A Dissertation Entitled Erk1/2 Signaling Pathway And

A Dissertation

Entitled

Erk1/2 Signaling Pathway and Transcriptional Repressor Gfi1 in the Regulation of

Neutrophil versus Monocyte Development in Response to G-CSF and M-CSF

Nan Hu

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the

Doctor of Philosophy Degree in Biology

______Dr. Fan Dong, Committee Chair

______Dr. Lirim Shemshedini, Committee Member

______Dr. Deborah Chadee, Committee Member

______Dr.Stanislaw Stepkowski, Committee Member

______Dr. Kam Yeung, Committee Member

______Dr. Patricia R. Komuniecki, Dean College of Graduate Studies

The University of Toledo

August 2015

This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of

Erk1/2 Signaling Pathway and Transcriptional Repressor Gfi1 in the Regulation of Neutrophil versus Monocyte Development in Response to G-CSF and M-CSF

Nan Hu

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biology

The University of Toledo

August 2015

All lineages of mature blood cells are derived from the hematopoietic stem cells which reside in the bone marrow. Blood cell development, a process called hematopoiesis, is regulated by different mechanisms. At the cellular level, multiple transcription factors are critical for blood cell development. For example, the ratio of c/EBP to PU.1 is important for the direction of differentiation. High c/EBP to PU.1 ratio favors neutrophil differentiation whereas low c/EBP to PU.1 ratio leads to monocyte/macrophage differentiation. In addition to transcription factors, hematopoietic cytokines also play important roles in hematopoiesis. Granulocyte-colony stimulating factor (G-CSF) acts on the lineage of granulocytes while macrophage-colony stimulating factor (M-CSF) acts on the monocytic lineage. Hematopoietic cytokines are known to stimulate cell proliferation and survival, but whether these cytokines actively induce the differentiation of hematopoietic progenitor cells is still controversial. Our lab has previously shown that murine myeloblastic 32D cells transfected with wild type G-CSF receptor differentiated into neutrophils after G-CSF treatment, but cells transfected with the truncated G-CSFR lacking the three C-terminal tyrosine residues (Tyr 729, 744, 769) iii failed to differentiate. To address whether the three tyrosine residues are involved in granulocytic differentiation, 32D cells were transfected with a mutant G-CSFR (mA) in which the three tyrosine residues have been mutated to phenylalanine. Interestingly,

32D/mA cells showed monocytic differentiation in response to G-CSF, as evidenced by attachment to culture flasks, morphological features and expression of monocytic differentiation markers F4/80, Mmp-12 and M-CSF. By individually mutating each of the three tyrosine residues, we demonstrate that Tyr 729 of G-CSFR is required for the neutrophil differentiation in response to G-CSF. We further demonstrate that Erk1/2 activation upon G-CSF treatment is prolonged in 32D/Y729F and FDCPmix/Y729F cells as compared to WT cells and inhibition of Erk1/2 pathway using specific inhibitors and

Erk1/2 knockdown partially reversed monocytic differentiation of 32D/Y729F and

FDCPmix/Y729F cells. Together, these results indicate that Tyr729 of the G-CSFR negatively regulates Erk1/2 activation and that mutation of Tyr729 leads to prolonged

Erk1/2 activation. Furthermore, Erk1/2 activation upon M-CSF treatment is prolonged in

Lin- primary bone marrow cells as compared to G-CSF treatment. Mek1/2 inhibitors favor neutrophil development at the expense of monocytic development of Lin- bone marrow cells upon M-CSF treatment. To find out the downstream targets of Erk1/2, we examined expressions of c-Fos, Egr1 and phosphorylation of c-Fos which are important for monocytic differentiation. Both 32D/Y729F cells and FDCPmix/Y729F cells showed prolonged induction of c-Fos and Egr1, which is consistent with stronger induction of

TRE3-tk-Luc (containing 3 repeats of AP1 binding elements) and EBS24-Luc (containing

4 repeats of Egr1 binding sequence). We further showed that c-Fos or Egr1 knockdown restored neutrophil differentiation of 32D/Y729F cells and FDCPmix/Y729F cells, along

iv with repression of Mmp-12 and M-CSF. Together we have shown that Tyr729 is essential for instructing neutrophil development, and activation of Erk1/2 regulates neutrophil versus monocyte development through Egr1 and c-Fos.

Gfi1 is a transcriptional repressor that plays an important role in hematopoiesis.

Gfi1 favors neutrophil development and antagonize monocyte/macrophage development.

It has been shown that Gfi1 represses M-CSF, M-CSF receptor and Egr2 expression which are important for macrophage differentiation. Gfi1 also represses PU.1 transcription and further inhibits PU.1 activity through protein-protein interaction.

However, it is still incompletely understood how Gfi1 regulates neutrophil versus monocyte cell fate choice. Here we demonstrate that Gfi1 represses Egr1 and c-Fos to block macrophage development in both 32D and FDCP-mix A4 cell. Gfi1 knockout mice lack neutrophils and have elevated number of abnormal monocyte progenitors. We have also shown that mRNA levels of Egr1 and c-Fos were elevated and Erk1/2 activation was stronger in Gfi1-/- BM cells compared to Gfi1+/+ cells. To address whether strong activation of Erk1/2 is associated with the abnormal differentiation of Gfi1-/- BM cells through Egr1 and c-Fos, Gfi1-/- BM cells were treated with Mek1/2 inhibitors U0126 and

PD0325901. Egr1 and c-Fos mRNA levels were repressed significantly. Interestingly,

U0126 and PD0325901 also restored neutrophil development of Gfi1-/- BM cells in response to G-CSF. Together, our data showed a new mechanism of the action of Gfi1 in myelopoeisis that Gfi1 represses Egr1 and c-Fos expression through direct promoter binding and the abnormal differentiation of Gfi1-/- BM cells is associated with strong activation of Erk1/2.

This work is dedicated to my mother, Peizhi Kong, for her love and sacrifice.

Acknowledgements

I wish to thank my advisor, Dr. Fan Dong, for introducing me to the field of hematology, his guidance in my research and giving me the opportunity to work on very interesting projects.

Gratitude also goes to my committee members, Dr. Lirim Shemshedini, Dr.

Deborah Chadee, Dr. Stanislaw Stepkowski and Dr. Kam Yeung, for their help and insights.

I also would like to thank the people I have been working with in the past five years, Dr. Yaling Qiu for teaching me experiments and making the lab feel like home,

Srimathi Karsturirangan, Yangyang Zhang and previous lab member Dr. Pei Du. It is a pleasure to work with them.

I am eternally gratefully to my mother, Peizhi Kong, for her greatest love, sacrifice and support. Without her love, I would not achieve anything. I also would like to thank my husband, Jonathan McAtee, for his love and continuous encouragement, my daughter, Allison McAtee, for bringing the joy of being a parent, and all my family for loving and supporting me.

Last but not the least, I wish to thank all my friends for being supportive and being there for me.

vii

Table of Contents

Abstract ...... iii

Acknowledgements ...... vii

Table of Contents ...... viii

List of Figures ...... xi

List of Abbreviations ...... xiii

1 Introduction ...... 1

1.1 Hematopoiesis ...... 1

1.2 Hematopoietic cytokine and cytokine receptors ...... 3

1.3 Granulocyte Colony Stimulating Factor (G-CSF) Receptor ...... 5

1.4 Granulocyte Colony Stimulating Factor (G-CSF) Receptor signaling ...... 8

1.5 Hematopoietic transcription factors ...... 9

1.6 Growth factor independent 1 (Gfi1) ...... 11

1.7 Egr1 and c-Fos ...... 13

2 Material and Methods ...... 15

2.1 Cell lines and cell culture ...... 15

2.2 Construction of plasmids ...... 16

2.3 Transfection and generation of stable cell lines ...... 16

2.4 Flow cytometry ...... 16

2.5 Western blot analysis ...... 17 viii

2.6 Transient Tansfection and Luciferase reporter assay ...... 17

2.7 RNA Interference ...... 18

2.8 RNA extraction and quantitative real-time polymerase chain reaction ...... 19

2.9 Attachment and morphology examination ...... 19

2.10 Bone marrow cell culture ...... 19

2.11 Apoptosis assay ...... 20

2.12 Chromatin immunoprecipitation assay (CHIP assay) ...... 20

2.13 Statistics ...... 21

3 Results ...... 22

3.1 The duration of Erk1/2 signaling regulates neutrophil versus monocyte cell

fate choice in response to G-CSF and M-CSF ...... 22

3.1.1 Tyrosine 729 of G-CSFR is essential for instructing neutrophil lineage

choice ...... 22

3.1.2 Prolonged activation of Erk1/2 is required for monocyte development

mediated by G-CSFR Y729F ...... 27

3.1.3 Suppression of Erk1/2 pathway favors neutrophil development at the

expense of monocyte cell fate in response to M-CSF...... 34

3.1.4 G-CSFR Y729F mediates enhanced activation of c-Fos and Egr1 .....38

3.1.5 Neutrophil development is partially restored upon knockdown of

c-Fos or Egr1 in cells expression G-CSFR Y729F ...... 42

3.2 The role of transcriptional repressor Gfi1 in regulation of neutrophil versus

macrophage development ...... 48

3.2.1 Gfi1 overexpression rescues neutrophil development of cells

expressing GR Y729F ...... 48

3.2.2 Gfi1 inhibits Egr1 and C-Fos expression ...... 50

3.2.3 Suppression of Erk1/2 pathways restored neutrophil differentiation

of Gfi1-/- Lin- BM cells ...... 54

3.2.4 Gfi1 represses Egr1 and c-Fos expression through direct binding

to their promoter ...... 60

4 Discussion...... 63

4.1 The duration of Erk1/2 signaling regulates neutrophil versus monocyte cell

fate choice in response to G-CSF and M-CSF ...... 63

4.2 The role of transcriptional repressor Gfi1 in regulation of neutrophil versus

macrophage development ...... 67

5 Future Direction ...... 71

References ...... 73

Appendix A of cell lines ...... 83

List of Figures

1-1 Schematic representation of hematopoiesis and cytokines that regulate

hematopoiesis ...... 3

1-2 Schematic representation of G-CSF receptor protein structure ...... 7

1-3 Schematic representation of transcription factors in hematopoiesis ...... 11

1-4 Schematic representation of Gfi1 protein structure ...... 13

3-1 Mutations of the three C-terminal tyrosine residues of G-CSFR result in

monocyte development in response to G-CSF...... 24

3-2 Tyrosine 729 of G-CSFR is required for neutrophil development in 32D cells ....25

