.

VERBRUGGEN, H.; KOOISTRA, W. H. C. F. Morphological characterization of lineages within the calcified tropical seaweed genus Halimeda (Bryopsidales, Chlorophyta). European Journal of Phycology, v. 39, n. 2, p. 213-228, 2004.

VERBRUGGEN, H.; LITTLER, D. S.; LITTLER, M. M. Halimeda pygmaea and Halimeda pumila (Bryopsidales, Chlorophyta): Two new dwarf species from fore reef slopes in Fiji and the Bahamas. Phycologia, v. 46, n. 5, p. 513-520, 2007.

VERBRUGGEN, H.; TYBERGHEIN, L.; PAULY, K.; VLAEMINCK, C.; NIEUWENHUYZE, K. V.; KOOISTRA, W. H.; LELIAERT, F.; CLERCK, O. D. Macroecology meets macroevolution: evolutionary niche dynamics in the seaweed Halimeda. Global Ecology and Biogeography, v. 18, n. 4, p. 393-405, 2009b.

VILLAÇA, R.; PEDRINI, A.; PEREIRA, S.; FIGUEIREDO, M. D. O. Flora marinha bentônica das ilhas oceânicas brasileiras. Ilhas oceânicas brasileiras: da pesquisa ao manejo, p. 105-146, 2006.

VROOM, P. S.; SMITH, C. M.; KEELEY, S. C. Cladistics of the Bryopsidales: a preliminary analysis. Journal of phycology, v. 34, n. 2, p. 351-360, 1998.

WHITE, T. J.; BRUNS, T.; LEE, S.; TAYLOR, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications, v. 18, n. 1, p. 315-322, 1990.

WYNNE, M. J. Marine algae and early explorations in the upper North Pacific and Bering Sea. Algae, v. 24, n. 1, p. 1-29, 2009.

WYSOR, B.; KOOISTRA, W. H. An annotated list of marine Chlorophyta from the Caribbean coast of the Republic of Panama. Nova Hedwigia, v. 77, n. 3-4, p. 487-523, 2003.

XIMENES, C. F. Taxonomia e filogenia dos representantes do gênero Halimeda J. V. Lamour. (Bryopsidales, Chlorophyta) no Brasil. 2015. 79 pp. (Mestrado em Botânica). Universidade Federal Rural de Pernambuco

XIMENES, C. F.; CASSANO, V.; OLIVEIRA-CARVALHO, M. D. F.; BANDEIRA- PEDROSA, M. E.; GURGEL, C. F. D.; VERBRUGGEN, H.; PEREIRA, S. M. B. Systematics of the genus Halimeda (Bryopsidales, Chlorophyta) in Brazil including the description of Halimeda jolyana sp. nov. Phycologia, v. 56, n. 4, p. 369-381, 2017.

4. RESULTADOS

Artigo 1: Systematics of the genus Halimeda (Bryopsidales, Chlorophyta) in Brazil including the description of Halimeda jolyana sp. nov.

Phycologia Volume 56 (4), 369–381 Published 20 March 2017

1 2 1,3 CAROLINE FEIJÃO XIMENES *, VALÉRIA CASSANO , MARIA DE FÁTIMA DE OLIVEIRA-CARVALHO , MARIA ELIZABETH

1 4 5 1,3 BANDEIRA-PEDROSA , CARLOS FREDERICO D. GURGEL , HEROEN VERBRUGGEN AND SONIA MARIA BARRETO PEREIRA

1 Department of Biology, Federal Rural University of Pernambuco, Rua Dom Manoel de Medeiros, s/n, 52171-900, Recife, Pernambuco, Brazil 2 Department of Botany, Biosciences Institute, São Paulo University, Rua do Matão 277, 05508-090, São Paulo, Brazil 3 Programa de Pós-graduação em Saúde Humana e Meio Ambiente, Federal University of Pernambuco, Rua Alto do Reservatório, s/n, 55608-680, Vitória de Santo Antão, Pernambuco, Brazil 4 Departament of Botany, Federal University of Santa Catarina, 88040-900, Florianópolis, Santa Catarina, Brazil 5 School of BioSciences, University of Melbourne, Victoria 3010, Australia

ABSTRACT: The genus Halimeda has a wide geographic distribution in tropical to subtropical regions of the world. Molecular studies have uncovered cryptic and pseudocryptic species as well as strong biogeographic signals in phylogenies. To date, the diversity of Brazilian Bryopsidales has been studied from only a morphological perspective. Here we revised the diversity of Brazilian Halimeda based on molecular data (DNA barcode assessments of the tufA marker and multigene concatenated phylogenies) as well as morphological observations. Of the seven recognized morphospecies, only three were confirmed by molecular data: Halimeda opuntia, H. simulans and H. incrassata. The remaining four species, referred to as H. aff. cuneata, H. aff. gracilis, H. aff. tuna and H. aff. discoidea, showed morphological similarities with known species, but their sequences did not group with sequences of specimens from type localities, indicating the presence of cryptic diversity. Among the four taxa, H. aff. cuneata is so far endemic to Brazil and is herein described as a new species, H. jolyana sp. nov. The remaining three (pseudo-)cryptic species require further studies using a global sampling design. The evolutionary and biogeographic origins of Brazilian Halimeda species are discussed based on new molecular phylogenetic hypotheses.

KEY WORDS: Biogeography, DNA Barcoding, Multigene, Phylogeny, tufA

* Corresponding author ([email protected]). DOI: 10.2216/16-77.1 2017 International Phycological Society 34

INTRODUCTION

The marine green macroalgal genus Halimeda J.V.Lamouroux has 44 species (Guiry & Guiry 2016) and is an important constituent of calcareous sediment on the continental shelf in tropical and subtropical environments (Ries 2009). Halimeda species precipitate calcium carbonate in between their cells walls in the form of aragonite. The thallus is composed of calcified green segments formed by coenocytic filaments. Their segments accumulate after death (Hillis-Colinvaux 1980) to form reef limestone, which can be extracted and commercially exploited to produce lime or used in animal feed (Bandeira-Pedrosa et al. 2004b). Halimeda species are conspicuous members of benthic macroalgal communities, often forming clumps of thalli or monospecific meadows and providing shelter for important fishery resources, such as lobster (Panulirus argus Latreille, 1804) (Lentner & Ellis 2014). Halimeda specimens also produce secondary metabolites or bioactive molecules with antimicrobial activity, conferring them further economic value (e.g. Paul & Fenical 1984). The genus has received much attention by taxonomists due to its ecological and economic importance (Verbruggen et al. 2005a, b; Dijoux et al. 2012). Furthermore, several species present great phenotypic diversity. The genus contains cryptic and pseudocryptic species, making species delimitation on morphological grounds problematic (Kooistra et al. 2002; Verbruggen et al. 2005a, b; Dijoux et al. 2012; Pongparadon et al. 2015; Cremen et al. 2016).

Molecular studies have used techniques such as DNA barcoding to assist in green algal species delineation (e.g. Famá et al. 2002; Saunders & Kucera 2010; Sauvage et al. 2016). The plastid tufA marker has been successfully applied to delimit Halimeda species in New Caledonia (Dijoux et al. 2012) and Thai-Malay (Pongparadon et al. 2015) based on its suitable characteristics as both a DNA barcode and a phylogenetic marker (Saunders & Kucera 2010). TufA has also provided good phylogenetic resolution for other genera in the Bryopsidales, such as Caulerpa (Belton et al. 2014), confirming the effectiveness of this gene to discriminate species in the order. However, caution must be exercised, as the tufA marker is not a universal marker in the Chlorophyta. For example, tufA does not amplify in PCR reactions in species of Cladophorales, and hence its potential use within that order cannot be assessed (Saunders & Kucera 2010). In Brazil, previous studies on Halimeda using morphological and ultrastructural characters identified seven species: H. opuntia (Linnaeus) J.V.Lamouroux, H. tuna (J.Ellis & Solander) J.V.Lamouroux, H. gracilis Harvey ex J.Agardh, H. incrassata (J.Ellis) J.V.Lamouroux, H. discoidea Decaisne, H. cuneata Hering and H. simulans M.Howe 35

(Bandeira-Pedrosa et al. 2003, 2004b). The genus occurs from Maranhão state (northeastern Brazil, 02°31’47’’S) to Rio de Janeiro state (southeastern Brazil, 23°22’05’’S) and from intertidal to subtidal habitats up to 166 m deep (Bandeira-Pedrosa et al. 2004b). Due to high levels of morphological plasticity, the presence of cryptic species and the lack of molecular information, the main objective of this study was to revise the Brazilian Halimeda flora based on a combination of molecular and morphological data. Aspects of the biogeography of the Brazilian Halimeda flora are discussed. Our approach consisted of DNA barcode species delimitation methods using the tufA marker, phylogenetic reconstructions based on a concatenated data set of three genes and morphological observations.

MATERIAL AND METHODS

Specimens were collected along the Brazilian coast during 2009–2014 from the state of Maranhão (02°31’47’’S, 44°18’10’’W) to the state of Espírito Santo (20°19’10’’S, 40°20’16’’W) (Fig. A). A list of studied specimens with collection details and voucher accession numbers is presented in supplementary data Table S1. Samples were collected in either the intertidal region during low tide or subtidally to a depth of 24 m via SCUBA. Samples for molecular analysis were cleaned, dried in silica gel or preserved in absolute ethanol. Voucher specimens were deposited in the following herbaria: PEUFR (Rural Federal University of Pernambuco, Brazil), MELU (University of Melbourne, Australia) and SPF (São Paulo University, Brazil). The internal and external morphology were analysed according to Hillis-Conlivaux (1980) and Bandeira-Pedrosa et al. (2004b). For the internal morphology, specimens were decalcified with 20% HCl, and the filaments were dissected using a Leica S6D (Wetzlar, Germany) stereoscopic microscope. Utricle measurements and observations were performed with a Zeiss optical microscope Zeiss Axioskop (Oberkochen, Germany) and a stereoscopic microscope (Leica S6D). Silica-dried samples were macerated in liquid nitrogen to obtain a fine powder. DNA extraction was performed using a CTAB (cetyl trimethyl ammonium bromide) protocol as described in Oliveira-Carvalho et al. (2012). The plastid tufA gene was amplified with the primer pairs tufAF and tufAR (Famá et al. 2002). A single specimen per species-level cluster recognized in the tufA data was selected for rbcL amplification, which was achieved with two overlapping fragments with the primer pairs: F22-41 (Curtis et al. 2008) + R689–667 (Hanyuda et al. 2000) and F623-603 (Curtis et al. 2008) + R1396–1372 (Lam & Zechman 2006). 36

The genes were amplified by polymerase chain reaction (PCR). PCR was performed for each marker in a final volume of 50 µl, using 37.5 µl of MilliQ water, 5 µl of 10x PCR buffer, 37

1.5 µl of 50 mM MgCl2, 1 µl of 0.2 mM dNTP, 1 µl of 0.2 µM each primer, 3 µl of total DNA and 0.25 µl of Taq DNA polymerase (1.25 U; Promega Corp., Madison, Wisconsin USA). The reactions were performed in a Techne TC-4000 thermocycler (Bibby Scientific Ltd, Staffordshire, UK). For the tufA gene, the amplification cycle followed the Famá et al. (2002) protocol and for rbcL followed Curtis et al. (2008). PCR products were purified using the Illustra GFX PCR DNA and Gel Band Purification (GE Healthcare, Buckinghamshire, UK) according to the manufacturer’s instructions. Purified amplicons were sequenced in both directions using the same primers mentioned above and the BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, California USA) on an ABI PRISM 3100 or ABI PRISM 3730 Genetic Analyzer (Applied Biosystems). Consensus sequences from the reads and multiple sequence alignments were constructed manually using BioEdit v7.0.4.1 software (Ibis Biosciences, Carlsbad, California USA) (Hall 1999). In order to assess species membership of Brazilian specimens, we ran analyses of the tufA gene with data from previously published studies. For tufA analyses, Penicillus capitatus Lamarck (KU361927) and Udotea sp. (KU361932) were used as outgroups. Neighbour-joining (NJ) analysis was performed for tufA marker in PAUP v4.0b10 (Sinauer Associates Inc., Sunderland, Massachusetts USA) (Swofford 2002) with 2,000 bootstrap replicates. NJ was implemented using the Tamura & Nei (1993) substitution model. The most appropriate model of sequence evolution for maximum likelihood (ML) and Bayesian inference (BI) was selected using jModeltest v2.1.10 (Darriba et al. 2012) under the Akaike information criterion (AIC) as implemented on the online server CIPRES Science Gateway v3.3. The model selected was the general time reversible with invariant sites and gamma-distributed rates for the variable sites (GTR+I+G). ML analysis was performed using RAxML v8.2.0 (Stamatakis 2014) on the CIPRES portal with 100 bootstrap replicates. BI analysis was performed in MrBayes v3.0.4 (Huelsenbeck & Ronquist 2001) using four chains of the Markov chain Monte Carlo runs, sampling one tree every 1000 generations for 5,000,000 generations, starting with a random tree. The analysis was concluded when the average deviation of split frequencies was less than 0.01. We discarded the first 50,000 generations in both runs as the burn-in to build the consensus tree. The range of tufA divergence values within and between species was calculated using uncorrected p-distances in PAUP. In order to reliably infer the relationships between Brazilian and other Halimeda species, we constructed a concatenated alignment of tufA, rbcL and 18S DNA sequences, including some of our sequences along with previously published data. This data set was subjected to ML and BI phylogenetic analyses. ML searches were carried out with RAxML 38 v7.2.8 (Stamatakis 2006) with a GTR+I+G model and 100 bootstrap replicates. A chronogram was estimated to draw further biogeographic and evolutionary inferences from the data. The chronogram was constructed using the relaxed molecular method implemented in BEAST v1.8.2 (Drummond et al. 2012), the GTR+I+G model of sequence evolution, a Yule tree prior and a lognormal noncorrelated molecular clock model. The root of the tree, which was inferred by the relaxed molecular clock, was set to have an age of 147 Ma (Verbruggen et al. 2009b). The time calibrations by Verbruggen et al. (2009b) rely only on the fossil record of siphonous green algae, and hence no vicariance events are used to calibrate the molecular clock. The analysis was run for 10 million generations, logging the parameters and tree every 1000th generation. Stationarity of the run was determined visually with Tracer v1.6.0 and the burn-in set at 1 million generations. The post–burn-in sample of trees was summarized into a consensus with TreeAnnotator v1.8.2, calculating median node heights.

RESULTS Morphological analyses

Seven morphologically distinct taxa were identified among the 37 samples of Halimeda obtained from tropical and warm-temperate coasts of Brazil (Figs B 2–8): H. tuna (Fig. B-2), H. opuntia (Fig. B-3), H. aff. discoidea (Fig. B-4), H. simulans (Fig. B-5), H. aff. gracilis (Fig. B-6), H. jolyana sp. nov. (= H. aff. cuneata) (Fig. B-7) and H. incrassata (Fig. B-8). A comparison of morphological and anatomical characters among species is shown in Table 4.

Molecular species delimitation (tufA alignment)

The tufA alignment used for species delimitation was 792 nucleotides long and contained a total of 119 sequences: 36 newly generated and 83 downloaded from GenBank (Table S2). The data set consisted of 436 constant characters, of which 307 corresponded to parsimony-informative sites. The phylogeny showed five clades corresponding to distinct sections of the genus; however, there was no support for section Halimeda and moderate support for section Micronesicae in the NJ tree (Fig. C). Two species of section Rhipsalis – H. simulans and H. incrassata – showed the lowest interspecific differences for tufA (0.9%). Sequences of H. simulans and H. incrassata grouped with previously sequenced samples, confirming their morphological identification. The type locality of H. simulans is Isla de Culebra, Puerto Rico (Hillis-Conlivaux 1980), and the 39 sequences available in the database are from Jamaica, an island near the type locality. The type locality of H. incrassata is ‘West Indies’ (Silva et al. 1996). DNA sequence for tufA of H. incrassata from Brazil is identical to a sequence from the British Virgin Islands (FJ624534), suggesting that our material is true H. incrassata (Fig. B-8). In section Opuntia, only the pantropical species H. opuntia was present in Brazil, with 100% identity between sequences from Brazil, French Polynesia and the Philippines (Fig. C). There is no sequence from the type locality, Jamaica (Hillis-Colinvaux 1980), for comparison. For section Pseudo-opuntia, only specimens identified as H. aff. gracilis were found in Brazil (Fig. 6). In the tufA analyses, the Brazilian specimens did not group with sequences from the type locality, Sri Lanka, from which they differed by 3.8%, suggesting that they are not the same species. There was no intraspecific variation among Brazilian tufA sequences of H. aff. gracilis (n=2). The genetic divergence for H. gracilis from different countries ranged from 0.3% to 7.2%, and a 2.4% sequence divergence was found between Brazilian and US (Florida) specimens. The phylogenetic position and the high genetic divergence values between Brazilian and Floridian specimens of H. gracilis indicate that H. aff. gracilis from Brazil is a new species. Halimeda gracilis from the Philippines (FJ624727) and South Africa (JN644680) were the most divergent relative to other samples from this species complex (7%–7.2%) (Fig. C), indicating that Philippine and South African samples are not genuine H. gracilis. In section Halimeda, Brazilian specimens identified as H. aff. tuna showed low intraspecific divergence (0%–0.2%, n=5) and are sister to a subclade formed by H. tuna (Mexico) and H. scabra (Bahamas). The Brazilian specimens of H. aff. tuna diverged from H. tuna from Mexico by 1.2% and from H. scabra by 0.7%. The Brazilian specimens did not group with H. tuna from the Mediterranean Sea, the type locality of the species. The divergence between the Brazilian specimens and those from the type locality was high and ranged from 10.5% to 19.9%. It is noteworthy that samples from the Mediterranean Sea (Italy and France) differed from each other by 10% (79 base pairs). This high divergence may indicate that these are all distinct taxa. Brazilian specimens identified as H. aff. cuneata, including a sequence previously published as H. cuneata from Brazil (AY826358), were phylogenetically distinct from well-supported clades of H. cuneata from other parts of the world. The type locality of H. cuneata is South Africa, from which two species-level clusters corresponding to the morphology of H. cuneata are known (Verbruggen et al. 2005a). The intraspecific variation of Brazilian H. aff. cuneata range between 0.2% and 0.7% (n=7). Brazilian H. aff. cuneata diverged from H. cuneata from different countries by 9.1%– 10.3% and from sequences from the type locality (AY826353, AY826354) by 8.5%–12.5%, 40 indicating that the Brazilian specimens are not true H. cuneata but a separate species. The sample of Brazilian H. aff. discoidea grouped with a sequence from the Canary Islands, Spain (AY826361), and is sister to a well-supported H. discoidea clade from Jamaica (AY826362). The type locality of H. discoidea is considered Kamtschatka (northeastern Russia), but this information is questionable (Hillis-Conlivaux 1980), and there is no sequence from the type locality for comparison. The Brazilian H. aff. discoidea clade is separated from sequences of H. discoidea from the Indo-Pacific (e.g. New Caledonia, JN644661). Halimeda discoidea showed intraspecific divergences ranging from 1% to 10.1%. The highest observed divergence occurred between samples of H. aff. discoidea from Brazil and New Caledonia (10.1%) and the lowest between Brazil and Canary Islands sequences (1%). Specimens from Brazil and Jamaica differed by 4.3%.

