Human GCSH Gene Cdna Clone Plasmid

Total Page：16

File Type：pdf, Size：1020Kb

Human GCSH Gene cDNA clone plasmid Catalog Number: HG14568-G General Information Plasmid Resuspension protocol Gene : glycine cleavage system protein H (aminomethyl carrier) 1.Centrifuge at 5,000×g for 5 min. 2.Carefully open the tube and add 100 l of sterile water to Official Symbol : GCSH dissolve the DNA. 3.Close the tube and incubate for 10 minutes at room temperature. Synonym : GCE, NKH 4.Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g. Source : Human 5.Store the plasmid at -20 ℃. cDNA Size: 522bp The plasmid is ready for: • Restriction enzyme digestion RefSeq : BC000790 • PCR amplification • E. coli transformation Plasmid: pGEM-GCSH • DNA sequencing Description E.coli strains for transformation (recommended Lot : Please refer to the label on the tube but not limited) Sequence Description : Most commercially available competent cells are appropriate for the plasmid, e.g. TOP10, DH5α and TOP10F´. Identical with the Gene Bank Ref. ID sequence. Vector : pGEM-T Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. Storage : The lyophilized plasmid can be stored at ambient temperature for three months. Quality control : The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. Sequencing primer list : M13-47 ： 5’ GCCAGGGTTTTCCCAGTCACGAC 3’ RV-M ： 5’ GAGCGGATAACAATTTCACACAGG 3’ Other M13 primers can also be used as sequencing primers. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com Human GCSH Gene cDNA clone plasmid Catalog Number: HG14568-G Vector Information The pGEM-T vector is a high-efficiency TA cloning vector which contains multiple cloning sites as shown below. The pGEM-T vector is 3.0kb in size and contains the amplicin resistance gene for selection. The coding sequence was inserted by TA cloning. Physical Map of pGEM-T : Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com.

Copy Link

Recommended publications

GCSH Rabbit Pab
Leader in Biomolecular Solutions for Life Science GCSH Rabbit pAb Catalog No.: A3880 Basic Information Background Catalog No. Degradation of glycine is brought about by the glycine cleavage system, which is A3880 composed of four mitochondrial protein components: P protein (a pyridoxal phosphate- dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein Observed MW (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The 28kDa protein encoded by this gene is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in this gene are a cause of nonketotic Calculated MW hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other 18kDa probably not protein-coding,have been found for this gene. Also, several transcribed and non-transcribed pseudogenes of this gene exist throughout the genome. Category Primary antibody Applications WB Cross-Reactivity Human Recommended Dilutions Immunogen Information WB 1:500 - 1:1000 Gene ID Swiss Prot 2653 P23434 Immunogen A synthetic peptide of human GCSH Synonyms GCSH;GCE;NKH Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at 4℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide, pH7.3. Validation Data Western blot analysis of extracts of T47D cells, using GCSH antibody (A3880). Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution. Lysates/proteins: 25ug per lane. Blocking buffer: 3% nonfat dry milk in TBST. Antibody | Protein | ELISA Kits | Enzyme | NGS | Service For research use only. Not for therapeutic or diagnostic purposes.
[Show full text]
Noelia Díaz Blanco
Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
[Show full text]
AMT Gene Aminomethyltransferase
AMT gene aminomethyltransferase Normal Function The AMT gene provides instructions for making an enzyme called aminomethyltransferase. This protein is one of four enzymes that work together in a group called the glycine cleavage system. Within cells, this system is active in specialized energy-producing centers called mitochondria. As its name suggests, the glycine cleavage system breaks down a molecule called glycine by cutting (cleaving) it into smaller pieces. Glycine is an amino acid, which is a building block of proteins. This molecule also acts as a neurotransmitter, which is a chemical messenger that transmits signals in the brain. The breakdown of excess glycine when it is no longer needed is necessary for the normal development and function of nerve cells in the brain. The breakdown of glycine by the glycine cleavage system produces a molecule called a methyl group. This molecule is added to and used by a vitamin called folate. Folate is required for many functions in the cell and is important for brain development. Health Conditions Related to Genetic Changes Nonketotic hyperglycinemia Mutations in the AMT gene account for about 20 percent of all cases of nonketotic hyperglycinemia. This condition is characterized by abnormally high levels of glycine in the body (hyperglycinemia). Affected individuals have serious neurological problems. The signs and symptoms of the condition vary in severity and can include severe breathing difficulties shortly after birth as well as weak muscle tone (hypotonia), seizures, and delayed development of milestones. More than 70 mutations have been identified in affected individuals. Most of these genetic changes alter single amino acids in aminomethyltransferase.