3-3 Tyrosine 729 of G-CSFR is required for neutrophil development in FDCP-mix

A4 cells...... 26

3-4 G-CSFR Y729F mediates prolonged activation of downstream signaling

pathway ...... 29

3-5 Suppression of Erk1/2 signaling pathway largely restored neutrophil

development of 32DY729F cells ...... 31

3-6 Suppression of Erk1/2 signaling pathway largely restored neutrophil

development of FDCP-mix/Y729F cells ...... 32

3-7 Knockdown of Erk1/2 restores G-CSF-induced neutrophil development in

32D/Y729F cells ...... 33

3-8 Knockdown of Erk1/2 restores G-CSF-induced neutrophil development in xi

FDCPmix/Y729F cells ...... 34

3-9 Suppression of Erk1/2 signaling favors neutrophil over monocyte development

in response to M-CSF ...... 36

3-10 G-CSFR Y729F mediates augmented activation of c-Fos and Egr1 ...... 40

3-11 Egr1 and c-Fos activation were inhibited by MEK1/2 inhibitors ...... 41

3-12 Knockdown of c-Fos restores G-CSF-induced neutrophil development in

32D/Y729F cells ...... 44

3-13 Knockdown of c-Fos restores G-CSF-induced neutrophil development in

FDCPmix/Y729F cells ...... 45

3-14 Knockdown of Egr1 restores G-CSF-induced neutrophil development in

32D/Y729F cells ...... 46

3-15 Knockdown of Egr1 restores G-CSF-induced neutrophil development in

FDCPmix/Y729F cells ...... 47

3-16 Gfi1 rescues neutrophil development in 32D/Y729F cells ...... 49

3-17 Gfi1 rescues neutrophil development in FDCPmix/Y729F cells ...... 50

3-18 Egr1 and c-Fos expression were repressed by Gfi1 ...... 52

3-19 Gfi1 suppresses the levels of c-Fos and Egr1 mRNAs in 32D/Y729F and

FDCPmix/Y729F cells ...... 54

3-20 Signaling pathways activated in 32DGR/Y729F/Gfi1 and

FDCPmix/Y729F/Gfi1 cells cells ...... 56

3-21 Suppression of Erk1/2 signaling favors neutrophil over monocyte development

in response to G-CSF ...... 58

3-22 Gfi1 represses Egr1 and c-Fos transcription through direct binding to

xii

their promoters ...... 61

4-1 Model of the regulation of Erk1/2 pathway and Gfi1 on neutrophil

versus macrophage cell fate choice ...... 70

xiii

List of Abbreviations

5-FU ...... 5-fluorouracil

7-AAD ...... 7 amino-actinomycin

AML ...... Acute myeloid leukemia

AP1 ...... Activator protein 1

Bp ...... Base pair bZIF ...... Basic leucine zipper

C/EBP ...... CAAT/Enhancer binding protein

ChIP ...... Chromatin Immunoprecipitation

CLP ...... Common lymphoid progenitor

CML ...... Chronic myeloid leukemia

CMP ...... Common myeloid leukemia

CNL ...... Chronic neutrophilic leukemia

CRH ...... Cytokine receptor homology domain

DNA...... Deoxyribonucleic acid

EBS ...... Egr binding sites

EGR ...... Early growth response protein

ETS ...... E-twenty-six

ERK ...... Extracellular signal-regulated kinase

FBS ...... Fatal bovine serum

FITC ...... Fluorescein

FLT3 ...... Fms-like tyrosine kinase

FNIII ...... Fibronectin type III

G-CSF ...... Granulocyte-colony stimulating factor

Gfi1 ...... Growth factor independent 1

GFP ...... Green fluorescent protein

GM-CSF ...... Granulocyte-macrophage-colony stimulating factor

GMP ...... Granulocyte/monocyte progenitor

HSC ...... Hematopoietic stem cell xiv

IL ...... Interleukin

IgG ...... Immunoglobulinlike

IRF1 ...... Interferon regulatory factor 1

JNK ...... C-Jun amino-terminal kinase

KD ...... Knockdown

LSK ...... Lin-/Sca-1+/c-Kit+

MAPK ...... Mitogen-activated protein kinase

M-CSF ...... Macrophage-colony stimulating factor

MEP ...... Megakaryocyte/erythrocyte progenitor

MMP ...... Multipotent progenitors MPO ...... Myeloperoxidase

MS ...... Macrosialin

NE ...... Neutrophli elastase

PE ...... Phycoerythrin

PKB ...... Protein kinase B

PI3K ...... Phosphatidylinositol-4,5-bisphosphate 3-kinase

P/S ...... Penicillin/streptomycin PMA ...... Phorbol 12-myristate 13-acetate

PMSF ...... Phenylmethanesulfonylfluoride

RasGRP ...... Ras guanyl-releasing protein

RNA ...... Ribonucleic acid

SCF ...... Stem cell factor

SCN ...... Severe Congenital Neutropenia

SD ...... Standard deviation

SDS ...... Sodium dodecyl sulfate

SH2 ...... Src homology 2 shRNA ...... short hairpin RNA

SNAG ...... Snail/Slug

SOCS ...... Suppressor of cytokine signaling protein

STAT ...... Signal transducer and activator of transcription

SV40 ...... Simian virus 40

TNFα ...... Tumor necrosis factor

TPA ...... Tetradecanoylphorbol acetate

TPO ...... Thrombopoietin

TRE ...... Tetracycline-response element xv

WB ...... Western Blot

WT ...... Wild type

xvi

Chapter 1

Introduction

1.1 Hematopoiesis

Hematopoiesis is the process during which hematopoietic stem cells (HSCs) give rise to all types of differentiated blood cells through self-renewal, proliferation and differentiation. HSCs only count for about 1/104 of the bone marrow population, but is capable of reconstituting the whole hematopoietic system in an irradiated mouse[1]. To maintain its number, HSCs undergo self-renewal which is highly regulated by many factors, such as the microenvironment HSCs reside in, cytokines and transcription factors. For example, bone marrow stromal cells have been shown to support HSCs self- renewal and proliferation, SH2B adapter protein 3 (Lnk) is found as a negative regulator,

TPO positively regulates this process, and Gfi1 also regulates HSCs maintenance[2, 3].

In addition to self-renewal, HSCs give rise to all kinds of functional blood cells through hierarchical process of commitment and differentiation. First, HSCs become multipoent progenitiors (MPPs) which lost the unlimited self-renewal ability and develop into either common lymphoid progenitors (CLPs) or common myeloid progenitors (CMPs). CLPs can further differentiate into T lymphocytes, B lymphocytes, whereas CMPs give rise to

megakaryocyte/erythrocyte progenitors (MEPs) which can develop into megakaryoctyes/platelets and erythrocytes or granulocyte/macrophage progenitors

(GMPs) which can differentiate into granulocytes and monocytes/macrophages (Fig. 1-

1)[4].

Hematopoiesis is mainly regulated by three mechanisms. First, the “niche” in which hematopoietic cells reside plays an important role in balancing HSCs self-renewal and differentiation. For example, stromal cells provide signals through interaction with

HSCs to keep HSCs in an uncommitted state[2]. Additionally, cytokines regulate proliferation, differentiation and survival of hematopoietic cells by binding to their receptors[5, 6]. Furthermore, at cellular level, hematopoiesis is regulated by many transcription factors which favor certain lineage differentiation and antagonize other lineage development[7]. Deregulation of cytokines or transcription factors may cause aberrant hematopoietic development, leading to uncontrolled proliferation and loss of differentiation ability, and eventually hematopoietic malignancies, such as acute myeloid leukemia (AML) [8].

Fig.1-1: Schematic representation of hematopoiesis and cytokines that regulate hematopoiesis. Hematopoietic stem cells (HSCs) either undergo self-renewal or commit into Common Lymphoid Progenitors (CLPs) and Common Myeloid Progenitors (CMP). CLP further differentiate in to T cells and B cells, and CMP differentiate into mature myeloid cells including Neutrophils, monocytes, megakaryocytes/platelets and erythrocytes. Some of the major hematopoietic cytokines acting at various stages of hematopoiesis are shown.

1.2 Hematopoietic Cytokine and Cytokine Receptors

Hematopoietic cytokines play an important role in regulating proliferation, survival and differentiation of hematopoietic cells, and are produced by hematopoietic cells and stromal cells. Hematopoietic cytokines function through activating cognate receptors which can be grouped into two families according to their structural homology

in extracellular domains. Type I cytokine receptors share the CRH domain (cytokine receptor homology domain), four conserved cysteine residues, a WSXWS motif and

ﬁbronectin type (FN) III domains in the extracellular part of the receptor and conserved

Box1/Box2 regions in the membrane proximal domain. Type II cytokine receptors including those of interferon and IL-10 receptors have Box1 and Box2, but lack of conserved WSXWS domain [6]. The functions of cytokines are complicated. Some cytokines are active on early stage, such as Stem Cell Factor (SCF) which regulates self- renewal and commitment of stem cells and some are active on later stage, such as

Granulocyte Colony Stimulating Factor (G-CSF) which regulates differentiation of

Granulocyte-monocyte progenitors (GMPs) and granulocytes. Some cytokines function on multiple lineages like IL-7 and some function only on specific lineages, such as G-

CSF [6, 9]. Cytokines are important in hematopoietic differentiation, but the exact role of cytokines is controversial. There were two models proposed. One is stochastic model which supports that cytokines only provide survival signals for cells, while the differentiation is intrinsically determined. Evidence supporting this model is that Bcl-2 rescued T-lymphocyte differentiation in IL-7 deficient mice[10, 11]. The other one is instructive model which supports that cytokines transduce specific signals to direct lineage commitment and differentiation. Long term observations of individual mouse hematopoietic progenitor cells which differentiated into granulocytes upon G-CSF treatment and differentiated into macrophages upon M-CSF treatment by Michael A.

Rieger et al provided strong evidence for this model[12].

1.3 Granulocyte Colony Stimulating Factor Receptor (G-CSFR)

G-CSFR is a transmembrane glycoprotein and belongs to the type I cytokine receptor superfamily. G-CSFR is primarily expressed in cells of the granulocyte lineage but is also found in nonhematopoietic tissues such as placenta, fetal organs, vascular endothelial cells and some carcinomas[13]. Murine G-CSFR consists of 812 amino acids and shares 62.5% homology with the human G-CSFR which consists of 813 amino acids.

Both murine and human G-CSFRs have extracellular, transmembrane and cytoplasmic domains[14].The extracellular region of G-CSFR is comprised of immunoglobulinlike

(IgG) domain, a cytokine receptor homology (CRH) domain and three FN III domains.

The cytoplasmic region consists of a proline-rich Box 1 and an acidic residue containing

Box 2 and Box 3. The CRH domain is essential for ligand binding, while the IgG domain plays a role in ligand affinity. In contrast, the FN III domains are not required for binding, but are involved in maintaining receptor stability since their deletion resultes in reduced receptor levels (Fig. 1-2) [13].

Encoded by different cDNAs, four isoforms of G-CSFRs have been found in cells derived from alternative RNA splicing from the same G-CSFR gene. The extracellular domains of the four isoforms are identical. WT, pHG11 and D7 share the same transmembrane domain, while pHQ2 lacks transmembrane domain and was found to encode a secreted, soluble form receptor. pGH11 has an 27 amino acids insertion in the cytoplasmic region and D7 has a short alternative cytoplasmic domain[14, 15].

G-CSFR transduces signals essential for proliferation, survival and differentiation.

Mutation analysis has shown that the membrane proximal 55~ 57 amino acids are sufficient for proliferation, the downstream 30 amino acids augment mitogenic signals 5

and C-terminal 98 amino acids provide signals suppressing proliferation and essential for differentiation[16, 17]. Tyrosine residues are important for transducing signals for proliferation, differentiation and also providing docking sites for phosphor-binding molecules. There are four tyrosine residues in the cytoplasmic region of G-CSFR.

Previous studies have shown that the four tyrosine residues are required for both proliferation and differentiation in steady state conditions, but not in emergency conditions, such as infection, since replacement of all of the four tyrosine residues with phenylalanine almost abolished the proliferation and differentiation ability in 32D cells and bone marrow cells[18, 19]. Tyrosine residues 704, 729 and 744 support granulocytic differentiation in both LGM-1 and 32D cells. Mutation of tyrosine 728 of murine G-

CSFR resulted in macrophage-like differentiation of LGM-1 cells and mutation of tyrosine 729 of human G-CSFR caused a defect in granulocytic differentiation and more monocytic differentiation in bone marrow cells. However, the exact function of each tyrosine residue is still unknown [18-21].