Molecular phylogeny (concatenated alignment)

The chronogram (Fig. D) also showed how Brazilian species (gray boxes) relate to species from elsewhere. A tree with error bars for the inferred node ages is provided as supplementary material (S3). Halimeda jolyana (= H. aff. cuneata) was recovered with high confidence in the top lineage of section Halimeda, but resolution within that lineage is poor, and the exact position of the species was inconclusive. The chronogram indicates that H. jolyana (= H. aff. cuneata) is an early branching lineage, diverging from other lineages c. 70 Ma (95% HPD: 88–53 Ma). Brazilian H. aff. discoidea and H. aff. tuna are recovered in the same lineage of section Halimeda. In section Opuntia, the pantropical species H. opuntia was the most closely related to the Indo-Pacific species H. distorta 1 and 2. In section Pseudo- opuntia, the chronogram indicates that the Brazilian species H. aff. gracilis is an early- branching species (diverging c. 50 Ma; 95% HPD 59–37 Ma) without close relatives. Halimeda incrassata and H. simulans were inferred as sister species inside a well-supported lineage that also contained the Caribbean species H. monile (J.Ellis & Solander) J.V.Lamouroux and the Pacific species H. cf. stuposa W.R.Taylor. 41

Figures B - Habit of the studied species. (2) H. tuna (3) H. opuntia (4) H. aff. discoidea (5) H. simulans (6) H. aff. gracilis (7) H. aff. cuneata (= holotype of H. jolyana) (8) H. incrassata. Scale bars = 1 cm .

Table 4. Summary of morphoanatomical characteristics of Halimeda species from Brazilian coasts

Features H. opuntia H. incrassata H. simulans H. aff. discoidea H. aff. gracilis H. aff. tuna H. jolyana sp. nov. (as H. aff. cuneata) Shape of segments reniform, ribbed, cylindrical, Ribbed, reniform, reniform, discoid reniform, cuneate reniform, discoid discoid, cuneate auriculate, flattened subcylindrical, and subcylindrical and subcuneate and subcuneate cylindrical, discoid and flattened and subcuneate trilobed Measurement of 3-8 x 3-9 3-4 x 2-4 6-8 x 6-10 9-16 x 15-30 5.5-9 x 7-13 5-11 x 7-15 4-14 x 5-19 segments (length x width, mm) Holdfast Multiple holdfasts Bulbous Bulbous Basal and small Single Basal and single Basal and single Thallus length (cm) - 3.5-5.3 8 2.5 6-17 3.8-5 4.8-9.7 Nodal fusion Short with 2 or 3 Single cluster bu Single cluster by Short or complete Complete by 2 or 3 Short or complete Short or complete medullary siphons means of pores means of pores by 2 medullary medullary siphons by 2 medullary by 2 medullary connecting adjacent connecting adjacent siphons siphons siphons siphons siphons Primary utricles 12.5-35 40-62.5 22.5-45 47.5-75 47.5-67.5 27.5-50 50-75 diameter (surface view, µm) Primary utricles 12.5-50 45-90 40-100 25-85 40-75 50-125 60-162.5 length (surface view, µm) Second utricles 12.5-87.5 30-72.5 50-87.5 115-225 30-150 52.5-90 75-175 length (frontal view, µm) Shape of utricles Rounded to Hexagonal Hexagonal Hexagonal Rounded Polygonal Polygonal (surface view, µm) polygonal 43

Figura C - Consensus tree derived from Neighbour-Joining analyses of tufA sequences. Values above each branch refer to NJ (Neighbour-Joining), ML (maximum likelihood) bootstrap values and BI (Bayesian posterior probabilities), respectively. Brazilian samples generated in this study are in bold; – indicates lack of support; * indicates bootstrap support = 100%; LT indicates type locality. 44

Taxonomic changes

Based on our results, a new species is described to accommodate the taxon previously known as H. cuneata from Brazil:

Halimeda jolyana Ximenes, Bandeira-Pedrosa, Cassano, Oliveira-Carvalho, Verbruggen & S.M.B. Pereira, sp. nov.

Figs B-7, E, F

DIAGNOSIS: Thallus with light calcification and dark green colour, composed of very thick segments, 1.7–3.0 mm; segments often rounded, and some of them nearly half as long; nodal region with stalk zone giving loose appearance between the segments; medullary filaments torulose.

HOLOTYPE: Brazil, Espírito Santo, Anchieta, Praia de Castelhanos, 20°48’45.4’’S, 40°38’05.6’’W, leg. F. Scherner, collected 30 March 2012, subtidal zone, 3 m deep, deposited in Rural Federal University of Pernambuco, Brazil (PEUFR 52078). GenBank accession number for tufA KT781872.

ETYMOLOGY: The species is named in honor of Dr Aylthon Brandão Joly from the University of São Paulo, the first Brazilian phycologist.

OTHER REPRESENTATIVE SPECIMENS: Brazil. Espírito Santo, Anchieta, Praia de Castelhanos, subtidal zone; (PEUFR 52081), intertidal reef (MELU HV05153), Espírito Santo, Marataízes, semi exposed reef (MELU HV05229), Bahia, Prado, Praia Ponta do Corumbau, intertidal reef (PEUFR 52076).

PREVIOUSLY MISAPPLIED NAMES FOR BRAZIL: Halimeda cuneata in Bandeira-Pedrosa et al. (2004a, pp. 51, 55–56, figs. 1–25), Bouzon et al. (2010, pp. 600–601, figs. 1–5), Santos et al. (2013, p. 19), Torrano-Silva & Oliveira (2013, p. 155), Santos & Nunes (2015, p. 3, fig. 1a–k).

Morphology and anatomy

Plants were dark green and attached to rock by an extensive filamentous holdfast disc that spreads out for 1–2 cm (Figs E 11– 15). Mature plants stand 4–25 cm tall. The thallus branched dichotomously or in trifurcations. Segments were very lightly calcified. Basal 45 segments were commonly cylindrical or subcylindrical. Segments higher up the thallus were often discoid, sometimes cuneate or subcuneate and 5–19 mm broad, 4–14 mm long, and 1.8– 3.0 mm thick. Segments were remarkably thick set (Fig. 14), with a thickness-to-length ratio of 0.25–0.55 measured in fresh and wet-preserved material. Some segments were separated by an uncorticated region of medullary filaments extending for up to c. 1 mm. The cortex consisted of three (up to five) layers of utricles. Secondary utricles were 75–175 µm long, giving rise to two primary utricles. The primary utricles were 60–165 µm long and 50–75 µm wide and were elongate cup-shaped, and some fuse laterally with adjacent utricles. In surface view, primary utricles appeared in a regularly polygonal (mostly hexagonal) pattern, tightly pressed against one another. Nodal fusions were complete, with two medullary filaments joined to form a single one above the node. The spacer zone present between some segments consisted of joined siphons, showing thick cell walls and occasional tufts of rudimentary cortication (Bandeira-Pedrosa et al. 2004a). Gametangia were formed along the distal edge of the segment as well as on the segment surface, often in tufts (Figs 16–22). Gametangia were obovoid pyriform and borne per one to four on gametophores (Figs 19–22). The species also had lenticular thickenings of the external cell wall of primary utricles (Bandeira-Pedrosa et al. 2004a). For detailed figures see also Bandeira-Pedrosa et al. (2004b) as H. cuneata.

Ecology

Halimeda jolyana formed extensive populations near the low tide mark on rock platforms. We visited several locales near Anchieta (Espírito Santo state) during the perigee full moon of 8–10 September 2014. Halimeda jolyana was found in several stages of gametangial development, including the formation of gametangia on green plants, pale plants bearing dark green gametangia and completely white plants that had fully shed their gametes (Figs 16–22). Halimeda jolyana grew in semi-protected, wave-swept and surge-affected environments. Thalli of H. jolyana were very flexible, which reduces drag. The flexibility came almost entirely from the bendable nodes. While segments sat flush on top of one another in more protected areas, nodes were elongated in plants from areas more exposed to high- energy wave action, creating additional space between segments that facilitate bending. In these habitats, individual nodes could bend to an angle of nearly 908. We speculate that the typical H. cuneata morphology with elongated nodal areas and tiny cushion segments is an adaptation to facilitate thallus flexibility in high-energy environments. 46

Figure D - Bayesian chronogram for the genus Halimeda resulting from the BEAST analysis, showing the relationship of species present in Brazil (grey boxes) with those from elsewhere. Branch support is given as Bayesian posterior probabilities (BEAST analysis, shown if > 0.90) and ML bootstrap values (RAxML analysis, shown if > 50).

Figure E - Habit of the new species Halimeda jolyana. Scale bars = 1 cm. Fig. 11. Patch of plants growing on a rocky shore in the low intertidal (HV05229, Espírito Santo, Marataizes, Praia da Cruz). Fig. 12. Dense plant growing in a rock pool in the mid-intertidal (HV05091, Espírito Santo, Ubu, Praia de Parati). Fig. 13. Appearance of live plant in field laboratory, showing common discoid segments (HV05086, Espírito Santo, Ubu, Praia de Parati). Fig. 14. In situ photograph showing very thickset appearance of segments (Espírito Santo, Marataízes, Praia da Cruz). Fig. 15. Live plant showing very thick segments (HV05221, Espírito Santo, Marataízes, Praia da Cruz). 48

Figure F- Gametangia of the new species Halimeda jolyana. Scale bars = 5 mm. Fig. 16. In situ photograph of a fertile branch with segments still green (HV05153). Fig. 17. Ghost thallus from which gametes have been released. Fig. 18. Gametangia lining distal segment edge and occurring in patches on the segment surface (HV05198). Figs 19–22. Detailed view of gametophore clusters. All material collected in Espírito Santo state (Anchieta, Praia dos Castelhanos). Scale bars = 500 µm.

DISCUSSION Species diversity in Brazil

Our molecular and morphological results showed that several taxonomic revisions of the genus Halimeda at the species level are needed in Brazil. Of the seven taxa initially identified on morphological grounds, three were later assigned to the correct species based on molecular results: H. opuntia, H. incrassata and H. simulans. The remaining four species had morphological matches to known species, but molecular data showed that they represented cryptic diversity and hence are part of species complexes. The first well-defined species, H. opuntia, is easily recognized by the presence of multiple holdfasts that allow for the formation of large meadows in tropical reef flat areas (Hillis-Colinvaux 1980; Bandeira-Pedrosa et al. 2004b; Dijoux et al. 2012). Specimens of H. opuntia analysed in this study had high phenotypic plasticity, mainly in segment shape, but DNA sequence data confirmed that this variation is only at the morphological level. Morphological variation in shape, size and form have historically been attributed to environmental influences by Hillis-Colinvaux (1980), Bandeira-Pedrosa et al. (2004b) and Kooistra & Verbruggen (2005). Halimeda incrassata and H. simulans belong to section Rhipsalis. They are distinguished from other species by the presence of bulbous holdfasts and nodal fusions of siphons into a single cluster by means of pores connecting adjacent siphons (Hillis- Conlivaux 1980; Bandeira-Pedrosa et al. 2004 b; Verbruggen & Kooistra 2004). Both 49 species differ in size and shape of the holdfast as well as the shape of segments. Halimeda incrassata has a larger holdfast and segments with different shapes. Halimeda simulans has subcuneate basal segments and reniform ribbed segments nearer to the apices. The utricle shape also differs between these species: H. simulans has rounded primary utricles; whereas, those of H. incrassata are elongated. Despite the fairly low genetic divergence between H. simulans and H. incrassata, they are clearly distinguishable by morphological features, molecular sequences and timing of reproduction (Clifton 1997; Verbruggen et al. 2005 a, b). In Halimeda section Halimeda, H. tuna, H. discoidea and H. cuneata are overall morphologically consistent with the descriptions given by Hillis-Conlivaux (1980) and Bandeira-Pedrosa et al. (2004 a, b). However, the Brazilian specimens are genetically distinct from topotype sequences. Thus, we have opted to call them H. aff. tuna and H. aff. discoidea and describe H. aff. cuneata as a new species, H. jolyana. Kooistra et al. (2002), Verbruggen et al. (2005 a) and Dijoux et al. (2012) previously reported similar results where each of these morphospecies was recovered as multiple distinct clades, indicating cryptic diversity. Many of these cryptic species are geographically separated from one another, and each of the sections in Halimeda shows a biogeographic separation between Indo-Pacific and Atlantic sublineages, suggesting that vicariance may have happened either across the Isthmus of Panama (Kooistra et al. 1999) or, as molecular clocks would suggest, across the Middle Eastern Isthmus (Verbruggen et al. 2009 a, b). Halimeda jolyana (as H. cuneata) was reported initially from the Atlantic Ocean by Bandeira-Pedrosa et al. (2004 a), extending along the Brazilian coast from Rio do Grande do Norte (northeastern Brazil) to Espírito Santo (southeastern Brazil). Hillis-Colinvaux (1980) considered the presence of cuneate segments and small ‘cushion’ intercalary segments (or stalk) as diagnostic features distinguishing H. cuneata from related species, such as H. discoidea and H. tuna. Bandeira-Pedrosa et al. (2004a), using diagnostic features suggested by Hillis-Colinvaux (1980), originally recognized the Brazilian specimens as H. cuneata. However, our new collections from Brazil (Espírito Santo and Bahia) show specimens bearing mostly discoid segments (Figs 23–29; supplementary material S4). In this regard, H. jolyana differs from authentic H. cuneata, whose segments are more wedge shaped. Furthermore, our sequenced samples of H. jolyana are phylogenetically distant from H. cuneata from the type locality (South Africa) with high genetic divergence between them. A similar case was recently described by Cremen et al. (2016), who renamed H. cuneata from the southwestern coast of Australia as H. versatilis J.Agardh. The sequence 50 of H. versatilis (as H. cuneata, AY826355) from Australia positioned in a distinct lineage (Fig. 9) with 9.4%–9.5% of divergence regarding our H. jolyana. The Brazilian H. jolyana, the Australian H. versatilis and the authentic South African H. cuneata share some morphological similarities. These include the presence of a stalked nodal region (Figs 7, 28, S4), the presence of commonly cylindrical basal segments and the cushion zones at the nodal region (Cremen et al. 2016; this study). Morphologically, H. versatilis differs from H. jolyana by its broadly cuneate segments, often longer than broad, dichotomous branching pattern, but with two to three (up to five daughter segments), and nodal siphons adhering in pairs or clusters of three or more. Halimeda jolyana, in turn, has often discoid segments, dichotomously branched or in trifurcations and nodal siphons adhering in pairs. Halimeda aff. tuna showed great sequence similarity with sequences of Caribbean specimens belonging to the same species as well as with H. scabra. In turn, H. tuna from the Mediterranean Sea (type locality) formed a separate group from the Caribbean and Brazilian H. tuna sequences, indicating that this species is restricted to the Mediterranean Sea. It is clear that a new epithet is needed for H. aff. tuna from the Caribbean and Brazil, but due to the close molecular affinities between this entity, H. scabra and H. hummii D.L. Ballantine, more detailed work on this species complex across the geographic ranges of these species will be needed. Halimeda discoidea also falls into multiple species-level clades, including the lineage H. aff. discoidea present in Brazil. It is not possible to compare the Brazilian sequence to collections from the type locality in order to confirm the identification of the species because the precise information about the type locality remains questionable in the literature (Hillis-Conlivaux 1980). In this case, sequencing the type specimen may be the only option to resolve the issue. Halimeda aff. gracilis is a good morphological match with the isotype from Sri Lanka examined by Bandeira-Pedrosa et al. (2004b). This indicates that it could be a cryptic species; although, more detailed morphometric analysis may reveal differences (e.g. Verbruggen et al. 2006, 2016).

Biogeographic considerations

Our results also permit us to discuss the biogeography of the genus in more detail from the perspective of species distributions, biodiversity patterns along the Brazilian coast and the historical origins of the Brazilian species. 51

Bandeira-Pedrosa et al. (2004b) mapped the geographic distributions of the seven Brazilian Halimeda species. They recorded H. cuneata, H. opuntia and H. discoidea on the Espírito Santo coast. The present study recorded H. simulans for the first time in Espírito Santo as well, extending its distribution along the Brazilian coast (Fig.1). The distribution of many Halimeda species extend from northeastern to southeastern Brazil having distribution limits in Bahia or Espírito Santo states. However, H. jolyana appears to be restricted to the tropical waters from the south-central region of Bahia to Espírito Santo, being the only intertidal species that occurs in Espírito Santo state. The greatest species diversity of the genus occurred on the coasts of Bahia and Espírito Santo. They are in the tropical warm province and transition zone, respectively, according to the classification of Horta et al. (2001). All seven species of Halimeda from Brazil occur in Bahia state (Bandeira-Pedrosa et al. 2004b; Santos & Nunes 2015), which belongs to the tropical warm province, and is characterized by oligotrophic waters and sandstone reefs encrusted with algae and stony corals. Espírito Santo, in the transition between tropical and the so-called warm-temperate zone (sensu Horta et al. 2001), has unique features and high specific diversity. This is attributed to the wide range of environments, including reef formations, bedrock of the crystalline massif, consolidated substrates of calcareous algae and extensive rhodolith banks. These consolidated limestone substrata extend below 100m depth under the influence of the Brazil Current, which with its high transparency provides adequate habitat for colonizing macroalgae (Horta et al. 2001). From a historical biogeographical perspective, the time calibrated multigene results showed that the Brazilian Halimeda flora is formed by phylogenetically distinct lineages (i.e. four distinct sections). In Brazil, H. jolyana and H. aff. discoidea are the two phylogenetically closest species, yet the chronogram identified their most recent common ancestor at 70 Ma. Most recent common ancestors among all Brazilian Halimeda species are 70 Ma or older, which is indicative of a complete absence of local recent radiations. The relatively species- poor Halimeda flora (i.e. only seven species across ~ 7387 km of tropical and subtropical coastline) and the origin of this flora composed of phylogenetically distinct lineages suggest that Brazil is a sink and not a source of Halimeda species from other parts of the world. Many of the Halimeda species found in Brazil are derived from a more diverse pool of species in the Caribbean Sea and other subtropical Atlantic Ocean localities. Five out of the seven species – H. aff. discoidea, H. aff tuna, H. opuntia, H. incrassata and H. simulans – are Caribbean species that extend their distribution south into Brazil. The close phylogenetic relationship in terms of the Halimeda flora between Brazil and the Caribbean agrees with a wider analysis of 52 the origin of the Brazilian macroalgal flora that recognizes the Caribbean as one of the main source of species (Oliveira 1977). The Brazilian coasts also have an endemic element, represented here by the species H. jolyana and H. aff. gracilis. Regrettably, their evolutionary and biogeographic origins are difficult to establish. Our chronogram suggests that both are the sole descendants of early- branching lineages (> 45 Ma), and without close relatives for comparison, it is difficult to be conclusive about their historical biogeographic origins.

