DOCSLIB.ORG

BBA - Bioenergetics 1860 (2019) 708–716

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
BBA - Bioenergetics 1860 (2019) 708–716 BBA - Bioenergetics 1860 (2019) 708–716 Contents lists available at ScienceDirect BBA - Bioenergetics journal homepage: www.elsevier.com/locate/bbabio Tryptophan 224 of the rat mitochondrial carnitine/acylcarnitine carrier is T crucial for the antiport mechanism Nicola Giangregorioa,1, Annamaria Tonazzia,1, Lara Consoleb, Mariella Pistilloc, Vito Scalerac, ⁎ Cesare Indiverib, a CNR Institute of Biomembranes, Bioenergetics and Molecular Biotechnology, via Amendola 165/A, 70126 Bari, Italy b Department DiBEST (Biologia, Ecologia, Scienze della Terra) Unit of Biochemistry and Molecular Biotechnology, University of Calabria, Via P. Bucci 4C, 87036 Arcavacata di Rende, Italy c Department of Biosciences, Biotechnology and Biopharmaceutics, University of Bari, via Orabona 4, 70126 Bari, Italy ARTICLE INFO ABSTRACT Keywords: The mitochondrial carnitine/acylcarnitine carrier (CACT) catalyzes an antiport of carnitine and acylcarnitines Carnitine and also a uniport reaction with a rate of about one tenth with respect to the antiport rate. The antiport process Mitochondria results from the coupling of the two uniport reactions in opposite directions. In this mechanism, the transition of Membrane transport the carrier from the outward open conformation to the inward open one (or vice versa) is much faster for the Site-directed mutagenesis carrier-substrate complex than for the unbound carrier. To investigate the molecular determinants that couple the binding of the substrate with the conformational transitions, site directed mutagenesis has been employed. The antiport or the uniport reaction was followed as [3H]carnitine uptake in or efflux from proteoliposomes reconstituted with the WT or Trp mutants of the rat CACT. Substitution of each the three Trp residues led to different results. Nearly no variations were observed upon substitution of W192 and/or W296 with Ala.While, substantial alteration of the transport function was observed in the mutants W224A, W224Y and W224F. Mutation of W224 led to the loss of the antiport function while the uniport function was unaltered. In these mutants impairment of the substrate affinity on the external side was also observed. The data highlights that W224 is involved in the coupling of the substrate binding with the matrix gate opening. The experimental data are in line with predictions by homology modeling of the CACT in its cytosolic (c-state) or matrix (m-state) opened conformations. 1. Introduction facing the matrix, connect the transmembrane segments within each couple. The substrate-binding sites are located in the central cavity at The mitochondrial carriers, belonging to the SLC25 family, share about mid of the membrane [3–8]. The recent structure of the ANC peculiar structural features and molecular mechanisms [1] which have from T. thermophila in complex with the bongkrekic acid (PDB code been firstly revealed by the 3D structure of the Adenine nucleotide- 6GCI), in the matrix-opened conformation (m-state), added important carrier (ANC) in a conformation opened towards the cytosol (c-state) information on the molecular mechanism of the transport reaction [2]. The structures of the other members of the SLC25 family have been catalyzed by mitochondrial carriers. The SLC25 mitochondrial carrier predicted by homology modeling, using the ANC 3D coordinates as the family counts many members each specific for few substrates. These template (PDB code 1OKC). A bundle of six α-helix transmembrane transporters catalyze the exchange of many metabolites from the cy- segments, enclosing a water-filled cavity, characterizes the carrier tosol to the mitochondrial matrix and vice-versa allowing completion of protein structures. Repetitions of two adjacent transmembrane seg- metabolic pathways which are characterized by the localization of en- ments show internal similarity highlighting a tripartite structure. Short zymes into both compartments. To perform this task most mitochon- hydrophilic loops with random coiled structure, facing the inter- drial carriers catalyze antiport reactions. In this transport mode, the membrane space, connect the hydrophobic transmembrane segment transport of one substrate from the cytosol to the matrix requires the repetitions while, larger hydrophilic loops with a α-helical structure, counter-transport of another substrate in the opposite direction. Two ⁎ Corresponding author. E-mail address: [email protected] (C. Indiveri). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.bbabio.2019.07.006 Received 31 March 2019; Received in revised form 6 July 2019; Accepted 18 July 2019 Available online 21 July 2019 0005-2728/ © 2019 Elsevier B.V. All rights reserved. N. Giangregorio, et al. BBA - Bioenergetics 1860 (2019) 708–716 networks of six amino acid residues present at the bottom (close to the previously described [26] was amplified using the forward primer ta- matrix) and at the top of the transporters (close to the intermembrane tatcatatgtccgccgccgaatcgccc and the reverse primer gaacggatccttagtc- space) play a crucial role in the molecular mechanism of the antiport. gaaaagcttgttcatga, containing the Nde I and BamHI restriction sites, The subsequent opening and closing of these networks together with respectively, for cloning into the pMW7 vector. The purified cDNA was the simultaneous rotation of the three intermembrane domains, allows cloned in pMW7 for transforming E. coli C0214 and over-expressing the substrates to enter the carrier from one side and to be translocated protein. Isolation, solubilization and purification of the wild-type AcuH towards the opposite side. The occurrence of this process in the two were performed as described above for the rat CACT [23,25]. To in- opposite directions realizes the alternating access mechanism, which is troduce specific mutations in the AcuH proteins the same procedure at the basis of the antiport function. Antiport is favored with respect to used for the rat CACT was used [23,24]. uniport, since the gate opening is much faster for the carrier-substrate complex than for the empty carrier [9]. Several information on the 2.3. Reconstitution of wild-type (WT) and mutant proteins in liposomes structure/function relationships has been obtained by site-directed mutagenesis [1,4,9–15]. However, the molecular determinants re- The recombinant proteins (60 μg protein) were reconstituted into sponsible for coupling substrate binding with gate opening that favors liposomes as described previously [7,23,25]. The concentration of in- the antiport, are still unknown. Some information derives from studies traliposomal carnitine was 15 mM except when differently specified in on the carnitine/acylcarnitine carrier (CACT) that has the peculiarity, the legends to figures. The orientation of the reconstituted protein was among mitochondrial carrier, of catalyzing a measurable uniport re- the same as in the native membrane as previously described [16]. action that occurs at a lower rate with respect to the antiport reaction. This special feature could allow discriminating the molecular de- 2.4. Transport measurements terminants crucial for the sole antiport reaction from those important for the overall mechanism of catalysis. Previous data highlighted that In order to remove the external substrate for antiport or uniport an amino acid residue belonging to the matrix network, namely K35, is assay, 550 μ1 proteoliposomes obtained as in Section 2.3, were passed involved in the antiport mechanism [16]. Trp residues have been shown through a Sephadex G-75 column (0.7 cm × 15 cm), equilibrated with in bacterial antiporters, as well as in some human orthologues, to play 10 mM PIPES pH 7.0 and 90 mM NaCl. The eluted proteoliposomes important roles in transport mechanism both in gating and in substrate (600 μl), distributed in reaction vessels (100 μl), were used for transport recognition [17–21]. Thus, we have now investigated the role of a Trp measurements using the inhibitor-stop method [27]. Transport was residue, which is conserved in the CACT sub-family and is rarely pre- performed at 25 °C, started by adding 0.1 mM [3H]carnitine (except sent in other mitochondrial carriers. Some crucial experiments have that in kinetic experiments in which different [3H]carnitine con- also been performed on the A. nidulans CACT which, differently from centrations were used) to proteoliposomes and terminated by the ad- the rat transporter, contains the sole conserved Trp residue. dition of 1.5 mM NEM (N-ethylmaleimide), a specific inhibitor of CACT. In control samples, the inhibitor was added together with the radi- 2. Materials and methods olabeled substrate at time zero. After stopping the transport reaction, the radioactivity not taken up by the proteoliposomes was removed by 2.1. Materials passing 100 μl of each sample through a Sephadex G-75 column (0.6 cm × 8 cm). The proteoliposomes were eluted with 1.2 ml 50 mM Sephadex G-75 was purchased from Pharmacia, egg-yolk phospho- NaC1 and collected in 4 ml scintillation mixture, vortexed and counted. lipids (l-α-phosphatidylcholine from fresh turkey egg yolk) and The experimental values were corrected by subtracting control values. Amberlite XAD-4 from Fluka, PIPES, Triton X-100, cardiolipin, N-do- For kinetic experiments, initial transport rate was derived from the decanoylsarcosine (sarcosyl), Koshland's reagent (KR) from Sigma, St. initial linear part of the time course of the isotope equilibration ki- Louis, MO, L-[methyl-3H]carnitine was from Amersham. All reagents netics. For
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Genome-Wide Analysis of Thyroid Hormone Receptors Shared and Specific Functions in Neural Cells
