© 2015 Nature America, Inc. All rights reserved. across the lifespan. maintained are brain the in changes induced hormonally opmental, devel these how unknown been has it but adulthood, until endure and in birth few days the first following changes are these established NATURE NATURE Received 14 August 2014; accepted 4 March 2015; published online 30 March 2015; Department, Mt. Sinai School of Medicine, New York, New York, USA. Correspondence should be addressed to B.M.N. ( of Medicine, Baltimore, Maryland, USA. 1 neurons POA on density spine dendritic increased by cated twofoldputativeincreaseatriggersin excitatory indisynapses, as and stellation astrocyte increases number, cell and volume regional in changes large induces androgens testicular POA from the in tized pituitary anterior the from secretion of gonadotropin control and behavior copulatory male in role central its with consistent (POA), area preoptic the in identified have been candidates gene masculinization brain for route presumptive the been has (ARs) receptors and androgen (ERs) receptors of estrogen activation transcription factors of family extended an of members are that receptors nuclear to bind masculinization brain rodent of mediators robust most are the estradiol metabolite and its potent of testosterone actions the but brain, in the differences sex or diminish magnify either variables environmental and complement Chromosome period. sensitive tal a perina during testis fetal by the generated steroids by gonadal ated medi is and phenotype female the from away differentiation the is of not Masculinization does steroids. ovarian secretion require active and ovary therefore a considered default pathway developmental that of the of brain is the independent feminization In gonads. mammals, either is o brain developing the ormasculinized feminized in species, a manner that assures adult neural physi- reproducing sexually In brain feminization is maintained by the active suppression of masculinization via DNA methylation. modulated by methylation that may underlie the divergent reproductive behaviors of males versus females. Our data show that isoform, Dnmt3a, also masculinized sexual behavior in female mice. RNA sequencing revealed gene and isoform variants resulting in masculinized neuronal markers and male sexual behavior in female rats. Conditional knockout of the releasing genes masculinizing from epigenetic inhibition repression. Pharmacological of Dnmts mimicked gonadal steroids, preoptic area (POA) is to reduce activity of DNA (Dnmt) methyltransferase enzymes, thereby decreasing DNA methylation and nuclear ligand-activated steroid receptors. We found that a primary effect of gonadal steroids in the highly sexually dimorphic sensitive period. It has been assumed that the brain undifferentiated is masculinized by direct induction of by transcription The developing mammalian brain is destined for a female phenotype unless exposed to gonadal hormones during a perinatal Anup Mahurkar Nugent M Bridget masculinization via DNA methylation Brain feminization requires active repression of Program in Neuroscience, University of Maryland School of Medicine, Baltimore, Maryland, USA. logy logy and reproductive behavior are consistent with the differentiated The most robust and reliable brain sexual dimorphisms are found found are dimorphisms sexual brain reliable and robust most The NEUR OSCI 9 , 1 EN 0 3 3 . In the neonatal male rodent, estradiol aroma estradiol rodent, male neonatal the In . , , and the of direct induction gene expression via , , Scott J Russo C 1 E , 2

, , Christopher L Wright ADVANCE ONLINE PUBLICATION 3 Institute for Genome Sciences, University of Maryland School of Medicine, Baltimore, Maryland, USA. 6– 4 8 . , Scott E Devine 2 , , Amol C Shetty 1 , 4 2

, . Steroids Steroids . 5 3 , yet few few yet , 1 & Margaret M McCarthy M Margaret & . All of of All . - - - - -

culinizing dose of estradiol decreased Dnmt activity to that of males males of that to activity Dnmt decreased estradiol of dose activ culinizing than lower ( was PN14 or 20 day embryonic on period, males sensitive the of outside ences from tissue ( PN4 POA in at variable was and PN2 and (PN0) 0 day postnatal on females in ity activity Dnmt Total Males have lower Dnmt activity in the neonatal POA than females RESULTS that feminization must and be actively behavior, maintained copulatory by DNAand POA methylation. the of masculinization in result activity Dnmt in decreases mediated hormonally that demonstrate more CpG methylated fully sites Our than significantly results males. with methylation, of levels higher had Females sequencing. bisulfite whole via and globally DNAmethylation of mea- level the sured also We mice. and rats both of brains the in activity Dnmt estradiol and in the POA of enzymes (Dnmt) of DNAfemale male, methyltransferase expression and activity the measured we masculinization, brain estradiol to contributesmethylationDNA whether mine plasticity neural with associated genes in particularly de novo and rapid demethylation with modifiable, DNAis highly methylome neuronal The conformation. ultimately,chromatin and, interactions long with adjacent to guanines (referred to as CpG sites), is frequently associated tion, which occurs predominantly at the 5 nous cues exert long Supplementary Fig. 1 Epigenetic processes are processes Epigenetic a means by and endogenous which exoge doi:10.1038/nn.398 3 , Georgia E Hodes Fig. 1 Fig. methylation occurring in response to changes in excitability, in to changes response in occurring methylation - term transcriptional repression by altering protein altering by repression transcriptional term 2 a Department Department of Pharmacology, University of Maryland School and - treated masculinized female rat pups and disrupted disrupted and pups rat female masculinized treated Supplementary Fig. 1 Fig. Supplementary - 8 term term control over gene expression. DNA methyla 1 , 2 ). Treatment of newborn female rats with a mas 4 , Kathryn M Lenz [email protected] ` position of cytosine residues ). There were no sex differ sex no were There ). 2 ) 4 ART , de novo Neuroscience Neuroscience

1 1 . To deter To . IC - Dnmt mediated mediated - genome genome - LE DNA S 1 ------

© 2015 Nature America, Inc. All rights reserved. expression increased between PN0 and PN2 ( 2 an indicate necessarily not may and regions genomic different out in CpG methylation might reflect the distribution of CpG sites through rarely present in CpG islands ( were and (<1%), exons and (~2%) promoterregions (~14%), introns ference in methylation were in intergenic regions (~84%), followed by Fig. 2a ( activity Dnmt inhibited or reduced with consistent likely revealing a population shift downward from 100% methylation, females, masculinized and males in frequent more were methylated ( respectively males, methylation on chromosome 5 and 13 was towardbiased females and although chromosomes, across dispersed generally were differences ( females masculinized or had nearly twice the level of fully (100%) methylated CpG sites as males methylated CpG sites (>90%), which are the majority, highly to and thatrestricted females was difference sex this that revealed sequencing PN1 on ( activity Dnmt measured of levels paralleled methylation DNA global of levels POA, the In sensitive period, no longer affected Dnmt activity ( ( by PN7 animals all in further still dropped and females masculinized activity levels dropped in normal females to match those of males and PN4, By PN2. until maintained was activity lower the and h 6 within other groups, ** female + estradiol; PN4, 6 female + estradiol; PN7, 5 female + estradiol; 5 female + estradiol; PN2, estradiol ( + PN2, estradiol; P P modulation in the amount of mRNA in the POA at any given age across groups (Dnmt1 sex differences in CpG methylation). ( of outside CpG in and regions, were CpG in islands Sex and most shores. CpG islands prevalent on differences intergenic (based shores methylation 1,242 6.594, sequencing revealed that females had more fully methylated CpG sites across the genome than males and estradiol-treated females (ANOVA, significantly reduced global DNA methylation in the female POA to the level of males (ANOVA, 64) = 3.72, later (on PN2, two-way ANOVA, had significantly higher levels of Dnmt activity in the POA than males and females treated with 100 Figure 1 ART Fig. Fig. 1 < 0.0001, 0.0001, <

= 0.975, Dnmt3b Dnmt3b 0.975, = e a a ). The overwhelming majority of CpG sites exhibiting a sex dif P

). ). Treatment with estradiol on PN14, following the close of the RFU 105 per mg

× IC = 0.0306). ( 0.0306). = Females have higher Dnmt activity and DNA methylation in the POA, which is reduced by estradiol treatment. ( a Dnmt1/GAPDH protein ), 100 150 200 250 0. 0. 0. 0. 1. 1. 1. 1. 1. 1. 1. P F 50 n LE 6 7 8 9 0 1 2 3 4 5 6 0 = 0.0031). ( 0.0031). = int = 5 male, female, and female + estradiol ( estradiol + female and female, male, 5 = ** P (6,54) = 0.8851, 01 024 < 0.01 in control females versus other groups. Data are presented as mean mean as presented are Data groups. other versus females control in 0.01 < n S = 7 male, 4 female, 5 female + estradiol; PN4, PN4, estradiol; + female 5 female, 4 male, 7 = F Dnmt3a sex d Supplementary Fig. 3 Fig. Supplementary ) Pie charts displaying the distribution of sex differences in CpG methylation across genomic compartments and within/outside of and within/outside of ) compartments in genomic across the sex CpG Pie distribution differences displaying methylation charts (2,54) = 0.013, n ** 2345 = 5 male, 5 female, 6 female + estradiol; PN7, PN7, estradiol; + female 6 female, 5 male, 5 = n n b = 6 male, 5 female, 5 female + estradiol. estradiol. + female 5 female, 5 male, 6 = PN4, estradiol; + female and female, male, 6 = ) On PN1, females had higher percent levels of global DNA methylation in the POA than males. 24 h of estradiol treatment treatment 24 h of estradiol males. than POA in the methylation DNA of global levels percent higher had ) females On PN1, : PN0, Fig. 1 Fig. Age (d Dnmt Age (d F Fig. 1 Fig. sex P 1 = 0.5123) and and 0.5123) = c (2, 64) = 10.1, ) n and ) = 5 male, 6 female, 5 female + estradiol; PN2, PN2, estradiol; + female 5 female, 6 male, 5 = e Fig. 1 Fig. ) Two-way ANOVA on qPCR analyses of Mal Female + Femal d P ). ). The proportion of differences 6 e = 0.9867), although there was a significant decline between PN0 and PN7 in in PN7 and PN0 between decline significant a was there although 0.9867), = Supplementary Fig. 2a Fig. Supplementary 67 e b F Age ). Whole ). e ). Sites that were 80–90% 80–90% were that Sites ). (3,54) = 51.46, Dnmt3b Supplementary Fig. 1 Fig. Supplementary P 8 = 0.0002). Dnmt activity decreased in all groups by PN7 ( PN7 by groups all in decreased activity Dnmt 0.0002). =

Dnmt3a/GAPDH b - 0. 0. 0. 1. 1. 1. 1. 1. 1. Percent methylation genome bisulfite bisulfite genome b 8 9 9 0 0 1 1 2 2 Supplementary Supplementary ), 10 15 20 25 expression ( expression 0 5 0 n = 3 male, female, and female + estradiol ( estradiol + female and female, male, 3 = Male P < 0.0001,

n Female = 6 male, female, and female + estradiol; PN7, PN7, estradiol; + female and female, male, 6 = ). Sex Sex ). 2 * Dnmt3b

F Female Age n = 6 male, 5 female, 5 female + estradiol ( estradiol + female 5 female, 5 male, 6 = ). - - + (3,54) = 20.46, e n Dnmt3a Age (d Dnmt1 = 5 male, 5 female, 6 female + estradiol; PN7, PN7, estradiol; + female 6 female, 5 male, 5 = F fully methylated CpGs fully treatment following of estradiol led females us the masculinizes POA and sexual behavior reliably pups rat female newborn of treatment estradiol Exogenous Low levels of Dnmt activity masculinize the bipotential brain transcription. to unrelated means other or phosphorylation availability, substrate via indirectly is modulated ( hormonal modulation of mRNA or protein levels of any of the Dnmts dant than the other Dnmts until at least PN7 ( increased by PN2 and remained elevated and substantially more abun of these enzymes sharply decreased in 1 week, whereas in 1 whereas week, decreased sharply enzymes of these and ( maintenanceorDnmt1the control females ( females had more CHG sites with 10–20% methylation compared with ( controlfemales and males comparedmethylation with 10% than less with sites CHGof number than CpG methylation, as expected. Estradiol significantly reduced the percentages of CHG methylation were substantially lower in frequency enrichment of sex differences in a specific genomic compartment. High : PN0, 4 int Fig. Fig. 1 1 Fig. c There were no sex differences in mRNA or protein levels of either either of levels protein or mRNA in differences sex no were There (6,54) = 1.323, ) Number of fully Dnmt3b