ACKNOWLEDGEMENTS

We would like to thank Conselho Nacional de Pesquisa e Tecnologia for the stock grant for the first author and the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior of the Programa Nacional de Pós-doutorado (Process 02991/09-8) for the financial support in obtaining collected botanical material. We would like to thank Mariana C. Oliveira, coordinator of the project Br-BOL 564945-20102, 301491-2013-5 (CNPq), for partial financial support and all the collectors listed, mainly Douglas Burgos, Fernando Scherner and Beatriz Torrano-Silva. H.V. thanks Mutue Fujii for facilitating fieldwork in Esp´ırito Santo state, CNPq for providing air travel and Vanessa Rossetto Marcelino for assistance in the field. Funding was provided to H.V. by the Australian Research Council (FT110100585), the Australian Biological Resources Study (RFL213-08) and the University of Melbourne (Faculty of Sciences engagement grant). 53

SUPPLEMENTARY DATA

Table S1. Brazilian samples of Halimeda obtained in this study.

Taxa Collection data tufA rbcL Halimeda aff. cuneata Brazil, Bahia, Porto Seguro, Praia do Espelho, 13.05.2014, B. N. Torrano-Silva, J. P. Santos, A. S. KT781874 KT781864 Santos, 16⁰43'35.8"S, 39⁰07'27.8"W, PEUFR 52075 Brazil, Bahia, Prado, Praia Ponta do Corumbau, 13.05.2014, B. N. Torrano-Silva, J. P. Santos, A. S. H. aff. cuneata KT781875 Santos, 16⁰53'52.8"S, 39⁰06'34.7"W, PEUFR 52076 Brazil, Bahia, Camaçari, Praia de Itacimirim, 06.11.2010, M. F. Oliveira-Carvalho, 12°36'50.0"S, H. aff. cuneata KT781871 38°02'50.0"W, PEUFR 52077 Brazil, Bahia, Salvador, Praia de Stella Maris, 22.05.2013, C. A. A. Azevedo, T. Vieira-Pinto, B. N. H. aff. cuneata KT781869 Torrano-Silva, 12⁰55'51.3"S, 38°19'12.4"W, PEUFR 52079 Brazil, Bahia, Ilha de Itaparica, Recifes de Caramuanos, 22.05.2013, C. A. A. Azevedo, T. Vieira- H. aff. cuneata KT781873 Pinto, B. N. Torrano-Silva, 13°07'55.3"S, 38°45'45.3"W, PEUFR 52080 Brazil, Espírito Santo, Anchieta, Praia de Castelhanos, 30.03.2012, F. Scherner, 20º48'45.4''S, H. aff. cuneata KT781872 40º38'05.6''W, PEUFR 52078 H. aff. cuneata Brazil, Espírito Santo, Anchieta, Praia de Castelhanos, 30.03.2012, F. Scherner, 20º48'45.4''S, KT781870 40º38'05.6''W, PEUFR 52081 H. aff. discoidea Brazil, Espírito Santo, Vitória, Arquipélago de Trindade, 03.07.2012, M. Sissini, 20º31'29''S, KT781876 29º19'29''W, PEUFR 52082 H. aff. gracilis Brazil, Espírito Santo, Escalvada, Praia de Guarapari, 28.03.2014, F. Scherner, 20º40'00''S, KT781877 40º29'00''W, PEUFR 52083 H. aff. gracilis Brazil, Espírito Santo, Escalvada, Praia de Guarapari, 28.03.2014, F. Scherner, 20º40'00''S, KT781878 KT781865 40º29'00''W, PEUFR 52084 H. incrassata Brazil, Pernambuco, Tamandaré, Praia da Perua Preta, 09.03.2012, D. C. Burgos, 08º44'11''S, KT781884 KT781867 35º05'18''W, PEUFR 52085 H. opuntia Brazil, Alagoas, Pajuçara, Praia da Pajuçara, 02.11.2013, M. F. Oliveira-Carvalho, C. F. Ximenes, S. KT781902 Rodrigues, 09º40’21"S, 35º42’43"W, PEUFR 52096 H. opuntia Brazil, Alagoas, Maceió, Praia de Ponta Verde, 07.07.2013, S. Rodrigues, 09°39'39"S, 35º42'11''W, KT781894 PEUFR 52097 54

Table S1. Brazilian samples of Halimeda obtained in this study.

Taxa Collection data tufA rbcL Halimeda opuntia Brazil, Alagoas, Pajuçara, Praia da Pajuçara, 02.11.2013, M. F. Oliveira-Carvalho, C. F. Ximenes, S. KT781897

Rodrigues, 09º40’21"S, 35º42’43"W, PEUFR 52100 H. opuntia Brazil, Alagoas, Pajuçara, Praia da Pajuçara, 02.11.2013, M. F. Oliveira-Carvalho, C. F. Ximenes, S. KT781898

Rodrigues, 09º40’21"S, 35º42’43"W, PEUFR 52101 H. opuntia Brazil, Alagoas, Maragogi, Praia de Maragogi, 05.11.2013, M. F. Oliveira-Carvalho, C. F. Ximenes, KT781895

S. Rodrigues, 09°00'49"S, 35º13'04''W, PEUFR 52098 H. opuntia Brazil, Bahia, Ilha de Itaparica, Recifes de Caramuanos, 22.05.2013, C. A. A. Azevedo, T. Vieira- KT781899

Pinto, B. N. Torrano-Silva, 13°07'55.3"S, 38°45'45.3"W, PEUFR 52102 H. opuntia Brazil, Bahia, Camaçari, Praia de Jauá, 23.05.2013, C. A. A. Azevedo, T. Vieira-Pinto, B. N. KT781900

Torrano-Silva 12°49'51.0"S, 38°13'44.1"W, PEUFR 52103 H. opuntia Brazil, Bahia, Camaçari, Praia de Jauá, 06.11.2010, M. F. Oliveira-Carvalho, 12°49'51.0"S, KT781901

38°13'44.1"W, PEUFR 52104 H. opuntia Brazil, Paraíba, João Pessoa, Picãozinho, 04.11.2010, M. F. Oliveira-Carvalho, 07º06'54''S, KT781891

34º51'47.2''W, PEUFR 52089 H. opuntia Brazil, Pernambuco, Sirinhaém, Ilha de Santo Aleixo, 12.09.2010, M. F. Oliveira-Carvalho, KT781890 08º36'46.4''S, 35º01'22.6''W, PEUFR 52090 H. opuntia Brazil, Pernambuco, Sirinhaém, Ilha de Santo Aleixo, 02.12.2009, M. F. Oliveira-Carvalho, KT781889 08º36'46.4''S, 35º01'22.6''W, PEUFR 52091 H. opuntia Brazil, Pernambuco, Tamandaré, Praia da Perua Preta, 09.03.2012, D. C. Burgos, 08º44'11''S, KT781888 35º05'18''W, PEUFR 52092 H. opuntia Brazil, Pernambuco, Paulista, Praia do Janga, 04.04.2012, D. C. Burgos, 07º56'21''S, 34º49'35''W, KT781887 PEUFR 52093 H. opuntia Brazil, Pernambuco, Ipojuca, Praia de Serrambi, 09.10.2010, M. F. Oliveira-Carvalho, 8º33'30''S, 35º00'58''W, PEUFR 52094 KT781886 H. opuntia Brazil, Pernambuco, Ipojuca, Praia de Serrambi, 31.01.2014, M. E. Bandeira-Pedrosa, 08º33'30''S, KT781885 35º00'58''W, PEUFR 52095 H. opuntia Brazil, Rio Grande do Norte, Nísia Floresta, Recifes de Pirangi do Sul, 04.12.2013, M. E. Bandeira- KT781893 Pedrosa, C. F. Ximenes, 05º59'01''S, 37º07'20''W, PEUFR 52087

Table S1. Brazilian samples of Halimeda obtained in this study.

Taxa Collection data tufA rbcL Halimeda opuntia Brazil, Rio Grande do Norte, Nísia Floresta, Recifes de Pirangi do Sul, 04.12.2013, M. E. Bandeira- KT781892 Pedrosa, C. F. Ximenes, 05º59'01''S, 37º07'20''W, PEUFR 52088 Brazil, Espírito Santo, Vitória, Arquipélago de Trindade, 10.07.2012, M. Sissini, ES, 20º31'29''S, KT781904 H. simulans 29º19'29''W, PEUFR 52106 Brazil, Bahia, Ilha de Itaparica, Praia da Coroa, 24.05.2013, C. A. A. Azevedo, T. Vieira-Pinto, B. N. KT781903 KT781868 H. simulans Torrano-Silva, 13°00'21.2"S, 38°38'16.0"W, PEUFR 52105 Brazil, Bahia, Porto Seguro, Praia de Ondina, 15.01.2012, M. F. Oliveira-Carvalho, 13°00'40"S, KT781879 H. aff. tuna 38º30'31''W, PEUFR 52111 Brazil, Alagoas, Paripueira, Praia de Paripueira, 03.11.2013, M. F. Oliveira-Carvalho, C. F. Ximenes, KT781880 H. aff. tuna S. Rodrigues, 09°28'26" S, 35º32'37''W, PEUFR 52110 Brazil, Maranhão, São Luiz, Parcel Manoel Luís, 12.04.2012, M. Sissini, 00º50'00''S, 44º15'00''W, KT781883 KT781866 H. aff. tuna PEUFR 52107 Brazil, Alagoas, Paripueira, Praia de Paripueira, 03.11.2013, M. F. Oliveira-Carvalho, C. F. Ximenes, KT781881 H. aff. tuna S. Rodrigues, 09°28'26" S, 35º32'37''W, PEUFR 52109 Brazil, Paraíba, João Pessoa, Picãozinho, 04.11.2010, M. F. Oliveira-Carvalho, 07º06'54''S, KT781882 H. aff. tuna 34º51'47.2''W, PEUFR 52108 56

Table S2. Taxa used in this study for phylogenetic analysis. Samples Collection data Reference GenBank accession numbers (tufA/rbcL/18S) Bryopsis plumosa (Huds.) C. Argentina Ciancia et al. 2012 JQ755423/-/- Agardh Caulerpa racemosa (Forssk.) New Caledonia Sauvage et al. 2013 JN645169/-/- J. Agardh Derbesia marina (Lyngb.) USA Saunders and Kucera 2010 HQ610250/-/- Solier Halimeda borneensis W. R. New Caledonia Dijoux et al., 2012 JN644651/-/- Taylor H. borneensis French Polynesia Dijoux et al., 2012 JN644647/-/- H. borneensis Indonesia Kooistra, unpublished -/-/AF525558 H. borneensis French Polynesia Verbruggen et al. 2006, AM049955/FJ624514/- 2009b H. copiosa Goreau & E. A. Jamaica Verbruggen et al. 2007 EF667065 Graham H. copiosa Jamaica Verbruggen et al. 2009b FJ624646/FJ624508/ AF525612 H. copiosa Jamaica Verbruggen et al. 2009b FJ624647/-/- H. cryptica Hillis-Col. & E. A. Jamaica Verbruggen et al. 2007 EF667057/FJ624496 /- Graham H. cryptica Jamaica Kooistra et al. 2002 -/-AF407244 H. cuneata K. Hering South Africa Verbruggen et al. 2005b AY826353/-/- H. cuneata South Africa Verbruggen et al. 2005b AY826354/-/AY823841 H. cuneata South Africa Verbruggen et al. 2009b -/FJ624533/- H. cuneata South Africa Verbruggen et al. 2005b -/-/AF407256 H. cuneata Sri Lanka Verbruggen et al. 2005b FJ624537/-/- H. cuneata Brazil Verbruggen et al. 2005b AY826358/-/AY823837 H. cuneata Australia Verbruggen et al. 2005b AY826355/-/ AY823838 H. cuneata Guam Verbruggen et al. 2006 AY826357/-/- H. cuneata Yemen Verbruggen et al. 2006 AY826356/-/- H. cylindracea Decne. New Caledonia Dijoux et al. 2012 JN644653 H. cylindracea Yemen Verbruggen et al. 2006 AM049956/FJ624510/- H. cylindracea Australia Kooistra, unpublished -/-/AF525548 H. discoidea Descne. Spain Kooistra et al. 2002, AY826361/-/AF407249 Verbruggen et al. 2005b H. discoidea “friabilis” Jamaica Verbruggen et al. 2005b, AY826362/-/FJ624489 2009b H. discoidea New Caledonia Dijoux et al. 2012 JN644661/-/- H. discoidea Yemen Verbruggen et al. 2005b AY826360/-/- H. discoidea Japão Hanyuda et al. 2000 -/AB038488/- H. discoidea Fiji Kooistra, unpublished -/-/AF525600 H. distorta (Yamada) Hillis- Philippines Verbruggen et al. 2009b FJ624653 Col. H. distorta Wallis and Futuna Verbruggen et al. 2009b FJ624644/-/- H. distorta Australia Kooistra et al. 2002 -/-/AF407269 H. distorta Tanzania Verbruggen et al. 2009b FJ624658 H. distorta French Polynesia Verbruggen et al. 2009b FJ624709/FJ624505/- H. distorta Australia Kooistra, unpublished -/-/AF525642 57

Table S2. Taxa used in this study for phylogenetic analysis. Samples Collection data Reference GenBank accession numbers (tufA/rbcL/18S) Halimeda distorta New Caledonia Verbruggen et al. 2009b FJ624652/-/- H. fragilis W. R. Taylor Mariana Islands Verbruggen et al. 2009b FJ624640/-/- H. fragilis Guam Kooistra et al. 2002, -/FJ624498/AF407245 Verbruggen et al. 2009b H. fragilis New Caledonia Dijoux et al. 2012 JN644673/-/- H. fragilis New Caledonia Dijoux et al. 2012 -/JN644739/- H. fragilis Maldives Dijoux et al. 2012 JN644671/-/- H. gigas W. R. Taylor Tanzania Verbruggen et al. 2009b FJ624539/-/- H. gigas Maldivas Dijoux et al. 2012 JN644674/-/- H. goreauii W. R. Taylor Jamaica Verbruggen et al. 2009b FJ624662/-/- H. goreauii Panama Verbruggen et al. 2009b FJ624659/FJ624509/- H. goreauii Mexico Kooistra, unpublished -/-/AF525611 H. gracilis Harv. ex J. Agardh USA Verbruggen et al. 2009b FJ624731/FJ624491/ FJ624487 H. gracilis Jamaica Verbruggen et al. 2007 EF667063/FJ624494/- H. gracilis Tanzania Verbruggen et al. 2009b FJ624725/-/- H. gracilis Panama Kooistra, unpublished -/-AF525609 H. gracilis South Africa Verbruggen et al. 2009b FJ624726/-/- H. gracilis Sri Lanka Kooistra et al. 2002, FJ624724/-/AF407257 Verbruggen et al. 2009b H. gracilis Jamaica Verbruggen et al. 2009b FJ624719/-/- H. gracilis Austrália Verbruggen et al. 2009b FJ624728/-/- H. gracilis French Polynesia Verbruggen et al. 2009b FJ624722/-/- H. gracilis French Polynesia Verbruggen et al. 2006 AM049965/FJ624492/- H. gracilis Philippines Verbruggen et al. 2009b FJ624727/FJ624493/- H. gracilis South Africa Dijoux et al. 2012 JN644680/-/- H. gracilis French Polynesia Verbruggen et al. 2005a, FJ624722/-/AY786525 2009b H. heteromorpha N'Yeurt Philippines Verbruggen et al. 2009b FJ624535/-/- H. heteromorpha French Polynesia Dijoux et al. 2012 JN644683/-/- H. heteromorpha French Polynesia Verbruggen et al. 2009b -/FJ624511/- H. hummii D. L. Ballant. Panama Verbruggen et al. 2005b AM049988/-/- H. hummii Panama Kooistra, unpublished -/-AF407247 H. incrassata (J. Ellis) J. V. USA Verbruggen et al. 2006 AM049959/-/- Lamour. H. incrassata French Polynesia Kooistra, unpublished -/-/AF525569 H. incrassata Bahamas Verbruggen et al. 2006 AM049958/-/- H. incrassata Virgins British Island Verbruggen et al. 2006 FJ624534/-/- H. incrassata French Polynesia Verbruggen et al. 2006 AM049957/-/- H. incrassata USA Kooistra, unpublished -/-/AF525540 H. kanaloana Vroom New Caledonia Dijoux et al. 2012 JN644685/-/- H. kanaloana USA Verbruggen et al. 2009b -/FJ624512/- H. kanaloana USA Verbruggen et al. 2009b -/-/FJ624486 H. lacrimosa M. Howe Bahamas Verbruggen et al. 2007 EF667064/-/- H. lacrimosa Bahamas Verbruggen et al. 2009b FJ624730/FJ624495/- 58

Table S2. Taxa used in this study for phylogenetic analysis. Samples Collection data Reference GenBank accession numbers (tufA/rbcL/18S) Halimeda lacrimosa Bahamas Kooistra et al. 2002 -/-/AF407258 H. lacunalis W. R. Taylor New Caledonia Dijoux et al. 2012 JN644689/-/- H. lacunalis Guam Verbruggen et al. 2005b AY826363/-/AF525579 H. lacunalis New Caledonia Dijoux et al. 2012 JN644686/-/- H. lacunalis Australia Verbruggen et al. 2009b -/FJ624521/- H. macroloba Decne. Tanzania Verbruggen et al. 2006 AM049960/FJ624513/- H. macroloba Australia Waegele et al. 2011 HM140244/-/- H. macroloba Tanzania Kooistra et al. 2002 -/-/AF407240 H. macrophysa Askenasy New Caledonia Verbruggen et al. 2005b AM049989/-/AF525590 H. magnidisca Noble Guam Verbruggen et al. 2009b AY826364/-/- H. magnidisca Australia Verbruggen et al. 2009b FJ624536/FJ624530/- H. magnidisca Yémen Kooistra, unpublished -/-/AF407253 H. magnidisca Australia Verbruggen et al. 2009b FJ624536/FJ624530/- H. melanesica Valet New Caledonia Dijoux et al. 2012 JQ432551/-/- H. melanesica Philippines Verbruggen et al. 2006 AM049961/FJ624515/- H. melanesica Indonesia Kooistra et al. 2002 -/-/AF407237 H. micronesica Yamada Fiji Verbruggen et al. 2007 EF667061/-/- H. micronesica Australia Verbruggen et al. 2007 EF667060/-/- H. micronesica Wallis and Futuna Verbruggen et al. 2009b -/FJ624499/- H. micronesica Australia Kooistra et al. 2002 -/-/AF407243 H. minima (W. R.Taylor) New Caledonia Dijoux et al. 2012 JN644697/-/- Hillis-Col. H. minima Yemem Kooistra et al. 2002, -/FJ624500/AF407263 Verbruggen et al. 2009b H. minima Guam Verbruggen et al. 2009b -/FJ624503/- H. minima Guam Kooistra, unpublished -/-/AF525620 H. minima Philippines Verbruggen et al. 2009b FJ624676/-/- H. minima Philippines Verbruggen et al. 2009b -/FJ624504/AF525618 H. minima Fiji Verbruggen et al. 2009b FJ624686/-/- H. minima Philippines Verbruggen et al. 2009b -/FJ624502/- H. monile (J. Ellis & Sol.) J.V. Panama Verbruggen et al. 2006, AM049962/FJ624516/- Lamour. 2009b H. monile Panama Verbruggen et al. 2005a -/-/AY835502 H. opuntia J.V. Lamour. French Polynesia Verbruggen et al. 2007 EF667066/-/- H. opuntia Philippines Verbruggen et al. 2009b FJ624690/-/- H. opuntia New Caledonia Dijoux et al. 2012 JN644713/-/- H. opuntia Japão Hanyuda et al. 2000 -/AB038489/- H. opuntia Panama Kooistra, unpublished -/-/AF525624 H. pygmaea Verbruggen, Fiji Verbruggen et al. 2007 EF667062/-/- Littler & Littler H. pygmaea Fiji Verbruggen et al. 2009b -/FJ624497/- H. renschii Hauck Tanzania Verbruggen et al. 2009b FJ624717/-/- Halimeda renschii Tanzania Verbruggen et al. 2009b -/FJ624501/FJ624485 H. scabra M. Howe Bahamas Verbruggen et al. 2009b FJ624540/-/- 59