    Genome-wide analysis of thyroid hormone receptors shared and specific functions in neural cells Fabrice Chatonneta, Romain Guyota, Gérard Benoîtb, and Frederic Flamanta,1 aInstitut de Génomique Fonctionnelle de Lyon, Université de Lyon, Centre National de la Recherche Scientifique (CNRS), Institut National de la Recherche Agronomique, École Normale Supérieure de Lyon, 69364 Lyon Cedex 07, France; and bCentre de Génétique et de Physiologie Moléculaire et Cellulaire, CNRS, Université Lyon 1, Unité Mixte de Recherche 5334, Villeurbanne F-69622, France Edited by Pierre Chambon, Institut de Génétique et de Biologie Moléculaire et Cellulaire (Centre National de la Recherche Scientifique UMR7104, Institut National de la Santé et de la Recherche Médicale U596, Université de Strasbourg, College de France), Illkirch-Cedex, France, and approved January 4, 2013 (received for review June 25, 2012) TRα1 and TRβ1, the two main thyroid hormone receptors in mam- issue. It would help to develop new selective ligands (6). It might mals, are transcription factors that share similar properties. How- also help to predict the possible detrimental side effects of these ever, their respective functions are very different. This functional synthetic ligands in heart and brain (7) and the toxicity of some divergence might be explained in two ways: it can reflect different environmental contaminants supposed to interfere with TR expression patterns or result from different intrinsic properties of functions (8). The primary sequence and 3D structure of TRα1 β the receptors. We tested this second hypothesis by comparing the and TR 1 are very similar, although differences are observed for – repertoires of 3,3′,5-triiodo-L-thyronine (T3)-responsive genes of key amino acids in the DNA-binding domain (9 12).
    [Show full text]
  • Epistasis-Driven Identification of SLC25A51 As a Regulator of Human
    ARTICLE https://doi.org/10.1038/s41467-020-19871-x OPEN Epistasis-driven identification of SLC25A51 as a regulator of human mitochondrial NAD import Enrico Girardi 1, Gennaro Agrimi 2, Ulrich Goldmann 1, Giuseppe Fiume1, Sabrina Lindinger1, Vitaly Sedlyarov1, Ismet Srndic1, Bettina Gürtl1, Benedikt Agerer 1, Felix Kartnig1, Pasquale Scarcia 2, Maria Antonietta Di Noia2, Eva Liñeiro1, Manuele Rebsamen1, Tabea Wiedmer 1, Andreas Bergthaler1, ✉ Luigi Palmieri2,3 & Giulio Superti-Furga 1,4 1234567890():,; About a thousand genes in the human genome encode for membrane transporters. Among these, several solute carrier proteins (SLCs), representing the largest group of transporters, are still orphan and lack functional characterization. We reasoned that assessing genetic interactions among SLCs may be an efficient way to obtain functional information allowing their deorphanization. Here we describe a network of strong genetic interactions indicating a contribution to mitochondrial respiration and redox metabolism for SLC25A51/MCART1, an uncharacterized member of the SLC25 family of transporters. Through a combination of metabolomics, genomics and genetics approaches, we demonstrate a role for SLC25A51 as enabler of mitochondrial import of NAD, showcasing the potential of genetic interaction- driven functional gene deorphanization. 1 CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria. 2 Laboratory of Biochemistry and Molecular Biology, Department of Biosciences, Biotechnologies and Biopharmaceutics,
    [Show full text]
  • Pflugers Final
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Serveur académique lausannois A comprehensive analysis of gene expression profiles in distal parts of the mouse renal tubule. Sylvain Pradervand2, Annie Mercier Zuber1, Gabriel Centeno1, Olivier Bonny1,3,4 and Dmitri Firsov1,4 1 - Department of Pharmacology and Toxicology, University of Lausanne, 1005 Lausanne, Switzerland 2 - DNA Array Facility, University of Lausanne, 1015 Lausanne, Switzerland 3 - Service of Nephrology, Lausanne University Hospital, 1005 Lausanne, Switzerland 4 – these two authors have equally contributed to the study to whom correspondence should be addressed: Dmitri FIRSOV Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925406 Fax: ++ 41-216925355 e-mail: [email protected] and Olivier BONNY Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925417 Fax: ++ 41-216925355 e-mail: [email protected] 1 Abstract The distal parts of the renal tubule play a critical role in maintaining homeostasis of extracellular fluids. In this review, we present an in-depth analysis of microarray-based gene expression profiles available for microdissected mouse distal nephron segments, i.e., the distal convoluted tubule (DCT) and the connecting tubule (CNT), and for the cortical portion of the collecting duct (CCD) (Zuber et al., 2009). Classification of expressed transcripts in 14 major functional gene categories demonstrated that all principal proteins involved in maintaining of salt and water balance are represented by highly abundant transcripts. However, a significant number of transcripts belonging, for instance, to categories of G protein-coupled receptors (GPCR) or serine-threonine kinases exhibit high expression levels but remain unassigned to a specific renal function.