Mutations in CSF3R are frequently found in the Severe Congenital Neutropenia

(SCN) patients who were treated with G-CSF and later progressed to acute myeloid leukemia (AML)[22, 23]. Most of the mutations are non-sense mutations that truncate about 100 amino acids of the C-terminal region of G-CSFR. The truncated receptors cause hyperproliferation response of 32D cells and myeloid progenitors from mice upon

G-CSF treatment[24]. Activation of the truncated receptors including D715 induced prolonged activation of STAT5, AKT/PI3K, Erk1/2 and reduced activation of STAT3

[25-27]. Truncated receptors have defective spontaneous and ligand-induced internalization which leads to high expression on cell surface and partially caused 6

prolonged activation of STAT5 compared to WT receptors[28]. SOCS3 activation decreased in D715 expressing cells due to lack of tyrosine 729 which serves as a locking site for SOCS3 is another reason that STAT5 activation is prolonged by D715 receptor upon G-CSF treatment[29]. Moreover, D715 receptors also confer resistance to apoptosis in BaF3 cells by activating prolonged AKT/PI3K and phosphorylation of anti- apoptotic protein Bad[30]. Another membrane proximal mutation, known as T618I, was lately discovered a prevalent mutation in chronic neutrophilic leukemia (CNL) and atypical (BCR-ABL1–negative) chronic myeloid leukemia (CML) patients. G-CSFRs harboring T618I mutations exhibit auto-activating ability due to lack of o-glycosylation of receptors and increased auto-dimerization. Moreover, this mutation confer sensitivity to Jak inhibitors which has been used as a drug in clinic[23, 31].

Fig 1-2: Schematic representation of G-CSF receptor protein structure and signaling 7

1.4 Granulocyte Colony Stimulating Factor (G-CSF) Receptor Signaling

After G-CSF binding, G-CSFRs form homodimers and transduce signals through their cytoplasmic domains[13]. G-CSFR does not have intrinsic kinase function.

Therefore G-CSFR must recruit non-receptor tyrosine kinases to trigger downstream signal cascades, like Src family and Jak family kinases. The four tyrosine residues located in the distal region of G-CSFR serve as docking sites for signaling molecules containing the Src homology 2 (SH2) domains [32]. Some signaling pathways emanating from G-CSFR which are important for proliferation and differentiation have been studied.

Among the pathways activated by G-CSFR, the Jak/Stat pathway is well characterized. Jaks are recruited to Box1 and Box2 of G-CSFR following G-CSF binding and receptor dimerization. Stat5 and Stat3 are then recruited to the receptor and phosphorylated by Jaks[33]. Phosphorylated Stat5 and Stat3 subsequently translocated to the nucleus and activate responsive genes, such as IRF-1 and egr-1 [13]. STAT5 supports granulocytic differentiation by promoting the generation of mature neutrophils from

GMPs and maintaining the survival of mature neutrophils [34, 35]. Stat5 activation is dependent upon Box1 and Box2, the downstream 30 amino acids of Box2 are for the maximal activation [25]. STAT3 is crucial for neutrophil proliferation and differentiation.

In normal granulopoeisis, STAT3 induces expression of granulocyte secondary granule proteins. In emergency granulopoiesis, STAT3 promotes proliferation of immature myeloid cells and regulates acute neutrophil mobilization [36-39]. STAT3 activation requires Tyr704 and Tyr744, and has been reported to be important for differentiation.

Gene knock-out studies showed no defects in granulopoiesis in Jak-/- mice, suggesting a redundant role for Jaks in the neutrophil differentiation [25, 40, 41]. 8

MAPK pathway is a highly conserved signaling pathway which is important for cell survival, proliferation and differentiation. Extracellular signal-regulated kinase

(ERK), c-Jun amino-terminal kinase (JNK) and p38 MAPK are the three primary MAP kinases [42]. G-CSF transduces signals by recruiting adapter protein Shc to Tyr764 of G-

CSFR allowing Ras activation [13]. Erk1/2 are essential for neutrophil and monocytic differentiation. It is shown that MEK inhibitor potently inhibited the monocytic and granulocytic differentiation in HL60 cells. Erk1/2 phosphorylation is prolonged during the monocytic differentiation by phorbol 12-myristate 13-acetate (PMA) than that in the neutrophil differentiation induced by retinoic acid [43]. Erk1/2 regulate transcription factors that are important for myeloid differentiation. For instance, Erk1/2 phosphorylate c/EBPα at the position serine 21 and negatively regulate neutrophil differentiation [44].

Besides Jak/Stat and Raf/Ras/MAPK pathways, there are some other factors important in myeloid differentiation. For example, JNK1 has been reported to interact with c/EBPα in vitro and in vivo, and possibly phosphorylates c/EBPα and play an active role in granulopoiesis. C-Jun and c-Fos may negatively regulate neutrophil differentiation by forming heterodimers with c/EBPα. P38 is also reported to phosphorylate c/EBPα on the serine 21 and regulate the differentiation and proliferation during granulopoiesis [42].

1.5 Hematopoietic Transcription factors

Hematopoiesis is under control of a group of transcription factors which support certain lineage commitment and antagonize the development of other lineages by activating lineage-specific gene expression and repressing lineage-foreign genes. C/EBPα

is essential for neutrophil differentiation, since C/EBPα-/- mice lack neutrophils and eosinophils and are neutropenic [45]. C/EBPα has also been shown to induce neutrophil specific genes MPO and neutrophil elastase (NE) expression in collaboration with G-

CSFR and inhibit macrosialin RNA or JunB expression [46-48]. Ets transcription factor

PU.1 is required for monocyte/macrophage differentiation and also important for neutrophil differentiation. PU.1-/- mice lack B cells and monocytes and have severely reduced neutrophils[49, 50]. PU.1 also regulates the expression of genes important in myelopoiesis, such as M-CSFR and Elane [51, 52]. Transcription factors also regulate hematopoiesis through regulating expression of other transcription factors. The level of relative expression of transcription factors also affects the direction of differentiation.

C/EBPα has been shown to regulate PU.1 expression and the ratio of c/EBPα to PU.1 protein level determines the direction of differentiation into either monocytes or neutrophils. High PU.1to c/EBPα ratio favors monocyte differentiation, while low PU.1 to c/EBPα ratio lead to neutrophil differentiation (Fig. 1-3) [53, 54].

Hematopoietic transcription factors also regulate hematopoiesis in collaboration with cytokines. For example, IL-7 activates Raf signaling and STAT5 during B cell development [55]. Gfi1 regulates Ras signaling through RasGRP1 in 32D and bone marrow cells [56]. Expression of the GM-CSFR, G-CSFR and M-CSFR are regulated by

PU.1 and Gfi1, PU.1-/- mice lack mature granulocytes, macrophages and B cells [57].

Fig 1-3: Schematic representation of transcription factors in hematopoiesis

1.6 Growth factor independent 1 (Gfi1)

Gfi1 is a zinc finger transcriptional repressor originally identified as an insertion in Moloney murine leukemia virus (Mo-MuLV)-induced rat T cell lymphomas[58, 59].

Functioning as an oncogene, overexpression of Gfi1 inhibits apoptosis and G1 cell cycle arrest induced by IL-2 withdrawal [60-62].

Gfi1 also plays a critical role in hematopoiesis. Studies have shown that Gfi1 regulates hematopoietic stem cells survival and self-renewal by restricting hematopoeitic stem cell proliferation. Gfi1-/- HSCs are hyperproliferative and impaired in long term proliferation [3, 63, 64]. Gfi1 also plays a key role in lymphopoiesis supported by the

evidence that Gfi1-/- mice have reduced number of B cells and T cells [65, 66]. Apart from that, Gfi1 is essential for myeloid differentiation by promoting terminal differentiation of neutrophils and antagonize monocytic differentiation [67]. Gfi1-/- mice lack mature neutrophils, but accumulate a population of atypical myeloid cells instead which share characteristics of both immature granulocyte and macrophage. The atypical myeloid cells function as neutrophils but do not have secondary and tertiary granule expression. They differentiate into macrophage, but not neutrophils upon G-CSF treatment [65, 66]. Loss-of-function mutations of Gfi1 are associated with severe congenital neutropenia (SCN) in human providing further evidence that Gfi1 is essential for granulocytic differentiation [68, 69]. However, the mechanism by which Gfi1 regulates granulocytic differentiation is still poorly understood.

As a transcriptional repressor, Gfi1 consists of 423 amino acids with an N- terminal SNAG domain which is necessary for nuclear localization and transcriptional repression activity and six C-terminal zinc fingers critical for DNA binding. Gfi1 binds to the DNA sequence TAAATCAC(A/T)GCA[59, 60]. Gfi1 exerts its repressional activity through direct DNA binding. Among the targets of Gfi1, many are associated with granulocytic differentiation[70]. For instance, c/EBPα is essential for neutrophil differentiation, c/EBPε is induced at the late stage of neutrophil differentiation, M-CSF induces granulocyte-monocyte progenitors to develop along the macrophage lineage.

Furthermore, Gfi1 also represses gene expression and protein activity indirectly and regulates myeloid differentiation through protein-protein interaction, PU.1 exemplified the transcription factor which is important in macrophage differentiation and whose activity is repressed by Gfi1[71]. 12

Figure 1-4: Schematic representation of Gfi1 protein structure. Gfi1 contains an N- terminal SNAG domain for nuclear localization and transcription repression, 6 C- terminal ZF domains for DNA binding.

1.7 Early growth response protein 1(Egr1) and c-Fos

Early growth response family consists of Egr1-Egr4 which are important in cell growth and differentiation. In particular, Egr1 plays a role in macrophage differentiation.

Knockdown of Egr1 with oligodeoxynucleotides inhibited macrophage differentiation in

HL60, U937 and M1 cells, while overexpression of Egr1 induced macrophage differentiation in HL60, 32Dcl3 and M1 cells [72-74]. However, later studied showed that Egr1 knockout mice showed unimpaired macrophage differentiation and function, suggesting that the role of Egr1 in macrophage development is dispensable and a redundant role among Egr family members [75, 76]. Egr2 is also important in macrophage differentiation. Egr2 expression was induced during differentiation into macrophage in PU.1high cells which express high level of PU.1, but not in PU.1low cells.

Egr2 knockdown in PU.1high myeloid progenitor cells altered the macrophage differentiation and restored neutrophil characteristics of the cells. Egr1 and Egr2 were shown to repress Gfi1 expression, in turn, Gfi1 represses Egr1 and Egr2 expression [77]. 13

Among the bZIP subfamily, AP-1s favor monocytic differentiation. It has been shown that c-Fos expression is associated with terminal macrophage differentiation of

THP-1 cells upon TNF-α, IL-6 and TPA treatment. Ectopic expression c-Fos and c-Jun induces monocytic differentiation of myeloid cells [78-81]. C-Jun also increases PU.1 activity by interacting with PU.1. AP-1 forms heterodimers with c/EBPα and preferentially binds and activates monocyte-specific gene expressions [75, 76, 78]. AP-1 family members form heterodimers with c/EBPα and bind PU.1 promoter to induce its expression and favor monocytic differentiation [82].