, methylated CpG sites n Dnmt3a = 6 male, female, female + estradiol; PN4, PN4, estradiol; + female female, male, 6 = n e e 1,000 1,500 2,000 F = 5 male, 6 female, 5 female + estradiol; PN2, PN2, estradiol; + female 5 female, 6 male, 5 = and and and and sex 500 6 0 ADVANCE ONLINE PUBLICATION (2,54) = 0.661, P Supplementary Fig. 4 Fig. Supplementary mRNA were most abundant at birth, but levels of both both of levels but birth, at abundant most were mRNA Supplementary Fig. 4 Fig. Supplementary o < 0.0001, 0.0001, < and and

s.e.m. ( s.e.m. Male F (2,12) = 5.55, P P < 0.0001) ( 0.0001) < 8 Dnmt3b

= 0.2629). PN0, Female M g estradiol (e) at birth and killed 6 (on PN0) or 48 h 6 PN0) (on killed and at birth (e) g estradiol

a Dnmt3b/GAPDH * , 0. 0. 0. 0. 1. 1. 1. 1. 1. 1. 1. b c F , 6 7 8 9 0 1 2 3 4 5 6 , int e d P detected no or detected sex hormonal differences Female ) or as mean ), (6,54) = 0.555, = 0.5205, Dnmt3a Dnmt3a 0.5205, = 0 P Dnmt1

< 0.0001), and males and masculinized masculinized and males and 0.0001), < + de novo de Supplementary Fig. 2b Fig. Supplementary

P e F = 0.0197). ( 0.0197). = age d e ). * (3, 64) = 76.85, : PN0, n ), suggesting that enzyme activity activity enzyme that ), suggesting ). Based on relative units, units, relative on Based ). n 2 = 7 and male, female, + female = 6 male, female, and female Dnmts, Dnmt3a and Dnmt3b Dnmt3b and Dnmt3a Dnmts, P o Dnmt1 Intergeni Intron Exon Promoter < 0.05 in versus females control s.d. ( s.d. a ) On PN0 and PN2, females females PN2, and PN0 ) On n P Dnmt3b = 5 male, 6 female,

Age (d) = 0.7634), whereas whereas 0.7634), = 1 c n . The marked decrease in . decrease The marked ) Whole-genome bisulfite NATURE NATURE c = 6 male, 5 female, 4 c ( ). F F n Fig. 1 Fig. sex Age = 5 male, 5 female, (2,54) = (2,54) 0.024, Male Female + Femal (3,54) = (3,54) 36.19, P n < 0.0001, 0.0001, < = 6 male, female, e ). NEUR 6 ). There was no was There ). Other CpG shores CpG island e Dnmt3a F e (2,6) (2,6) = OSCI s

Dnmt3a Dnmt1 8 F levels int

EN

(6, (6,

C E -

© 2015 Nature America, Inc. All rights reserved. NATURE NATURE by detected the spine with relative density precisely POA, correlating to be an accurate and reliable proxy marker for spines dendritic in the western blot and quantification of immunohistochemical Neurabin II to localization postsynapticthe densityenhanced dendriticof spines its of because spinophilin as known also adulthood into excitatory synapses are then maintained at twice the density ofthese females and neurons, POA on spines dendritic of formation Dnmts the across site binding catalytic the of conservation high of result a as applicability tor is to which RG108, targeted Dnmt1, but to have considered broad stimulate base DNAadduct a in enzyme the traps which (Zeb), ine low the inhibitors: Dnmt different ( adulthood in behavior and markers neuronal adult masculinized producing estradiol, of effects the mimic would brain female in neonatal the of Dnmt activity inhibition macological phar that We predicted feminization. promote and masculinization POA serve to repress gene expression to prevent neural and behavioral to that hypothesize high levels of CpGs methylated fully in the female of the open field arena was masculinized by Zeb treatment of females ( locomotor activity as measured by grid crosses ( in adult females. Neonatal Zeb treatment also increased the number of mounts by adult males. ( and thrusts ( shown and full length blots are provided in significantly increased Neurabin II protein levels in the adult female POA ( masculinized dendritic spine density of adults (ANOVA, ( testing. behavioral of completion the at collected were brains and later d 20 assessed was behavior sexual Male levels. testosterone circulating male adult stable achieve to capsules testosterone-releasing with implanted and gonadectomized were animals adults, As PN1. and PN0 on RG108 or Zeb inhibitors Dnmt the ( behavior. masculinizes and neurons POA on density spine dendritic increases inhibition Figure 2 with control female. zeb, 8 male + zeb. Time in center of arena: 6 male, 6 female + zeb, 7 male + zeb ( n RG108 ( PN0 andPN1 b a b a ICV inhibitors = 8 female, 6 male, 7 female + zeb, 8 male + zeb. Mount latency: latency: Mount zeb. + male 8 zeb, + female 7 male, 6 female, 8 = ) Animals were treated with with treated were ) Animals ) Golgi-Cox impregnated adult POA neurons were quantified for dendritic spine density. Neonatal Dnmt inhibition by either Zeb or RG108 in females females in RG108 or Zeb either by inhibition Dnmt Neonatal density. spine dendritic for quantified were neurons POA adult impregnated ) Golgi-Cox

Number of spines or vehicle per µm dendrite 0.1 0.2 0.3 0.4 0.5 0.6 0

b NEUR Neonatal Dnmt Dnmt Neonatal ), Vehicle Male n F * = 9 female, 9 male, 9 female + zeb, 9 male + zeb ( zeb + male 9 zeb, + female 9 male, 9 female, 9 = (3,25) = 7.87, - OSCI excision repair 6 . Neurabin II is an F an is II Neurabin . Vehicle # EN P

< 0.05 compared with control male. Data are presented as mean mean as presented are Data male. control with compared 0.05 < 1 C

4

Female . In males, endogenous estradiol induces the the induces estradiol endogenous males, In . E

Zeb

**

ADVANCE ONLINE PUBLICATION P

< 0.0001) and decreased the latency to mount ( mount to latency the decreased and 0.0001) <

1

3 RG108 , and the small ** testosterone replacement Ponceau Neurabin II - Gonadectomy and toxicity cytidine analog zebular analog cytidine toxicity d c

), Grid crosses:

- Normalized optical density actin–binding protein that is is that protein actin–binding PN40

Supplementary Figure 10 (arbitrary units) n S = 8 female, 8 male, 7 female + zeb, 8 male + zeb ( zeb + male 8 zeb, + female 7 male, 8 female, 8 = 0 1 2 3 4 5 6 7 F 1 Male (3,27) = 0.72, - 5 ** molecule molecule direct inhibi . We have found both both found Wehave . Fig. 2 Fig. + zeb Male n F * a 1 = 8 female, 8 male, 7 female + zeb, 8 male + zeb. Rears: Rears: zeb. + male 8 zeb, + female 7 male, 8 female, 8 = (3,22) = 4.92, and braincollection Male sexbehavior 2 ). We). two used , but may also also may but , F F F Male emale +RG1 emale + emale PN60

Female P

c putative putative = 0.5486) and rears ( rears and 0.5486) = ), Mounts: ze n . ( = 8 female, 6 male, 7 female + zeb, 7 male + zeb. Thrust latency: latency: Thrust zeb. + male 7 zeb, + female 7 male, 6 female, 8 = b d F Female + zeb ) Neonatal Zeb treatment increased mounts ( (3,27) = 7.4, 08 P - - - * = 0.0091). Scale bar represents 10 10 represents bar Scale 0.0091). = F (3,32) = 4.69, n Analysis of behavior in an open field confirmed that general motor motor general that confirmed field open an in behavior of Analysis ( behaviors thrust display to latency the decreased ment motivation sexual of male to a mount, measure cies Dnmtinhibitor vehicle ( animals feminized with normally treated females male few very displayed neonates control as whereas female, receptive (intromission more thrusts and in mounts behavior. engaged inhibition sexual Dnmt neonatal adult received who Females masculinized inhibitor Dnmt either with ( ( density spine dendritic POA increased in resulted PN1 and PN0 on female. receptive sexually a of introduction lowing fol initiated are behaviors these which with latency the and female receptive a intromit to attempts or mounts animal masculinized the behavior sexual male correlate of with adult the positively ofanimals robustness individual neuroanatomical measures d = 8 female, 6 male, 7 female + zeb, 8 male + zeb. Thrusts: Thrusts: + zeb. 8 male + zeb, 7 female 6 male, = 8 female, Fig. 2 Fig. Fig. F e Number of thrusts Number of mounts Intracerebroventricular (ICV) administration of Zeb or RG108 RG108 or Zeb of administration (ICV) Intracerebroventricular 10 10 20 30 40 50 60 70 12 14 (3,24) = 4.25, Seconds in center of arena 0 2 4 6 8 0 25 30 35 40 10 15 20

0 5 2 Male Male c b *** P * and and ) and higher levels of Neurabin II in the adult female POA female adult the in II Neurabin of levels higher and ) Female = 0.0009); 0.0009); = F o Zeb Vehicle (3, 27) = 0.6, s.e.m. * + zeb + zeb P Male Male Supplementary Fig. 5b Fig. Supplementary *** *** = 0.0079). Cropped representative western bands are are bands western representative Cropped = 0.0079). # - treated females also had significantly shorter laten shorter significantly had also females treated e Male Female Female P ** e ) Animals treated with Zeb showed no impairments in impairments no showed Zeb with treated ) Animals *** = 0.0153) and thrust ( thrust and 0.0153) = ). * n P 1 = 5 female, 7 male, 7 female + zeb, 7 female + 7 female + zeb, 7 female 7 male, = 5 female, 6 < 0.05, ** 0.05, < , which is quantified as the number of times times of number the as quantified is which , Female Female + zeb + zeb P ** ** = 0.6205); however, time spent in the center center the in spent time however, = 0.6205);

6 Number of grid crosses . . Moreover, Neurabin II levels in the POA 160 200 120 40 80 0 Fig. 2 Fig. M m. ( Female P - < 0.01, *** 0.01, < Thrust latency (s) Mount latency (s) n like behaviors) toward a sexually sexually a toward behaviors) like c 1,000 F = 8 female, 8 male, 7 female + 7 female 8 male, = 8 female, d ) Zeb treatment on PN0 and PN1 PN1 and PN0 on treatment ) Zeb ). Notably, treatment of females females of Notably, ). treatment (3,25) = 22.18, 200 400 600 800 100 200 300 400 500 - and like behaviors, as expected of of expected as behaviors, like 0 0 F (3,21) = 4.05, Male Male Male Supplementary Fig. 5a Fig. Supplementary ** * P < 0.001 compared compared < 0.001 + zeb + zeb Male Number of rears Male ART ** 30 40 10 20 * 1 0 7 P , and Zeb treat < 0.0001) < 0.0001) Female n Female Female P = 6 female, = 6 female,

= 0.0203) = 0.0203) IC Fig. 2 Fig. Female Female LE + zeb + zeb Male ** * d S ). ). ). ). 3 - - -

© 2015 Nature America, Inc. All rights reserved. 4 female mice homozygous for a knockout of Dnmt3a in the neonatal mouse POA. Newborn male and the relative role of a specific Dnmt, we used AAV2 tools do not distinguish between Dnmts; thus, to gain some insight into nance and plasticity response to internal and external stimuli and is implicated in neuronal replication ( injection Zeb ICV after h 24 control with compared reduced significantly was Methylation assay. methylation global the using confirmed was methylation CpG other dimorphic endpoints. The of efficacy Zeb treatment at reducing to generalizable not is differentiation sexual in DNAmethylation of ( cyclicity estrous 5c Fig. Supplementary in Dnmt neonatal following ( females inhibition culinized anxiety butimpaired, not was activity female, ** 7 female gfp, 6 male cre, 4 male gfp. Total distance: 5 female gfp, 8 male cre, 3 male gfp. Thrusts: male gfp. Mount time: n latency: Mount gfp. 2 male cre, 4 male investigation: Anogenital gfp. 3 male cre, 4 male Solicitations: open field arena ( P time spent in the center of ( ( weeks. 3 consecutive across trial a 30-min in P greater number of thrusts ( time ( ( latency mount decreased a significantly showed P anogenital investigation, solicitations, (ANOVA; knockout Dnmt3a by unaffected were behavior sexual male of components Appetitive behavior. sexual male displayed 100% of the AAV2-Cre Dnmt3a that revealed AAV2-GFP or AAV2-Cre either with neonatally treated animals adult in behavior groups. ( between number cell or intensity staining in differences observable no were There injection. AAVby targeted was POA the that verify to group experimental each from animals of subset Immun and 40x (bottom) (scale bars represent 75 × (top) 10 at POA the in staining GFP of images exons (redrawn from ref. 43). ( represent boxes numbered The Dnmt3a. of alleles modified and construct targeting locus, female mice. ( of behavior reproductive masculinizes POA Figure 3 ART compared with 20% of control AAV2control of 20% with compared AAV2 of viral transfection was localized to the POA ( animalsconfirmedof subset visualizationPOAa GFP thein PN0.on mice; d F = 5 female cre, 5 female gfp, 8 male cre, 4 cre, 8 male gfp, 5 female cre, = 5 female