    [Show full text]
  • Frontiersin.Org 1 April 2015 | Volume 9 | Article 123 Saunders Et Al
    ORIGINAL RESEARCH published: 28 April 2015 doi: 10.3389/fnins.2015.00123 Influx mechanisms in the embryonic and adult rat choroid plexus: a transcriptome study Norman R. Saunders 1*, Katarzyna M. Dziegielewska 1, Kjeld Møllgård 2, Mark D. Habgood 1, Matthew J. Wakefield 3, Helen Lindsay 4, Nathalie Stratzielle 5, Jean-Francois Ghersi-Egea 5 and Shane A. Liddelow 1, 6 1 Department of Pharmacology and Therapeutics, University of Melbourne, Parkville, VIC, Australia, 2 Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen, Denmark, 3 Walter and Eliza Hall Institute of Medical Research, Parkville, VIC, Australia, 4 Institute of Molecular Life Sciences, University of Zurich, Zurich, Switzerland, 5 Lyon Neuroscience Research Center, INSERM U1028, Centre National de la Recherche Scientifique UMR5292, Université Lyon 1, Lyon, France, 6 Department of Neurobiology, Stanford University, Stanford, CA, USA The transcriptome of embryonic and adult rat lateral ventricular choroid plexus, using a combination of RNA-Sequencing and microarray data, was analyzed by functional groups of influx transporters, particularly solute carrier (SLC) transporters. RNA-Seq Edited by: Joana A. Palha, was performed at embryonic day (E) 15 and adult with additional data obtained at University of Minho, Portugal intermediate ages from microarray analysis. The largest represented functional group Reviewed by: in the embryo was amino acid transporters (twelve) with expression levels 2–98 times Fernanda Marques, University of Minho, Portugal greater than in the adult. In contrast, in the adult only six amino acid transporters Hanspeter Herzel, were up-regulated compared to the embryo and at more modest enrichment levels Humboldt University, Germany (<5-fold enrichment above E15).
    [Show full text]
  • Antagonistic Epistasis of Hnf4α and Foxo1 Networks Through Enhancer Interactions
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.04.187864; this version posted July 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Kuo et al, Hnf4a and FoxO1 in b-cell function Antagonistic epistasis of Hnf4α and FoxO1 networks through enhancer interactions in β-cell function Taiyi Kuo1,3,*, Wen Du1, Yasutaka Miyachi1, Prasanna K. Dadi2, David A. Jacobson2, Domenico Accili1 1Department of Medicine and Berrie Diabetes Center, Columbia University College of Physicians and Surgeons, New York, NY 2Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 3Lead Contact *Correspondence: Taiyi Kuo, Department of Medicine and Berrie Diabetes Center, Columbia University College of Physicians and Surgeons, 1150 St. Nicholas Avenue, Room 237, New York, New York 10032, USA. Phone: 1-212-851-5333. Email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.04.187864; this version posted July 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Kuo et al, Hnf4a and FoxO1 in b-cell function Abstract Genetic and acquired abnormalities contribute to pancreatic β-cell failure in diabetes. Transcription factors Hnf4α (MODY1) and FoxO1 are respective examples of these two components, and are known to act through β-cell-specific enhancers.
    [Show full text]
  • Kidney V-Atpase-Rich Cell Proteome Database
    A comprehensive list of the proteins that are expressed in V-ATPase-rich cells harvested from the kidneys based on the isolation by enzymatic digestion and fluorescence-activated cell sorting (FACS) from transgenic B1-EGFP mice, which express EGFP under the control of the promoter of the V-ATPase-B1 subunit. In these mice, type A and B intercalated cells and connecting segment principal cells of the kidney express EGFP. The protein identification was performed by LC-MS/MS using an LTQ tandem mass spectrometer (Thermo Fisher Scientific). For questions or comments please contact Sylvie Breton ([email protected]) or Mark A. Knepper ([email protected]).