Table S2. Taxa used in this study for phylogenetic analysis. Samples Collection data Reference GenBank accession numbers (tufA/rbcL/18S) H. scabra Bahamas Verbruggen et al. 2009b -/FJ624523/FJ624490 H. simulans M. Howe Jamaica Verbruggen et al. 2006 AM049963/-/- H. simulans Panama Kooistra, unpublished -/-/AF525543 H. taenicola W. R. Taylor French Polynesia Verbruggen et al. 2005b AY826365 H. taenicola New Caledonia Dijoux et al. 2012 JN644717/JN644752/- H. taenicola Maldives Dijoux et al. 2012 JN644723/-/- H. taenicola French Polynesia Verbruggen et al. 2005b, AY826365/FJ624529/- 2009b H. taenicola French Polynesia Verbruggen et al. 2009b -/-/AF407255 H. tuna (J. Ellis & Sol.) J. V. French Polynesia Verbruggen et al. 2005b AY826368/-/- Lamour. H. tuna Panama Kooistra, unpublished -/-/AF525589 H. tuna Italy Verbruggen et al. 2005b AY826366/-/- H. tuna Mexico Verbruggen et al. 2005b AY826367/-/- H. tuna Malta Kooistra, unpublished -/-/AF525588 H. tuna French Polynesia Verbruggen et al. 2005b AY826368/-/- H. tuna France Handeler et al. 2010 GU592574/-/- H. velasquezii W. R. Taylor Tanzania Verbruggen et al. 2009b FJ624718/-/- H. velasquezii Philippines Verbruggen et al. 2009b FJ624699/-/- H. velasquezii Philippines Verbruggen et al. 2009b FJ624697/-/- H. velasquezii USA Verbruggen et al. 2009b FJ624694/-/- H. velasquezii Philippines Verbruggen et al. 2009b -/FJ624507/- H. velasquezii Papua New Guinea Kooistra et al. 2002 -/-/AF407262 H. xishaensis Tseng & Dong Maldives Dijoux et al. 2012 JN644728/-/- H. xishaensis Maldives Dijoux et al. 2012 -/-/AF525593 Halimeda sp. Mariana Islands Verbruggen et al. 2009b FJ624704/-/- Halimeda sp. Mariana Islands Verbruggen et al. 2009b FJ624705/-/- H. cf. stuposa W. R. Taylor New Caledonia Dijoux et al. 2012 JN644714/-/- H. cf. cuneata Philippines Verbruggen et al. 2009b -/FJ624528/FJ624488 H. cf. cuneata Australia Verbruggen et al. 2009b FJ624538/-/-

Figure G – Erros bars on the node ages of Bayesian chronogram for the genus Halimeda resulting from the BEAST analysis.

REFERENCES

BANDEIRA-PEDROSA M.E., BOUZON Z.L., PEREIRA S.M.B., & OLIVEIRA E.C. 2003. Ultrastructure of some species of Halimeda (Bryopsidales, Chlorophyta) from Brazil. Cryptogamie, Algologie 24: 1–13. BANDEIRA-PEDROSA M.E., PEREIRA S.M.B., BOUZON Z.L. & OLIVEIRA, E.C. 2004a. Halimeda cuneata (Bryopsidales, Chlorophyta), a new record for the Atlantic Ocean. Phycologia 43: 50–57. BANDEIRA-PEDROSA M.E., PEREIRA S.M.B. & OLIVEIRA E.C. 2004b. Taxonomy and distribution of the green algal genus Halimeda (Bryopsidales, Chlorophyta) in Brazil. Brazilian Journal of Botany 27: 363–377. BELTON G.S., PRUD’HOMME VAN REINE W.F., HUISMAN J.M., DRAISMA S.G.A. & GURGEL C.F.D. 2014. Resolving phenotypic plasticity and species designation in the morphologically challenging Caulerpa racemosa–peltata complex (Chlorophyta, Caulerpaceae). Journal of Phycology 50: 32–54. BOUZON Z.L., BANDEIRA-PEDROSA M.E. & SCHMIDT E.C. 2010. Ultrastructure of the siphonaceous green alga Halimeda cuneata, with emphasis on the cytoskeleton. Micron 41: 598–603. CLIFTON K.E. 1997. Mass spawning by green algae on coral reefs. Science 275: 1116–1118. CREMEN M.C.M., HUISMAN J. M., MARCELINO V.R. & VERBRUGGEN H. 2016. Taxonomic revision of Halimeda (Bryopsidales, Chlorophyta) in south-western Australia. Australian Systematic Botany 29: 41–54. CURTIS N.E., DAWES C.J. & PIERCE S.K. 2008. Phylogenetic analysis of the large subunit rubisco gene supports the exclusion of Avrainvillea and Cladocephalus from the Udoteaceae (Bryopsidales, Chlorophyta). Journal of Phycology 44: 761–767. DARRIBA D., TABOADA G.L., DOALLO R. & POSADA D. 2012. jModeltest2: more models, new heuristics and parallel computing. Nature Methods 9: 772. DIJOUX L., VERBRUGGEN H., MATTIO L., DUONG N. & PAYRI, C. 2012. Diversity of Halimeda (Bryopsidales, Chlorophyta) in New Caledonia: a combined morphological and molecular study. Journal of Phycology 48: 1465–1481. DRUMMOND A.J., SUCHARD M.A., XIE D., & RAMBAUT A. 2012. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29: 1969–1973. FAMÀ P., WYSOR B., KOOISTRA W.H.C.F. & ZUCCARELLO G.C. 2002. Molecular phylogeny of the genus Caulerpa (Caulerpales, Chlorophyta) inferred from chloroplast tufA gene. Journal of Phycology 38: 1040–1050. GUIRY M.D. & GUIRY G.M. 2016. AlgaeBase. World-wide electronic publication, National University of Ireland, Galway. http://www.algaebase.org; searched on 20 January 2016. HALL T.A. 1999. BioEdit: a user-friendly biological alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. HANYUDA T., ARAI S. & UEDA K. 2000. Variability in the rbcL introns of Caulerpalean algae (Chlorophyta, Ulvophyceae). Journal of Plant Research 113: 403– 413. 62

HILLIS-COLINVAUX L. 1980. Ecology and taxonomy of Halimeda: primary producer of coral reefs. Advances in Marine Biology 17: 1–327. HORTA P.A., AMANCIO E., COIMBRA C.S. & OLIVEIRA E. C. 2001. Considerações sobre a distribuição e origem da flora de macroalgas marinhas brasileiras. Hoehnea 28: 243–265. HUELSENBECK J.P. & RONQUIST F. 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755. KOOISTRA W.H.C.F. & VERBRUGGEN H. 2005. Genetic patterns in the calcified tropical seaweeds Halimeda opuntia, H. distorta, H. hederacea and H. minima (Bryopsidales, Chlorophyta) provide insights in species boundaries and interoceanic dispersal. Molecular Phylogenetics and Evolution 41: 177–187. KOOISTRA W.H.C.F., CALDERI´ON M. & HILLIS L.W. 1999. Development of the extant diversity in Halimeda is linked to vicariant events. Hydrobiologia 398: 39–45. KOOISTRA W.H.C.F., COPPEJANS E.G.G. & PAYRI C. 2002. Molecular systematics, historical ecology, and phylogeography of Halimeda (Bryopsidales). Molecular Phylogenetics and Evolution 24: 121–138. LAM D.W. & ZECHMAN F.W. 2006. Phylogenetic analyses of the Bryopsidales (Ulvophyceae, Chlorophyta) based on rubisco large subunit gene sequences. Journal of Phycology 42: 669–678. LENTNER A. & ELLIS R. 2014. Variation in size and abundance of Caribbean spiny lobster (Panulirus argus) with change in hard bottom habitat. The Owl 4: 5. OLIVEIRA F.E.C. 1977. Algas marinhas bentônicas do Brasil. PhD dissertation. University of São Paulo, São Paulo. 407 pp. OLIVEIRA-CARVALHO M.D.F., OLIVEIRA M.C., PEREIRA S.M.B. & VERBRUGGEN H. 2012. Phylogenetic Analysis of Codium Species from Brazil, with the description of the new species C. pernambucensis (Bryopsidales, Chlorophyta). European Journal of Phycology 47: 355–365. PAUL V.J. & FENICAL W. 1984. Novel bioactive diterpenoid metabolites from tropical marine algae of the genus Halimeda (Chlorophyta). Tetrahedron 40: 3053–3062. PONGPARADON S., ZUCCARELLO G.C., PHANG S-M., KAWAI H. & HANYUDA. T. 2015. Diversity of Halimeda (Chlorophyta) from the Thai–Malay Peninsula. Phycologia 54: 349–366. RIES J.B. 2009. Effects of secular variation in seawater Mg/Ca ratio (calcite-aragonite seas)

on CaCO3 sediment production by the calcareous algae Halimeda, Penicillus and Udotea – evidence from recent experiments and the geological record. Terra Nova 21: 323– 339. SANTOS G.N. & NUNES J.M.C. 2015. O gênero Halimeda (Bryopsidales, Chlorophyta) no litoral do estado da Bahia, Brasil. Sitientibus série Ciências Biológicas 15: 1–15 SANTOS G.N., NASCIMENTO O.S., PEDREIRA F.A., RIOS G.I., VASCONCELOS J.N.C. & NUNES J.M.C. 2013. Análise quali-quantitativa das algas arribadas do norte do estado da Bahia, Brasil. Acta Botanica Malacitana 38: 13–24. SAUNDERS G.W. & KUCERA H. 2010. An evaluation of rbcL, tufA, UPA, LSU and ITS as DNA barcode markers for the marine green macroalgae. Cryptogamie, Algologie 31: 487– 528. SAUVAGE T., SCHMIDT W.E., SUDA S. & FREDERICQ S. 2016. A metabarcoding framework for facilitated survey of endolithic phototrophs with tufA. BMC Ecology 16: 1. 63

SILVA P., BASSON P.W. & MOE R.L. 1996. Catalogue of the benthic marine algae of the Indian Ocean. University of California Publications in Botany 79: 1–1259. STAMATAKIS A. 2014. RAxML version 8: a tool for phylogenetic analysis and post- analysis of large phylogenies. Bioinformatics 30: 1312–1313. STAMATAKIS A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–2690. SWOFFORD, D.L. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods), ver. 4. Sinauer Associates, Sunderland, Massachusetts. TAMURA K. & NEI M. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10: 512–526. TORRANO-SILVA B.N. & OLIVEIRA E.C. 2013. Macrophytobenthic flora of the Abrolhos Archipelago and the Sebastião Gomes Reef, Brazil. Continental Shelf Research 70: 150– 158. VERBRUGGEN H. & KOOISTRA W.H.C.F. 2004. Morphological characterization of lineages within the calcified tropical seaweed genus Halimeda (Bryopsidales, Chlorophyta). European Journal of Phycology 39: 213–228. VERBRUGGEN H., DE CLERCK O., SCHILS T., KOOISTRA W.H.C.F. & COPPEJANS E. 2005a. Evolution and phylogeography of Halimeda section Halimeda (Bryopsidales, Chlorophyta). Molecular Phylogenetics and Evolution 37: 789–803. VERBRUGGEN H., DE CLERCK O., KOOISTRA W.H.C.F. & COPPEJANS E. 2005b. Molecular and morphometric data pinpoint species boundaries in Halimeda section Rhipsalis (Bryopsidales, Chlorophyta). Journal of Phycology 41: 606–621. VERBRUGGEN H., DE CLERCK O., N’YEURT A.D.R., SPALDING H. & VROOM P.S. 2006. Phylogeny and taxonomy of Halimeda incrassata, including descriptions of H. kanaloana and H. heteromorpha spp. nov. (Bryopsidales, Chlorophyta). European Journal of Phycology 41: 337–362. VERBRUGGEN H., TYBERGHEIN L., PAULY K., VLAEMINCK C., VAN NIEUWENHUYZE K., KOOISTRA W.H.C.F., LELIAERT F. & DE CLERCK O. 2009a. Macroecology meets macroevolution: evolutionary niche dynamics in the seaweed Halimeda. Global Ecology and Biogeography 18: 393–405. VERBRUGGEN H., ASHWORTH M., LODUCA S.T., VLAEMINCK C., COCQUYT E., SAUVAGE T., ZECHMANE F.W., LITTLER D.S., LITTLER M.M., LELIAERT F. & DE CLERCK O. 2009b. A multi-locus time calibrated phylogeny of the siphonous green algae. Molecular Phylogenetics and Evolution 50: 642–653. VERBRUGGEN H., BROOKES M.J. & COSTA J.F. 2016. DNA barcodes and morphometric data indicate that Codium fragile (Bryopsidales, Chlorophyta) may consist of two species. Phycologia 56: 54–62.

Received 14 June 2016; accepted 7 October 2016 Associate Editor: Fabio Rindi

Artigo 2 - Updates on Section Pseudo-opuntia of Halimeda: H. soniae sp. nov. (Bryopsidales, Chlorophyta) is revealed by phylogenetic analyses for the Brazilian coast

Caroline Feijão Ximenes1,*, Maria de Fátima de Oliveira-Carvalho2, Maria Elizabeth

Bandeira-Pedrosa1, Valéria Cassano3

Running title: Updates on Section Pseudo-opuntia of Halimeda: H. soniae

1 Programa de Pós-Graduação em Botânica, Universidade Federal Rural de Pernambuco, Rua

Dom Manoel de Medeiros, s/n, Dois Irmãos, 52171-900, Recife, Pernambuco, Brazil.

2 Universidade Federal de Pernambuco, Rua Alto do Reservatório, s/n, 55608-680, Vitória de

Santo Antão, Pernambuco, Brazil.

3 Departamento de Botânica, Instituto de Biociências, Universidade de São Paulo, Rua do

Matão, 277, 05508-090, São Paulo, Brazil.

* Corresponding author. Email: [email protected]. Fax: +558133206360

Abstract Halimeda is a genus of green seaweed that presents high morphological plasticity. Studies using molecular markers for species delimitation and phylogenetics have revealed cryptic diversity and have also described new species around the world. In Brazil, seven species of

Halimeda are currently recognized. One of them, Halimeda aff. gracilis, was previously revealed to be a cryptic species by plastid markers. The present study describes the new species Halimeda soniae Ximenes, Oliveira-Carvalho, M. E. Bandeira-Pedrosa et Cassano sp. nov. to accommodate the species previously identified as Halimeda aff. gracilis for Brazil.

Samples of H. soniae were collected in Espírito Santo state (southeastern Brazil, and plastid gene sequences of tufA and rbcL were obtained. The phylogenetic analyses showed that H. soniae belongs to Section Pseudo-opuntia together with H. gracilis and H. lacrimosa. The three species have overlapping morpho-anatomical features, and phylogenetic analyses suggest that Halimeda gracilis is restricted to the Indian Ocean, whereas the other two species appear restricted to the Atlantic. Additional research on the Caribbean specimens is necessary to resolve the taxonomic position of the taxa named as H. lacrimosa and H. gracilis in this region.

Key-words: Chlorophyta, molecular phylogeny, rbcL, taxonomy, tufA 67

Introduction Halimeda J. V. Lamouroux (Bryopsidales, Chlorophyta) is a coenocytic green macroalgal genus that has been studied since the 20th century under morphological (Hillis

1959, Hillis-Colinvaux 1980, Bandeira-Pedrosa et al. 2004) and ultrastructural approaches

(Borowitzka and Larkum 1974, 1977, Bandeira-Pedrosa et al. 2003), and more recently by

DNA analyses (Hillis et al. 1998, Kooistra et al. 1999, 2002, Verbruggen and Kooistra 2004,

Kooistra and Verbruggen 2005, Verbruggen et al. 2005a,b, 2009, Dijoux et al. 2012, Kojima et al. 2015, Pongparadon et al. 2015, Ximenes et al. 2017).

The 47 taxa of Halimeda currently accepted taxonomically (Guiry and Guiry 2019) are characterized by calcified thalli due to the presence of aragonite on their surface, contributing to the accumulation of limestone at the bottom of tropical and subtropical reefs of the world

(Hillis-Colinvaux 1980, Testa and Bosence 2008, Ries 2009). Due to the complex architecture of the thallus, plants of Halimeda provide protection and refuge to small invertebrates and reef fishes, being important members on the marine ecosystems (Lentner and Ellis 2014). In addition, the plants have diterpenes such as halimedatrial, with antimicrobial activity (Paul and Fenical 1984).

The Section Pseudo-opuntia was proposed by J. Agardh (1887). Later, the section was validated by De Toni (1889). Hillis-Colinvaux (1980) did not recognize the Section Pseudo- opuntia and transferred H. gracilis Harvey ex J. Agardh and H. lacrimosa M. Howe to the

Section Halimeda by the nodal fusion pattern (complete nodal siphon fusion). The Section

Pseudo-opuntia was reinstated by Verbruggen and Kooistra (2004) including H. gracilis and

H. lacrimosa, based on partial sequences SSU rDNA, ITS1-2 and 5.8S rDNA, the clavate shape of secondary utricles serving as a synapomorphy.

Molecular markers have been useful for algal species delimitation around the world

(Saunders 2005, Saunders and Kucera 2010, Oliveira-Carvalho et al. 2012), and there are many studies showing the cryptic diversity in some Halimeda species (Kooistra et al. 1999, 68

2002, Verbruggen et al. 2005b, 2006, Dijoux et al. 2012, Ximenes et al. 2017). Verbruggen et al. (2005b) suggested some species have passed by reticulate speciation due to biogeographic changes in the oceans, such as currents and continental drift, for example, the closure of the

Tethys Sea in the Miocene and the establishment of the Isthmus of Panama in the Pliocene.

Thus, many phycologists have observed different species for the Atlantic vs the Indo-Pacific basins, leading them to describe new species to accommodate these cryptic entities occurring in both basins (Hillis-Colinvaux 1980, Kooistra et al. 1999, 2002, Dijoux et al. 2012, Reuter et al. 2012).

Halimeda gracilis was reported for the first time for the coast of South America in northern Rio de Janeiro state by Joly et al. (1968), dredged at 75 m deep. Later, Bandeira-

Pedrosa et al. (2004), revising the genus Halimeda from Brazil based on morpho-anatomical features, recognized that some collections of H. gracilis were mis-identified as H. tuna (J.