= 0.387) or total distance traveled in an in traveled distance total or = 0.387) females AAV2-GFP to compared = 0.051) females AAV2-Cre whereas = 0.0132), ) There were no significant differences in differences significant no were ) There (3,18) = 3.505, Dnmt1 largely maintains DNA methylation patterns following DNA F Fig. 3 Fig. o (3,16) = 7.17, histochemistry was performed in a in performed was histochemistry

IC c - Conditional Dnmt3a knockout in the the in knockout Dnmt3a Conditional 1 ) Quantification of male sexual sexual male of ) Quantification Cre Dnmt3a P 9 de de novo 1 , although a strong interdependence between the mainte the between interdependence strong a although , < 0.01 compared with AAV2-GFP female, female, AAV2-GFP with compared 0.01 < 8 a LE F , whereas Dnmt3a induces Dnmt3a whereas , ) were injected with either AAV2 n n a (3,10) = 11.17, = 3 female cre, 4 female gfp, gfp, 4 female cre, = 3 female = 2 female cre, 5 female gfp, gfp, 5 female cre, = 2 female ) Schematic diagram of genomic genomic of diagram ) Schematic F S P (3,18) = 1.64, Dnmts is now emerging Supplementary Fig. 6 Fig. Supplementary = 0.036), increased mount mount increased = 0.036), P n loxP/loxP = 0.0029), and a and = 0.0029), = 4 female cre, cre, = 4 female F ). There was no effect of Zeb treatment on on treatment Zeb of effect no was There ). (3,9) = 6.372, = 6.372, (3,9) F t F test, test, (3,13) = 3.385, = 3.385, (3,13) (3,18) = 1.07, = 1.07, (3,18) loxP b loxP/loxP P females displayed male sexual behavior, ) Representative ) Representative = 0.0016; = 0.0016; t P (6) = 2.32, - = 0.274). = 0.274). flanked females females

-

- GFP Dnmt3a GFP M de novo de related behaviors were mas were behaviors related Dnmt3a m). m). 2 Fig. Fig. 3

), suggesting that the role role the that suggesting ),

0

P . Current pharmacological n

= 0.0417). = = 4 female cre, 3 female gfp, 7 male cre, 3 male gfp ( gfp male 3 cre, male 7 gfp, female 3 cre, female 4 = - Cre or AAV2 b DNA methylation in methylationDNA exon (Dnmt3a exon ). In adulthood, 100% n a c - # driven conditional = 5 female cre, 7 female gfp, 6 male cre, 4 male gfp ( gfp male 4 cre, male 6 gfp, female 7 cre, female 5 = Seconds Percent performing P Eco/Sspl 12.5kb Eco/Sspl 5.5kb 1,000 1,500 2,000 < 0.05 compared with AAV2-Cre female ( female AAV2-Cre with compared 0.05 < loxP/loxP Female CRE Female CRE male sex behavior 500 100 20 40 60 80 0 Female GFP Female GFP 0 17 Fig. Fig. 2 Eco/Sspl 9.5kb 17 17 - Mount latency * GFP into

females females Male CRE Male CRE 17 loxP/loxP

e Male GFP Male GFP and - - Pgk-NEO 18

18 well as mounting behavior in adult female rats ( rats female adult in behavior mounting as well as levels, protein II Neurabin in increases observed again once and as neonates (sexes mixed, real quantitative of depletion Significant Dnmt3a mRNA by AAV2 culinize Neurabin II levels or sexual behavior, confirming the previouslytreatment of females at the same developmental time point did not mas treatmentreducedmountlatencies. Notably,also andthrust estradiol PN11; and (PN10 period sensitive the of outside rats female critical period. To directly test this hypothesis, we administered Zeb to de are genes critical if occur can linization mascu that and phenotype brain female the maintains methylation of the sensitive for period differentiation, sexual suggesting that DNA of Dnmt3a therefore may not have been fully implemented by the close injected intovirus the POA of mice on the day of birth, and knockout AAV2 DNA methylation maintains the female brain phenotype ( mice the in behavior this in difference sex a there was nor Dnmt3a knockout in the POA had no effect on activity in an open field, AAV2controlwithcompared thrusts of number increased an and times mount long latencies, mount fast ( 19 Fig. 3 Fig. 21 18

Seconds 19 1,000 Female CRE Female CRE 20 200 400 600 800 22 20 10 15 20 19 0 5 0 23 - Female GFP Female GFP 21 c mediated knockout takes days to weeks to become effective. We ). AAV2 20 21 22 ** Solicitations Mount tim 24

ADVANCE ONLINE PUBLICATION Male CRE

Male CRE 23 22

Male GFP Male GFP 23 21 # - - 22 Cre Dnmt3a time PCR (qPCR) in adult POA from animals treated ** e * 23 24 24 c Exon loxP , d ) . c site Data are presented as mean mean as presented are Data

), Time in center of arena: Seconds

Female CRE Female CRE Targeting construct 200 400 600 t cassettle (2lox) after removalofneo Targeting construct 20 40 60 test, test, 0 Female GFP 0 Female GFP Number ofthrusts loxP/loxP d allele (1lox) Recombined locus endogenous DNMT3a ). * * investigation t Anogenital Frt site

(9) = 4.691, Male CRE Male CRE P

< 0.05 compared with AAV2-GFP AAV2-GFP with compared < 0.05 Male GFP Male GFP female mice exhibited extremely - GFP Dnmt3a GFP * b

- P NATURE NATURE repressed outside of the the of outside repressed = 0.0011). = d

- Seconds Seconds Cre was confirmed by Fig. n 2,000 4,000 6,000

= 5 female cre, cre, = 5 female Female CRE Female CRE 100 150 200 250 o 50 s.e.m. 0 0

loxP/loxP 4b NEUR Female GFP Female GFP , Time incenter Total distance c

). The same The ). Male CRE Male CRE of arena OSCI females. females.

Fig. 3 Fig. Male GFP Male GFP Fig. 4 Fig. EN d a C ), ), ). E - -

© 2015 Nature America, Inc. All rights reserved. NATURE NATURE methylation be to and bycantly increased Dnmt in inhibition the female ( POA male signifi were in the expression higher with of 34 genes the females and higher in males than in control females. We found that 24 we masculinization, onfocused those that were upregulated by Zeb in ( differentiation sexual to evant masculinization. to leading cascade transduction signal male thus this to and respond both and mast cells prostaglandins, produce Prostaglandins are mediators critical of of masculinization the POA of hormone gonadotropin and (GnRH) releasing prostaglandins release the including by brain, the controlled functions reproductive Mast and with immunity acquired mediate have cells associated been ized protein, respectively, were exclusively expressed in the male POA. and versavice( and females than males in higher half approximately with genes 70 of expression the in observed were differences Sex PN1. and on PN0 or Zeb vehicle either with PN2 treated POAthe and of females males RNA We used expression. gene of patterns masculinized in result should activity Dnmt inhibiting then masculinization, for necessary genes of expression differential mediate activity Dnmt in differences If sex gene expression in differences sex -independent and Methylation-dependent loss of hormonally mediated inhibition of Dnmt activity. a is period sensitive the of close the to leading factor one least atthat treat estradiol ment outside by of the sensitive ( period activity Dnmt in reduction no was there Moreover, defined sensitive period for hormonally mediated sexual differentiation. Data are presented as mean ** 4 female + estradiol, 7 female + zeb. Thrust latency: 6 female + zeb. Mount latency: in females. were large differences in the number there of thrusts between Although males behavior. and or females brain ( of masculinization induce not did point time same this at administered treatment estradiol whereas inhibition Dnmt t mount ( ( Figure 10 full length blots are provided in and shown are bands western representative (ANOVA, groups treatment all across effect main no was t t priori (a levels protein II Neurabin masculinized brain the of differentiation sexual for period critical the of close the after administration of three weeks of behavioral testing. ( completion the following POA the in quantified were levels II Neurabin and collected were d Brains later. 20 assessed was behavior sexual male and capsules testosterone-releasing with implanted and gonadectomized were animals adulthood, In PN11. and PN10 at ( behavior. masculinizes and POA the in markers spine dendritic increases period Figure 4 test between females and females + zeb: zeb: + females and females between test F (8) = −2.833, + zeb: females and females between test a ) Animals were treated with Zeb or estradiol estradiol or Zeb with treated were ) Animals

P (4,27) = 5.23, Only a subset of genes de genes of subset a Only < 0.01, *** 0.01, < D4AD88, Supplementary Table 2 Table Supplementary - - specific expression specific of Seq to compare total gene and genetic isoform expression in in expression isoform genetic and gene total compare to Seq F

(4,26) = 2.44, F NEUR Dnmt inhibition outside of the critical critical the of outside inhibition Dnmt . ( (4,22) = 2.22, n c Fig. 5 Fig. = 7 male, 7 male zeb, 6 female, 4 female + estradiol, 4 female + zeb ( zeb + female 4 estradiol, + female 4 female, 6 zeb, male 7 male, 7 = mounts of ) Number which code for mast cell protease 2 and an uncharacter OSCI P P = 0.0221), although there there although = 0.0221), < 0.001, one-way ANOVA main effect compared with vehicle-treated female. female. vehicle-treated with compared effect main ANOVA one-way 0.001, < P a = 0.003), the latency to latency the = 0.003), - and EN dependent gene candidates for masculinization masculinization for candidates gene dependent C P E Supplementary Table1 Supplementary = 0.0718, a priori a priori = 0.0718, P

= 0.1002). Cropped Cropped = 0.1002). o ADVANCE ONLINE PUBLICATION Mcpt2 s.e.m. - n Supplementary Supplementary ). We considered this subset of genes genes of subset this considered We ). repressed by Dnmt inhibition are rel are inhibition Dnmt by repressed = 7 male, 8 male zeb, 6 female, 4 female + estradiol, 6 female + zeb. Thrusts: Thrusts: zeb. + female 6 estradiol, + female 4 female, 6 zeb, male 8 male, 7 =

Fig. Fig. may be a critical node initiating the b Supplementary Fig. 1 Supplementary ) Zeb ) Zeb

5 ). To identify genes involved in involved genes To). identify

t (10) = 2.862,

). Two). genes, PN0 b a n = 7 male, 8 male zeb, 4 female, 4 female + estradiol, 3 female + zeb ( zeb + female 3 estradiol, + female 4 female, 4 zeb, male 8 male, 7 = P SC estradiolor Ponceau Neurabin II < 0.05; 0.05; < ICV zebor PN10 and P vehicle vehicle

Normalized optical density PN1 = 0.0169), and thrust latency ( latency thrust and 0.0169), = (arbitrary units) ), suggesting 0.2 0.4 0.6 0.8 1.0 1 S