    [Show full text]
  • Discerning the Role of Foxa1 in Mammary Gland
    DISCERNING THE ROLE OF FOXA1 IN MAMMARY GLAND DEVELOPMENT AND BREAST CANCER by GINA MARIE BERNARDO Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Adviser: Dr. Ruth A. Keri Department of Pharmacology CASE WESTERN RESERVE UNIVERSITY January, 2012 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Gina M. Bernardo ______________________________________________________ Ph.D. candidate for the ________________________________degree *. Monica Montano, Ph.D. (signed)_______________________________________________ (chair of the committee) Richard Hanson, Ph.D. ________________________________________________ Mark Jackson, Ph.D. ________________________________________________ Noa Noy, Ph.D. ________________________________________________ Ruth Keri, Ph.D. ________________________________________________ ________________________________________________ July 29, 2011 (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. DEDICATION To my parents, I will forever be indebted. iii TABLE OF CONTENTS Signature Page ii Dedication iii Table of Contents iv List of Tables vii List of Figures ix Acknowledgements xi List of Abbreviations xiii Abstract 1 Chapter 1 Introduction 3 1.1 The FOXA family of transcription factors 3 1.2 The nuclear receptor superfamily 6 1.2.1 The androgen receptor 1.2.2 The estrogen receptor 1.3 FOXA1 in development 13 1.3.1 Pancreas and Kidney
    [Show full text]
  • RNA-Seq Reveals Conservation of Function Among the Yolk Sacs Of
    RNA-seq reveals conservation of function among the PNAS PLUS yolk sacs of human, mouse, and chicken Tereza Cindrova-Daviesa, Eric Jauniauxb, Michael G. Elliota,c, Sungsam Gongd,e, Graham J. Burtona,1, and D. Stephen Charnock-Jonesa,d,e,1,2 aCentre for Trophoblast Research, Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, CB2 3EG, United Kingdom; bElizabeth Garret Anderson Institute for Women’s Health, Faculty of Population Health Sciences, University College London, London, WC1E 6BT, United Kingdom; cSt. John’s College, University of Cambridge, Cambridge, CB2 1TP, United Kingdom; dDepartment of Obstetrics and Gynaecology, University of Cambridge, Cambridge, CB2 0SW, United Kingdom; and eNational Institute for Health Research, Cambridge Comprehensive Biomedical Research Centre, Cambridge, CB2 0QQ, United Kingdom Edited by R. Michael Roberts, University of Missouri-Columbia, Columbia, MO, and approved May 5, 2017 (received for review February 14, 2017) The yolk sac is phylogenetically the oldest of the extraembryonic yolk sac plays a critical role during organogenesis (3–5, 8–10), membranes. The human embryo retains a yolk sac, which goes there are limited data to support this claim. Obtaining experi- through primary and secondary phases of development, but its mental data for the human is impossible for ethical reasons, and importance is controversial. Although it is known to synthesize thus we adopted an alternative strategy. Here, we report RNA proteins, its transport functions are widely considered vestigial. sequencing (RNA-seq) data derived from human and murine yolk Here, we report RNA-sequencing (RNA-seq) data for the human sacs and compare them with published data from the yolk sac of and murine yolk sacs and compare those data with data for the the chicken.
    [Show full text]
  • The Pdx1 Bound Swi/Snf Chromatin Remodeling Complex Regulates Pancreatic Progenitor Cell Proliferation and Mature Islet Β Cell
    Page 1 of 125 Diabetes The Pdx1 bound Swi/Snf chromatin remodeling complex regulates pancreatic progenitor cell proliferation and mature islet β cell function Jason M. Spaeth1,2, Jin-Hua Liu1, Daniel Peters3, Min Guo1, Anna B. Osipovich1, Fardin Mohammadi3, Nilotpal Roy4, Anil Bhushan4, Mark A. Magnuson1, Matthias Hebrok4, Christopher V. E. Wright3, Roland Stein1,5 1 Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2 Present address: Department of Pediatrics, Indiana University School of Medicine, Indianapolis, IN 3 Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 4 Diabetes Center, Department of Medicine, UCSF, San Francisco, California 5 Corresponding author: [email protected]; (615)322-7026 1 Diabetes Publish Ahead of Print, published online June 14, 2019 Diabetes Page 2 of 125 Abstract Transcription factors positively and/or negatively impact gene expression by recruiting coregulatory factors, which interact through protein-protein binding. Here we demonstrate that mouse pancreas size and islet β cell function are controlled by the ATP-dependent Swi/Snf chromatin remodeling coregulatory complex that physically associates with Pdx1, a diabetes- linked transcription factor essential to pancreatic morphogenesis and adult islet-cell function and maintenance. Early embryonic deletion of just the Swi/Snf Brg1 ATPase subunit reduced multipotent pancreatic progenitor cell proliferation and resulted in pancreas hypoplasia. In contrast, removal of both Swi/Snf ATPase subunits, Brg1 and Brm, was necessary to compromise adult islet β cell activity, which included whole animal glucose intolerance, hyperglycemia and impaired insulin secretion. Notably, lineage-tracing analysis revealed Swi/Snf-deficient β cells lost the ability to produce the mRNAs for insulin and other key metabolic genes without effecting the expression of many essential islet-enriched transcription factors.
    [Show full text]