Ellis et Solander) J.V. Lamouroux and H. opuntia (Linnaeus) J.V. Lamouroux. Recently, phylogenetic analyses revealed H. aff. gracilis to be a cryptic species in Brazil (Ximenes

2015, Ximenes et al. 2017). Halimeda gracilis was treated as a pantropical species by Hillis

(1959) and Hillis-Colinvaux (1980). However, its description in both studies was based on morpho-anatomical analysis for specimens from the Atlantic, Indian and Pacific Oceans, including the isotype from Sri-Lanka. Kooistra et al. (2002), on the basis of phylogenetic analyses, affirmed that Halimeda gracilis has cognate pairs representing the Atlantic and

Indo-Pacific basins (i.e. phenotypically similar but also genetically related entities). Then,

Kooistra et al. (2002) considered this morphological convergence as the result of similar selective pressures and a shared common ancestry. Verbruggen et al. (2009) obtained similar results, analyzing six loci concatenated, and the sequences of H. gracilis formed three distinct clades with full support.

Therefore, the aim of this study is to describe a new species, namely, Halimeda soniae, for the Brazilian coast to accommodate the taxon previously treated as H. gracilis and H. aff. 69 gracilis, and to discuss phylogenetic and morphological aspects with other species of the

Pseudo-opuntia Section.

Material and methods

Samples of Halimeda soniae were collected in Espírito Santo state (southeastern Brazil,

9º40’21’’S, 35º42’43’’W) in 2014, which were obtained on subtidal zone (24m) by SCUBA, and were preserved in absolute ethanol and silica gel for both DNA extraction and morphological study.

The internal and external morphology were analyzed according to Hillis (1959), Hillis-

Colinvaux (1980) and Bandeira-Pedrosa et al. (2004), using a stereoscopic microscope Leica

S6D (Wetzlar, Germany) and optical microscope Zeiss Axioskop (Oberkochen, Germany).

Vouchers specimens were deposited in the Herbarium PEUFR (Universidade Federal Rural de

Pernambuco) and duplicates in the Herbarium SPF (Universidade de São Paulo). Additional specimens from Herbarium PEUFR were also examined.

The method applied to DNA extraction followed Oliveira-Carvalho et al. (2012). For

PCR amplification and sequencing for tufA gene followed Famá et al. (2002) and for rbcL gene, Curtis et al. (2008). Consensus sequences and multiple sequence alignments were built using BioEdit 7.0.4.1 (Hall 1999). We used 22 tufA sequences and six rbcL sequences of

Halimeda Section Pseudo-opuntia from Genbank for one locus analyses for both markers. We used H. opuntia (Linnaeus) J.V. Lamouroux as outgroup for tufA and rbcL analyses.

The model of sequence evolution for maximum likelihood (ML) and Bayesian inference

(BI) was selected using jModelTest 2.1.10 (Darriba et al. 2012) under Akaike Information

Criterion corrected (AIC). The model selected was the general-time-reversible model of nucleotide substitution with invariant sites and gamma distributed rates for the variable sites

(GTR+I+G) for tufA and GTR+I for rbcL. Neighbor-Joining (NJ) was implemented using

Tamura and Nei (1993) with bootstrapping (2,000 replicates) on the Geneious version 10.1.3 70

(Kearse et al. 2012). ML analysis was performed using RAxML v.8.2.9 (Stamatakis 2014) on the Geneious with 1,000 bootstrap replicates. BI analysis was performed in MrBayes v.3.0.4

(Huelsenbeck and Ronquist 2001) using four chains of the Markov chain Monte Carlo runs, sampling one tree every 1,000 generations for 5,000,000 generations, starting with a random tree, and stopped when the average deviation of split frequencies was less than 0.01. We discarded the first 50,000 generations in both runs as the burn-in to build the consensus tree.

The range of tufA and rbcL divergence values within and between species was calculated using uncorrected p-distances in MEGA 6 (Tamura et al. 2012).

Results

Molecular analysis

Two tufA sequences and one rbcL sequence of Halimeda soniae were obtained (Table

S4). The final alignment for tufA consisted of 25 sequences (including outgroup) with 780 bp, whereas for rbcL, the alignment consisted of eight sequences with 1280 bp (including outgroup).

In the tufA analyses, Pseudo-opuntia was composed of 24 sequences represented by H. lacrimosa, H. soniae (as H. aff. gracilis), and at least six lineages named as H. gracilis (Fig.

H). The genetic divergences observed within the Section Pseudo-opuntia are shown in Table

5. The Brazilian samples of H. soniae formed a separated clade from all other sequences of H. gracilis. The authentic clade that includes the topotype of H. gracilis ranged 0-1.4%.

Halimeda soniae diverged from the sequence from the type locality (Sri-Lanka, FJ624724) by

3.8%, and from other lineages named as ‘H. gracilis’ by 2.0-6.2%, indicating that the

Brazilian samples are representatives of a distinct species. Halimeda soniae diverged from H. lacrimosa (Bahamas, type locality) by 3.3-3.4%, however the latter diverged from ‘H. gracilis’ (Jamaica) by 1.0-1.1%, suggesting that they may be the same species (Table 5). 71

Figure H - Consensus tree derived from Bayesian inference of tufA sequences. NJ (neighbor-joining), ML (maximum likelihood) bootstrap values and PP (Bayesian posterior probabilities) are given at the nodes. New sequences generated in this study and those from topotypes are in bold; * indicates full support; – indicates lack of support or values under 70.

In the rbcL analyses, Halimeda soniae (as H. aff. gracilis) was resolved as an independent clade, separate from other sequences of Section Pseudo-opuntia represented by

H. gracilis and H. lacrimosa from the Atlantic and Indo-Pacific Oceans (Fig. I); however with full support only for NJ. There is no sequence of H. gracilis from the type locality (Sri Lanka) available in the databases for comparison. The rbcL divergences are shown in Table 6.

Halimeda soniae diverged from H. gracilis by 4.5-5.0%, and from H. lacrimosa by 4.5%.

Unlike tufA, sequences rbcL of H. gracilis from the Indo-Pacific Ocean (Philippines, New

Caledonia and French Polynesia) formed a single well-supported lineage with low divergence 72

(0.8-1.2%), showing that rbcL is a most conservative gene. On the other hand, as in our results of tufA, H. gracilis from Jamaica was closest to H. lacrimosa from the Bahamas, diverging by 1% (Table 6).

Table 5. Levels of intraspecific genetic variation (in percentage, diagonal in bold and gray), interspecific variation (in percentage, under the diagonal), and number of divergent base pairs (over the diagonal) for tufA sequences, based on uncorrected p-distance between Halimeda clades. - Absent values.

Sequences 1 2 3 4 5 6 7 8 1 - H. gracilis 0-1.4, 11 15-17 43-48 23-30 27-30 26-31 28-35 26-32 Authentic clade

2 - ‘H. gracilis’ 1.9-2.1 0 44-46 27 30 24 31-32 29 French Polynesia

3 - ‘H. gracilis’ 5.5-6.1 5.6-5.8 0-0.2, 2 43-45 47-49 51-52 50-51 47-48 Indian Ocean

4 - ‘H. gracilis’ 2.9-3.8 3.4 5.5-5.7 - 16 27 29-30 29 USA, Florida

5 - H. soniae 3.4-3.8 3.8 6.0-6.2 2.0 0 47-49 26-27 28 Brazil

6 - ‘H. gracilis’ 3.3-3.9 3.0 6.5-6.6 3.4 6.0-6.2 0 8-9 12 Jamaica

7 - H. lacrimosa 3.5-4.4 3.9-4.1 6.4-6.5 3.7-3.8 3.3-3.4 1.0-1.1 0.1, 1 10-11 Bahamas

8 - ‘H. gracilis’ 3.3-4.1 3.7 6.0-6.1 3.7 3.5 1.5 1.2-1.4 - Jamaica

Figure I - Consensus tree derived from Bayesian inference of rbcL sequences. NJ, ML bootstrap values and PP are given at the nodes. * indicates full support; – indicates lack of support or values under 70.

Table 6. Percentage of genetic divergence (under the diagonal) and number of divergent base pairs (over the diagonal) for rbcL sequences, based on uncorrected p-distances between Halimeda species.

Sequences 1 2 3 4 5 6 7 1. H. gracilis Philippines - 7 6 19 27 29 30 2. H. gracilis New Caledonia 1.2 - 5 21 23 25 30 3. H. gracilis French Polynesia 1.0 0.8 - 19 25 27 28 4. H. gracilis Florida 3.2 3.5 3.2 - 27 25 28 5. H. gracilis Jamaica 4.5 3.9 4.2 4.5 - 6 27 6. H. lacrimosa Bahamas 4.9 4.2 4.5 4.2 1.0 - 27 7. H. soniae Brazil 5.0 5.0 4.7 4.7 4.5 4.5 -

Morphological analysis

Based on the phylogenetic results obtained, a new species is to be described to accommodate the taxon previously going under the name Halimeda aff. gracilis from Brazil:

Halimeda soniae Ximenes, Oliveira-Carvalho, Bandeira-Pedrosa et Cassano sp. nov. (Figs J:

3-7)

Description

Thallus prostrate, strongly calcified, attached on rocks by multiple holdfasts. Mature plants up to 24 cm long, di-trichotomously branched. Segments predominantly subcuneate to reniform, ocasionally subcylindrical, measuring 5.5-9 mm long, 7-13 mm broad, with a smooth and shiny surface. Complete nodal fusion. Medullary siphons fusion in pairs, sometimes in three groups. Cortical zone composed of 2-3 layers of utricles. Primary utricles rounded, 47.5-67.5

µm diameter and 40-75 µm length on frontal view, similar to Halimeda gracilis. Secondary utricles measuring 30-150 µm long giving arise up to eight primary utricles. Intertidal specimens have smaller segments similar to H. opuntia, and subtidal specimens have larger segments, cuneate or reniform similar to H. tuna. Fertile specimens not observed.

Type locality

Brazil, Espírito Santo, Guarapari, Escalvada; 9º40’21’’S, 35º42’43’’W, subtidal zone at 20-24 m depth, 28 March 2014, collector F. Scherner.

Holotype PEUFR 52084. Genbank accession numbers for tufA (KT781877) and rbcL

(KT781865).

Isotype SPF58088 A, B. Genbank accession numbers for tufA (KT781878).

Etymology: The name honors Dr. Sonia Maria Barreto Pereira for her contribution to the study of marine macroalgae in Brazil.

Habitat: Epilithic specimens collected in the subtidal zone up to 24 m depth.

Other specimens examined and here being identified as H. soniae, thus Paratypes:

Brazil, Ceará, 01º43’S, 37º07’W, 54 m, 6 Jun. 1998, Antares - NE - III (PEUFR 35112), loc. id., 03º50’S, 37º37’W, 166 m, 12 Oct. 1995, Antares - NE - I (PEUFR 35103); Rio Grande do

Norte, 04º51’S, 36º22’W, 30m, 27 Mar. 1980, G.C. Teixeira (PEUFR 4500), loc. id., 05º17’S,

35º08’W, 34 m, 25 Nov. 1979, F.R. Lima (PEUFR 4975); Paraíba, 07º34’00”S, 34º42’00”W,

20 m, 21 Jan. 1981, A. Fernandes (PEUFR 6513); Pernambuco, 08º33’30”S, 35º00’58”W,

Serrambi, 12 Jul. 1987, M.C. Accioly (PEUFR 2784), loc. id., 07º28’S, 34º32’W, 36 m, 31

Jan. 1997, Antares - NE – II (PEUFR 35108); Bahia, 13º38’S, 38º45’W, 50 m, 19 Oct. 1997,

Astro Garoupa-Central II (PEUFR 36471), loc. id., 15º34’S, 38º51’W, 50 m, 25 Oct. 1997

(PEUFR 36498), loc. id., 17º04’S, 36º53’W, 250 m, 14 Nov. 1997, Astro Garoupa-Central II

(PEUFR36478); Espírito Santo: 19º28’S, 38º22’W, 94 m, 27 Feb.1996, Astro Garoupa-

Central II (PEUFR 36474); Rio de Janeiro: 20º38’S, 40º01’W, 57 m, 27 Feb.1996, Astro

Garoupa-Central I (PEUFR 36472).

Misapplied Names for Brazil: Halimeda gracilis sensu Joly et al. (1968, pp.162-164, Figs 2-

4), Bandeira-Pedrosa et al. (2004, pp. 366, 369, 372-375, Figs 8, 19, 38-40), Guimarães et al.

(2008, pp. 35-36, 40-42), Pereira et al. (2008, pp. 952), Oliveira et al. (2009, pp. 211), 75

Cocentino et al. (2010, pp. 988, 990, 993), Pupo and Coto (2011, pp. 139), Santos and Nunes

(2015, pp. 3-4, 6, 8-9, Fig. 5a-h), Ximenes (2015, pp. 14-41, Fig. 2), as H. aff. gracilis

(Ximenes et al. 2017, Fig. 6).

Figure J - Halimeda soniae Ximenes, Oliveira-Carvalho, M.E. Bandeira-Pedrosa et Cassano sp. nov. (3) Holotype specimen (PEUFR 52084). Scale bar = 1 cm. (4) Isotype specimen (SPF58088 A). Scale bar = 1 cm. (5) Primary utricles on surface view. Scale bar = 50 µm. (6) Nodal fusion complete by two filaments. Scale bar = 100 µm. (7) Primary and secondary utricles on frontal view, secondary utricles with clavate shape. Scale bar = 25 µm.

Table 7. Comparison of diagnostic morphoanatomical features of Halimeda species belonging to Pseudo-opuntia Section with the authors and locality on the study was done. Taxa / Halimeda Halimeda gracilis Halimeda features lacrimosa soniae sp. nov. References Hillis- Agardh Barton (1901) Taylor (1972) Hillis- Leliaert et al. Coppejans et Dijoux et Bhagyaraj and Bandeira- Ximenes et al. Colinvaux (1887) Colinvaux (2001) al. (2009) al. (2012) Kunchithapatham Pedrosa et al. (2017, as H. (1980) Type (1980) (2016) (2004, as H. aff. gracilis) / Description gracilis) This study Locality North-western Indian Atlantic: Virgin Caribbean Indian Ocean Indian Ocean: Indian Ocean: Indian Indian Ocean: Brazil Brazil Atlantic Ocean: Sri Islands, (Western and South África Sri Lanka Ocean: India Lanka (as Fernando de eastern); (KwaZulu- New Ceylon) Noronha western Pacific Natal) Caledonia Islands. Indian: (north and and Indonesia, Sri south); western Maldives Lanka. Pacific: Atlantic (north Hawaii and south) Habit Fragile, Not cited Not cited Not cited Flaccid, Flaccid and Densely Sprawling Prostate Prostate Prostrate straggling and straggling and decumbent intricate decumbent decumbent forming thick cushions Thallus length To 5 cm Not cited More than 40 To 40 cm To 1 m To 25cm 20-25 cm Not cited Not cited To 24 cm to 17 cm cm Holdfast Not cited Not cited Not cited Not cited Multiple Not cited Multiple Multiple Multiple Multiple Multiple Calcification Strong Not cited Strong Strong Moderate to Strong Strong Not cited Moderate to Moderate to Not observed level strong strong strong Branching Di to Not cited Short and Not cited Sparse, usually Di to Supporting 4 to Sparse Not cited Di to Di to trichotomous numerous or frequent trichotomous 5 branches trichotomous trichotomous long and few; supporting up just one plane to five branches Shape of Cylindrical, Obovate, Cuneate to Subcylindrical, Ribbed, chalky Flattened and Cuneate, Flat, Subcylindrical, Subcuneate to Reniform, segments often cylindrical, subcylindrical cuneate to to brittle, at ribbed, brittle, flabellate, trilobed, cuneate to reniform, with cuneate and moniloid; oblong, subreniform times cuneate or diamond- broad reniform, with a a smooth and subcylindrical others and cuneate subcylindrical trilobed, the shaped to ovoid smooth and shiny shiny surface, and shiny particularly but more upper margin somewhat to narrow surface margin surface the more commonly entire, rounded or cuneate undulate apical ones subcuneate to undulated or subcylindrical commonly reniform, the trilobed spherical or upper margin tear-shaped entire, undulate or lobed Measurement Up to 5 x 5 12-6 0.5-9 x 1.5-11 0.5-9 x 1.5-11 9 x 15 Up to 8 x 10 2-5 x 2-3 2–6 x 1–6 11 x 18 11 x 18 5.5-9 x 7-13 of segments (length x width, mm) Nodal fusion Complete or Not cited Complete by 2 Complete by 2 Complete by 2 Not cited Not cited Complete Not cited Complete by Complete by 2 short by 2, 3 medullary or often by 3 or often by 3 fusion 2 or or 3 siphons 77

Discussion The Section Pseudo-opuntia encompasses currently Halimeda gracilis, H. lacrimosa and H. soniae. A comparison of these three species shows that they share most of the morphological features (Table 7). Halimeda lacrimosa has tridimensional (“tear”-shape) segments, whereas H. gracilis and H. soniae have bidimensional (flattened) segments.

However, this feature cannot be evaluated by itself because it is subject to environmental changes depending on the habitat (e.g. depth), and, therefore, has no effective diagnostic value in the separation of these species (Hillis-Colinvaux 1980, Vroom et al. 2003, Bandeira-

Pedrosa et al. 2004).

Our results indicate Halimeda soniae, previously identified as H. gracilis or H. aff. gracilis on the Brazilian coast (Joly et al. 1968, Bandeira-Pedrosa et al. 2004, Santos and

Nunes 2015, Ximenes 2015, Ximenes et al. 2017), is an undescribed species based on molecular markers. Halimeda soniae is morphologically similar to H. gracilis described by

Barton (1901), Hillis (1959), Hillis-Colinvaux (1980) and Littler and Littler (2000), but they have differences on shape of segments and on thallus appearance; while H. gracilis has segments predominantly subcylindrical (Agardh, 1887, Barton, 1901), H. soniae has the mostly segments subcuneate to reniform, occasionally subcylindrical and the thallus is always glossy. Dijoux et al. (2012) reported the presence of trilobed segments in H. gracilis from

Maldivas and New Caledonia, which have been not observed on H. soniae.

The analyses for both markers showed that sequences of H. soniae did not group with any H. gracilis sequences and diverged from the topotype by 3.8% for tufA. The genetic divergence between H. soniae and all other sequences of ‘H. gracilis’ for tufA (2.0-6.2%), and for rbcL (4.5-5.0%) is within the ranged found by Ximenes (2015) and Ximenes et al.

(2017) for other Halimeda species, which found 0.9% between sisters species (H. incrassata and H. simulans). Besides, Saunders and Kucera (2010) found similar values of minimum 79 divergence interspecific (1.44 %) on Codium Stackhouse (Bryopsidales) and 0.91 on Ulva

Linnaeus (Chlorophyta). Thus, we considered H. soniae as different taxonomic entity.

Halimeda gracilis is native to the Indo-Pacific basins and was cited from the Atlantic based on morphological features (Barton, 1901, Hillis 1959, Hillis-Conlivaux 1980, Littler and Littler 2000, Bandeira-Pedrosa et al. 2004). At the present time, H. soniae is endemic to

Brazil and is distributed along the Brazilian coast from Ceará to São Paulo (Bandeira-Pedrosa et al. 2004, Pupo and Coto 2011). Despite its wide distribution no fertile specimens have been recorded, suggesting the reproduction of the species is solely by vegetative fragmentation.