0 Fig. Vehicle Mcpt2

21 5a Male , 2 , 2 2 b 3 - - - - . Zeb Gonadectomy

testosterone replacement F PN40 (4,27) = 14.861, Analysis of a large CpG island in the the in island CpG large a of d. 5 Analysis another least at for treatment estradiol following elevated was Moreover,methylation.DNA of loss a to secondary instead but ERs, by transcription of induction of result birth after days few first the POA during male the in level higher a at expressed be to shown previously genes few which is the estradiol poe t dvrec, f ae ad females methylation and as males of convergence, a divergence, in to opposed resulting actively are methylation, DNA expression by gene in suppressed differences sex underlying that suggesting some inhibition, Dnmt to subject were sexes both when of that to by methylation. opposite repressed are which is genes, masculinization but methylation, involves that manner a in males versus females in levels higher at maintained are genes zation in males than and Zeb females control in expression higher with those as defined genes, feminization candidate were them of (22%) percentage large a but demethylation, following expected be would as treatment, Zeb firming our RNA ( genes Fig. with (5–8%; genes masculinization compared candidate other most (~50%) methylation CpG of levels high unusually estradiol the assumptions, qPCR ( sex difference and estradiol ( 19A1 P450 cytochrome gene the was set methylation the Among genes. candidate independent Zeb not but males, in expressed highly were that genes ten the regarded and brain, the of and Vehicle Also Also unexpected was that 381 genes became differentially expressed after decreased of genes number small of a relatively mRNA levels

8 ). Expression patterns of additional candidate masculinization masculinization candidate of additional patterns Expression ). b Estradiol Female ). Mounts: Ebf2 Supplementary Fig. 7 Fig. Supplementary and brain collection Male sex behavior PN6 , - F Efb3 dependent convergence in gene expression may pro may expression gene in convergence dependent Ze (4,21) = 6.67, 0 - # treated females ( b # P P n - and < 0.0001), Zeb did not masculinize number of thrusts thrusts of number masculinize not did Zeb < 0.0001), Seq results ( results Seq = 7 male, 8 male zeb, 7 female, 4 female + estradiol, + estradiol, 4 female 7 female, zeb, 8 male = 7 male, < 0.05 0.05 < c

- Number of thrusts Number of mounts synthesizing enzyme aromatase and one aromatase of enzyme the synthesizing 10 20 30 40 50 60 70 80 90 Nr2f2 10 15 20 25 - 0 0 5 treated or control females, as methylationas females,control or treated Vehicle Vehicle Male Male *** t ** - test compared to vehicle-treated female. female. vehicle-treated to compared test - mediated increase in in increase mediated induced induced increase in P ) were marginally higher in males, con males, in higher marginally were )

Zeb *** Zeb = 0.0013) were also masculinized by masculinized also were = 0.0013) * ), but we found that, contrary to prior prior to contrary that, found we but ), Supplementary Fig. 9 Fig. Supplementary

Fig. Fig. 5a Vehicle Vehicle n = 7 male, 8 male zeb, 6 female, 6 female, zeb, 8 male = 7 male, Female Estradiol Female Estradiol , d Cyp19a1

Cyp19a1 Zeb Zeb ). This suggests that femini * Cyp19a1

c Thrust latency (s) ) 1,000 1,200 Mount latency (s) . * 200 400 600 800 100 150 200 250 2 Cyp19a1 50 4 P 2 0 0 promoter revealed revealed promoter . We confirmed the the We . confirmed mRNA expression expression mRNA Cyp19a1 ,

< 0.05, < 0.05, Vehicle Vehicle 2 ART ; Male Male 5 LOC100359906 ( * Supplementary Supplementary ).

i. 5 Fig. Zeb Zeb ** mRNA with

- Vehicle Vehicle dependent dependent IC

was not a not was Female Female Estradiol Estradiol a ). This This ). LE

Zeb Zeb # * S ), ), 5 - - - -

© 2015 Nature America, Inc. All rights reserved. 6 via achieved is which regions, DNA methylation. brain relevant reproductively in females and males in gene of this expression convergent toward sure difference sex a of absence the for notable were POA but the and hypothalamus regions, brain multiple We in a sex difference observed recently was thereby making them different from Dnmt inhibitor–treated females. example notable One Foxp2 amplified. greatly more is expression gene in divergence which against backdrop undifferentiated an vide the expression of female-biased genes. Based decreasing on and data from genes male-biased of expression the increasing both by POA female the in expression gene masculinizes inhibition Dnmt that suggesting lines), (red Zeb to response in expression in decreased genes female-biased the of one but all and lines), (blue Zeb following females in expression in increased genes male-biased the of all females, in Zeb by altered were that differences sex basal with genes the Of genes). feminization (putative POA male control the versus POA female control the in expression higher with genes indicate lines Red genes). masculinization (putative POA female control the versus POA male control the in expression higher with genes indicate lines Blue expression. in differences sex without genes indicate lines Gray male-like pattern of isoform expression. ( POA masculinization. ( patterns resembling male gene expression. Arrow indicates the creating POA, female the in expression gene in sex-differences basal disrupted Zeb groups. across expression relative higher indicates red and expression relative lower indicates blue Light females. in treatment Zeb by altered significantly also were that POA the in differences sex basal with maintained at equal levels in males and females by DNA methylation. ( is expression that meaning genes, convergence as to referred therefore are and sexes, both in inhibition Dnmt following females and males in expressed differentially became genes 400 Almost females. in observed methylation DNA higher the with consistent treatment, Zeb following males in than females in expression changed significantly genes more Overall, inhibition. Dnmt following levels male to decreased were females in levels higher at expressed genes the of half to Close expression. dependent Dnmt inhibition, indicating methylation- following females in increased were males in expression higher with genes of 70% these, Of females. in expressed highly more being 36 and males in expressed highly more being 34 with females, and males in levels different at expressed be to found were genes 70 Only POA. neonatal the in expression gene dependent representation of sex differences in methylation- expression in the female POA. ( gene in changes methylation-dependent identify to RNA-Seq to subject and extracted was mRNA PN2, On Zeb. with PN1 and PN0 on treated were Animals inhibition. Dnmt by expression Figure 5 ART a

female 313 ze femal : males showed increased expression after Dnmt inhibition, inhibition, Dnmt after expression increased showed males :

IC Masculinization of POA gene gene POA of Masculinization 34 male e b > 24 fe LE m differences in 70 genes > Se S x 36 fem mal c ) Heat map of genetic isoforms with basal sex differences that were significantly altered by Zeb treatment in females to create a create to females in treatment Zeb by altered significantly were that differences sex basal with isoforms genetic of map ) Heat 63 female 14 zeb female e differences) prevents sex genes (methylation 381 convergence > a ) Schematic ) Schematic > 2

6

, suggesting that there is pres is there that suggesting , d –1 b row Zscore ) Bar plot of all changes in total gene expression induced by Zeb treatment in the neonatal female POA. POA. female neonatal the in treatment Zeb by induced expression gene total in changes all of plot ) Bar

Foxp2

0

d 1 mRNA and protein in –2 Female n = 2 female, 3 Zeb female, 3 male, 3 Zeb male (not represented in plots). in represented (not male Zeb 3 male, 3 female, Zeb 3 female, 2 = Cyp19a1 02 Log Male b gene, which encodes the enzyme p450 aromatase, a known contributor to contributor a known aromatase, p450 enzyme the encodes which gene, ) Heat map of genes genes of map ) Heat 2 foldchange -

encodes encodes Neurabin II, suggesting that the well was more highly expressed in males than females was were ( in versus males females higher isoforms 87 and females, control in POA than male the in expressed highly more were isoforms gene 100 of total A expression. gene all over for observed than more far POA, developing the in expression promoters gene of methylation alternative isoforms via differential transcript specific of expression selective the in implicated been has DNAmethylation DNA methylation regulates sex-specific gene isoform expression 4 Female + zeb 68 ADVANCE ONLINE PUBLICATION

D4A582_RAT Unknown3 Gucy1a NEXN_RAT F1MAJ2_RAT D3ZA18_RA LOC100365317 F1LWD2_RA Ebf LOC100359906 RGD1564597 Ppp1r1b Ptk2b Ox RG1-A2 RGD1565493 Ebf Wdr5 Ccdc153 F1LW98_RA Mns1 DYH1_RAT F1M440_RA Cdh29 Rpl17 Rps24 Crabp1 Gipr Ptgds Nr2f F1M2K3_RAT Unknown2 LOC100364549 F1LN76_RAT Tusc2 Unknown1 Rxr LOC361646 LOC682432 Adora2a Arpp21 Asb14

t 2 2 3 g 2 7 2 . We detected 187 sex differences in gene isoform isoform gene in differences sex 187 Wedetected . 3

inf T T T T c Female Male Fig. Fig. 5

c - Female +ze NATURE NATURE established sex difference ). One gene isoform that isoform ). gene One b NEUR Ppp1r9b ENSRNOT000DDD11679 ENSRNOT000DDD24740 ENSRNOT000DDD66152 ENSRNOT000DDD43509 ENSRNOT000DDD40446 ENSRNOT000DDD27304 ENSRNOT000DDD41994 ENSRNOT000DDD41520 ENSRNOT000DDDD5726 ENSRNOT000DDD66464 ENSRNOT000DDD64208 ENSRNOT000DDD45315 ENSRNOT000DDD17887 ENSRNOT000DDD11074 ENSRNOT000DDD21702 ENSRNOT000DDD65303 ENSRNOT000DDD15991 ENSRNOT000DDD67766 ENSRNOT000DDD61027 ENSRNOT000DDD44972 ENSRNOT000DDD63892 ENSRNOT000DDD23503 ENSRNOT000DDD57013 ENSRNOT000DDDD9802 ENSRNOT000DDD51566 ENSRNOT000DDD12549 ENSRNOT000DDD66096 ENSRNOT000DDD61036 ENSRNOT000DDD55066 ENSRNOT000DDD35009 ENSRNOT000DDD32327 ENSRNOT000DDD36512 ENSRNOT000DDD33489 ENSRNOT000DDD31907 ENSRNOT000DDD45723 ENSRNOT000DDD16568 ENSRNOT000DDD66965 ENSRNOT000DDD35438 ENSRNOT000DDD16038 ENSRNOT000DDD25172 ENSRNOT000DDDD7002 ENSRNOT000DDDD6117 ENSRNOT000DDD65545 ENSRNOT000DDD63860 ENSRNOT000DDD28829 ENSRNOT000DDD55860 ENSRNOT000DDD67823 ENSRNOT000DDD66154 ENSRNOT000DDD36556 ENSRNOT000DDD57476 ENSRNOT000DDD68168 ENSRNOT000DDD55447 ENSRNOT000DDD52877 ENSRNOT000DDD26197 ENSRNOT000DDD41965 ENSRNOT000DDD47440 ENSRNOT000DDD49805 ENSRNOT000DDD57587 ENSRNOT000DDD41218 ENSRNOT000DDD27496 ENSRNOT000DDD21642 ENSRNOT000DDD37199 ENSRNOT000DDD25120 ENSRNOT000DDD41140 ENSRNOT000DDD21456 ENSRNOT000DDD67155 ENSRNOT000DDDD1759 ENSRNOT000DDD44046 ENSRNOT000DDD37752 ENSRNOT000DDD34329 ENSRNOT000DDD26646 ENSRNOT000DDD65955 ENSRNOT000DDD65812 ENSRNOT000DDD67591 ENSRNOT000DDD46259 ENSRNOT000DDD10209 ENSRNOT000DDD19356 ENSRNOT000DDD52270 ENSRNOT000DDDD7941 ENSRNOT000DDD57522 ENSRNOT000DDD45323 ENSRNOT000DDD56257 ENSRNOT000DDD59680 ENSRNOT000DDD36987 ENSRNOT000DDD64196 ENSRNOT000DDD31925 ENSRNOT000DDD24450 ENSRNOT000DDD66321 ENSRNOT000DDD21343 ENSRNOT000DDD46456 ENSRNOT000DDD56437 ENSRNOT000DDD67582 ENSRNOT000DDD66495 ENSRNOT000DDD48535 ENSRNOT000DDD58771 ENSRNOT000DDD18225 ENSRNOT000DDD58936 ENSRNOT000DDD68665 ENSRNOT000DDD60857 ENSRNOT000DDD30995 ENSRNOT000DDDDD464 ENSRNOT000DDDD9763 ENSRNOT000DDD58983 ENSRNOT000DDD50919 ENSRNOT000DDD38727 OSCI , , which