Chapter 2

Materials and Methods

2.1 Cell lines and cell culture

Murine myeloblast 32D cells, 32D/mA, 32D/Y729F, 32D/Y744F and 32D/Y764F were maintained in RPMI-1640 with 10% heat inactivated fetal bovine serum (FBS),

10% WEHI-3B cell-conditioned media as a crude source of murine interleukin-3, and 1% penicillin/streptomycin (P/S). Murine multipotent stem cells FDCPmix/WT and

FDCPmix/Y729F cells were cultured in IMDM with 15% heat inactivated horse serum,

10% WEHI and 1% P/S. To examine the differentiation, cells were washed by phosphate- buffered saline (PBS) and cultured in RPMI-1640 medium supplemented with 10% FBS,

10ng/ml human recombinant G-CSF and 1% P/S. For cytokine induction, cells were washed by PBS and placed in RPMI-1640 medium with 10% FBS and 1% P/S for 2 hours before stimulation with 10 ng/ml G-CSF. Mek1/2 inhibitors U0126 (Cell

Signaling) and PD0325901 (Selleckchem) were added at the same time of the starvation.

The cells were grown in a humidified incubator at 37℃ with 5% CO2.

2.2 Construction of plasmids

Murine Egr1 promoter fragment containing Bgl II and Hind III sites (-1780 bp to

+21 bp) was generated by PCR using Egr1 bac plasmid as template (Bacpac Resources,

Clone#RP23-108C3), and were inserted into pGL3-basic plasmid. c-Fos promoter (-1141 bp to +19 bp) was a generous gift of Dr. Wan-Wan Lin from National Taiwan University.

Inducible Gfi1 expression construct pTMrtTA-Gfi1, which expressed Gfi1 upon addition of doxycycline was generated as described [62].

2.3 Transfection and generation of stable cell lines

293T cells were transfected with pTMrtTA-Gfi1 plasmid along with packaging plasmids psPAX2 and pMD2G (with 9:1 ratio of psPAX2 to pMD2G) using the calcium phosphate coprecipitation procedure. Medium were changed 16 hours after transfection, and viral particles were harvested at 48 and 72 hours, concentrated and used to infect 32D and FDCP-mix A4 cells with 8µg/ml polybrene (Santa Cruz Biotechnology ). GFP positive cells were sorted by FACS.

2.4 Flow cytometry

To examine differentiation, cells were washed by PBS with 2% horse serum and blocked with Fc block (ebioscience) at 1:100 dilution for 15min, and followed by incubation with either isotype control anti-mouse IgG antibody conjugated with phycoerythrin (PE) at concentration of 2.5μg/ml (eBioscience), anti-F4/80 antibody

conjugated with phycoerythrin (PE) at concentration of 2.5μg/ml (eBioscience) for 30 min, followed by washing with PBS with 2% horse serum.

2.5 Western blot analysis

Cells were harvested and lysed with SDS lysis buffer (0.2M Tris, 1% SDS) with

20µg/ml phenylmethanesulfonylfluoride (Sigma-Aldrich), boiled for 5min and span at

12,000 rpm for 20min. 20μg lysates were placed in 4×loading buffer, boiled and separated on a 10% sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gel. Protein was then transferred on to a polyvinylidenedifluoride (PVDF) membrane, and blocked with 5% milk in Tris-Buffered Saline and Tween 20 (T-BST) for one hour at room temperature, followed by immunobloting with anti-phosphor-STAT5, anti-phosphor-

STAT3, anti-phosphor-ERK1/2, anti-Erk1/2, anti-c-Fos, anti-phosphor-c-Fos, anti-Egr1 and anti-actin (Cell Signaling) overnight at 4℃. Membranes were then washed with T-

BST and incubated with secondary antibody anti-rabbit, anti-mouse conjugated with horseradish peroxidase at 1:10000 dilutions in T-BST for 1 hour at room temperature and signal were detected using Supersignal West (Pierce). Western Blot bands were quantitated using Image J.

2.6 Transient transfection and Luciferase Reporter assay

Cells were transfected with 8µg reporter constructs TRE3-tk-Luc (a gift from Dr.

Lirim Shemshedini, The University of Toledo) or pEBS24-Luc (a gift from Dr.Gerald

Thiel, University of the Saarland Medical Center). 16 hours after transfection, cells were

washed by PBS and placed in RPMI-1640 with either 10% WEHI or 10ng/ml G-CSF.

Cells were harvested after 8 hours and lysed using 1× Cell Culture Lysis Reagent

(CCLR) and luciferase activities were measured using Luciferase reporter kit and

Molecular Devices Lmaxluminometer (Sunnyvale, CA).

2.7 RNA Interference

Lentiviral constructs encoding murine c-Fos specific shRNA and murine Egr1 specific shRNA were purchased from Open Biosystems. To target murine ERK2, shRNA

TRCN54729 with puromycin selection marker were purchased from Dharmacon. To target murine ERK1, oligonucleotides were designed to generate mature antisense

AATGTAAACATCTCTCATGGC and cloned into pLKO.1 hygro (Addgene #24150).

293T cells were transfected with individual shRNA plasmid along with packaging plasmids psPAX2 and pMD2G using the calcium phosphate coprecipitation procedure.

Medium were changed 16 hours after transfection, and viral particles were harvested at

48 and 72 hours, concentrated and used to infect cells with 8µg/ml polybrene (Santa

Cruz Biotechnology ). Cells were selected in 2mg/ml puromycin for 48 h. ShRNA- mediated knockdown of c-Fos and Egr-1 was examined by Western blot analysis. To generate Erk1/2 knockdown cells, cells were selected in 2mg/ml puromycin for 48 h, and subsequently infected with Erk1 shRNA virus and selected with hygromycin for 5 days at

1mg/ml. ShRNA-mediated knockdown of Erk was examined by Western blot analysis.

2.8 RNA extraction and quantitative real-time polymerase chain reaction

Cells were harvested and RNA was extracted using TRIzol reagent (Invitrogen).

RNA concentration were measured using nano drop, cDNA was synthesized using the

1µg RNA, reverse-transcriptase, dNTP, MgCl2 and 5× reaction buffer (Promega). Real- time PCR were performed using the SsoFastTM EvaGreen Supermix® kit (Bio-Rad) and normalized to GAPDH.

2.9 Attachment and morphology examination

Pictures were taken by Olympus Microscope, and cells were spun on the glasses and stained with Wright-Giemsa (Fisher Scientific) for 30min and then washed with water, pictures were taken using Microscope.

2.10 Bone Marrow Cell Culture

Bone marrow cells isolated from Six- to 8-week-old C57BL/6 mice were lysed with ACK Lysing buffer (Lonza), separated with Ficoll (Sigma) and subjected to lineage depletion using antibodies (CD3e, CD11b, CD45R/B220, Ly6G and Ly-6C, and TER-

119) from BD Biosciences and immunomagnetic beads (Miltenyi Biotec). After eluted from the column, lineage negative cells were cultured in IMDM media with 10% FBS,

1% P/S, 10ng/ml IL-3, 20ng/ml IL-6 and 25ng/ml SCF (Peprotech). For M-CSF induced differentiation, cells were cultured in IMDM media with 10% FBS, 1%P/S, 10ng/ml IL-

3, 20ng/ml IL-6, 25ng/ml SCF and 10ng/ml M-CSF for three days. Then morphology was

examined, and macrophages and neutrophils were counted. Real-time PCR and apoptosis assay were also performed. For colony forming assay, bone marrow cells isolated from

Six- to 8-week-old C57BL/6 mice treated with 5-fluorouracil (5-FU) intraperitoneally

(150 mg/kg) for 5 days were cultured in IMDM media with 10% FBS, 1% P/S, 10ng/ml

IL-3, 20ng/ml IL-6, 25ng/ml SCF for 1 hour to recover. Then 104 cells were seeded in

Methylcellulose-based Media (R&D System) with 10% FBS, IL-3, IL-6, SCF, M-CSF with or without indicated inhibitors for each plate. Colonies were enumerated 7 days after.

2.11 Apoptosis assay

Apoptosis was examined using the Annexin V-PE apoptosis detection kit (BD

Biosciences). Briefly, cells were washed with cold PBS twice and incubated with

Annexin V-PE and 7 amino-actinomycin (7-AAD) for 15min. Cells were applied to

FACS machine to examine the expression of Annexin V-PE and 7AAD.

2.12 Chromatin immunoprecipitation assay (ChIP assay)

32D cells cultured in WEHI medium with or without Dox for 24 hours were fixed with

1% formaldehyde, treated with 0.125M Glycin for the cross linking and then lysed in hypotonic buffer [5 mM Tris-HCl (pH 7.5), 85mM KCl and 0.5% Nonidet P-40]. Nuclei were spun down at 6000 rpm for 5 min, lysed in ChIP lysis buffer [1% SDS, 10 mM

EDTA, and 50mMTris HCl (pH 7.5)] and sonicated to shear chromatin DNA to about

500 bp fragments. Nuclear lysates were precleared with protein A/G agarose beads

and rabbit normal IgG for 1 h and subjected to immunoprecipitation using the anti

Gfi1 antibody. Precipitated DNA was examined by semi-quantitative PCR.

2.13 Statistics

GraphPad Prism software (GraphPad Software, La Jolla, CA, USA) was used for all statistical analysis. Data are shown as mean ±SD in all figures. A p value<0.05 was considered significant for all analyses and shown as *. ** denotes P<0.01, *** denotes

P<0.001 and **** denotes p<0.0001.

Chapter 3

Results

3.1 The duration of Erk1/2 signaling regulates neutrophil versus monocyte cell fate signaling in response to G-CSF and M-CSF

3.1.1 Tyrosine 729 of G-CSFR is essential for instructing neutrophil lineage choice

The four tyrosine residues of the cytoplasmic region of G-CSFR are important in transducing signals for cell proliferation, survival and differentiation. 32D cells are murine myeloid precursors dependent on IL-3 for growth, but do not have endogenous G-

CSF receptors, which is a good model to study the receptor structure and function. To examine differentiation, 32D cells stably expressing the G-CSFR mutant mA in which the three C-terminal tyrosine (Y) residues were mutated to phenylalanine (F) (32D/mA)

[27] were cultured in the presence of G-CSF for 6 days. 32D cells expressing wild type receptors (32D/WT) differentiated into neutrophils which were confirmed by morphology, FACS (Fig.3-1 B C), whereas 32D/mA cells started to attach to the dishes on day 4 which is a characteristic of macrophage (Fig.3-1 A). To further assess the differentiation of 32D/mA cells, morphology and FACS were also conducted. 32D/mA cells exhibit macrophage characteristics, as there is a high ratio of cytoplasm to nucleus

and high expression of F4/80 (Fig.3-1 B, C). Mmp-12 and M-CSF are differentiation markers of monocytes, consistent with the macrophage differentiation, there is increased expression of Mmp-12 and M-CSF in 32D/mA cells on Day 6 compared to 32D/WT cells

(Fig.3-1 D). Thus, the C-terminal three tyrosine residues of G-CSFR are essential for granulocytic differentiation and substitutions of these three tyrosine residues with phenylalanine causes monocytic differentiation upon G-CSF treatment. To identify the tyrosine residue that is essential for granulocytic differentiation, 32D/Y729F, 32D/Y744F and 32D/Y764F were cultured in the presence of G-CSF for six days. Interestingly, only

32D/Y729F cells developed into macrophages compared to 32D/Y744F and 32D/Y764F cells which developed into neutrophils (Fig.3-2). To confirm that Tyr729 is essential for neutrophil development, we used mouse multipotent hematopoietic stem cells FDCP-mix

A4 cells which were transduced with wild type G-CSFR (FDCPmix/WT) or Y729F mutant receptors (FDCPmix/Y729F). FDCPmix/WT and FDCPmix/Y729F cells were cultured in the presence of G-CSF, FDCPmix/WT cells developed into neutrophils after

5 days, while FDCPmix/Y729F cells developed into macrophages 2 days after being cultured in G-CSF medium (Fig.3-3). Taken together, Tyr729 of G-CSFR is essential for instructing neutrophil cell fate, and loss-of-function of Tyr729 drives monocytic development upon G-CSF treatment.