The consensus tree of tufA showed Halimeda gracilis split into six distinct subclades, indicating that the sequenced specimens may correspond to six different species, with only the subclade containing sequences from Sri Lanka, the Maldives, Tanzania, Hawaii,

French Polynesia and New Caledonia, representing the genuine H. gracilis. Halimeda lacrimosa is sister to ‘H. gracilis’ from Jamaica representing the Caribbean Sea. The separation of H. gracilis from Indo-Pacific vs Atlantic and H. lacrimosa has already been clearly shown in other studies (Kooistra et al. 2002, Verbruggen and Kooistra 2004,

Verbruggen et al. 2007, Dijoux et al. 2012, Ximenes et al. 2017) through different markers, although the genetic divergence between H. lacrimosa from the type locality (Bahamas) and

‘H. gracilis’ from the Caribbean Sea (Jamaica) is low according to our results (1-1.1% for tufA and 1% for rbcL), indicating that the citation of H. gracilis from Jamaica should be reviewed. This is reinforced by the high genetic divergence between ‘H. gracilis’ from the

Caribbean Sea (Jamaica) and also from the Gulf of Mexico (Florida) and H. gracilis from the

Indo-Pacific, suggesting that more studies are necessary on Section Pseudo-opuntia focusing on these regions of the Atlantic for clarification of the taxonomic position of these entities.

Acknowledgements 80

We are very grateful to our colleague Fernando Scherner for help with field material, and

Michael Wynne to his valuable comments. This study was financed in part by the

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) - Finance

Code 001. CFX thanks the Conselho Nacional de Pesquisa e Tecnologia (CNPq) for the scholarships (132493/2013-6; 140798/2015-3), VC thanks CNPq for the Productivity

Fellowship (302549/2017-0).

Supplementary Material

Table S3 – Sequences used for phylogenetic analyses.

GenBank accession Taxa Collection site numbers rbcL tufA Halimeda aff. gracilis Harvey ex Brazil KT781865 KT781877 J.Agardh Halimeda aff. gracilis Brazil - KT781878 H. gracilis French Polynesia FJ624492 AM049965 H. gracilis Jamaica FJ624494 EF667063 H. gracilis Jamaica - FJ624719 H. gracilis Jamaica - FJ624720 H. gracilis Jamaica - FJ624721 H. gracilis French Polynesia - FJ624722 H. gracilis USA, Hawaii - FJ624723 H. gracilis Sri Lanka - FJ624724 H. gracilis Tanzania - FJ624725 H. gracilis South Africa - FJ624726 H. gracilis Philippines FJ624493 FJ624727 H. gracilis Australia - FJ624728 H. gracilis Tanzania - FJ624729 H. gracilis USA, Florida FJ624491 FJ624731 H. gracilis New Caledonia JN644741 JN644675 H. gracilis Maldives - JN644676 H. gracilis Maldives - JN644677 H. gracilis Maldives - JN644678 H. gracilis Maldives - JN644679 H. gracilis Maldives - JN644680 H. lacrimosa M.Howe Bahamas - EF667064 H. lacrimosa Bahamas FJ624495 FJ624730 H. opuntia French Polynesia - AM049967 H. opuntia Brazil KY570459 -

References Agardh, J.G. 1887. Till algernes systematik. Nya bidrag. (Femte afdelningen.). Acta Univ. Lund. 23: 1-174. Bandeira-Pedrosa, M.E., Z.L. Bouzon, S.M.B. Pereira and E.C. Oliveira. 2003. Ultrastructure of some species of Halimeda (Bryopsidales, Chlorophyta) from Brazil. Cryptogamie Algol. 24: 219-231. Bandeira-Pedrosa, M.E., S.M.B. Pereira and E.C. Oliveira. 2004. Taxonomy and distribution of the green algal genus Halimeda (Bryopsidales, Chlorophyta) in Brazil. Braz. J. Botany. 27: 363-377. Barton, E.S. 1901. The genus Halimeda. Siboga-Expeditie Monographe, Leiden 60:1-32. Bhagyaraj, I. and Kunchithapatham, V.R. 2016. Diversity and distribution of seaweeds in the shores and water lagoons of Chennai and Rameshwaram coastal areas, South-Eastern coast of India. Biodivers. J. 7: 923-934. Borowitzka, M.A. and A.W.D. Larkum. 1974. Chloroplast development in the caulerpalean alga Halimeda. Protoplasma 81: 131-144. Borowitzka, M.A. and A.W.D. Larkum. 1977. Calcification in the green alga Halimeda. I. An ultrastructure study of thallus development. J. Phycol. 13: 6-16. Cocentino, A.D.L.M., M.T. Fuji, T.N.D.V. Reis, N.C. Guimarães-Barros, M.D.F. Rocha and S. Neumann-Leitão. 2010. Diversity and distribution Patterns of the infralittoral green macroalgae from Potiguar basin, Rio Grande do Norte, Northeastern Brazil. Acta Bot. Bras. 24: 986-996. Coppejans, E., F. Leliaert, O. Dargent, R. Gunasekara and O. De Clerck. 2009. Sri Lankan seaweeds: Methodologies and field guide to the dominant species. Belgian Development Cooperation. pp. 265. Curtis, N.E., C.J. Dawes and S.K. Pierce. 2008. Phylogenetic analysis of the large subunit rubisco gene supports the exclusion of Avrainvillea and Cladocephalus from the Udoteaceae (Bryopsidales, Chlorophyta). J. Phycol. 44: 761-767. Darriba, D., G.L. Taboada, R. Doallo and D. Posada. 2012. jModelTest 2: More models, new heuristics and parallel computing. Nature Meth. 9: 772. De Toni, J.B. 1889. Sylloge Algarum. Vol. I. Sect. I. Chlorophyceae. Dijoux, L., H. Verbruggen, L. Mattio, N. Duong and C. Payri. 2012. Diversity of Halimeda (Bryopsidales, Chlorophyta) in New Caledonia: a combined morphological and molecular study. J. Phycol. 48: 1465-1481. 83

Famà, P., B. Wysor, W.H.C.F. Kooistra and G.C. Zuccarello. 2002. Molecular phylogeny of the genus Caulerpa (Caulerpales, Chlorophyta) inferred from chloroplast tufA gene. J. Phycol. 38: 1040-1050. Guimarães, N.C.L., T.N.V. Reis and A.D.L.M Cocentino. 2008. Chlorophyta bentônicas da zona econômica exclusiva do nordeste brasileiro (REVIZEE NE I). Insula 37: 35-52. Guiry, M.D. and G.M. Guiry. 2019. AlgaeBase. World-wide electronic publication. National University of Ireland, Galway: http://www. algaebase. org. Searched on 29 January 2019. Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41: 95-98 Hillis, L.W. 1959. A revision of the genus Halimeda (order Siphonales). Pub. Inst. Mar. Sci. 6: 321-403. Hillis, L.W., J.A. Engman and W.H.C.F. Kooistra. 1998. Morphological and molecular phylogenies of Halimeda (Chlorophyta, Bryopsidales) identify three evolutionary lineages. J. Phycol. 34: 669-681. http://dx.doi.org/10.1046/j.1529-8817.1998.340669.x Hillis-Colinvaux, L.W. 1980. Ecology and taxonomy of Halimeda: primary producer of coral reefs. Adv. Mar. Biol. 17: 1-327. Horta, P.A., E. Amancio, C.S. Coimbra and E.C. Oliveira. 2001. Considerações sobre a distribuição e origem da flora de macroalgas marinhas brasileiras. Hoehnea 28: 243-265. Huelsenbeck, J.P. and F. Ronquist. 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754-755. Joly, A.B., M.M. Ferreira, F. Pinheiro-Vieira and Y. Yoneshigue-Braga. 1968. Additions to the American South Atlantic marine algae. I. Arq. Estac. Biol. Mar. Univ. Ceará 8: 177-181. Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock, S. Buxton, A. Cooper, S. Markowitz, C. Duran, T. Thierer, B. Ashton, P. Meintjes and A. Drummond. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649. Kojima, R., T. Hanyuda and H. Kawai. 2015. Taxonomic reexamination of Japanese Halimeda species using genetic markers, and proposal of a new species Halimeda ryukyuensis (Bryopsidales, Chlorophyta). Phycol. Res. 63: 178-188. Kooistra, W.H. C.F., M. Calderón and L.W. Hillis. 1999. Development of the extant diversity in Halimeda is linked to vicariant events. Hydrobiologia 398: 39-45. Kooistra, W.H.C.F., E.G.G. Coppejans and C. Payri. 2002. Molecular systematics, historical ecology, and phylogeography of Halimeda (Bryopsidales). Molec. Phylogenet. Evol. 24:121-138. 84

Kooistra, W.H.C.F. and H. Verbruggen. 2005. Genetic patterns in the calcified tropical seaweeds Halimeda opuntia, H. distorta, H. hederacea and H. minima (Bryopsidales, Chlorophyta) provide insights in species boundaries and interoceanic dispersal. Molec. Phylogenet. Evol. 41: 177-187. Lentner, A. and R. Ellis. 2014. Variation in size and abundance of Caribbean spiny lobster (Panulirus argus) with change in hardbottom habitat. The Owl 4: 5. Leliaert, F., De Clerck, O., Bolton, J.J., and E. Coppejans. 2001. New records of the Chlorophyta from South Africa, with the emphasis on the marine benthic flora of Kwazulu- Natal. S. Afr. J. Bot. 67: 450-459. Littler, D.S. and M.M. Littler. 2000. Caribbean Reef Plants. OffShore Graphics, Washington DC. pp. 402-405. Oliveira, V.P., D.R.P. Fernandes, N.M. de Figueiredo, Y. Yoneshigue-Valentin and R.C. Garla. 2009. Four new additions to the marine flora of Fernando de Noronha Archipelago, tropical western South Atlantic Ocean. Check List. 5: 210-215. Oliveira-Carvalho, M.D.F., M.C. Oliveira, S.M.B. Pereira and H. Verbruggen. 2012. Phylogenetic analysis of Codium species from Brazil, with the description of the new species C. pernambucensis (Bryopsidales, Chlorophyta). Eur. J. Phycol. 47: 355-365. Paul, V.J. and W. Fenical. 1984. Novel bioactive diterpenoid metabolites from tropical marine algae of the genus Halimeda (Chlorophyta). Tetrahedron 40: 3053-3062. Pereira, S.M.B., F.A. Ribeiro and M.E. Bandeira-Pedrosa. 2008. Algas pluricelulares do infralitoral da praia de Gaibú (Pernambuco-Brasil). Braz. J. Bioscience 5: 951. Pongparadon, S., G.C. Zuccarello, S.M. Phang, H. Kawai, T. Hanyuda, and A. Prathep. 2015. Diversity of Halimeda (Chlorophyta) from the Thai–Malay Peninsula. Phycologia 54: 349- 366. Pupo, D. and A.C.S.P. Coto. 2011. Checklist of Ulvophyceae of the São Paulo State. Biota Neotrop. 11: 137-142. Reuter, M., W.E. Piller and S. Richoz. 2012. The dispersal of Halimeda in northern hemisphere mid-latitudes: Palaeobiogeographical insights. Perspect. Plant Ecol. Evol. Syst. 14: 303-309. Ries, J.B. 2009. Effects of secular variation in seawater Mg/Ca ratio (calcite–aragonite seas) on CaCO3 sediment production by the calcareous algae Halimeda, Penicillus and Udotea– evidence from recent experiments and the geological record. Terra Nova. 21: 323-339. Santos, G.N. and J.M.C. Nunes. 2015. O gênero Halimeda (Bryopsidales, Chlorophyta) no litoral do estado da Bahia, Brasil. Sitientibus série Ciências Biológicas 15: 1-15. 85

Saunders, G.W. and H. Kucera. 2010. An evaluation of rbcL, tufA, UPA, LSU and ITS as DNA barcode markers for the marine green macroalgae. Cryptogam. Algol. 31: 487-528. Stamatakis, A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 30: 1312-1313. Tamura, K. and M. Nei. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molec. Biol. Evol. 10: 512-526. Tamura, K., G. Stecher, D. Peterson, A. Filipski and S. Kumar. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30: 2725-2729. Taylor, W. R. 1972. Marine algae of the eastern tropical and subtropical coasts of the Americas. University of Michigan, Michigan. pp. 870. Testa, V. and D.W. Bosence. 1999. Physical and biological controls on the formation of carbonate and siliciclastic bedforms on the north‐east Brazilian shelf. Sedimentology 46: 279- 301. Verbruggen, H. and W.H.C.F. Kooistra. 2004. Morphological characterization of lineages within the calcified tropical seaweed genus Halimeda (Bryopsidales, Chlorophyta). Eur. J. Phycol. 39: 213-228. Verbruggen, H., O. De Clerck, W.H.C.F. Kooistra and E. Coppejans. 2005a. Molecular and morphometric data pinpoint species boundaries in Halimeda section Rhipsalis (Bryopsidales, Chlorophyta). J. Phycol. 41: 606-621. Verbruggen, H., O. De Clerck, T. Schils, W.H.C.F. Kooistra and E. Coppejans. 2005b. Evolution and phylogeography of Halimeda section Halimeda (Bryopsidales, Chlorophyta). Molec. Phylogenet. Evol. 37: 789-803. Verbruggen, H., O. De Clerck, A.D. N'yeurt, H. Spalding and P.S. Vroom. 2006. Phylogeny and taxonomy of Halimeda incrassata, including descriptions of H. kanaloana and H. heteromorpha spp. nov. (Bryopsidales, Chlorophyta). Eur. J. Phycol. 41: 337-362. Verbruggen, H., L. Tyberghein, L. Pauly, C. Vlaeminck, K.V. Nieuwenhuyze, W.H.C.F. Kooistra, F. Leliaert and O. De Clerck. 2009. Macroecology meets macroevolution: evolutionary niche dynamics in the seaweed Halimeda. Global Ecol. Biogeogr. 18: 393-405. Vroom, P.S., C.M. Smith and S.C. Keeley. 1998. Cladistics of the Bryopsidales: a preliminary analysis. J. Phycol. 34: 351–360. Ximenes, C.F. 2015. Taxonomia e filogenia dos representantes do gênero Halimeda J. V. Lamour. (Bryopsidales, Chlorophyta) no Brasil. (Masters Thesis). Universidade Federal Rural de Pernambuco, Recife, Brazil. 86

Ximenes, C.F., V. Cassano, M.F. Oliveira-Carvalho, M.E. Bandeira-Pedrosa, C.F.D. Gurgel, H. Verbruggen and S.M.B. Pereira. 2017. Systematics of the genus Halimeda (Bryopsidales, Chlorophyta) in Brazil including the description of Halimeda jolyana sp. nov. Phycol. 56: 369-381. 87

Artigo 3 – Inferências filogenéticas revelam uma nova espécie de Halimeda J. V. Lamour., H. americana sp. nov. para o Atlântico Sul americano e Caribe

Caroline Feijão Ximenes4, Maria de Fátima de Oliveira-Carvalho5, Ana Maria Benko- Iseppon6, Valéria Cassano7, Sonia Maria Barreto Pereira4

4 Programa de Pós-Graduação em Botânica, Universidade Federal Rural de Pernambuco, Rua Dom Manoel de Medeiros, s/n, Dois Irmãos, 52171-900, Recife, Pernambuco, Brasil. 5 Universidade Federal de Pernambuco, Rua Alto do Reservatório, s/n, 55608-680, Vitória de Santo Antão, Pernambuco, Brazil. 6 Universidade Federal de Pernambuco, Av. Prof. Moraes Rego, s/no. 50732-970, Recife – PE, Brazil. 7 Departamento de Botânica, Instituto de Biociências, Universidade de São Paulo, Rua do Matão, 277, 05508- 090, São Paulo, Brazil. 88

Resumo Desde a introdução das análises filogenéticas com marcadores moleculares plastidiais nos estudos taxonômicos do gênero Halimeda, uma diversidade de espécies crípticas tem sido descoberta aumentando o número de táxons para o gênero. Na Seção Halimeda, prévios estudos revelaram a existência de mais espécies filogeneticamente delineáveis do que morfologicamente reconhecíveis. O presente trabalho teve por objetivo analisar espécies desta Seção para o Atlântico Sul. Para isto, foram obtidas amostras da região entre marés do Caribe e Brasil, as quais foram analisados caracteres morfoanatômicos e moleculares, seguindo as etapas de extração de DNA total, amplificação e sequenciamento dos marcadores tufA, rbcL e SSU. Foram geradas árvores filogenéticas de DNA barcode (tufA) e da matriz concatenada com sequências dos três marcadores, que revelaram que a espécie Halimeda tuna, citada para o Mar Mediterrâneo (localidade-tipo) e Oceano Atlântico, é críptica mostrando alta divergência genética entre espécimes destes locais. Desta forma, este trabalho propõe uma nova espécie Halimeda americana sp. nov., visando acomodar o táxon previamente citado como H. tuna e H. aff. tuna para o Atlântico Sul-americano e Caribe. Estudos paleoceanográficos hipotetizam que Halimeda tuna do Mar Mediterrâneo tornou-se restrita durante um período de resfriamento global no Plioceno, o que pode ter levado a especiação alopátrica das populações do Caribe e Brasil em relação à H. tuna do Mar Mediterrâneo.

Palavras-chave: Bryopsidales, Chlorophyta, DNA barcode, taxonomia. 89

Introdução O gênero Halimeda J. V. Lamour. (Bryopsidales, Chlorophyta) é amplamente distribuído nos mares tropicais e subtropicais ao redor do mundo (Hillis-Colinvaux, 1980).

Atualmente, representado por 47 espécies (Guiry and Guiry, 2018), é reconhecido por apresentar talo fortemente calcificado, segmentado e anatomicamente constituído de filamentos cenocíticos comuns as algas da ordem Bryopsidales (Hillis, 1959; Curtis et al.

2008). Taxonomicamente, vem sendo estudado sob perspectivas morfológica, filogenética e biogeográfica (Hillis, 1959; Hillis-Colinvaux, 1980; Kooistra, et al. 2002; Bandeira-Pedrosa et al. 2004; Verbruggen et al. 2005, 2009; Dijoux et al. 2012; Pongparadon et al. 2015), por apresentar morfologia simples com plasticidade fenotípica e registros de espécies crípticas

(Kooistra, et al. 1999, 2002; Verbruggen et al., 2005, 2006; Ximenes et al., 2017).

Sistematicamente, suas espécies são agrupadas em cinco Seções: Rhipsalis J. Agardh ex De

Toni, Opuntia J. Agardh ex De Toni, Micronesicae Hillis-Colinvaux, Pseudo-opuntia J.

Agardh ex De Toni e Halimeda J. Agardh ex De Toni, as quais possuem caracteres morfológicos compartilhados (por exemplo, o padrão de fusão nodal), mas são consolidadas por análises filogenéticas de marcadores plastidiais (tufA, rbcL, UCP7) e nucleares (SSU,

LSU, HSP90) (Kooistra, et al. 2002; Verbruggen and Kooistra, 2004).