EN C E -

© 2015 Nature America, Inc. All rights reserved. NATURE NATURE transcriptional a as acting system, nervous the in expression gene reversible. thus and tion is that an and feminization active ongoing repression of masculiniza brain and behavior, at confirming was masculinizing effective period tion of the dele genetic or activity Dnmt total of Second, inhibition period. pharmacological sensitive the during treatment estradiol as degree brain to and behavior the same and masculinized of actions estradiol of inhibition ated Dnmt the sites. mimicked Pharmacological activity antibody the that gests whole antibody an using methylation global of measures between consistency of degree high The CpGs. methylated fully of pups of the to activity Dnmts both decrease the and number decrease female newborn of treatment estradiol of ability the in evident was This sites. CpG methylated fully at of particularly reversal methylation, or DNA prevention either and activity Dnmt of was suppression estradiol steroid masculinizing developing the of the action in principle that, a found POA, we First, views. these of both lenge chal data Our undone. be cannot process the complete, once and, period sensitive restricted a during occurs This development. brain to critical genes of expression inducing directly and receptors factor the from default female byphenotype binding to cognate nuclear phenotype transcription male a induce steroids that holds brain the of differentiation sexual mediated hormonally of view traditional The DISCUSSION transcriptome. the in differences sex of differential expression, greatly amplifying both the amount and nature to have sex ables regulates sex a that of mix vari suggesting use, promoter alternative from resulted female and male of 29% and 25% only imprinting parental and ants isoform expression include differential promoter usage, splicing vari gated Ca and physiology, such as structure cellular that are in basic proteins involved encode isoforms ( POA the of feminization for important likely are which females, to exclusive isoforms 37 the of 16 of expression the prevent to able was and males, than in females that expressed were more isoforms 87 highly the of 40 of expression the reduced significantly females in tion POA. Wethe spine in densitydendritic in foundDnmtinhibithat other in morphogenesis regions brain spine dendritic determines that protein 4 Table Zeb in males to similar expression isoform in patterns creating males, in detected exclusively were that of isoforms 32 of 16 the expression the induced and in males, expression had higher that 100 gene normally isoforms tion in the increased females significantly expression level of 58 of the form were by expression regulated DNA as Dnmt methylation, inhibi female POA ( ( POA male the in found exclusively were Moreover,isoforms gene 32 ( treatment estradiol lowing levels higher confirmed of again we qPCR, Using expression. script in spine tran proxy this marker may dendritic from arise differential Supplementary Table 3 Supplementary P < 0.05; Non Ppp1r9b - - genome sequencing detection of fully methylated CpGs sug CpGs methylated fully of detection sequencing genome ). One notable isoform encodes drebrin 1 ( 1 drebrin encodes isoform notable One ). CpG methylation is emerging as an important regulator of of regulator important an as emerging is methylation CpG NEUR 2+ Fig. 5 Fig. channel Cav2.1. The potential sources of sex differences in - de de novo in male POA and a significant increase in females fol specific isoformspecific expression were not found to have overall - Supplementary Supplementary Table 3 2 treated females ( females treated OSCI 8 and may therefore be important for sex differences differences sex for important be therefore may and c and - methyltransferase Dnmt3a outside of the sensitive methyltransferase specific isoform expression. Many specific genes observed EN C Supplementary Table 4 Supplementary - E based assay was biased toward fully methyl Ank1

), whereas 37 isoforms were exclusive to were the exclusive 37 isoforms ), whereas ADVANCE ONLINE PUBLICATION 2 (Ankyrin 1) and and 1) (Ankyrin 9 P . Analysis of promoter usage revealed revealed usage promoter of Analysis . P = 0.047; < 0.05; ). ). Some of the differences in iso - biased isoforms, respectively, respectively, isoforms, biased Fig. 5 Fig. upeetr Fg 7b Fig. Supplementary c Cacna1a ). Many of these gene gene these of Many ). and Dbn1 - based assay and and assay based Supplementary Supplementary , the voltage , the ), a synaptic synaptic a ),

). ). ------

activity of additional enzymes such as the TET family of proteins, proteins, of family TET the as such enzymes additional of activity demethylation to sequester the Dnmts and broadly prevent their action, thereby leading ing to unmethylated DNA. This, combined with a long bind their and bind Dnmts enhance is now to Zeb reversibly known active, be to division cell requires and Dnmts the binds irreversibly genes sor reawakenhypermethylatedtosupprestumor used is therapyand others by observed previously effect an assay, methylation global a in tion glia and neurons in different are markedly samples, methylation CpG CHG and of both patterns that given tissue POA our in types cell of heterogeneity the is study of our A limitation at time. this synaptogenesis of dynamic reflective be may and females masculinized and males with compared females in variable highly was methylated CHG 90–100% were that sites of The number females. and than males both 10–20% masculinized methylation with sites fewer had females particular, in significant differences; were sex there yet methylation, of levels low very had sites in frequency during periods of synaptogenesis repressor similar to CpG methylation, and has been shown to increase or ARs), we found an almost equal distribution of genes expressed at of expressed genes distribution equal we or an found ARs), almost ERs by transcription genomic direct predicted of result a (as males in levels at higher expressed be would of genes majority the that tion differencesoverallin gene expression and, expecta contrary tothe sex few relatively We POA. identified dimorphic sexually highly the adult in the tissue of in results emergence testicular gene, of a single deletion the where ovary, the to apply to appears principle A similar expression. gene relevant control of tight sexually but are robust in males relatively modest in the brains are of adultprofile females expression following gene gonadectomy, in changes Moreover, marks. epigenetic removing by profile genetic male the unmask dose and duration ate appropri of hormones adult that possible is It methylation. gene of by female a female the in suppressed actively instead is it induced, being not simply program genetic male the than rather and consistent view wholly light shed new bywith this that, revealing presence of both male and female circuits or phenotypes. Our data are simultaneous the for arguing some with brain, the of duality the for quent to genetic manipulation treatment hormone adult to response in either behavior There are examples of female rodents that exhibit male challenges. without but not standing, long is brain developing the on expression. isoform gene specific and gene overall both regulates active which DNAvia methylation, the of masculinization process suppressing is feminization that indicate data our demethylation, of brain the demethylationin the role of TET or Gadd45, but they are established regulators of DNA ER including proteins regulatory scriptional tran of recruiters are and stress, as such factors, environmental by base excision repair. Both the TET enzymes and Gadd45 are regulated sion repres epigenetic of free therefore and state demethylated relatively a in islands CpG maintain to speculated are and promoters gene to the of return cytosine to and an unmethylated state repair excision base to subject are that mediates inter of variety a into oxidation to vulnerable then is substrate This whichconvert 5 Inhibition of Dnmt activity resulted in decreased DNA methyla DNA decreased in resulted activity Dnmt of Inhibition Using RNA Using The concept of permanent perinatal organizational effects of steroids 3 6 . Also involved are the Gadd45 enzymes, which are integral to to integral are which enzymes, Gadd45 the are involved Also . 3 2 . Zeb is a well a is Zeb . 3 3 . Originally thought to be a cell suicide inhibitor that that inhibitor suicide cell a be to thought Originally . - Seq, we identified differences in gene expression in in expression gene in differences identified we Seq, - methyl 3 4 . This last step is likely achieved by concomitant concomitant by achieved likely is step last This . 8 , consistent with the view that females maintain - established demethylating agent in cancer cancer in agent demethylating established - cytosines into 5 38 3 , 3 1 4 9 . 1 . Thus, regardless of the final source source final the of regardless Thus, . . . These examples are used as evidence 3 5 . . TET proteins are highly localized - hydroxymethyl A 3 0 3 . The majority of CHG 7 . We did not explore We explore . not did ART 4 2 - . - specific pattern pattern specific - half half life, acts to like like mounting 4 0 - IC or conse or cytosines. cytosines. LE Foxl2 S 7 ------, © 2015 Nature America, Inc. All rights reserved. 8 4. 3. 2. 1. reprints/index.htm at online available is information permissions and Reprints The authors declare no competing financial interests. performed immunohistochemistry. transgenic mice and G.E.H. and M.M.M. performed mouse experiments. K.M.L. S.E.D. provided additional bioinformatics support for RNA whole C.L.W. conducted repeated qPCR, Dnmt activity assays and DNAextracted for performed bioinformatics analysis of whole and behavioral experiments, analyzed molecular and behavioral data, and B.M.N. performed most of the molecular biology experiments, rat pharmacology B.M.N. and M.M.M. the designed experiments and wrote the manuscript. B.M.N. of requirements MH099562 to S.J.R. This work was conducted as part of the doctoral thesis R01 MH052716 to M.M.M. and F31NS073545 kindly providing the Dnmt3a manuscript. We thank G. Fan (University of California, Los Angeles) for We thank B.K. Krueger and S.M. Thompson for their helpful input on this onl Note: Any Supplementary Information and Source Data files are available in the the BioProject ID under Archive Read NCBI’s in Short found be can reads sequencing Whole Omnibus. Expression Gene NCBI’s in ited codes. Accession the in available are pape the of version references associated any and Methods M enabling the development of sex differences in the brain. and for ultimately feminization, allowing preventing masculinization both DNA methylation, differential involves clearly expression gene proximate mechanism by which females maintain control over neural the summary, In POA. the of differentiation sexual in important are genes autosomal that suggesting X were linked, in females expressed highly more genes 36 the of 3 and males, in expressed highly more few sex differences in X complexity for which there is no current explanation. There were also of layer an additional reveals females in of genes number substantial a reduced inhibition Dnmt that observation Our stimulation. mone default the hor steroid is of absence it the in that occurs that pathwaydevelopmentalgiven difficult been has brain the of nization higher levels in males or females. Identifying genes regulating femi ART 7. 6. 5. COM AUTH ACKNOWLEDGMEN

ET ine version of the pape the of version ine uw, .. Mcools V, aeod J & isa, . oe o estrogen of Roles E. Rissman, & J. Gatewood, V., Michopoulos, A.E., Kudwa, brain. the D.J. Mangelsdorf, of differentiation sexual Reframing A.P. Arnold, & M.M. McCarthy, brain. developing the and Estradiol M.M. McCarthy, Bakker, J., Honda, S.I., Harada, N. & Balthazart, J. The aromatase knock-out mouse Amateau, S.K. & McCarthy, M.M. A novel mechanism of T. dendritic spineSato, plasticity involving o te xrsin f oisxa bhvos n adulthood. in behaviors sociosexual of (2002). 9104–9112 expression the for female the in development during required is estradiol that evidence new provides prostaglandin-E2. of induction estradiol USA Sci. Acad. Natl. Proc. (2006). 921–928 receptors 83 Neurosci. Nat. (2008). P H - , 835–839 (1995). 835–839 , genome bisulfite sequencing. A.C.S. analyzed RNA analyzed A.C.S. sequencing. bisulfite genome O E ODS TI R IC CON NG A t al. et and LE FI TRIBUTI

N l 14 . A ri msuiiain eurs nrgn eetr function. receptor androgen requires masculinization Brain B S in differentiation of mouse sexual behavior. sexual mouse of differentiation in , 677–683 (2011). 677–683 , et al. et NC RNA 27579 r TS . r IA . The nuclear receptor superfamily: the second decade. second the superfamily: receptor nuclear The ON L - loxP/loxP linked linked genes. Only 1 of the 34 genes that were I - 6

e ras ( reads Seq N 101 S . T E , 1673–1678 (2004). 1673–1678 , R mice. This work was supported by grant E STS J. Neurosci. J. - genome bisulfite sequencing data. GSE6620 - 01 to B.M.N., and R21

22 , 8586–8596 (2002). 8586–8596 , 3 hso. Rev. Physiol. - hv be depos been have ) Seq data, Seq and A.M. and - Seq. Seq. S.J.R. provided http://www.nature.c - genome bisulfite bisulfite genome Neuroscience . Neurosci. J.

88

91–124 ,

online online

138 om/ Cell 22 - - - , ,

43. 42. 41. 40. 39. 38. 37. 36. 35. 34. 33. 32. 31. 30. 29. 28. 27. 26. 25. 21. 20. 19. 18. 17. 16. 15. 14. 13. 12. 11. 10. 9. 8. 24. 23. 22.