[Show full text]
Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
[Show full text]
The MER41 Family of Hervs Is Uniquely Involved in the Immune-Mediated Regulation of Cognition/Behavior-Related Genes
bioRxiv preprint doi: https://doi.org/10.1101/434209; this version posted October 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The MER41 family of HERVs is uniquely involved in the immune-mediated regulation of cognition/behavior-related genes: pathophysiological implications for autism spectrum disorders Serge Nataf*1, 2, 3, Juan Uriagereka4 and Antonio Benitez-Burraco 5 1CarMeN Laboratory, INSERM U1060, INRA U1397, INSA de Lyon, Lyon-Sud Faculty of Medicine, University of Lyon, Pierre-Bénite, France. 2 University of Lyon 1, Lyon, France. 3Banque de Tissus et de Cellules des Hospices Civils de Lyon, Hôpital Edouard Herriot, Lyon, France. 4Department of Linguistics and School of Languages, Literatures & Cultures, University of Maryland, College Park, USA. 5Department of Spanish, Linguistics, and Theory of Literature (Linguistics). Faculty of Philology. University of Seville, Seville, Spain * Corresponding author: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/434209; this version posted October 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. ABSTRACT Interferon-gamma (IFNa prototypical T lymphocyte-derived pro-inflammatory cytokine, was recently shown to shape social behavior and neuronal connectivity in rodents. STAT1 (Signal Transducer And Activator Of Transcription 1) is a transcription factor (TF) crucially involved in the IFN pathway.
[Show full text]
Model Mice for Mild-Form Glycine Encephalopathy: Behavioral And
0031-3998/08/6403-0228 Vol. 64, No. 3, 2008 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2008 International Pediatric Research Foundation, Inc. ARTICLES Model Mice for Mild-Form Glycine Encephalopathy: Behavioral and Biochemical Characterizations and Efficacy of Antagonists for the Glycine Binding Site of N-Methyl D-Aspartate Receptor KANAKO KOJIMA-ISHII, SHIGEO KURE, AKIKO ICHINOHE, TOSHIKATSU SHINKA, AYUMI NARISAWA, SHOKO KOMATSUZAKI, JUNNKO KANNO, FUMIAKI KAMADA, YOKO AOKI, HIROYUKI YOKOYAMA, MASAYA ODA, TAKU SUGAWARA, KAZUO MIZOI, DAIICHIRO NAKAHARA, AND YOICHI MATSUBARA Department of Medical Genetics [K.K.-I., S.K., A.I., T.S., A.N., S.K., J.K., F.K., Y.A., Y.M.], Department of Pediatrics [H.Y.], Tohoku University School of Medicine, Miyagi, 980-8574, Japan; Department of Neurosurgery [M.O., T.S., K.M.], Akita University School of Medicine, Akita, 010-8502, Japan; Department of Psychology [D.N.], Hamamatsu University School of Medicine, Shizuoka, 431-3192, Japan ABSTRACT: Glycine encephalopathy (GE) is caused by an inher- genase, which are encoded by GLDC, AMT, GCSH and GCSL, ited deficiency of the glycine cleavage system (GCS) and character- respectively (2). A defect of any component can lead to ized by accumulation of glycine in body fluids and various neuro- defective overall activity of the GCS. GLDC, AMT and GCSH logic symptoms. Coma and convulsions develop in neonates in mutations have been reported in GE patients (3,4). Patients typical GE while psychomotor retardation and behavioral abnormal- with typical GE have severe symptoms such as convulsions, ities in infancy and childhood are observed in mild GE.
[Show full text]
Glycine Encephalopathy, AMT-Related
Glycine encephalopathy What is glycine encephalopathy? Glycine encephalopathy is an inherited metabolic disease that, in its typical form, is characterized by seizures in infancy and other progressive nervous system problems. Individuals with glycine encephalopathy have an abnormally low level of an enzyme that helps to breaks down the amino acid glycine. Symptoms are due to a toxic build-up of glycine, especially in the brain.1 Glycine encephalopathy is also known as non-ketotic hyperglycinemia.2 What are the symptoms of glycine encephalopathy and what treatment is available? Glycine encephalopathy is a disease that varies in severity and age at presentation. The majority of individuals with glycine encephalopathy show symptoms within the first few days of life, and a subset of individuals with early onset may also have birth defects (such as cleft lip/palate or club feet). Some individuals may show less severe symptoms later in infancy or childhood.1,2 Symptoms may include:1,2 • Seizures that may not respond to treatment • Lethargy • Hypotonia (low muscle tone) • Difficulty breathing • Hiccupping • Feeding difficulties • Intellectual disability and possible behavior problems • Coma and possible death There is no cure for glycine encephalopathy. Treatment includes supportive care for symptoms including medicine to help reduce levels of glycine in the blood and control seizures. A ketogenic diet, feeding and respiratory support, and physical therapy may improve symptoms in some individuals.2 Without intervention, individuals with severe glycine encephalopathy often do not survive past infancy.1 Glycine encephalopathy is included on newborn screening profiles in some states in the US.3 How is glycine encephalopathy inherited? Glycine encephalopathy is an autosomal recessive disease caused by mutations in one of three different genes.