Fig.3-1 Mutations of the three C-terminal tyrosine residues of G-CSFR result in monocyte development in response to G-CSF (A) 32D/WT and 32D/mA cells were cultured with G-CSF (10ng/ml) for 6 days and pictures were taken using Olympus microscope. (B) Cells were spun on glass slides and stained with Wright-Giemsa. (C) F4/80 expression was examined by FACS. (D) M-CSF and MMP-12 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh.

Fig.3-2 Tyrosine 729 of G-CSFR is required for neutrophil development of 32D cells. (A) 32D/Y729F, Y744F, Y764F cells were cultured in the presence of G-CSF (10ng/ml) for 6 days and pictures were taken using Olympus microscope. (B) Cells were spun on glass slides and stained with Wright-Giemsa. (C) F4/80 expression was examined by FACS. (D) M-CSF and MMP12 mRNA expression was assessed by RT- qPCR and normalized to the mRNA expression of Gapdh.

Fig.3-3 Tyrosine 729 of G-CSFR is required for neutrophil development of FDCP- mix A4 cells (A) FACS analysis for G-CSFR in FDCP-mix A4 cells transfected with retroviral vectors expressing WT or mutant receptor Y729F. FDCPmix/WT cell were cultured with G-CSF (10ng/ml) for 5 days, FDCPmix/Y729F cells were cultured with G- CSF (10ng/ml) for 2 days and pictures were taken using Olympus microscope. (C) Cells were spun on glass slides and stained with Wright-Giemsa. (D) FDCPmix/WT and FDCPmix/Y729F cells were cultured with G-CSF (10ng/ml) for 2 days, and F4/80 expression was examined by FACS. (E) M-CSF and MMP-12 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh.

3.1.2 Suppression of Erk1/2 pathway favors neutrophil development at the expense of monocyte cell fate in response to M-CSF

We examined the activation of Stat5, Akt and Erk1/2, as they are important for myeloid differentiation and the duration of phosphorylation of Stat5 and Erk1/2 are affected by tyrosine 729[27]. 32D/WT and 32D/Y729F cells were starved of IL-3 for 2 hours and then stimulated with G-CSF for different times. Activation of Stat5, Akt and

Erk1/2 were prolonged in 32D/Y729F cells (Fig.3-4 A, E). To confirm the results, experiments were also conducted in FDCPmix/WT and FDCPmix/Y729F cells.

Phosphorylation of Stat5 and Erk1/2 were also prolonged. We next analyzed the activation of Erk1/2 following prolonged G-CSF stimulation for up to 48 hours.

Phosphorylation of Erk1/2 was prolonged in 32D/Y729F cells and FDCPmix/Y729F cells

(Fig.3-4 B, E). Erk1/2 expression was also examined to show the prolonged activation of

Erk1/2 in 32D/Y729F cells and FDCPmix/Y729F cells is not due to Erk1/2 expression change. Altogether, these data showed that phosphorylation of Erk1/2 was prolonged in cells expressing Y729F receptor mutants. To address whether Stat5 and Akt activation induced monocyte development, 32D/Y729F cells were treated with Stat5 or Akt inhibitors. 32D/Y729F cells treated with Stat5 inhibitor lost the ability to attach to the dishes, but still showed macrophage morphology. 32D/Y729F cells treated with Akt inhibitor died after 3 days (data not shown). To address whether prolonged Erk1/2 activation caused the monocytic differentiation in cells expressing Y729F receptor mutants, Mek1/2 inhibitors U0126 and PD0325901 were used to treat the 32D/Y729F cells when they were cultured in the presence of G-CSF. Interestingly, 32D/Y729F cells cultured with G-CSF along with U0126 and PD0325901 did not attach to the dishes 27

(Fig.3-5 A). To examine the differentiation of the cells, Wright-Giemsa staining was performed and 32D/Y729F cells showed terminal granulocytic differentiation after

Mek1/2 inhibitor treatment (Fig.3-5 B). Consistently, M-CSF and Mmp-12 induction was repressed in real-time PCR (Fig.3-5 D). Unexpectedly, we did not see a decrease in F4/80 expression even when 32D/Y729F cells differentiated into neutrophils after Mek1/2 inhibitors treatment (Fig.3-5 C), which suggested that other pathways than MAPK pathway induce F4/80 expression during monocytic differentiation. Same experiments were conducted in FDCPmix/Y729F cells, and the data was reproducible (Fig.3-6). To further confirm the specificity of Erk1/2 in the regulation of monocytic and neutrophil development, the expression of Erk1 and Erk12 was sequentially knockdown down in

32D/Y729F and FDCPmix/Y729F cells. Cells were first infected an Erk2 shRNA virus, selected with puromycin for two days, followed by infection with an Erk1 shRNA and selection with hygromycin for 5 days. Erk1/2 knockdown was confirmed by Westrern blot analysis (Fig.3-7 A). After cultured in G-CSFfor 6 days, Erk1/2 knockdown

32D/Y729 and FDCPmix/Y729F cells barely showed attachment and development into neutrophils (Fig.3-7 B, C), associated with downregulation of M-CSF and Mmp12 expression (Fig.3-7 D and Fig.3-8). Collectively, these data demonstrated that prolonged phosphorylation of Erk1/2 promotes monocytic differentiation in 32D/Y729F and

FDCPmix/Y729F cells.

Fig.3-4 G-CSFR Y729F mediates prolonged activation of downstream signaling pathways. 32D (A and C) and FDCPmix (B and D) cells expressing WT or Y729F forms of G-CSFR starved for 2 hours by removing IL-3 were cultured in G-CSF for 0 to 48 hours. Total cellular extracts were examined by immunoblotting and activation of Stat5, Akt and Erk1/2 were detected with the phosphor-specific antibodies as indicated. The membranes were subsequently probed with the indicated antibodies.(E) The results shown in A, B, C and D were quantitated and normalized to the control blots.

Fig.3-5 Suppression of Erk1/2 signaling largely restores neutrophil development in 32D/Y729F cells. 32D/Y729F were cultured in the presence of G-CSF (10ng/ml) with either U0126 (10μg/ml) or PD0325901 (0.25 μg/ml) for 6 days. (A) Pictures were taken using Olympus microscope. (B) Cells were spun on glass slides and stained with Wright- Giemsa. (C) Expression of F4/80 was examined by FACS. (D) M-CSF and MMP12 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh.

Fig.3-6 Suppression of Erk1/2 signaling largely restores neutrophil development in FDCPmix/Y729F cells. FDCPmix/Y729F were cultured in the presence of G-CSF (10ng/ml) with either U0126 (10μg/ml) or PD0325901 (0.25 μg/ml) for 2 days. (A) Pictures were taken using Olympus microscope. (B) Cells were spun on glass slides and stained with Wright-Giemsa. (C) Expression of F4/80 was examined by FACS. (D) M- CSF and MMP12 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh.

Fig.3-7 Erk1/2 knockdown reversed the monocytic differentiation of FDCPmix/Y729F cells. FDCPmix/Y729F cells were infected with the lentivirus containing either control plasmid pLKO.1 or Erk1/2 shRNA. (A) The expression of Erk1/2 proteins was examined by Western blot analysis. FDCPmix/Y729F cells were cultured in G-CSF (10ng/ml) for 2 days. (B) Pictures were taken using Olympus microscope, (C) cells were spun on glass slides and stained with Wright-Giemsa, and (D) M-CSF and MMP12 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of GAPDH.

Fig.3-8 Erk1/2 knockdown reversed the monocytic differentiation of FDCPmix/Y729F cells. FDCPmix/Y729F cells were infected with the lentivirus containing either control plasmid pLKO.1 or Erk1/2 shRNA. (A) The expression of Erk1/2 proteins was examined by Western blot analysis. FDCPmix/Y729F cells were cultured in G-CSF (10ng/ml) for 2 days. (B) Pictures were taken using Olympus microscope, (C) cells were spun on glass slides and stained with Wright-Giemsa, and (D) M-CSF and MMP12 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of GAPDH.

3.1.3 Suppression of Erk1/2 pathway favors neutrophil development at the expense of monocyte cell fate in response to M-CSF

M-CSF has been shown to instruct monocytic development and stimulate more potent activation of Erk1/2 than G-CSF [83, 84]. We examined in more detail Erk1/2 activation by G-CSF and M-CSF in mouse Lin- BM cells. As shown in Fig. 3-9A and C,

Erk1/2 activation is stronger and prolonged in response to M-CSF compared to G-CSF.

In contrast, G-CSF, but not M-CSF, stimulated Stat3 phosphorylation. More than 70% of

Lin- BM cells developed into monocytes/macrophages after 3 days in culture with M-

CSF (Fig.3-9 B and D). Interestingly, U0126 or PD0325901 altered the direction of differentiation with increased the numbers of mature neutrophils and fewer macrophages.

The decrease in macrophage population was unlikely due to increased apoptosis as

U0126 and PD0325901 had only a modest effect on cell survival (Fig.3- 9 G). We further performed colony formation assays to assess the effect of the Mek1/2 inhibitors on the development of myeloid precursors. Two Mek1/2 inhibitors caused an approximate two- fold increase in the number of CFU-G, but about 50% decrease of the number of CFU-M

(Fig.3-9 E). Consistent with their effect on neutrophil versus monocyte development,

U0126 and PD0325901 downregulated the expression of M-CSF and MMP-12 (Fig.3-9

F), but upregulated the expression of neutrophil differentiation markers, including the primary granule proteins myeloperoxidase (MPO) and neutrophil elastase (NE), secondary granule protein lactoferrin and tertiary granule protein gelatinase B in BM cells cultured in M-CSF (Fig.3- 9 F). Thus, M-CSF mainly supported neutrophil cell fate in mouse BM cells upon suppression of Erk1/2 signaling.

Fig.3-9 Suppression of Erk1/2 signaling favors neutrophil over monocyte development in response to M-CSF. (A) WT Lin- bone marrow cells were starved in IMDM medium with FBS for one hour and stimulated with either G-CSF or M-CSF for different time points. 37

Total cellular protein extracts were examined by immunoblotting and activation of Stat3 and Erk1/2 were detected with the phosphor-specific antibodies as indicated. (B) WT Lin- bone marrow cells were cultured in IMDM with IL-3, IL-6, SCF and M-CSF with or without Mek1/2 inhibitors U0126 or PD0325901 for three days. Cells were spun on glass slides and stained with Wright-Giemsa. (C) The results in A were quantitated and normalized to control blots. (D) Macrophages and neutrophils were enumerated. (E) Bone marrow mononuclear cells obtained from mice treated with 5-FU (150mg/kg) were cultured in methylcellulose with IL-3, IL-6, SCF and M-CSF at 104cells/dish, with either no inhibitor, U0126, or PD0325901. CFUs were counted 8 days later. The percentages of each CFU obtained with the two Mek inhibitors relative to the control colony numbers are shown. (F) M-CSF, MMP12, NE, MPO, Lactorferrin and MMP9 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of GAPDH. (G) Apoptosis Assay was performed with Annexcin V conjugated with PE and 7AAD.