Destas, a Seção Halimeda tem a distribuição mais ampla de espécies, ocorrendo nos

Oceanos Atlântico, Pacífico e Índico, sendo alvo de estudos biogeográficos (Hillis-Colinvaux,

1980; Verbruggen et al. 2005). Além disso, trabalhos prévios têm mostrado que há mais espécies geneticamente delineáveis do que morfologicamente reconhecíveis para esta seção

(Verbruggen et al. 2005; Kojima et al. 2015; Cremen et al. 2016; Ximenes et al. 2017). Tais autores vêm reportando a separação das linhagens do Indo-Pacífico versus Atlântico devido ao estabelecimento do Istmo do Panamá e fechamento do Mar de Tethys, que tem levado a eventos de especiação de indivíduos morfologicamente iguais (Verbruggen et al. 2005). 90

Neste estudo, abordamos aspectos morfológicos, biogeográficos e filogenéticos de espécies de Halimeda seção Halimeda para o litoral do Atlântico Sul, trazendo a descrição de uma espécie críptica Halimeda americana Ximenes, Oliveira-Carvalho, Cassano et S.M.B.

Pereira sp. nov., que se estende também ao Mar do Caribe.

Material & Métodos

Espécimes de Halimeda spp. foram obtidos da região entre-marés de pontos do litoral da Venezuela, Panamá, Mar do Caribe, México, Cuba e Brasil (Tabela S4). As amostras foram condicionadas em álcool ou sílica gel para análises morfológicas e moleculares.

A morfologia interna e externa foi analisada com auxílio de estereomicroscópio e microscópio óptico com ocular micrométrica utilizando bibliografia pertinente (Hillis, 1959;

Hillis-Colinvaux, 1980; Bandeira-Pedrosa et al. 2004). Os vouchers foram tombados e incorporados aos acervos do herbário Professor Vasconcelos Sobrinho (PEUFR/UFRPE) e da

Universidade de São Paulo (SPF/USP).

O DNA total foi extraído utilizando o protocolo manual Cetil-trimetil Brometo de

Amônio (CTAB) descrito em Oliveira-Carvalho et al. (2012). Os marcadores tufA, rbcL e a região 18S-ITS1-5.8S-ITS2-28S foram amplificados por reação da cadeia polimerase (PCR) com os primers utilizados por Famà et al. (2002) para o tufA, Hoef-Emden and Melkonian

(2003) e Bellorin et al. (2002) para a região 18S-ITS1-5.8S-ITS2-28S e Curtis et al. (2008) para o rbcL. Para as reações foi utilizado o Kit illustra PuReTaq Ready-To-Go PCR Beads

(GE Healthcare), segundo as instruções do fabricante usando-se o termociclador Techne TC-

4000 (Bibby Scientiﬁc Ltd, Staffordshire, UK) e com ciclos descritos em Famà et al. (2002),

Hoef-Emden and Melkonian (2003) e Curtis et al. (2008). As etapas de purificação e sequenciamento seguiram as descritas em Ximenes et al. (2017).

As sequências obtidas foram checadas utilizando-se a ferramenta “Nucleotide Blast” do

“National Center Biotechnology Information” via plataforma online. As sequências consenso 91 e as matrizes foram montadas e alinhadas utilizando-se o programa Geneious v. 10 (Kearse et al. 2012). O modelo de substituição de nucleotídeos (GTR+I+G) foi selecionado através do software JModelTest 2 (Darriba et al. 2012) sob o Akaike Information Criterion (AIC).

Foram realizadas as análises de distância Neighbour-Joining (NJ) com 2.000 réplicas e cálculo de divergência para o marcador barcode tufA no software Geneious v. 10 (Kearse et al. 2012). Uma matriz com os marcadores concatenados foi montada com auxílio do Sequence

Matrix (Vaidya et al. 2011). Foram geradas árvores filogenéticas de Máxima Verossimilhança

(ML) com 1.000 réplicas e Inferência Bayesiana (BI) com 5.000.000 gerações para a matriz concatenada e para a matriz contendo apenas o marcador tufA com os programas RaxML

(ML) e MrBayes (BI) através do software Geneious (Kearse et al. 2012).

Resultados

Nove espécies morfologicamente reconhecidas foram obtidas para o litoral do Atlântico

Sul: H. discoidea Decne., H. incrassata (J.Ellis) J.V.Lamour., H. jolyana Ximenes, Bandeira-

Pedrosa, Cassano, Oliveira-Carvalho, Verbruggen & S.M.B.Pereira, H. monile (J.Ellis & Sol.)

J.V.Lamour., H. scabra M.Howe, H. simulans M.Howe, H. opuntia (L.) J.V.Lamour., H. soniae Ximenes, Oliveira-Carvalho, Bandeira-Pedrosa & Cassano e H. americana Ximenes,

Oliveira-Carvalho, V. Cassano et S.M.B. Pereira sp. nov .

O alinhamento final dos marcadores concatenados consistiu de um total de 3.137 pb de

66 sequências de Halimeda obtidas nesse estudo e as disponíveis no banco de dados

(Genbank), sendo 62 sequências com 587 pb para o tufA, 51 sequências com 1.313 pb para o rbcL, 33 sequências com 1.237 pb para o SSU (Tabela S4).

A árvore consenso de Inferência Bayesiana (BI) para o tufA (Fig. K) mostra as espécies

Halimeda tuna, H. americana (como H. tuna e H. aff. tuna) e H. scabra dentro da Seção

Halimeda, cujo clado obteve suporte máximo nas análises de ML e BI. As sequências de H. americana (como H. aff. tuna) do Brasil (KT781879, KT781880, KT781883) e de H. 92

americana (como H. tuna) da Jamaica (KT887756) e de Cuba (sem acesso por enquanto) se

agruparam num clado com suporte moderado, mas separadas da H. tuna da localidade-tipo da

(Itália, AY826366), mostrando que se tratam de espécies diferentes.

*/* Seção Rhipsalis 76/0,94 Halimeda americana sp. nov. Cuba Halimeda americana sp. nov. Cuba 73/0,87 Halimeda americana sp. nov. Jamaica (como H. tuna) (KT887756) -/0,97 Halimeda americana sp. nov. Brasil (como H. aff. tuna) (KT781883) 98/0,91 Halimeda americana sp. nov. Brasil (como H. aff. tuna) (KT781880) Halimeda americana sp. nov. Brasil (como H. aff. tuna) (KT781879) 78/0,98 H. scabra México: Puerto Morelos */* H. scabra México: Playa Paraiso H. scabra Bahamas (Localidade-tipo) (FJ624540) -/0,85 H. scabra Bahamas (Localidade-tipo) (KT887752) 82/0,87 H. hummii Panamá (KT887745) */* H. discoidea Brasil H. discoidea Espanha: Ilhas Canárias (AY826361) -/0,97 H. tuna Itália (Localidade-tipo) (AY826366) H. jolyana Brasil (Localidade-tipo) (KT781872) Seção Halimeda */* H. jolyana Brasil (Localidade-tipo) (KT781874) H. jolyana Brasil (Localidade-tipo) (KT781875) 98/* H. lacunalis Austrália (KT887747) H. ryukyuensis Japão (Localidade-tipo) (AB924512) */* -/0,78 H. cuneata Sri Lanka (FJ624537) H. versatilis Austrália (KT887721) 80/* H. macrophysa Filipinas (KT887749) H. taenicola Polinésia Francesa (AM049966) 83/* H. xishaensis Maldivas (KT887757) H. cuneata África do Sul (Localidade-tipo) (AY826353) 88/* -/0,91 H. discoidea Nova Caledônia (JN644658) 95/* H. gigas Tanzania (FJ624539) H. magnidisca Austrália (KT887751) 99/* -/0,9 Seção Opuntia */* Seção Pseudo-opuntia -/0,8 */* Seção Micronesicae

0.02 Figura K - Árvore consenso de Inferência Bayesiana não enraizada construída para as 62 sequências do tufA de diferentes amostras de Halimeda. As sequências das espécies pertencentes a seções Rhipsalis, Micronesicae, Opuntia e Pseudo-opuntia foram omitidas para melhor visualização da árvore. Apenas valores acima de 70% de boostrap ou 0,7 de probabilidade a posteiori estão indicados nos ramos, na ordem ML/BI. Sequências em negrito foram obtidas neste estudo. (*) Indica suporte máximo da análise.

Tais resultados foram obtidos através em análises com genes concatenados (Fig. L). As

sequências de H. americana (nomeadas como H. aff. tuna e H. tuna) do Brasil, Jamaica e

Cuba, aparecem agrupadas entre si com baixo suporte para ML e moderado para BI e

separadas da H. tuna da localidade-tipo, Itália. 93

*/* Seção Rhipsalis 94/* */* Seção Opuntia */* Seção Pseudo-opuntia H. cuneata Sri Lanka H. discoidea Oman -/0,86 H. macrophysa Austrália H. taenicola Polinésia Francesa 92/* H. versatilis Austrália (Localidade-tipo) 83/* H. xishaensis Maldivas 93/* H. cuneata África do Sul -/0,82 H. discoidea Nova Caledônia 97/0,88 H. gigas Tanzânia H. magnidisca Austrália (Localidade-tipo) */* H. discoidea Espanha: Ilhas Canárias H. discoidea Brasil H. tuna Itália (Localidade-tipo) */* H. hummii Panamá 92/* H. scabra México: Puerto Morelos Seção Halimeda */* 73/* H. scabra México: Playa Paraiso H. scabra Bahamas (Localidade-tipo) 95/0,99 H. scabra Bahamas (Localidade-tipo) H. scabra Bahamas (Localidade-tipo) 86/- H. scabra México: Puerto Morelos Halimeda americana sp. nov. Brasil (como H. aff. tuna) 91/* 83/0,99 Halimeda americana sp. nov. Brasil (como H. aff. tuna) Halimeda americana sp. nov. Brasil (como H. aff. tuna) 88/0,99 Halimeda americana sp. nov. Jamaica (como H. tuna) -/0,83 Halimeda americana sp. nov. Cuba (como H. tuna) 98/* Halimeda americana sp. nov. Cuba (como H. tuna) H. jolyana Brasil (Localidade-tipo) */* H. jolyana Brasil (Localidade-tipo) H. jolyana Brasil (Localidade-tipo) */* H. lacunalis Australia H. ryukyuensis Japão (Localidade-tipo) */* Seção Micronesicae

0.02

Figura L - Árvore consenso de Inferência Bayesiana não enraizada construída para as 66 sequências concatenadas do tufA, rbcL e 18S-ITS1-5.8S-ITS2-28S de diferentes amostras de Halimeda. As sequências das espécies pertencentes a seções Rhipsalis, Micronesicae, Opuntia e Pseudo-opuntia foram omitidas para melhor visualização da árvore. Apenas valores acima de 70% de boostrap ou 0,7 de probabilidade a posteiori estão indicados nos ramos, na ordem ML/BI. Sequências em negrito foram obtidas neste estudo. (*) Indica suporte máximo do ramo.

Os percentuais de divergência do tufA variou de 0-10% (0-90 pb) entre as sequências de

Halimeda americana (incluindo as previamente nomeadas como H. tuna e H. aff. tuna) e H. scabra. As sequências de H. americana do Atlântico divergiram entre si de 0-0,46% (0-4 pb) e de H. tuna da localidade-tipo de e de 8,6-10,1% (74-86 pb), indicando que são espécies distintas.

A divergência entre as sequências de H. americana e H. scabra do Atlântico variou de

0,58-1,18% (5-10 pb) indicando que são espécies muito próximas.

Baseado nas análises filogenéticas e de DNA Barcode, uma nova espécie é proposta para acomodar os táxons previamente citados como H. tuna e H. aff. tuna para o Atlântico ocidental.

Halimeda americana sp. nov. Ximenes, Oliveira-Carvalho, Cassano et S.M.B. Pereira (Figs.

M: 3-10).

Descrição Talo ereto, imbricado, medindo de 3,8-10 cm, preso ao substrato rochoso por apressório basal pequeno, cilíndrico ou discoide. Segmentos reniformes (maioria), discoides, subcuneados a subcilíndricos. Ramificação di a tricotômica com até 5 segmentos dispostos em vários planos, saindo de um único segmento e medindo 5-12 mm de comprimento e 9-20 mm de largura.

Região cortical com duas a quatro camadas de utrículos. Utrículos primários alongados em forma de taça medindo 50-196 µm de comprimento e 27,5-55 µm de diâmetro. Utrículos secundários medindo 52,5-177 µm de comprimento, suportando de dois a quatro utrículos primários. Filamentos medulares fusionados completamente aos pares ou em grupo de três.

Hábito: Espécimes epilíticos ocorrendo da zona entre marés até 60m de profundidade

(Bandeira-Pedrosa et al. 2004).

Etimologia: O epíteto específico faz referência a sua distribuição na costa americana do

Atlântico Sul e caribenha.

Localidade-tipo

Brasil, Alagoas, Paripueira; 9º28’26’’S, 35º32’37’’O, zona entre marés, 03 de novembro de

2013, coletores: C. F. Ximenes, M. F. Oliveira-Carvalho & S. Rodrigues.

Holótipo: PEUFR 52110. Acesso Genbank: tufA (KT781880), rbcL (KY570456) e 18S-ITS-

28S (não disponível).

Isótipo: SPF58269, PEUFR 52109. Acesso Genbank: tufA (KT781881).

Material Examinado:

Brasil, Maranhão, São Luís, Parcel Manoel Luís, 12 abr. 2012, M. Sissini (PEUFR 52107); loc. id., 10m, 29 mai. 2000, A.C.L.L.Castro & M.M. Ferreira-Correia (PEUFR 38007,

38008); Rio Grande do Norte, 04°50’S, 35° 41’W, 02 mar. 1980, G. C. Teixeira (PEUFR

4451); Paraíba, João Pessoa, Picãozinho, 04 out. 2013, M.F.Oliveira-Carvalho & D.C.Burgos

(PEUFR 52108); Pernambuco, Tamandaré, Praia de Campas, 29 mar. 2002, M.E.Bandeira-

Pedrosa (PEUFR 40563); loc. id., Tamandaré, Praia de Tamandaré, 10 mar. 1999,

M.E.Bandeira-Pedrosa (PEUFR 35036); loc. id., Tamandaré, Praia de Tamandaré, 5 mai.

1999, M.E.Bandeira-Pedrosa (PEUFR 35037); loc. id., Ilha de Itamaracá, Praia de Jaguaribe,

28 set. 2004, M.E.Bandeira-Pedrosa (PEUFR 50744); loc. id., Paulista, Praia de Pau Amarelo,

Est. 01, 20. jul.1997, M.F. de Oliveira-Carvalho & N.M.B. de Oliveira (PEUFR 30965); loc. id., Ilha de Itamaracá, Praia de Jaguaribe, 14 nov. 1997, M.E.Bandeira-Pedrosa &

M.F.Oliveira-Carvalho (PEUFR 30524); loc. id., Ilha de Itamaracá, Praia de Jaguaribe, 15 out. 1997, M.E.Bandeira-Pedrosa & M.F.Oliveira-Carvalho (PEUFR 30523); Bahia, Porto

Seguro, Praia de Ondina, 15 jan. 2012, M.F.Oliveira-Carvalho (PEUFR 52111); loc. id. Coroa

Vermelha, 19 abr. 1988, C. Nassar (PEUFR 37576); loc. id. Coroa Vermelha, 26 jan. 1988,

Mitchell (PEUFR 37573); Est. 15C, 18º01’S, 35º53’W, 60 m, 13 out. 1997, Astro Garoupa-

Central II (PEUFR 36481); Est. 29C, 19º48’S, 37º46’W, 58 m, 16 out. 1997, Astro Garoupa-

Central II (PEUFR 36479); Est. 24C, 20º21’S, 36º38’W, 62 m, 07 out. 1997, Astro Garoupa-

Central II (PEUFR 36480); Est. 28, 07º26’S, 34º30’W, 12 mai. 1997, Antares NE-II (PEUFR

35040); Est. 77A, 01º37’S, 38º05’W, 07 mai. 1998, Antares NE-I (PEUFR 35038); Est. 137, 96

01º36’S, 38º10’W, 18 set. 1996, Antares NE-I (PEUFR 35039); Est. 193, 20º16’S, 41º34’W,

14 Set. 1996, 44,1 m, Antares-NE I (PEUFR 36480); Cuba, Havana, Playa, Santa Fé, 24 mai.

2016. Duran, A. & Collado-Vides, L. (SPF 58281); Cuba, Havana, Playa, Santa Fé, 24 mai.

2016. Duran, A. & Collado-Vides, L. (SPF 58282).

Nomes mal aplicados para o Atlântico: Jamaica: Taylor (1972, pp. como Halimeda tuna),

Blair & Norris (1988, pp. 227-228, 232-235 como H. tuna), Cuba: Howe (1918, como H. tuna) Brasil: Pereira et al. (1996, pp. 160-161), Nunes (1998, p. 18) Pereira & Accioly (1998, pp. 44, 47, Figs. 74-75), Bandeira-Pedrosa et al. (2004, pp. 366-367, 369, 372-376, Figs. 9-10,

23, 41), Guimarães et al. (2008, pp. 35-38, 40-41, 48, 52), Cocentino et al. (2010, pp. 988,

990, 993), Santos & Nunes (2015, pp. 3-4, 14-15, Fig.13a-f), Ximenes (2015, pp. 14-41, Fig.

2), como H. aff. tuna (Ximenes et al. 2017, Fig. 2).

As características morfológicas de H. tuna e H. americana sp. nov. são comparadas na

Tabela 8. Morfologicamente, as espécies H. americana e H. tuna se assemelham por possuir hábito imbricado, não medindo mais que 15 cm de altura de talo, apressório discreto e apresentar segmentos com formato reniforme, subcuneado ou discoide. Internamente, os táxons apresentam de duas a quatro camadas de utrículos e fusão nodal completa (Hillis-

Colinvaux, 1980; Bandeira-Pedrosa et al. 2004). As medidas dos tamanhos dos utrículos se sobrepõem, contudo, H. tuna pode apresentar utrículos fusionados sensu Hillis-Colinvaux

(1980), diferindo assim de H. americana.

Figura M – Halimeda americana sp. nov. Ximenes, Oliveira-Carvalho, V. Cassano & S.M.B. Pereira. (3) Isótipo (PEUFR 52109). Escala = 1 cm. (4) Vista superficial dos utrículos. Escala = 100 µm. (5) Padrão de fusão nodal completa por dois filamentos. Escala = 100 µm. (6) Espécime de H. americana de Cuba (SPF 58281). Escala = 1 cm. (7) Exemplar de H. americana de infralitoral. (PEUFR 4451). (8) Vista frontal do utrículos primários e secundários. Escala = 100 µm. (9) Holótipo (PEUFR 52110). Escala = 1 cm. (10) Espécime de H. americana densamente ramificado. Escala = 1 cm.

Tabela 8 - Comparação das características morfológicas de Halimeda tuna e H. americana sp. nov.