[Show full text]
Glycine Decarboxylase Deficiency–Induced Motor Dysfunction in Zebrafish Is Rescued by Counterbalancing Glycine Synaptic Level
Glycine decarboxylase deficiency–induced motor dysfunction in zebrafish is rescued by counterbalancing glycine synaptic level Raphaëlle Riché, … , Pierre Drapeau, Éric Samarut JCI Insight. 2018;3(21):e124642. https://doi.org/10.1172/jci.insight.124642. Research Article Genetics Neuroscience Graphical abstract Find the latest version: https://jci.me/124642/pdf RESEARCH ARTICLE Glycine decarboxylase deficiency–induced motor dysfunction in zebrafish is rescued by counterbalancing glycine synaptic level Raphaëlle Riché,1 Meijiang Liao,1 Izabella A. Pena,2 Kit-Yi Leung,3 Nathalie Lepage,2 Nicolas D.E. Greene,3 Kyriakie Sarafoglou,4 Lisa A. Schimmenti,5,6,7 Pierre Drapeau,1,8 and Éric Samarut1,8 1Research Center of the University of Montreal Hospital Center (CRCHUM), Department of Neurosciences, Université de Montréal, Montreal, Quebec, Canada. 2Children’s Hospital of Eastern Ontario Research Institute and Department of Pediatrics, Faculty of Medicine, University of Ottawa, Ontario, Canada. 3Developmental Biology and Cancer Programme, UCL Great Ormond Street Institute of Child Health, University College London, London, United Kingdom. 4Division of Pediatric Endocrinology, Department of Pediatrics, University of Minnesota, Minneapolis, Minnesota, USA. 5Department of Otorhinolaryngology, 6Department of Pediatrics, and 7Department of Clinical Genomics, Mayo Clinic College of Medicine, Rochester, Minnesota, USA. 8DanioDesign Inc., Montréal, Quebec, Canada. Glycine encephalopathy (GE), or nonketotic hyperglycinemia (NKH), is a rare recessive genetic disease caused by defective glycine cleavage and characterized by increased accumulation of glycine in all tissues. Here, based on new case reports of GLDC loss-of-function mutations in GE patients, we aimed to generate a zebrafish model of severe GE in order to unravel the molecular mechanism of the disease.
[Show full text]
A Novel Intronic Homozygous Mutation in the AMT Gene of a Patient with Nonketotic Hyperglycinemia and Hyperammonemia
Metabolic Brain Disease (2019) 34:373–376 https://doi.org/10.1007/s11011-018-0317-0 SHORT COMMUNICATION A novel intronic homozygous mutation in the AMT gene of a patient with nonketotic hyperglycinemia and hyperammonemia Sarah Silverstein1 & Aravindhan Veerapandiyan2 & Caroline Hayes-Rosen1 & Xue Ming1 & Jeffrey Kornitzer1 Received: 26 June 2018 /Accepted: 12 September 2018 /Published online: 22 October 2018 # Springer Science+Business Media, LLC, part of Springer Nature 2018 Abstract Nonketotic Hyperglycinemia is an autosomal recessive disorder characterized by defects in the mitochondrial glycine cleavage system. Most patients present soon after birth with seizures and hypotonia, and infants that survive the newborn period often have profound intellectual disability and intractable seizures. Here we present a case report of a 4-year-old girl with NKH as well as hyperammonemia, an uncommon finding in NKH. Genetic analysis found a previously unreported homozygous mutation (c.878–1 G > A) in the AMT gene. Maximum Entropy Principle modeling predicted that this mutation most likely breaks the splice site at the border of intron 7 and exon 8 of the AMT gene. Treatment with L-Arginine significantly reduced both the proband’s glycine and ammonia levels, in turn aiding in control of seizures and mental status. This is the first time the use of L- Arginine is reported to successfully treat elevated glycine levels. Keywords Glycine encephalopathy . Genetics . Hyperammonemia . L-arginine . Maximum entropy principle modeling Introduction removal of carbon dioxide from glycine and attaches the re- mainder of the glycine molecule to the H subunit. The T sub- Nonketotic hyperglycinemia (NKH) is an autosomal recessive unit, amino methyltransferase (AMT), catalyzes the produc- disorder characterized by defects in the mitochondrial glycine tion of N5, N10-methylene-H4folate and ammonia in the cleavage system (GCS).