3.1.4 G-CSFR Y729F mutant mediates enhanced activation of c-Fos and Egr1

As mutation of Tyr729 induced monocyte development upon G-CSF treatment through prolonged Erk1/2 activation, we next tried to uncover the underlying mechanism by which prolonged activation of Erk1/2 induced monocyte development. Egr1 is an

Erk1/2 downstream target and phosphorylation of c-Fos by Erk1/2 has been shown to affect protein stability and prime further phosphorylation on c-Fos, which favors monocytic differentiation[85]. Therefore, we hypothesized that c-Fos and Egr-1 were more potently activated by Erk1/2 and induced monocyte development. To test this,

32D/WT and 32D/Y729F cells were starved for 2 hours and then stimulated with G-CSF from 0 to 28 hours. In Western blot, c-Fos expression did not show much difference between 32D/WT and 32D/Y729F cells. Interestingly, there were upper band shifts of c-

Fos induced preferentially in 32D/Y729F cells, indicating they might be phospho-c-Fos, which was confirmed by Western blot using phospho-c-Fos (S32). Egr1 expression by 4 hours was induced more potently in 32D/Y729F cells compared to that in 32D/WT cells 38

(Fig.3-10 A, E). These data was reproducible in FDCPmix/WT and FDCPmix/Y729F cells (Fig.3-10 B,E). To further confirm that Egr1 and c-Fos were more strongly activated in cells expressing Y729F receptor mutants, we performed luciferase assay using TRE3- tk--Luc which contains three repeats of TPA-responsive elements and pEBS24-Luc constructs which contain four repeats of Egr binding sequence. TRE3-tk-Luc and pEBS24-Luc constructs were more strongly induced upon G-CSF treatment in

32D/Y729F cells compared to that in 32D/WT cells (Fig.3-10 C D). To validate that c-

Fos and Egr1 are activated by G-CSF through Erk1/2, cells were treated with G-CSF for

1 or 2 hours with or without Mek1/2 inhibitors U0126 and PD0325901. After Mek1/2 inhibitors treatment, c-Fos and Egr1 induction were repressed in both 32D and FDCP- mix A4 cells (Fig.3-11 A, B). Consistently, activation of TRE3-tk-Luc and pEBS24-Luc were repressed after U0126 and PD0325901 treatment in luciferase assay (Fig.3-11 C,

D).

Fig.3-10: Egr1 and c-Fos are strongly induced by G-CSF in 32D/Y729F and FDCPmix/Y729F cells through Erk1/2 pathway. (A, B) Cells starved for 2 hours were cultured in G-CSF for 0 to 28 hours. Total cellular protein extracts were examined by immunoblotting and expression of c-Fos and Egr1 were detected with the antibodies as 40

indicated. The membranes were subsequently probed with phosphor-c-Fos antibodies. (C, D) Cells transfected with either TRE3-tk-Luc or pEBS24-Luc by electroporation were washed by PBS and cultured in the presence of either WEHI-3B (10%) or G-CSF (10ng/ml). Luciferase activities were measured 8 hours later and normalized for activity of cells cultured in WEHI-3D conditioned media. (E) The results in A and B were quantitated and normalized to Actin.

Fig.3-11: Egr1 and c-Fos activation were inhibited by Mek1/2 inhibitors. (A, B) Cells starved for 2 hours cultured in G-CSF for 0 to 2 hours with or without U0126 or PD0325901. Total cellular protein extracts were examined by immunoblotting and expression of c-Fos and Egr-1 were detected with the antibodies as indicated. (C, D) Cells transfected with either TRE3-tk-Luc or pEBS24-Luc by electroporation were washed by PBS and cultured in the presence of either WEHI-3B (10%) or G-CSF (10ng/ml) with or without U0126 or PD0325901. Luciferase activities were measured 8 hours later and normalized for activity of cells cultured in WEHI-3D conditioned media. (E) The results in A and B were quantitated and normalized to Actin.

3.1.5 32D/Y729F and FDCPmix/Y729F cells adopt neutrophil cell fate upon knockdown of c-Fos or Egr1

We reasoned that c-Fos and Egr1 are essential for monocytic differentiation of the cells expressing G-CSFR Y729F mutant. To address this, 32D/Y729F cells were infected with c-Fos shRNA virus and selected with puromycin. c-Fos knockdown was confirmed by Western blot, shRNA 79 markedly and shRNA 80 moderately inhibited c-Fos 42

induction by G-CSF (Fig.3-12 A). After cultured in G-CSF for 6 days, 32D/Y729F cells transduced with shRNA 79 did not attach to the dishes at all, and there is some attachment of cells transduced with shRNA 80, but a lot less compared to control cells

(Fig.3-12 B). Morphologically, 32D/Y729F cells with c-Fos knockdown developed into neutrophils. Along with the neutrophil development, M-CSF and Mmp-12 induction were also repressed (Fig. 3-12 C, E). However, F4/80 expression in c-Fos knockdown cells was not repressed. Results were reproducible in FDCPmix/Y729F cells (Fig.3-13). Taken all together, we concluded that c-Fos expression and activity are essential for monocytic differentiation.

We next want to find out whether Egr1 is also essential for monocytic differentiation. Similar experiments were conducted. 32D/Y729F cells were infected with

Egr1 shRNA virus and selected with puromycin. Egr1 knockdown was confirmed by

Western blot (Fig.3-14 A). We pick three different Egr1 shRNA (24, 25 and 26) knockdown cells, and cultured them in the presence of G-CSF. Compared to control cells, attachment of 32D/Y729F transduced with shRNA 24 is similar, shRNA 25 expressing cells did not have any attachment and shRNA 26 expressing cells have a lot less attachment (Fig.3-14 B). Morphologically, control and shRNA 24 expressing cells differentiated into macrophages, whereas Egr1 knockdown 32D/Y729F cells developed into neutrophils, along with repression of M-SCF and Mmp-12 induction (Fig. 3-14 C,

D). Similarly, F4/80 expression was not repressed upon G-CSF treatment in Egr1 knocked down 32D/Y729F cells. Results were reproducible in FDCPmix/Y729F cells

(Fig.3-15). Therefore, all these data suggested Egr1 is also essential for the cells to differentiate into monocytes. 43

Fig.3-12 Knockdown of c-Fos restores G-CSF-induced neutrophil development in 32D/Y729F cells. 32D/Y729F cell infected with the lentivirus containing either control plasmid pLKO.1 or c-Fos shRNA 79, 80 (A) were starved for 2 hours and then were treated with G-CSF for 0 to 2 hours. The expression of c-Fos protein was examined by Western blot analysis. Cells were cultured in G-CSF (10ng/ml) for 6 days. (B) Pictures were taken. (C) Cells were spun on glass slides and stained with Wright-Giemsa. (D) Expression of F4/80 was examined by FACS. (E) M-CSF and MMP12 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh.

Fig.3-13 Knockdown of c-Fos restores G-CSF-induced neutrophil development in FDCPmix/Y729F cells. FDCPmix/Y729F cells infected with the lentivirus containing either control plasmid pLKO.1 or c-Fos shRNA 79, 80 (A) were starved for 2 hours and then were treated with G-CSF for 1 hour. The expression of c-Fos protein was examined by Western blot analysis. Cells were cultured in G-CSF (10ng/ml) for 2 days. (B) Pictures were taken. (C) Cells were spun on glass slides and stained with Wright-Giemsa. (D) Expression of F4/80 was examined by FACS. (E) M-CSF, MMP12, NE and MPO mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh.

Fig.3-14 Knockdown of Egr1 restores G-CSF-induced neutrophil development in 32D/Y729F cells. 32D/Y729F cell infected with the lentivirus containing either control plasmid pLKO.1 or Egr1 shRNA 24, 25 or 26 (A) were starved for 2 hours and then were treated with G-CSF for 0 to 2 hours. The expression of Egr1 proteins was examined by Western blot analysis. Cells were cultured in G-CSF (10ng/ml) for 6 days. (B) Pictures were taken. (C) Cells were spun on glass slides and stained with Wright-Giemsa. (D) Expression of F4/80 was examined by FACS. (E) M-CSF and MMP12 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh.

Fig.3-15 Knockdown of Egr1 restores G-CSF-induced neutrophil development in FDCPmix/Y729F cells. FDCPmix/Y729F cells infected with the lentivirus containing either control plasmid pLKO.1 or Egr1 shRNA 24, 25 or 26 (A) were starved for 2 hours and then were treated with G-CSF for 1 hour. The expression of Egr1 proteins was examined by Western blot analysis. Cells were cultured in G-CSF (10ng/ml) for 2 days. (B) Pictures were taken. (C) Cells were spun on glass slides and stained with Wright- Giemsa. (D) Expression of F4/80 was examined by FACS. (E) M-CSF, MMP12, NE and MPO mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh.

3.2 The role of transcriptional repressor Gfi1 in regulation of neutrophil versus macrophage differentiation

3.2.1 Gfi1 overexpression rescues neutrophil development of cells expressing GR

Y729F

We have shown that mutation of Tyr729 into phenylalanine of G-CSFR caused macrophage differentiation of 32D/Y729F and FDCPmix/Y729F cells in response to G-

CSF. Since Gfi1 favors neutrophil differentiation and suppresses macrophage differentiation by repressing M-CSF and M-CSFR[67], we asked whether Gfi1 in

32D/Y729F or FDCPmix/Y729F cells inhibited macrophage development independent of

M-CSF signaling. 32D/Y729F cells were transduced with inducible lentiviral expression construct for Gfi1, which contained tetracyclineresponse element (TRE). Endogenous expression level of Gfi1 was barely detectable by Western blot analysis and expression of

Gfi1 was strongly induced upon addition of doxycycline (Fig.3-16 A). Interestingly, upon

Gfi1 induction, 32D/Y729F cells barely showed attachment, along with smaller cell size when cultured in G-CSF compared to the 32D/Y729F cells (Fig. 3-16 B). To further assess the differentiation, morphology was examined by Wright-Giemsa staining, and macrophage markers F4/80, M-CSF and MMP-12 were examined by FACS and Real- time PCR. As shown in Fig.3-16 C-E, 32D/Y729F cells overexpressing Gfi1 displayed neutrophil morphology along with reduced expression of F4/80, M-CSF and MMP-12.

We also expressed Gfi1 in FDCPmix/Y729F cells. As shown in Fig. 3-17, overexpression of Gfi1 blocked macrophage development of FDCPmix/Y729F cells cultured in the presence of G-CSF, and rescued neutrophil characteristics, i,e, smaller cell size,

neutrophillic morphology, reduced expression of F4/80, M-CSF and MMP-12. Therefore, overexpression of Gfi1 rescued neutrophil cell fate in 32D/Y729F or FDCPmix/Y729F cells in response to G-CSF treatment.

Fig.3-16: Gfi1 rescues neutrophil development in 32D/Y729F cells. 32D/Y729F cells were transduced with the inducible lentiviral expression construct for Gfi1. (A) Expression of Gfi-1 was examined by Western blot with or without doxycycline for 24 hours. Cells were cultured with G-CSF (10ng/ml) for 6 days with or without doxycycline. (B) Pictures were taken. (C) Cells were spun on glass slides and stained with Wright- Giemsa. (D) Expression of F4/80 is examined by FACS. (E) M-CSF and Mmp-12 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh.