Dodge, J.E. Dodge, N.H. Uhlenhaut, behaviour sexual male T.,underlying Kimchi, circuit functional A C. Dulac, & J. Xu, after cycle, estrous the during rat female the in behavior P.Mounting Sodersten, D.P. Gavin, Tan,Y.G.Shi, & L. Tetdevelopment in 5-hydroxymethylcytosine and proteins family repair. DNA and Gadd45 by demethylation DNA Active A. Schafer, & C. Niehrs, proteins-guardians TET methylation: DNA K. Helin, & J. Christensen, K., Williams, D. Globisch, C. Champion, M.A. Sabatino, Miller, C.A. R. Lister, J.U. Guo, R.F. Luco, Takahashi, H. A.K. Maunakea, sex mediates Foxp2 M.M. McCarthy, & M.R. Perez-Pouchoulen, J.M., Bowers, M.M. McCarthy, eeee, . Gli SJ Ms cls n bspis n curd immunity. acquired in basophils and cells Mast S.J. Galli, & J. Wedemeyer, methylation. DNA in concepts New R.Z. Jurkowska, & A. Jeltsch, Q. LaPlant, the in retained actively is methyltrasferase DNA H. Leonhardt, & M.C. Cardoso, Everitt, B.J. Sexual motivation: a neural and behavioural analysis of the mechanisms E2 prostaglandin of Identification M.M. McCarthy, & S.R. Burks, C.L., Wright, A. Satoh, P. Siedlecki, formation. memory in structure chromatin of Regulation J.D. Sweatt, & T.L. Roth, therapy.epigenetic for drug P.A.new Jones, a & Zebularine: J.C. Cheng, Yoo,C.B., J.U. Guo, vertebrate the of differentiation Sexual S.M. Breedlove, & C.L. Jordan, J.A., Morris, sexually of development and organization reproduction: for Wired R.B. Simerly, X. Xu, mta, .. MCrh, .. nuto o PE b etail mediates estradiol by PGE2 Lauber, M.E., ofSarasin, A. & Lichtensteiger, W. InductionTransient sex differences of aromatase M.M. McCarthy, & S.K. Amateau, and cells mast brain GnRH, R. Silver, & M. Khalil, L., Asarian, A.J., Silverman, Br. Med. Bull. Med. Br. Sci. accumbens. nucleus development. early during cytoplasm and Rev. rats. behavior male of responses copulatory sex and appetitive underlying adult of masculinization perinatal correlates. neuroanatomical mediating receptors (1998). methylation. Neurobiol. Opin. Curr. Trans.Soc. Biochem. brain. adult forebrain. mammalian the in circuits dimorphic (2012). 596–607 J. Biol. Chem. Biol. J. immortalization. spontaneous and instability, chromosomal hypomethylation, dna ablation. FOXL2 brain. mouse female the in (1972). 307–320 administration. testosterone or estrogen after and ovariectomy, (2012). 531–542 psychosis. major in demethylation DNA mediated disease. and Biol. TrendsCell islands? CpG of intermediates. demethylation active zebularine. by methyltransferases brostallicin. binder groove Epigenetics minor DNA the to sensitivity restores and cells cancer 13 development. brain. mammalian adult the (2011). Neurosci. J. morphogenesis. spine dendritic and density-95 postsynaptic of targeting synaptic promoters. alternative maternal of order directs and pups retrieval. rat by vocalization ultrasonic in differences Neurosci. J. brain. rat (1997). 173–180 developing the in expression mRNA (CYP19) behavior. sex of masculinization developmental behavior. nervous system. nervous (2002). , 664–666 (2010). 664–666 ,

39 14 t al. et , 310–318 (2014). 310–318 , , 217–232 (1990). 217–232 , ADVANCE ONLINE PUBLICATION J. Neurosci. J. Prog. Brain Res. Brain Prog. et al. et et al. et t al. et

et al. t al. et

t al. et et al. et et al. et 8 Nat. Neurosci. Nat. oua gntc oto o sxal dmrhc behaviors. dimorphic sexually of control genetic Modular 23 32 t al. et J. Med. Chem. Med. J. Development t al. et , 656–665 (2013). 656–665 , et al. Science

t al. et

56 280 Distribution, recognition and regulation of non-CpG methylation in methylation non-CpG of regulation and recognition Distribution, , 6586–6595 (2003). 6586–6595 , (2012). 2241–2247 , Neuronal activity modifies the DNA methylation landscape in the in landscape methylation DNA the modifies activity Neuronal Cortical DNA methylation maintains remote memory. t al. et

EMBO Rep. EMBO t al. et et al. et pgntc i atraie r-RA splicing. pre-mRNA alternative in Epigenetics Nat. Neurosci. Nat. et al. et Cell Inactivation of dnmt3b in mouse embryonic fibroblasts results in results fibroblasts embryonic mouse in dnmt3b of Inactivation Dnmt3a regulates emotional behavior and spine plasticity in the in plasticity spine and behavior emotional regulates Dnmt3a 22 lbl pgnmc eofiuain uig amla brain mammalian during reconfiguration epigenomic Global t al. et , 936–955 (2000). 936–955 , N e u r a b i n - I I / s p i n o p h i l i n . rwh ret n DAdmg-nuil, ea (GADD45b)- beta DNA-damage-inducible, and arrest Growth Drebrin-dependent actin clustering in dendritic filopodia governs ise itiuin f -yrxmtyctsn ad erh for search and 5-hydroxymethylcytosine of distribution Tissue , 17986–17991 (2005). 17986–17991 , icvr o to oe, ml-oeue niios f DNA of inhibitors small-molecule novel, two of Discovery , 220–227 (2012). 220–227 ,

Nat. Neurosci. Nat.

139

Sex differences in the brain: the not so inconvenient truth. inconvenient so not the brain: the in differences Sex

euaie atal rvre GT ehlto i prostate in methylation GST reverses partially Zebularine Conserved role of intragenic DNA methylation in regulating in methylation DNA intragenic of role Conserved 32 33 Nature 341 19 ehnsi isgt o te niiin f 5 DNA C5 of inhibition the on insights Mechanistic oai sx ergamn o aut vre t tse by testes to ovaries adult of reprogramming sex Somatic , 910–912 (2004). 910–912 , , 3276–3283 (2013). 3276–3283 , , 336–342 (2009). 336–342 , , 1130–1142 (2009). 1130–1142 ,

, 1237905 (2013). 1237905 ,

139 141 14

Nature Dev. Neurobiol. Dev.

49 Nat. Neurosci. Nat.

13 466 , 1345–1351 (2011). 1345–1351 ,

, 1895–1902 (2012). 1895–1902 , , 315–325 (2002). 315–325 , , 678–683 (2006). 678–683 , , 28–35 (2012). 28–35 , 7 , 1034–1039 (2004). 1034–1039 , , 253–257 (2010). 253–257 , PLoS ONE PLoS

448 PLoS ONE PLoS 13 J. Cell Biol. Cell J. , 1137–1143 (2010). 1137–1143 , , 1009–1014 (2007). 1009–1014 ,

17 68

. il Chem. Biol. J. 5 Nat. Neurosci. Nat.

, e12388 (2010). e12388 , , 215–222 (2014). 215–222 , , 1406–1419 (2008). 1406–1419 , Annu. Rev. Neurosci. Rev. Annu. 5

, e15367 (2010). e15367 ,

147 NATURE NATURE Neuropsychopharmacology , 25–32 (1999). 25–32 , Neuroendocrinology

7

NEUR ersi Biobehav. Neurosci. , 643–650 (2004). 643–650 , 273 Cell om Behav. Horm. TrendsBiochem. , 3470–3475 3470–3475 ,

Nat. Neurosci.

25 OSCI 144 , 507–536 , Cell 16–26 , EN

148

37 66

C 3 E , , , ,

© 2015 Nature America, Inc. All rights reserved. doi: interfaced with a Nikon Eclipse E600 microscope at 40× magnification. fixed in 18% Kodak Fix. Neurons were rinsedtraced again in dH using Neurolucida (MBF Biosciences) for week. 1 Slides weredarkdH in the toin dry rinsed on were a at sectioned cryostat 100 Brains were transferred to Solution C (RapidGolgi Kit, FD) for 3 d at 4 °C. tionBrains (K ice cold saline for approximately 5 min. Brains were removed and placed in COX solu Loos der G significance was set at groups.Statisticalbetween estrus of stage each inspent daysnumberof the in previouslydensityas ofcells described and shape the onday, each based estrus or proestrus diestrus, in as described 15 consecutive days. Cells were viewed at 10× magnification and each Aroundanimal PN40 vaginal smearswas were performed between 10 and 11 a.m. daily for adulthood. to raised andabove, described as PN1 and PN0 on vehicle or Zeb GraphPad Prism for Mac OS X (version 6.00, GraphPad Software). was set at and all other parametric data were normally distributed. Statistical significance differences. D’Agostino and Pearson omnibus normality tests ANOVAsindicatedTukey’sby followed were that these behavioral testing were analyzed by one was blind to the experimental treatment of each animal. Data generated during observer The cycle. animal’slight the of phase dark the during light red dim Assessment of locomotor activity and male sexual behavioreach. min 5 forarenawas the in placed wereconducted Ratsrears). and crosses (grid activity under assess anxiety described previouslybehavior, like of intromission number behavior sexual quantified were numberthe of mounts, latency tofirstmount, of a hormonally primed, sexually receptive stimulus female. Parameters of male thehours of 12p.m. and p.m.,4 Plexiglasina behavioral arena inthepresence sexual behavior was assessed. Animals were video recorded for 30 min between linized females and allows for performance of male sexual behavior in developmentally mascu male adult an of typical levelshormone circulating the mimics capsules these Implantationofneck. the of nape the at testosterone(Sigma) crystalline with 30 was collected at time specified points. pawonforthe treatment group identification. experimentTissueeach in used hormone/drug treatments, animals received small subcutaneous injections1 ofa ink with infused was hemisphere Each bilaterally.delivered were injections ICV syringewas lowered 2mm below the surface of the skull to reach the ventricle. 23 A ventricle. lateral the of location approximatethe to bregma landmark cranial the of visualization for allowing illumination, light bright underintracerebroventricularlypupsistered cryoanesthetized to (ICV) admin Tocris)were DMSO; 10% in ng (300 RG108 or Calbiochem) vol/vol; actions of the steroid. The Dnmt inhibitors zebularine (Zeb, 300 steroidng in and 1% enhancesDMSO, deposition into muscle for slow release; it does not alter ouslythe and dissolved in sesame oil. The benzoate moiety increases solubility of the groups of three. 100 on a reverse 12 h light/dark cycle. After weaning, same sex animals were caged birth. Allin animals were allowed food and water of timing the determine to pupsof presence the for daily checkedwere Cages in maternal care. Pregnant females were isolated and allowed to deliver treatmentnormally. and then randomly distributed back to dams to control for differences experiments, pups from multiple litters were randomly assigned to experimental timed and Use Committee. Rat pups used in the following experiments were birthed by approval from the University of Maryland School of Medicine Institutional Care Rattreatment andbehavioral testing. ONLINE MET olgi- - At PN40 male and female rats were gonadectomized and implanted with a implantedwith andgonadectomized were rats female and male PN40At Estrous cyclicity was assessed in a separate group of female rats, injected with - mm silastic capsule (1.57 10.1038/nn.3988 M l volume of drug delivered over 60 s. Following subcutaneous and ICV and subcutaneous Following s. 60 over delivered drug of volume l - C pregnantorderedratsSpragueHarlanfromDawley Laboratories. all In 2 Cr ox labeling and quantification. and labeling ox 4 A 7 2 . Briefly, deeply anesthetized rats were transcardially perfused with transcardiallyperfusedwere rats anesthetizedBriefly, deeply . O = 0.05. Statistical analyses for all behavioral tests were performed in 7 - , HgCl related behavior (time spent in center of the arena) and locomotor 6 . 3 weeks following surgery and testosterone replacement, male H 2 ODS O, incubated in 1% Kodak Dektol (wt/vol), rinsed again, then 2 M , K g of estradiol benzoate (Sigma) was delivered subcutane A - 2 = 0.05. Data were graphed in R in graphed were Data 0.05. = like behaviors (thrusts) and latency to first intromission CrO - mm inner diameter, 3.18 4 ) for 3 weeks. COX solution was replaced every 3 d. M m and mounted onto slides. Slides were placed 4 post-hoc 4 . Behavior in an open field was used to used was field open an in Behavior . 4 - 5 All experiments were conducted with conductedwere experiments All Labeling was based on Glaser and Van way analysis of variance (ANOVA). All . t tests were toassess used differences comparisons to determine group determine comparisonsto ad ad libitum - 2 mm outer diameter) filled O, 4 6