[Show full text]
Molecular Cytogenetic Characterization of Partial Monosomy 2P and Trisomy 16Q in a Newborn: a Case Report
EXPERIMENTAL AND THERAPEUTIC MEDICINE 18: 1267-1275, 2019 Molecular cytogenetic characterization of partial monosomy 2p and trisomy 16q in a newborn: A case report FAGUI YUE1,2, YUTING JIANG1,2, YUAN PAN1,2, LEILEI LI1,2, LINLIN LI1,2, RUIZHI LIU1,2 and RUIXUE WANG1,2 1Center for Reproductive Medicine and Center for Prenatal Diagnosis, The First Hospital; 2Jilin Engineering Research Center for Reproductive Medicine and Genetics, Jilin University, Changchun, Jilin 130021, P.R. China Received August 12, 2018; Accepted May 16, 2019 DOI: 10.3892/etm.2019.7695 Abstract. Trisomy 16q is a rare disorder with severe abnor- Introduction malities, which always leads to early postnatal mortality. It usually results from a parental translocation, exhibiting 16q Trisomy 16 is recognized as the most common type of trisomy duplication associated with another chromosomal deletion. in first‑trimester spontaneous abortions, occurring in 1% of The present study reports on the clinical presentation and all clinically recognized pregnancies, while being rarer in the molecular cytogenetic results of a small-for-gestational-age second and third�� trimesters�� (1-3). Early lethality and incompat- infant, consisting of partial trisomy 16q21→qter and mono- ibility with life have been described as its major outcomes (1). somy 2p25.3→pter. The proband presented with moderately Trisomy 16 may be classified into three major types: Full low birthweight, small anterior fontanelles, prominent trisomy, mosaics and partial trisomy of 16p or 16q. Since forehead, low hairline, telecanthus, flat nasal bridge, choanal Schmickel (��)�� re�orted the fifirst rst case of ��16q�� trisomy as identi- atresia, clinodactyly of the fifth fingers, urogenital anomalies, fied using a chromosome banding techni�ue in �975, >30 cases congenital muscular torticollis and congenital laryngoma- of partial trisomy 16q have been described.
[Show full text]
Downregulation of SNRPG Induces Cell Cycle Arrest and Sensitizes Human Glioblastoma Cells to Temozolomide by Targeting Myc Through a P53-Dependent Signaling Pathway
Cancer Biol Med 2020. doi: 10.20892/j.issn.2095-3941.2019.0164 ORIGINAL ARTICLE Downregulation of SNRPG induces cell cycle arrest and sensitizes human glioblastoma cells to temozolomide by targeting Myc through a p53-dependent signaling pathway Yulong Lan1,2*, Jiacheng Lou2*, Jiliang Hu1, Zhikuan Yu1, Wen Lyu1, Bo Zhang1,2 1Department of Neurosurgery, Shenzhen People’s Hospital, Second Clinical Medical College of Jinan University, The First Affiliated Hospital of Southern University of Science and Technology, Shenzhen 518020, China;2 Department of Neurosurgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116023, China ABSTRACT Objective: Temozolomide (TMZ) is commonly used for glioblastoma multiforme (GBM) chemotherapy. However, drug resistance limits its therapeutic effect in GBM treatment. RNA-binding proteins (RBPs) have vital roles in posttranscriptional events. While disturbance of RBP-RNA network activity is potentially associated with cancer development, the precise mechanisms are not fully known. The SNRPG gene, encoding small nuclear ribonucleoprotein polypeptide G, was recently found to be related to cancer incidence, but its exact function has yet to be elucidated. Methods: SNRPG knockdown was achieved via short hairpin RNAs. Gene expression profiling and Western blot analyses were used to identify potential glioma cell growth signaling pathways affected by SNRPG. Xenograft tumors were examined to determine the carcinogenic effects of SNRPG on glioma tissues. Results: The SNRPG-mediated inhibitory effect on glioma cells might be due to the targeted prevention of Myc and p53. In addition, the effects of SNRPG loss on p53 levels and cell cycle progression were found to be Myc-dependent. Furthermore, SNRPG was increased in TMZ-resistant GBM cells, and downregulation of SNRPG potentially sensitized resistant cells to TMZ, suggesting that SNRPG deficiency decreases the chemoresistance of GBM cells to TMZ via the p53 signaling pathway.
[Show full text]
Mouse Gcsh Conditional Knockout Project (CRISPR/Cas9)
https://www.alphaknockout.com Mouse Gcsh Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Gcsh conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Gcsh gene (NCBI Reference Sequence: NM_026572 ; Ensembl: ENSMUSG00000034424 ) is located on Mouse chromosome 8. 5 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 5 (Transcript: ENSMUST00000040484). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Gcsh gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-254F5 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 27.45% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 4084 bp, and the size of intron 2 for 3'-loxP site insertion: 1747 bp. The size of effective cKO region: ~580 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 3 5 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Gcsh Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
[Show full text]