Fig.3-17: Gfi1 rescues neutrophil development in FDCPmix/Y729F cells. FDCPmix/Y729F cells were transduced with the inducible lentiviral expression construct for Gfi1. (A) Expression of Gfi-1 was examined by Western blot with or without doxycycline for 24 hours. Cells were cultured with G-CSF (10ng/ml) for 5 days with or 2 days without doxycycline. (B) Pictures were taken. (C) Cells were spun on glass slides and stained with Wright-Giemsa. (D) Expression of F4/80 was examined by FACS. (D) M-CSF and Mmp-12 mRNA expression was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh on day 2.

3.2.2 Gfi1 inhibits Egr1 and C-Fos expression

Because Egr1 and c-Fos have been shown to favor macrophage/monocyte differentiation [72-75, 79, 80, 86] , Gfi1 may regulate myelopoiesis through Egr-1,2/Nab-

2 and expression of Egr1 was deregulated in Gfi1 knockout mice[77, 87]. We examined the mRNA expression of Egr1 and c-Fos in Gfi1+/+ and Gfi1-/- mice. As shown in Fig. 3- 50

18 A, mRNA expression of Egr1 and c-Fos were significantly augmented in Gfi1-/- mice compared to Gfi1+/+ mice. Therefore, we reasoned that Gfi1 may promote granulocytic vesus monocytic cell fates through inhibiting Egr1 and c-Fos expression. We next examined Egr1 and c-Fos induction by G-CSF from 0 to 2 hours with or without Gfi1 overexpression in both 32D/Y729F and FDCPmix/Y729F cells. In comparison with control cells, Egr1 and c-Fos protein expression levels were dramatically decreased in the presence of Gfi1 overexpression (Fig.3-18 B, D). Notably, during continuous culture in the presence of G-CSF, Egr1 and c-Fos expression increased along with days without doxycycline, but barely detectable when Gfi1 was overexpressed (Fig. 3-18 C). Thus,

Gfi1 inhibits Egr1 and c-Fos expression. To test whether mRNA expression of Egr1 and c-Fos is also repressed by Gfi1, we did real-time PCR. As shown in Fig. 3-19 A and B, mRNA expression levels of Egr1 and c-Fos were significantly repressed with the induction of Gfi1 in response to G-CSF in both 32D/Y729F and FDCPmix/Y729F cells.

Therefore, we concluded that Gfi1 repressed Egr1 and c-Fos expression.

Fig.3-18: Egr1 and c-Fos expression were repressed by Gfi1. (A) Lin- cells were isolated from Gfi1+/+ and Gfi1 -/- mice between 6 to 8 weeks. c-Fos and Egr1 expression levels were assessed by RT-qPCR and normalized to the mRNA expression of Gapdh. (B) 32D/Y729F and FDCPmix/Y729F cells starved for 2 hours were cultured in the presence of G-CSF for 2 to 4 hours with or without doxycycline. Total cellular protein extracts were examined by immunoblotting and c-Fos and Egr1 were detected with specific antibodies as indicated. (C) 32D/Y729F and FDCPmix/Y729F were cultured in the presence of G-CSF (10ng/ml) with or without doxycycline for different days. c-Fos and Egr1 expression was examined by Western blot. (d) The results in B were quantitated and normalized to Actin.

Fig.3-19: Gfi1 suppresses the levels of c-Fos and Egr1 mRNAs in 32D/Y729F and FDCPmix/Y729F cells. (A) 32D/Y729 and (B) FDCPmix/Y729F cells starved for 2 hours were cultured in G-CSF for 15 to 30 minutes with or without doxycycline. c-Fos and Egr1 mRNA expression levels was assessed by RT-qPCR and normalized to the mRNA expression of Gapdh.

3.2.3 Suppression of Erk1/2 pathways restored neutrophil differentiation in Gfi1-/-

Lin- BM cells

Neutrophil differentiation is defective in Gfi1-/- mice, and Gfi1-/- progenitor cells differentiated into monocyte even upon G-CSF treatment[65, 66]. We have shown that

Erk1/2 activation regulates neutrophil versus macrophage cell fate. Therefore we examined the Erk1/2 activation upon G-CSF treatment with or without doxycycline in

32D/Y729F/Gfi1 and FDCPmix/Y729F/Gfi1 cells. As shown in Fig.3-20 A and E, Erk1/2 phosphorylation is repressed by Gfi1 upon G-CSF treatment in 32D/Y729F/Gfi1 cells 54

during a short treatment, which is consistent with the neutrophil development of

32D/Y729F/Gfi1 with Gfi1 expression. However, the repression is not reproducible in

FDCPmix cells and in both cell lines during a long treatment. Next, we examined Erk1/2 activation in Gfi1+/+ and Gfi1-/- Lin- BM cells. As shown in Fig.3-21 A and B, Erk1/2 phosphorylation is stronger in Gfi1-/- BM cells. Since c-Fos and Egr1 are downstream targets of MAPK/Erk pathway, bone marrow cells from Gfi1-/- mice were treated with

Mek1/2 inhibitors U0126 and PD0325901 for 8 hours and examined for mRNA expression of c-Fos and Egr1 by RT-PCR. As shown in Fig. 3-21 C, c-Fos and Egr1 expression were repressed by both Mek1/2 inhibitors. When cultured in G-CSF media for 3 days, about 54% of Lin- BM cells developed into monocytes/macrophages, with only 7% of cells differentiated into neutrophils (Fig. 3-21 D and E). Interestingly, with treatment of Mek1/2 inhibitors U0126 and PD0325901, the number of macrophages decreased to about 12.3% and the number of neutrophils increased to around 30%. The decrease in macrophage population was unlikely due to increased apoptosis as U0126 and

PD0325901 had only a modest effect on cell survival (Fig. 3-21 I). To further confirm the effect of Mek1/2 inhibitors on cell fate choice, we performed colony culture assay. As shown in Fig 3-21 F, CFU-G number increased by about 2.5 fold with the treatment of

U0126 and PD0325901 and CFU-M number markedly decreased. Consistent with increased neutrophil development at the expense of monopoiesis, U0126 and PD0325901 downregulated macrophage markers M-CSF and MMP-12 (Fig. 3-21 G), but unregulated the expression of neutrophil differentiation markers, including the primary granule proteins myeloperoxidase (MPO) and neutrophil elastase (NE), secondary granule protein lactoferrin in BM cells cultured in M-CSF (Fig. 3-21 H). Therefore, Mek1/2 inhibitors 55

restored neutrophil development of Gfi1-/- Lin- BM cells by suppressing Erk1/2 activation.

Fig.3-20: Signaling pathways activated in 32DGR/Y729F/Gfi1 and FDCPmix/Y729F/Gfi1 cells. Cells starved for 2 hours were cultured in presence of G- CSF for 0 to 48 hours. Total cellular protein extracts were examined by immunoblotting and activation of Stat5, Akt and Erk1/2 were detected with the phosphor-specific antibodies as indicated in (A, C) 32D/Y729F (B, D) FDCPmix/Y729F cells. (E) The results above were quantitated and normalized to Actin.

Fig.3-21 Suppression of Erk1/2 signaling favors neutrophil over monocyte development in response to G-CSF. Lin- cells were isolated from Gfi1+/+ and Gfi1-/- mice between 6 to 8 weeks. (A) Cells were treated with G-CSF, and Erk1/2 phosphorylation was examined by Western blot. (B) The results in A were quantitated and normalized to Actin. (C) Cells

were treated with or without Mek1/2 inhibitors U0126 or PD0325901 for 8 hours. C-Fos and Egr1 expression levels were assessed by RT-qPCR and normalized to the mRNA expression of Gapdh. (D, E) Cells were cultured in the presence of G-CSF with or without U0126 or PD0325901 for 3 days, and were spun on glass slides and stained with Wright-Giemsa, and neutrophils and monocytes were counted. (F) Bone Marrow mononuclear cells obtained from Gfi1-/- mice treated with 5-FU (150mg/kg) were cultured in methylcellulose with IL-3, IL-6, SCF and G-CSF at 104cells/dish, with no inhibitor, U0126, or PD0325901. CFUs were counted 8 days later. The percentage of each CFU obtained with the two Mek inhibitors relative to the control colony numbers is shown. (G, H) M-CSF, Mmp12, MPO, NE and Lactorferrin mRNA expressions were assessed by RT-qPCR and normalized to the mRNA expression of Gapdh. (I) Cells were incubated with Annexin V conjugated with PE and 7AAD, and apoptosis assay were assessed by FACS.

3.2.4 Gfi1 represses Egr1 and c-Fos transcription through direct binding to their promoters

We examined whether Gfi1 repressed murine c-Fos promoter region spanning from -1070 to +30 bp and murine Egr1 promoter from -1780 to +50 bp in 32DGR/Y729F cells. As shown in Fig.3-22 A, luciferase activity of c-Fos and Egr1 promoters were repressed when Gfi1 was induced. To further test whether repression by Gfi1 is through direct binding, we performed CHIP assay Analysis of the c-Fos and Egr1 promoters using using online software (TFBIND) revealed potential Gfi1 binding sites at c-Fos

(-786bp to -584bp) and Egr1 (-997bp to -971bp and -1614bp and -1590bp) respectively.

32DGR/Y729F cells were cultured in the presence of doxycycline for 12 hours, and protein-DNA complex were exacted and immunoprecipitated with Gfi1 antibody and then PCR were performed with the indicated primers flanking the potential Gfi1 binding sites. As shown in Fig.3-22 B, without Gfi1 overexpression, the bands were barely detectable, however, when Gfi1 was induced, it is evident that the bands were produced 60

in the c-Fos proximal region and two Egr1 proximal regions, but not in the distal region.

The CHIP assay results showed that Gfi1 binds to between 745 and 591 region upstream of transcription start site on c-Fos promoter and two regions (between 1021 and 921, between 1649 and 1525) upstream of transcription start site on Egr1 promoter. This result is consistent with the promoter analysis using online softeware and the luciferase assay results. Thus, Gfi1 represses c-Fos and Egr1 promoter activity through direct DNA binding.

Fig.3-22 Gfi1 represses Egr1 and c-Fos transcription through direct binding to their promoters. (A) 32D/Y729F cells were transfected with pGL3-basic with c-Fos and Egr1 promoter constructs and cultured in G-CSF with or without doxycycline. Luciferase activities were measured 24 hours later. (B) 32DGR/Y729F cells were cultured with or

without doxycycline for 24 hours. ChIP assays were carried out using the anti-mouse Gfi1 antibody. The indicated regions of c-Fos and Egr1 promoters were amplified by PCR.

Chapter 4

Discussion

4.1 The duration of Erk1/2 signaling regulates neutrophil versus monocyte cell fate choice in response to G-CSF and M-CSF

Cytokines orchestrate hematopoiesis, but whether cytokines instruct lineage commitment and development is still controversial. With regard to myeloid development, it has been shown that G-CSF can instruct neutrophil development and M-CSF instructs macrophage/monocyte development [12]. However, how G-CSF and M-CSF stimulate intracellular signaling to induce neutrophil and macrophage cell fate choice is still unknown.

In this study, we have shown that mutation of the C-terminal three tyrosine residues of G-CSFR caused macrophage development in 32D cells upon G-CSF treatment. Further studies in both 32D and FDCP-mix A4 cells confirmed that the macrophage differentiation arisen from the mutation of Tyr729, which is consistent with previous reports [18, 19]. This result indicates that development of granulocyte and macrophage from GMPs may depend on common signaling pathways, but the duration of signal activation may affect the direction of differentiation.