- incubatedNH in . and were maintained gauge,1 - M l Hamiltonl 4 OH, - - - - -

western blot. western by proteinlevels Dnmtquantification offor or assay activity Dnmt the in use Bradford assay. Nuclear extracts were used immediately or frozen at −80 °C untilthe (Epigentek)using Kit Extraction NuclearEpiQuik the using dissections POA N behavioral experiments. site accuracy into the POA was confirmed via GFP staining in all mice used for with an Olympus BX51 microscope coupled to a cooled CCD camera. Injection slipped with VectaShield Hard Set (Vector Laboratories). Sections were imaged to Alexa Fluor 488 (Invitrogen, 1:333) in PBST + 5% NGS, mounted, and cover antigoat in h 2 for incubated and rinsed subsequently (Aves #1020, 1:3,000; 1DegreeBio ID: 1DB Triton 0.4% X + PBS in vol/vol) (NGS, serum goat normal 10% with blocked previously established protocols for mice followed and group experiment to blindinvestigator an by done was scoring ingstarted at 6 p.m. and was performed under red light conditions. Behavioral 30 min. Testing was conducted at 3–5 for videotapedinteractions behavioral and female stimulusreceptive sexual a subjectanimals weretest cagesinplaced forbefore min 30introduction the of testing of day the On receptivity. sexual induce to implants silastic releasing per cage, by sex until behavioral testing. adult male circulating levels within 2–3 weeks. Animals were group housed, five 0.25 ml) and implanted with a testosterone releasing silastic ofcapsule age that allproduces animals were gonadectomized underwere warmedanesthesia by a (ketamine/acepromazine,heating pad and returned to the Groupdam whenidentification fully active. was Atachieved ~70 byd injection of Indiaover 60 a andlateralinfused mm bregmamm toof depth2.5 0.5 a to ink made into were the injections paws. Bilateral Animals pups. cryoanesthetized on syringe Hamilton 1 needle fixed a with performed were Injections PN1. or birth of day the on 10 × AAV of (1.5 and female pups from 6 litters were bilaterally infused into the POA with 0.23 common genetic background. At the Ichan School of Medicine at generatea generationsto Mt. several for mice 129Jaewith Sinai, backcrossedwere They male erated in the laboratory of En Li at Novartis Institutes of Biomedical Research Dnmt3a Use and Committee. Care Institutional Medicine of School Sinai Mt. the from approval with conducted were ments C treatment effect on any one control protein. a of possibility the reduces which kDa, 43–47 from size proteinsofin ranging loading. The band appearing at approximately 45 kDa contains a large number at approximately 45 kDa was used for standardization to correct errors in samplewith Ponceau S solution. The dense protein band stained by Ponceau membraneswatervisualization, wereand with S distilled stained briefly washed appearing Hyperfilm for of detection proteins by recognized the antisera. The blots wereto exposed used was BioLabs) England (New system chemiluminescence Phototope The tion in goat anti ID: 1DB 0000807789) or anti anti 1DB ID: cat.1DegreeBio no. 1:1,000; Signaling, 2160; (Cell 1DB ID: 1DegreeBio 1:2,000; SC–20701; at overnight and 4 incubated then °C in anti either nonfat in (wt/vol) 0.1% Tweenmilk TBS (vol/vol, T (Bio membrane diflouride polyvinyl SDS8–16%an on lanes Immunohistochemistry. killed and perfused for detection of GFP in the POA. was animals of subset a testing behavioral ofcompletion behavior. the At sex mount time and latency, thrust rate and percentage of animals performing male duration of anogenital investigation, number of solicitations, mounts and thrusts, - onditional deletion of of deletion onditional uclear extraction and western blot. western and extraction uclear 100 (vol/vol, PBST), incubated overnight at 4 °C in antiserum to GFP GFP to antiserum in °C 4 at overnight incubated PBST), (vol/vol, 100 Stimulus females were gonadectomized as above and implanted with estradiol with and implanted as above gonadectomized were females Stimulus Protein concentrations of 10 10 of concentrations Protein

- auatrrs rtcl Poen ocnrtos ee eemnd by determined were concentrations Protein protocol. manufacturer’s Dnmt3b (Cell Signaling, cat. Signaling, no.Dnmt3b ID: 1DB (Cell 1DegreeBio 1:1,500; 2161; - 001 - ECL (Amersham) for varying amounts of time (1–10 min). After After min). (1–10 time of amounts varying for (Amersham) ECL - 0000850617) 0000850617) in 2.5% milk in TTBS, followed by a 30 - rabbit HRP conjugated IgG Signaling; 1:3,000) in (Cell TTBS. 8 infectious units expressingml) per control GFPor Cre/GFP - Neurabin (Millipore, cat. no. 06–852; 1:1,000; 1DegreeBio - polyacrylamide gel (Invitrogen) and transferred to a to transferred and (Invitrogen) gel polyacrylamide D Mouse brain sections were frozen sectioned at 45 45 at sectioned frozen were sections brain Mouse nmt3a and behavioral testing in mice. testingin behavioral and nmt3a M g per 20 per g - d intervals for a total of three tests. All test - Rad). Membranes were blocked in 5% 5% in blocked were Membranes Rad). Nuclear extracts were generated from generated were extracts Nuclear 48 - 001 M , 4 9 l were electrophoresed in separate separate in electrophoresed were l - . Briefly, animals were assessed for 001 - 0000745552) in PBST + 5% NGS, loxP/loxP - - 01035, anti 0001405395), NATURE NATURE Dnmt1 (Santa Cruz, cat. no. - TTBS) for TTBS) 1 h at 23–24 °C mice were originally gen originally were mice - chickenIgG conjugated - NEUR 001 - 0000807788), 0000807788), - min incuba OSCI All experi - - s period. period. s Dnmt3a Dnmt3a EN - 001 M - C m, 4 M M 3 E ------l l .

© 2015 Nature America, Inc. All rights reserved. NATURE NATURE de and bismarkby produced files SAM sort to used bismark mapper aware were mapped to the UCSC ht trimmed reads shorter than 20 bp was performed with Trimbioin Galore (version 0.3.7, (version0.10.1, FastQC with performed was controlreadsraw on in provided are libraries of Details library. 98% that per reads million 276 averageof an greater obtained we andsamples nine of each was for efficiency conversion Bisulfite QC. library following single tion. Bisulfite converted DNA libraries were produced and adaptor ligated, and ratio of between 1.8 to 2.1. 1 fied with absorbance spectroscopy such that the samples had a 260 nm/280 nm the manufacturer instructions. The concentration and quality of gDNA was veri from PN4 preoptic areas using the Qiaamp DNA Micro Kit100 (Qiagen) according to W the mean used ANOVA followed by a Tukey’s where manufacturer the by reader. Percent microplatemethylation a using was nm calculated450 of usingabsorbance thean atfollowing read reaction equationcolorometric a supplied with an anti probed then and wells plate to bound was manufacturer’sDNA instructions. the following samples tissue POA from collected DNA of methylation global quantify to used was (Epigentek)Kit Ultra QuantificationMethylation DNA Kit Purification DNA Genomic Global Methylampmanufacturer’sThe Wizard the instructions. following(Promega) the using extracted was samples DN Data in graphical form represent the mean same assay kit. All statistical tests used the of versionolder, colormetric an using obtained were material plementary two transform the fluorescent values from each sample. Data were analyzed using a platestoother equationregressedthe fromthe to equal equationset raticand quad a with regressed were together which extracts, nuclear pooled from tein 0.1 and 0.2 0.4, 0.6, 1, of standards triplicate contained plate each 590 530 using quantified fluorometrically be then activity,can enzyme to proportional is which DNA,methylated of amount antibody.The substrate. The methylated DNA is then with recognized an anti methyl the from cytosines to nuclearDnmttion,samplesfromenzymesthe extract transfermethyl group a cytosine a with coated are wells to measure total Dnmt activity, from all three Dnmt isoforms. In this assay, strip instructions. The EpiQuik Dnmt Activity/Inhibition Assay Ultra Kit is designed #p (Epigentek Kit Ultra Assay Inhibition triplicatefor relative levels of Dnmt activity using theEpiQuik Dnmt Activity/ D mean A Tukey’sa by followed each lane represents one animal. Data were analyzed using a one samplesments5–8 withgroupfor eachblot. western eachForwithinblots, all experi all for immunoblots several across compared were Samples software. with a CCD camera and quantified using US National Institutes of Health Image Methylatio < 0.05 as the criterion for significance. Data in graphicalrepresentformincriterion forsignificance.Datathe the as 0.05 < nmt activity assay. tp://www.bioinformat hole-genome bisulfite sequencing. bisulfite hole-genome The integrative grayscale pixel area density (IAD) for each protein was captured - A isolation and quantification of global methylation. global of quantification and isolation A - M nm emission readings from a microplate reader. To compare across plates, way ANOVA followed by a Tukey’s formatics.bbsrc.ac.u A g of estradiol benzoate or oil on PN0 and PN1. Genomic DNA was isolated - o < 0.05 as the criterion for significance. Data in graphical form represent n ras ee eune o a Ilmn HiSeq Illumina an on sequenced were reads end X s.e.m. for each group. each for s.e.m. = 42%, CG content in the rat. Data were analyzed using a one a using analyzed were Data rat. the in content CG 42%, = o NEUR n( s.e.m. for each group. each for s.e.m. - 5 %) - methylcytosine antibody and HRP antibody methylcytosine OSCI  ( Positive 0.5 0.5 5 EN post hoc post 0 ics.babraham.ac.uk/p (version 0.13.0). Samtools 0.13.0). (version k/projects/fastq ( M C Samp g of nuclear extracts from the POA were analyzed in Rattus norvegicus E Cont M - donormolecule,Adomet, methylateto DNA the g of gDNA sample was used for library construc post hoc test when appropriate. All statistical tests used used tests statistical appropriate. All when test le - OD rro rich DNA substrate. During a 45 a During substrate. DNA rich lO

test when appropriate. All statistical tests Pups were treated subcutaneouslywithtreated were Pups A DN Negative c post hoc - < 0.05 as the criterion for significance. ), and adaptor trimming and removal of 3010) according to the manufacturer’s

o rojects/trim_galor rn5 genome with the methylation s.e.m. for each group. each for s.e.m. Supplementary Table 5 Table Supplementary egat test. Dnmt activity data in sup Contro iv 5 - 1 linked secondary to produce (version 0.1.19–96b5f2294a) eC - duplicatereads. files SAM ontrol lO - 50 y Epigentek, by 2500 D) - nm excitation andexcitation nm - DNA from POA from DNA OD e 5 / ). Trimmed reads X - methylcytosine - )1 wayANOVA r http://www. - M min reac min 0 g of pro of g . Quality Quality . r 100% - way ------