Táxons / Halimeda tuna Halimeda americana sp. nov. Ximenes, Características Oliveira-Carvalho, Cassano et. S.M.B. Pereira Referências Hillis-Colinvaux (1980) Bandeira-Pedrosa et al. 2004 (como H. tuna) e Ximenes et al. 2017 (como H. aff. tuna) / Este estudo Hábito Espalhado ou compacto Ereto, imbricado Comprimento do talo até 15 Até 13,5 (cm) Apressório Inconspícuo Pequeno, basal e único Nível de Calcificação Moderada a leve, às vezes, forte Moderada a leve na base Ramificação Geralmente di ou tricotômica Geralmente di ou tricotômica em vários planos, com até cinco segmento saindo de um segmento Formato dos Segmentos basais subcuneados, Segmentos basais fortemente segmentos nas demais porções do talo calcificados, cilíndricos, subcilíndricos e subcuneados, discoides ou subcuneados, nas demais porções do talo reniformes, comumente discoides, reniformes, cuneados a pequenos subcuneados Medida dos segmentos Até 13 x 19 Até 11 x 20 (comp. x larg., mm) Camadas de utrículos 2-4 2-4 Padrão de fusão nodal Completa em dois ou três Curta ou completa em dois ou três filamentos medulares filamentos medulares Diâmetro dos utrículos 25-125 27,5-55 primários (em vista superficial, µm) Comprimento dos 46-230 50-196 utrículos primários (em vista frontal, µm) Comprimento dos 30- 80 44-90 utrículos secundários (em vista frontal, µm) Formato dos utrículos Não observada Poligonal com a parede mais espessa (vista superficial) que em outras espécies 99

Discussão

Estudos prévios no gênero Halimeda tem reportado a diversidade críptica no grupo, indicando o estabelecimento do Istmo do Panamá e o fechamento do Mar de Tethys como eventos vicariantes que levaram a especiação dentro do gênero (Verbruggen et al. 2005).

Dentro da classificação do grupo, a Seção Halimeda foi estudada por Verbruggen et al. (2005) analisando vários espécimes representados pelos Oceanos Pacífico, Índico e Mar

Mediterrâneo, através de análises morfológicas e de marcadores moleculares (UCP7, 18S,

ITS1-ITS2, tufA e UCP3). Estes autores observaram que espécimes reconhecidos como

Halimeda tuna do Mar Mediterrâneo (localidade-tipo) e Caribe eram filogeneticamente divergentes. Tais resultados foram também mostrados em Ximenes et al. (2017), que tratam as amostras do Brasil, de forma equivocada, como Halimeda aff. tuna baseado em análises de

DNA barcode e filogenia concatenada do tufA, rbcL e 18S com relógio molecular.

Nossos resultados mostraram que Halimeda americana (citada previamente como H. tuna e H. aff. tuna) posicionou-se em um clado separado das demais espécies, sendo assim uma nova espécie de Halimeda. Além do posicionamento filogenético, os resultados de divergências interespecífica para o marcador tufA entre H. americana e o topótipo de H. tuna, confirmaram que ambas são espécies diferentes.

Morfologicamente as espécies H. americana e H. tuna são muito semelhantes, não apresentando características para diferenciá-las, sendo, portanto, espécies crípticas, como já reportado anteriormente por Verbruggen et al. (2005), sendo apenas diferenciadas por aspectos biogeográficos quanto ao local de ocorrência, enquanto H. tuna possivelmente está restrita ao Mar Mediterrâneo, H. americana até o presente momento ocorre apenas na costa do Atlântico desde o Rio de Janeiro (Bandeira-Pedrosa et al. 2004) ao Golfo do México.

Harvey (1858) descreveu pela primeira vez H. tuna para o continente americano reportando nenhuma diferença entre os exemplares da Flórida e do Mar Mediterrâneo. Hillis-

Conlivaux (1980) tratou H. tuna como uma espécie pantropical, ocorrendo no Oceano Índico, 100

Pacífico, Atlântico e Mar Mediterrâneo. No entanto, nossos dados corroboraram os trabalhos anteriores do gênero Halimeda (Verbruggen et al. 2005, Ximenes et al. 2017), os quais mostraram que H. tuna é restrita ao Mar Mediterrâneo, sua localidade-tipo.

Reuter et al. (2012) através de dados paleobiogeográficos levantaram a hipótese de que o possível ancestral a H. tuna invadiu o Mar Mediterrâneo durante o Plioceno e tornou-se isolada após um período de resfriamento, o que justificaria na sua especiação e na ausência no

Golfo Pérsico, como mostrado por esses autores. 101

AGRADECIMENTOS Agradecemos a todos os coletores que nos enviaram amostras de Halimeda do Caribe, em especial à Dra. Ligia Collado-Vides e ao Dr. Abel Senties. CFX agradece ao Conselho

Nacional de Desenvolvimento Científico e Tecnológico (CNPq) pela bolsa de doutorado

(140798/2015-3). VC agradece ao Conselho Nacional de Desenvolvimento Científico e

Tecnológico (CNPq) pela bolsa de produtividade (302549/2017-0).

REFERÊNCIAS BIBLIOGRÁFICAS

Bandeira-Pedrosa, M.E., S.M.B. Pereira and E.C. Oliveira. 2004. Taxonomy and distribution of the green algal genus Halimeda (Bryopsidales, Chlorophyta) in Brazil. Braz. J. Botany. 27:

363-377.

Bellorin, A.M., Oliveira, M.C. and E.C. Oliveira. 2002. Phylogeny and systematics of the marine algal family Gracilariaceae (Gracilariales, Rhodophyta) based on small subunit rDNA and ITS sequences of Atlantic and Pacific species. J. Phycol. 38: 551-563.

Cremen, M. C. M., J. M.Huisman, V. R.Marcelino and H. Verbruggen. 2016. Taxonomic revision of Halimeda (Bryopsidales, Chlorophyta) in south-western Australia. Aust. Syst. Bot.

29: 41-54.

Curtis, N.E., C.J. Dawes and S.K. Pierce. 2008. Phylogenetic analysis of the large subunit rubisco gene supports the exclusion of Avrainvillea and Cladocephalus from the Udoteaceae

(Bryopsidales, Chlorophyta). J. Phycol. 44: 761-767.

Darriba, D., G.L. Taboada, R. Doallo and D. Posada. 2012. jModelTest 2: More models, new heuristics and parallel computing. Nature Meth. 9: 772.

Dijoux, L., H. Verbruggen, L. Mattio, N. Duong and C. Payri. 2012. Diversity of

Halimeda (Bryopsidales, Chlorophyta) in New Caledonia: a combined morphological and molecular study. J. Phycol. 48: 1465-1481.

102

Famà, P., B. Wysor, W.H.C.F. Kooistra and G.C. Zuccarello. 2002. Molecular phylogeny of the genus Caulerpa (Caulerpales, Chlorophyta) inferred from chloroplast tufA gene. J.

Phycol. 38: 1040-1050.

Guiry, M.D. and G.M. Guiry. 2018. AlgaeBase. World-wide electronic publication. National

University of Ireland, Galway: http://www. algaebase. org. Searched on 11 September 2018.

Hillis, L.W. 1959. A revision of the genus Halimeda (order Siphonales). Pub. Inst. Mar. Sci.

6: 321-403.

Hillis, L.W., J.A. Engman and W.H.C.F. Kooistra. 1998. Morphological and molecular phylogenies of Halimeda (Chlorophyta, Bryopsidales) identify three evolutionary lineages. J.

Phycol. 34: 669-681.

Hoef-Emden, K., B. Marin and M. Melkonian. 2002. Nuclear and nucleomorph SSU rDNA phylogeny in the Cryptophyta and the evolution of cryptophyte diversity. J. Mol. Evol. 55:

161-179.

Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock, S. Buxton, A.

Cooper, S. Markowitz, C. Duran, T. Thierer, B. Ashton, P. Meintjes and A. Drummond. 2012.

Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649.

Kojima, R., T. Hanyuda and H. Kawai. 2015. Taxonomic reexamination of Japanese

Halimeda species using genetic markers, and proposal of a new species Halimeda ryukyuensis

(Bryopsidales, Chlorophyta). Phycol. Res. 63: 178-188.

Kooistra, W.H. C.F., M. Calderón and L.W. Hillis. 1999. Development of the extant diversity in Halimeda is linked to vicariant events. Hydrobiologia 398: 39-45.

Kooistra, W.H.C.F., E.G.G. Coppejans and C. Payri. 2002. Molecular systematics, historical ecology, and phylogeography of Halimeda (Bryopsidales). Molec. Phylogenet.

Evol. 24:121-138. 103

Kooistra, W.H.C.F. and H. Verbruggen. 2005. Genetic patterns in the calcified tropical seaweeds Halimeda opuntia, H. distorta, H. hederacea and H. minima (Bryopsidales,

Chlorophyta) provide insights in species boundaries and interoceanic dispersal. Molec.

Phylogenet. Evol. 41: 177-187.

Oliveira-Carvalho, M.D.F., M.C. Oliveira, S.M.B. Pereira and H. Verbruggen. 2012.

Phylogenetic analysis of Codium species from Brazil, with the description of the new species

C. pernambucensis (Bryopsidales, Chlorophyta). Eur. J. Phycol. 47: 355-365.

Pongparadon, S., G.C. Zuccarello, S.M. Phang, H. Kawai, T. Hanyuda, and A. Prathep. 2015.

Diversity of Halimeda (Chlorophyta) from the Thai–Malay Peninsula. Phycologia 54: 349-

366.

Taylor, W. R. 1972. Marine algae of the eastern tropical and subtropical coasts of the

Americas. University of Michigan, Michigan. pp. 870.

Vaidya, G., D.J. Lohman and R. Meier. 2011. SequenceMatrix: concatenation software for the fast assembly of multi‐gene datasets with character set and codon information. Cladistics. 27:

171-180.

Verbruggen, H. and W.H.C.F. Kooistra. 2004. Morphological characterization of lineages within the calcified tropical seaweed genus Halimeda (Bryopsidales, Chlorophyta). Eur. J.

Phycol. 39: 213-228.

Verbruggen, H., L. Tyberghein, L. Pauly, C. Vlaeminck, K.V. Nieuwenhuyze, W.H.C.F.

Kooistra, F. Leliaert and O. De Clerck. 2009. Macroecology meets macroevolution: evolutionary niche dynamics in the seaweed Halimeda. Global Ecol. Biogeogr. 18: 393-405.

Verbruggen, H., O. De Clerck, A.D. N'yeurt, H. Spalding and P.S. Vroom. 2006. Phylogeny and taxonomy of Halimeda incrassata, including descriptions of H. kanaloana and H. heteromorpha spp. nov. (Bryopsidales, Chlorophyta). Eur. J. Phycol. 41: 337-362. 104

Verbruggen, H., O. De Clerck, T. Schils, W.H.C.F. Kooistra and E. Coppejans. 2005.

Evolution and phylogeography of Halimeda section Halimeda (Bryopsidales, Chlorophyta).

Molec. Phylogenet. Evol. 37: 789-803.

Ximenes, C.F., V. Cassano, M.F. Oliveira-Carvalho, M.E. Bandeira-Pedrosa, C.F.D. Gurgel,

H. Verbruggen and S.M.B. Pereira. 2017. Systematics of the genus Halimeda (Bryopsidales,

Chlorophyta) in Brazil including the description of Halimeda jolyana sp. nov. Phycol. 56:

369-381.

105

MATERIAL SUPLEMENTAR

Tabela S4 – Sequências de Halimeda utilizadas nas análises filogenéticas

Marcadores Táxon Local tufA rbcL SSU-LSU Halimeda borneensis Polinésia Francesa AM049955 FJ624514 AY786513 W.R. Taylor H. copiosa Goreau & Jamaica: Discovery EF667065 FJ624508 FJ624622 E.A. Graham Bay H. cryptica Colinvaux & Jamaica: St. Ann EF667057 FJ624496 - E.A.Graham Parish, Priory H. cuneata Hering Sri Lanka FJ624537 - FJ624577 H. cuneata Palm Beach, AY826353 - AY823840 KwaZulu Natal, South Africa H. cylindracea Decaisne Yémen AM049956 FJ624510 H. discoidea Decaisne Gran Canaria, AY826361 - AF407249 Canary Islands (Spain) H. discoidea New Caledonia JN644658 JN644734 - H. discoidea Oman: Hasik - - FJ624580 H. discoidea Brasil: Espírito Santo H. distorta (Yamada) French Polynesia: FJ624709 FJ624505 AY649374 Hillis-Colinvaux Rangiroa Atoll, Tiputa H. fragilis W.R. Taylor Guam: Bile Bay EF667058 FJ624498 - H. gigas W.R. Taylor Tanzania: Mtwara, FJ624539 - - Mtwara H. goreauii W.R. Taylor Panama: Galeta FJ624659 FJ624509 - Island H. gracilis Harvey ex J. French Polynesia: AM049965 FJ624492 AY786526/FJ624633 Agardh Rangiroa, Avatoru H. aff. gracilis Brazil KT781877 KT781865 H. heteromorpha New Caledonia JN644682 JN644742 - N'Yeurt H. hummii D.L. Panama: Portobelo, KT887745 FJ624522 - Ballantine Isla Mamey H. incrassata (J. Ellis) USA: Turks & Este estudo Este Este estudo J.V. Lamouroux Caicos estudo H. incrassata México: Quintana Este estudo Este Este estudo Roo estudo H. incrassata USA: Turks & Este estudo Este Este estudo Caicos estudo H. jolyana Ximenes, Brazil: Bahia KT781874 KT781864 - Bandeira-Pedrosa, Cassano, Oliveira- Carvalho, Verbruggen & S.M.B. Pereira 106

Tabela S4 – Sequências de Halimeda utilizadas nas análises filogenéticas

Marcadores Táxon Local tufA rbcL SSU-LSU H. jolyana Brazil: Espírito KT781872 Santo H. jolyana Brazil: Bahia KT781875 - - H. kanaloana Vroom New Caledonia JN644684 JN644743 - H. lacrimosa M. Howe Bahamas: Green FJ624730 FJ624495 - Turtle Cay H. lacunalis W.R. Australia: Western KT887747 FJ624521 - Taylor Australia, Scott Reef H. macroloba Decaisne Tanzania: Zanzibar, AM049960 FJ624513 AY786514 Nungwi H. macrophysa Philippines: Luzon, KT887749 FJ624526 - Askenasy Sorsogon, Bulusan, Dancalan H. magnidisca J.M. Australia: KT887751 - FJ624606 Noble Queensland, Heron Island H. melanesica Valet Philippines: SW AM049961 FJ624515 AY835496 Luzon, Dapdap H. micronesica Yamada Caroline Islands EF667059 - AY786517 Halimeda micronesica Wallis and Futuna: AM049964 FJ624499 AY786518/FJ624619 Wallis Island H. minima (W.R. Philippines: Luzon, FJ624687 FJ624502 FJ624625 Taylor) Hillis-Colinvaux Sorsogon, Bulusan, Dapdap H. monile (J. Ellis & México: Quintana Este estudo Este Este estudo Solander) J.V. Roo estudo Lamouroux H. monile Panama: Galeta AM049962 FJ624516 AY835498 H. opuntia (Linnaeus) México: Veracruz Este estudo Este Este estudo J.V. Lamouroux estudo H. opuntia Brazil KT781896 KY570459 Não disponível H. opuntia French Polynesia: AM049967 AY649380 Moorea, Cook Bay H. opuntia Venezuela: Cayo Este estudo Este Este estudo Muerto estudo H. pygmaea Fiji: North EF667062 FJ624497 FJ624618 Verbruggen, D.S. Littler Astrolabe Reef & Littler H. renschii Hauck Tanzania: Zanzibar, FJ624691 FJ624501 FJ624485/FJ624626 Mnemba Atoll H. ryukyuensis Kojima, Japan: Okinawa AB899321 AB924512 - Hanyuda & Kawai Island: Chatan H. scabra M. Howe México: Puerto Este estudo Este Este estudo Morelos estudo H. scabra Bahamas: Green FJ624540 - - Turtle Cay 107

Tabela S4 – Sequências de Halimeda utilizadas nas análises filogenéticas

Marcadores Táxon Local tufA rbcL SSU-LSU H. scabra México: Playa Este estudo Este Este estudo Paraiso estudo H. scabra Bahamas KT887752 - - H. simulans M. Howe Brazil KT781903 KT781868 Este estudo H. simulans USA: Turks & Este estudo Este Este estudo Caicos estudo H. simulans Isla de Culebra, AM049963 FJ624517 AY835511 Puerto Rico H. taenicola W.R. French Polynesia AM049966 FJ624529 AY786521 Taylor H. aff. tuna Brazil: Maranhão KT781883 KT781866 H. aff. tuna Brazil: Alagoas KT781880 KY570456 H. aff. tuna Brazil: Bahia KT781879 KY570457 H. tuna (J. Ellis & Jamaica KT887756 Solander) J.V. Lamour. H. tuna Italy: Naples AY826366 - FJ624616 H. velasquezii W.R. Philippines: Luzon, FJ624698 FJ624507 FJ624628 Taylor Sorsogon, Bulusan, Dapdap H. versatilis J. Agardh Australia: Western KT887721 Australia H. xishaensis C.K. Maldives: KT887757 - - Tseng & M.L. Dong Thiladhunmathi

108

CONSIDERAÇÕES FINAIS A presente tese foi proposta, no intuito de estudar as espécies de Halimeda ocorrentes no Oceano Atlântico, uma vez que a maioria dos estudos aborda representantes do Índo- Pacífico sob perspectivas morfológica e utilizando marcadores moleculares e até o começo dos anos 2000, o gênero foi estudado no Brasil e em outros países da América, apenas com dados morfológicos e citados em levantamentos florísticos. Baseado em dados pretéritos, o gênero possui 19 táxons infragenéricos ocorrentes na Costa Atlântica Oeste, dos quais apenas nove táxons foram acessados neste trabalho, com poucos locais de amostras, através da doação de pesquisadores internacionais (Flórida e Cuba). Destes nove, quatro espécies foram descobertas de serem crípticas, duas descritas como novas: Halimeda jolyana (Ximenes et al. 2017, capítulo 1) e H. soniae (Ximenes et al. in press, capítulo 2), e uma também será proposta como nova (i. e. H. americana, capítulo 3), permanecendo ainda outra espécie para ser descrita como nova para agregar o táxon previamente tratado como H. aff. discoidea no litoral brasileiro. Após esse estudo ter sido realizado, foi confirmado a hipótese que as espécies ocorrentes no Atlântico, não correspondem geneticamente com as do Indo-Pacífico, conforme já citado em outros trabalhos e que poucas espécies são verdadeiramente pantropicais (i. e. H. opuntia). Confirmando ainda que a diversidade do Atlântico tem distribuição limitada a esta costa, apresentando também espécies endêmicas, como H. jolyana e H. soniae. Em relação a utilização dos marcadores moleculares, os marcadores plastidiais como tufA e rbcL foram eficazes na delimitação das espécies, e de fácil obtenção das sequências. Seguindo as recomendações dadas de que os marcadores moleculares devem ser analisados concatenadamente, nos estudos de diversidade de macroalgas marinhas, nos utilizamos além destas sequências da região SSU-ITS-LSU, que juntos, foram suficientes na separação filogenéticas de espécies, como visto na Seção Halimeda. Além disso, há um grande volume de sequências disponíveis no banco de dados Genbank para estes três marcadores. Nesse trabalho, foi possível atingir os objetivos previamente propostos. Contudo, ainda há lacunas no conhecimento do gênero Halimeda no Oceano Atlântico, uma vez que não foi possível obter amostras de todas as espécies previamente citadas e que as árvores filogenéticas apontam para um número maior de táxons do que o atualmente reconhecido.

109

NORMAS DA REVISTA BOTÂNICA MARINA (QUALIS B1 – BIODIVERSIDADE)