TCCAGCTTATCATTCACA; GTT, Rev 5 5 For variants) all against designed primers 5 5 For variants) all against 5 Forvariants) all Dnmt3a 5 follows: as are sequences Primer Biosystems). go total for Primers (IDT). TechnologiesDNA Integrated by synthesized were primers All used. until °Cstored was−at20 thenand min for5 °C 85 and h for2 °C 37 min, 10 40 2 and transcriptase 4 1 mixing(Applied byBiosystems) strandcomplementary DNA capacitysynthesizedhigh was cDNA thewith kit Qiagen’s per Single digestionprotocol. DNase and columns and Qiazol with P real-timeQuantitative GraphPad Sofware). was performed in R and graphed in GraphPad Prism foranalysis Additionaldata <0.01. Mac of value q OSa groups,with X between 10% (versionleast at 6.00; coverage before analysis. Differential methylation wasfor defined normalizedas a anddifference site, of per reads three least at of cutoff a with coverage, on MethylKit using analyzed were ies were prepared with a TruSeq RNA Sample Prep kit (Illumina) using the the using (Illumina) kit Prep Sample RNA TruSeq a with prepared were ies mRNA Illumina PN2. on extracted was RNA and Zeb hemisphere per ngwereeithervehicleDMSO)with treated300orandPN1(0.1% PN0 on because it showed aberrant read counts compared to all other samples. Animals group.Onevehicle at the University of Maryland on 12 rat cDNA samples, R for to G.E. the standard curve. The G.E. for the gene of interest for each sample was normalized ( growth2 of generated cycle thresholds from the standard curve with a regressed exponential 65 °C and 95 °C after the 40 cycles. Threshold fluorescence between incrementswas °C set0.1 atgeneratedto were a curves Meltingabove.value step sionthat Ebf2 40 cycles of 95 °C for 15 s and an extension stepreal ofthe 60in °C cycled for and 60 s. The protocol for Master Mix (Applied Biosystems) containing 100 nM of the primer pairs above diluted sample or standard was then added to 15 sampledilutedwas1:30.Performing to reactionsalltriplicate, in 5 standard were defined as one genomic equivalent (G.E.). The cDNA from each diluting the pool 1:10, 1:30, 1:90, 1:270 and 1:810. Values attained from the 1:30 weregenerated by pooling an equal amount of cDNA from the samples all and machine (Applied real Biosystems)7 ViiA a using on ViiA method 7 curve softwarestandard the (versionusing quantified 1.1).was The standards 5 AGAA; 5 NM_0 promoter specific brain 5 5 Rev For 5 variants) all against designed primers TGCCGCCCTCTTCAGTAACA; ers designed against all variants) ACGCTTTGTCTACACTGCCCTTAA, Rev 5 XM_006 CTTATGTGCCGGACTCA; 5 For variants) all Darpp32 5 ` ` ` ` ` ` N GCTTTGACGGTGGCGAGAA, Rev 5 Rev GCTTTGACGGTGGCGAGAA, GCAAACTCACCACCTTCAAGAGT, Rev 5 Rev GCAAACTCACCACCTTCAAGAGT, AGGCCAAGCGTCTCATCAAG, Rev 5 Rev AGGCCAAGCGTCTCATCAAG, TCACAAGAGAAGGCAGCCCTGGT. Quantitative real CCTCTTCTTCGCCTGTTTTGTC, Rev 5 C A A A C T C C T T G T C A T C C T G A T A C T C A ; M v M . All other primers were designed using Primer Express (version 3.0, Applied A-Seq. RT Buffer, 4 Buffer,RT × 10 of L had an additional primer annealing step of 59 °C for 10 s before the exten the before s 10 for °C 59 of step annealing primer additional an had L with nuclease free water. The mixture was then incubated at 25 °C for °C 25 at incubated then was mixture water.The free nuclease with L ` ACGAAGCAAAGCTTTCCGAACCGT; 17085. Gapdh ( 230462. ( N RNA ` NM_138521. TTTGATGCAGGGTGTAGCTTCTG; TTTGATGCAGGGTGTAGCTTCTG; M_001003958. R 2 ( Gapdh n h tasae rgo fr ees pie dsg) For design) primer reverse for region translated the in 2 NM_017008. > 0.98). The G.E. for each sample was determined against the againstdetermined samplewas each for G.E. The 0.98). > - 1 Seq Seq was performed by the Institute for Genome Sciences (IGS) , Nr2f2 XM_00623046 ` - TTTCTTGAGTCTAACCCCGTGATG, Rev 5 treatedfemalesamplelater wasremoved analysisfromthe M ` for each sample. each for AGCCCCAGAGAGATGGAAACTC, Rev 5 - L of RNase inhibitor and bringing the total volume to volume total the bringing and inhibitor RNase of L time machine as follows: 95 °C for 10 min, followed byfollowed min, 10 for °C 95 follows: as machine time and 1 and Cyp19a1 C M 1 ` R. dNTP Mix, 2 2 Mix, dNTP × 25 of L GATGTGACACCTAAGAGCAGCAGTAC, Rev and Gapdh 4 ) For 5 Ebf2 RNA was extracted using the RNAse easy kit easy RNAse the using extracted was RNA 5 Dnmt3b 2 XM_006247344. (version 0.9.2) in R. Reads were filtered based 3. NM_001003957. Nr2f2 1 ( ( were designed at M , ` g total RNA with 4 RNAwith total g XM_006230464. TGGTGAAGGTCGGTGTGAACGG, Rev NM_001108383. EF474097. ( ` ( TCTGCAAGAACTCGACCACAATC; NM NM_001003959. ` ` CACGTCGACTCCGCCGAGTAC, GGCGGTCTCTTTTTTCAGGAA; ` ATGAGACGGTTTCAGGTCGT _080778. ` ` ATCTTGTGCTATTTTGCCTC ATGCCCTTCGCCCTCACA; 1 Adora2a M for forward primer design, design, primer forward for 1 Ppp1r9b Dnmt1 L of Power SYBR Green PCR primers designed against against designed primers Ebf3 1 primers designed against designed primers M 1 http://ww 1 , L of MultiScribe reverse MultiScribe of L 2 X and ( and and n M N M_006230465. ( ( = 3 per experimental ( L random hexamers,random L M_001108506. doi: 1 NM_053294. NM_053354. NM_053474. - primers designed designed primers XM_0062293 time PCR (qPCR) PCR time XM 10.1038/nn.3988 w.ncbi.nlm.nih. _006252133. ` - - TGCAAC M Seq librarSeq time PCR time L of each of L ` TGAG 1 3 3 , prim 1 1 For ) For ) ) For ) 66. , and 1 1 - - - - ` ,

© 2015 Nature America, Inc. All rights reserved. doi: using gplots R in generatedweremapsHeat genes. andtranscripts expresseddifferentially 0.1, < FDR conditionsnegativethe thetestedusing binomialwasdistribution. cutoffof A differential expression of genes or transcripts belonging to the same gene across calculate the significance of observed changes in expression. The significance of and varianceestimateTranscript to dances. used replicatesexpressionisfrom that the number of reads produced by each transcript is proportional to its abunples (grouped by condition) at the transcript level. The statistical model assumes (FPKM). Cuffdiff was used to estimate the differential expression between sam mapped fragments Million per exon of Kilobase PerFragments in transcripts of abundance of measure a produces and files TopHatalignment the within providedinformation read spliced the using transcripts individual assembles and test for differential expression and regulation transcriptome RNA aligned to assemble method a as ComputationalBioinformaticsfor andBiology Center Maryland tome identification tool. The Cufflinks tool has been developed at University of rate (FDR) < 0.1 and entially expressed if they met a fold change (FC) cutoff of > 1.0, a false discovery differentiallyhighlybycaused expressedwere considered genes.Genes differ distortion and depth sequencing for normalized were samples of counts read plausiblydifferentially expressedcomparedgenes when samples. between The calculated by the HTSeq read count tool. DESeq utilizes read counts readsto mappeddetermine to each gene described in the Ensembl gene annotation DESeq for rn4 was reads that aligned to more than 20 locations. BAM files were then forwardedment intophase, we allowed up to two mismatches per 30 sequence, downloaded from the UCSC Genome Browser’s server. In the align alignment tool the median Phred IGS quality control pipeline assesses base call quality and truncates reads where in IGS and index demultiplexing. Data were then processed through both FastQC and software,includeswhich image analysis, sequencecalling,quality base scoring fromthesequencer was processed using Illumina’s RTA and CASAVA pipeline sequencer. An average of 87.9 million reads were generated per library. Raw data were sequenced using the Libraries 100 Genomics). Coulter (Beckman beads XT AMPure with performed was library the of selection size the andreactions enzymatic between purified double the to ligated were indexes nucleotide six manufacturer’sIGS with protocol The alignment BAM files were next inputted into the Cufflinks transcrip Cufflinks the intoinputted next were files BAM alignment The TopHat the into fed were sample HiSeq rat each from obtained reads The 10.1038/nn.3988 - 5 house pipelines for sequence assessment and quality control. By default, 4 to analyze count data and test for differential expression. The number of P 5 5 < 0.01 and a fold change (FC) > 1 were used to select significant select to used were 1 > changefold(FC) a and 0.01 < . 5 3 to be aligned to the the to aligned be to - like quality score falls below Q20. P < 0.05. < - Seq Seq reads into transcripts, estimate their abundances, - bp bp paired - specific optimizations. Adaptorsspecific containing Rattus norvegicus - end protocol on an Illumina HiSeq2000 - stranded cDNA. DNA was DNAcDNA. stranded - bp segment and removed (rn4) reference genomic - wide. Cufflinks - - - - - 55. 54. 53. 52. 45. 44. latency analysis. thrust fromexcluded were thrusts displaynotnot did that females was is, that scored; it observed not was behavior a If videotapes. scoring during tainty group naturally adulthood, to Because these experiments included developmental treatment of animals raised rare. was of outliers occurrence the overall and group per outlier one than more never was There mean. the below or above s.d. the outside 2× differences in the brain. For all experiments, data points were excluded if of 0.5–2.0,they both offell which are based on 30 years of experience in the study of sex anticipatedanand mean magnitude differencethe of 10% exceednot didthat s.d. predicted a on based was analyses behavioral and molecular other all for assays, which prevent across assay comparisons in the 96 well plates. Sample size methylationglobal limitationsassaystechnicaltoweredue keptsmall these of sizes. sample on information Additional 51. 50. 49. 48. 47. 46. A n’sbehavioralexperiments,themost In same. outthe groupstartedeach in

Warnes, G.R. data. count sequence for analysis expression Differential W. Huber, & S. Anders, with junctions splice TopHat:discovering S.L. Salzberg, & L. Pachter,Trapnell, C., A. Akalin, Todd, B.J., Schwarz, J.M. & McCarthy, M.M. Prostaglandin-E2: a point of of point neonatalD.W.consequences EnduringofPfaff, McCarthy,& Schlenker, M.M.,E.H. a Prostaglandin-E2: M.M. McCarthy, & J.M. Schwarz, B.J., Todd, Li, H. Li, for caller methylation and aligner flexible a Bismark: S.R. Andrews, F.& Krueger, Park, J.H., Bonthuis, P., Ding, A., Rais, S. & Rissman, E.F. Androgen- and estrogen- behavior sexual male underlying circuit functional A C. Dulac, & J. T.,Xu, Kimchi, obverse-reverse by sections brain thick of Analysis H. Loos, der Van & Glaser,E.M. computing. statistical for environment and language Team.a Core R: R ramn wt atsne lgdoyuloie t etoe rcpo messenger receptorbrain. rat of differentiation estrogensexual on acid ribonucleic to oligodeoxynucleotides antisense with treatment (2005). 512–521 version 2.14.1. version Biol. Genome RNA-Seq. profiles. methylation DNA wide (2009). 2078–2079 applications. Bisulfite-Seq mice. B6D2F1 male in castration following behavior copulatory of regulation independent stain. Golgi-Nissl brain. mouse female the in clarity high new, a of Methods Neurosci. J. application microscopy: computer r-project.or (1993). iegne n srdo-eitd eul differentiation. sexual estradiol-mediated in divergence Supplementary Supplementary n values. et al. et Horm. Behav. Horm. et al. et Bioinformatics g The sequence alignment/map format and SAMtools. and format alignment/map sequence The (R Foundation for Statistical Computing, 2014). Computing, Statistical for Foundation (R et al.

N 11 MethylKit: a comprehensive R package for the analysis of genome- of analysis the for package R comprehensive a MethylKit: values for behavioral measures often varied due to uncer to due varied often measures behavioral for values http://CRAN.R-proje , R106 (2010). R106 , gplots: various R programming tools for plotting data. R package M

56

- ethods 4 occurring, random animal loss sometimes altered final , 117–125 (1981). 117–125 , , 254–263 (2009). 254–263 ,

25 Bioinformatics Nature , 1105–1111 (2009). 1105–1111 , C Genome Biol. Genome hecklist

448 ct.org/package=gplot , 1009–1014 (2007). 1009–1014 , is available.

27 Sample sizes for Dnmt activity and activity Dnmtfor Samplesizes , 1571–1572 (2011). 1571–1572 ,

13 , R87 (2012). R87 , NATURE NATURE Endocrinology s (2014). om Behav. Horm. NEUR Bioinformatics

133 OSCI http://www. , 433–439, EN

48 25 C E - , ,