We have shown that monocyte development directed by G-CSFR Y729F is associated with prolonged Erk1/2 activation and inhibition of Erk1/2 pathway rescues neutrophil development in 32D/Y729F and FDCPmix/Y729F cells upon G-CSF treatment. We have also shown that M-CSF, but not G-CSF, induced prolonged and stronger Erk1/2 activation in Gfi1+/+ Lin- BM cells, which is associated with monocyte/macrophage development. Furthermore, suppression of Erk1/2 signaling pathway favors neutrophil development over macrophage development in response to M-

CSF. These results indicate that although Erk1/2 pathway is activated during neutrophil and monocyte/macrophage development from GMPs, the duration and intensity of activation regulate the direction of development. Consistent with this, the Erk1/2 pathway has been shown to regulate lineage choice. The MEK/ERK pathway favors myeloid lineage commitment as the conversion from CLP cells into CMP cells by overexpressing

IL-2 receptors with IL-2 treatment was blocked by MEK inhibitors, and formation of granulocyte-macrophage colonies from hematopoietic stem cells was also reduced by

MEK inhibitors[88]. Our results provided further evidence for the instructive role of cytokines in lineage specification in the hematopoietic system. As shown in our results,

G-CSF induces neutrophil development through transient activation of Erk1/2, while M-

CSF induces monocyte/macrophage development through sustained activation of Erk1/2.

When prolonged Erk1/2 activation is induced by mutant receptor G-CSFR Y729, which is similar to Erk1/2 activation in response to M-CSF, both 32D/Y729F and

FDCPmix/Y729F cells develop into monocyte/macrophage lineage. On the contrary, in

Gfi1+/+ Lin- BM cells, 32D/Y729F and FDCPmix/Y729F cells, inhibition of Erk1/2 activation by Mek1/2 inhibitors or knockdown of Erk1/2 restored neutrophil 64

development. Together, these results demonstrate that one of the mechanisms by which

G-CSF and M-CSF instruct lineage choice involves regulation of the duration and intensity of Erk1/2 activation.

Erk1/2 pathway has been shown to be essential for cell differentiation. Sustained

Erk1/2 activation induced neuronal differentiation, whereas transient Erk1/2 activation only caused proliferation in PC12 cells [89]. Thrombopoietin-induced megakaryocytic differentiation is dependent on prolonged activation of the Ras-Erk1/2 pathway [90].

Persistent Erk1/2 signaling has been shown to be required for M-CSF-induced monocytic differentiation in myeloid FDCP1 cells and that the Mek1/2 inhibitors U0126 and

PD98059 inhibit the production of monocytes/macrophages from primary BM cells in vitro [84, 91]. However, our data indicate that Erk1/2 pathway regulates cell fate choice, but is not required for terminal differentiation since inhibition of Erk1/2 pathway or

Erk1/2 knockdown did not abolish the terminal differentiation in 32D/Y729F,

FDCPmix/Y729F or Lin- BM cells.

It should be pointed out that the macrophage differentiation of cells expressing G-

CSFR Y729F mutant is unlikely mediated by M-CSF and M-CSFR since the mRNA levels of M-CSF or M-CSFR were not significantly increased in these cells, as examined by real-time RT-PCR assays (data not shown). In addition, both 32D/Y729F and

FDCPmix/Y729F cells showed no response to recombinant murine M-CSF (data not shown).

Our data indicates that Erk1/2 pathway promotes monocyte cell fate through prolonged induction of c-Fos and Egr1. Knockdown of c-Fos and Egr-1 repressed macrophage development and redirected the cells to develop into neutrophils. Erk1/2 has 65

been shown to stabilize c-Fos expression level [92]. It has been shown that in addition to complexing with Jun family proteins, c-Fos may form heterodimers with c/EBPα and thereby, inhibits the formation of c/EBPα homodimers, which promotes monopoiesis at the expense of neutrophil development [81]. c-Fos also enhances PU.1 activity to support monocytic differentiation. It is possible that prolonged c-Fos activation in cells expressing G-CSFR Y729F may lead to more c/EBPα:c-Fos heterodimers which activate monocyte/macrophage specific genes. Irrespective of precise mechanism by which c-Fos promotes monopoiesis, our data indicate that c-Fos and Egr1 represent the key transcription factors that are differentially activated by G-CSF and M-CSF in an Erk1/2- dependent manner to resolve neutrophil versus monocyte cell fate.

Notably, F4/80 expression was not repressed after Mek1/2 inhibitor treatment, c-

Fos and Egr-1 knockdown, indicating F4/80 expression is not dependent on MAPK pathways. We speculate that G-CSFR Y729F may activate other signaling pathways to induce F4/80 expression. Interestingly, PU.1 is activated in 32DGR/Y729F cells by G-

CSF, but only minimally stimulated in 32D/WT cells, and Mek1/2 inhibitors has little effect on PU.1 activation. PU.1 activation has been shown to associate with F4/80 expression[93].

Erk1/2 has been shown to phosphorylate c/EBPα on serine 21 which inhibits its activity and thereby suppress neutrophil differentiation [83, 94]. However, we did not see increased phosphorylation of serine 21 of c/EBPα in 32D/Y729F cells (data not shown).

We conclude that tyrosine residue 729 of G-CSFR is essential for instructing neutrophil development. Furthermore, prolonged and augmented activation of Erk1/2 result in strong activation of Egr-1 and c-Fos induction, which favors 66

monocyte/macrophage development. However, Erk1/2 activation is not required for terminal differentiation. Thus, M-CSF instructs monocyte/macrophage development through sustained Erk1/2 activation, whereas G-CSF instructs neutrophil development through transient Erk1/2 activation. Our data support the instructive role of cytokines in cell fate choice in the hematopoietic system.

4.2 The role of transcriptional repressor Gfi1 in regulation of neutrophil versus macrophage cell fate decision in response to G-CSF

The role of Gfi1 in myelopoeisis is well established. Gfi1 favors neutrophil differentiation and antagonize monocyte/macrophage differentiation[65, 66]. Gfi1-/- mice have elevated number of monocytes and no mature neutrophils with accumulated abnormal granulocyte and macrophage precursors. It has been reported that Gfi1 blocks monocyte differentiation through repressing transcription factors which are important for monocyte differentiation. For instance, Gfi1 has been shown to repress PU.1 expression at transcriptional level and inhibit PU.1 activity by protein-protein interaction[71]. Egr2 has been shown to be repressed by Gfi1 through direct promoter binding[77, 95]. Gfi1 also blocks monocyte differentiation through repressing cytokine signaling, such as M-

CSF and M-CSFR, and blocking of M-CSFR signaling rescued neutrophil development in bone marrow cells expressing dominant-negative protein Gfi1N382S [87], which indicates that Gfi1 regulates neutrophil and monocyte/macrophage cell fate choice largely through M-CSFR signaling. The mechanism that Gfi1 regulates differentiation towards neutrophils and monocytes from GMPs is still incompletely understood.

We have shown that Gfi1 rescues neutrophil development of 32D/Y729F and

FDCPmix/Y729F cells in response to G-CSF. As 32D/Y729F and FDCPmix/Y729F cells do not respond to M-CSF, these results indicate that Gfi1 may favor neutrophil over monocyte development independent of M-CSF signaling. Our data further demonstrate that Gfi1 promotes neutrophil development and suppresses monopoiesis at least in part through repressing c-Fos and Egr1. Egr1 and c-Fos mRNA levels are significantly elevated in Gfi1-/- Lin- BM cells compared to Gfi1+/+ Lin- BM cells. We have also shown that induction of Egr1 and c-Fos in response to G-CSF is repressed by Gfi1. We have further demonstrated that Gfi1 binds to the promoters of c-Fos and Egr1, and represses the activities of c-Fos and Egr1 promoters. These data identify c-Fos and Egr1 as new

Gfi1 target genes.

Apart from direct repression of Egr1 and c-Fos, our data demonstrate that activation of Erk1/2 in response to G-CSF is enhanced in Gfi1-/- Lin- BM cells suggesting

Gfi1 may act to inhibit Erk1/2 activation. As the Erk1/2 pathway activates the expression of c-Fos and Egr1, it is possible that the enhanced activation of Erk1/2 may contribute to the increased mRNA levels of c-Fos and Egr1 in Gfi1-/- Lin- BM cells. Significantly, the two Mek inhibitors U0126 and PD0325901 rescue neutrophil development of Gfi1-/- Lin-

BM cells in response to G-CSF, along with the increased expression of primary granules neutrophil elastase, MPO and secondary granules lactoferrin and decreased expression of

M-CSF and Mmp12. However, it is unclear how Gfi1 inhibits the activation of Erk1/2 in the Lin- BM cells.

Interestingly, Erk1/2 activation is repressed by Gfi1 in 32D cells. However, we did not see consistent repression of Erk1/2 activation by Gfi1 in FDCPmix cells. It is 68

possible that Gfi1 overexpression is not high enough to repress Erk1/2 activation in

FDCPmix cells, since the endogenous Gfi1 expression is higher in FDCPmix cells compared to 32D cells. It is also likely that the inconsistent result is caused by experimental error which needs to be further examined.

In sharp contrast to our data, a previous study reported that Gfi1 positively regulated Ras/Mek/Erk pathway by upregulating Ras regulator RasGRP1 [56],

Overexpression of RasGRP1 restored Erk1/2 activation in response to G-CSF and rescued neutrophil development in Gfi1-/- BM cells [56]. The precise reason for the discrepancy is unclear at the moment. Mononuclear BM cells rather than Lin- BM cells were used in the previous study. As Gfi1-/- BM cells are unable to undergo terminal neutrophil differentiation, but instead develop into atypical monocytes, it is possible that the weak activation of Erk1/2 induced by G-CSF in the previous study may result from a lack of cells of neutrophilic lineage, which express G-CSFR, in the mononuclear cell population.

It is interesting to note that, unlike the Mek inhibitors or the knockdown of c-Fos or Egr1, Gfi1 represses F4/80 expression in 32D/Y729F and FDCPmix/Y729F cells induced to differentiate with G-CSF. As mentioned earlier, Gfi1 has been shown to repress PU.1 transcription and further PU.1 activity via direct protein-protein interaction.

It is possible that the effect of Gfi1 on F4/80 expression is mediated by PU.1.

Together, our data reveal two likely new mechanisms by which Gfi1 favors neutrophil development and antagonize monocyte development, i.e., repression of c-Fos and Egr1 and inhibition of Erk1/2 activation. Further studies are needed to address whether c-Fos or Egr1 knockdown rescues neutrophil development in Gfi1-/- Lin- BM 69

cells which will confirm that strong activation of Egr1 and c-Fos contribute to the abnormal monocyte development in Gfi1-/- Lin- BM cells. Altogether, as summarized in

Fig. 4-1, our data suggest that the duration and intensity of Erk1/2 activation regulate the activation of c-Fos and Egr1. M-CSF stimulates strong and sustained activation of

Erk1/2, leading to macrophage development whereas G-CSF stimulates weak and transient activation of Erk1/2, resulting in neutrophil development. Gfi1 favors neutrophil development and suppresses the alternative monocyte cell fate in part through repressing

Egr1 and c-Fos and inhibiting Erk1/2 activation.

Fig.4-1: Model of the regulation of Erk1/2 pathway and Gfi1 on neutrophil versus macrophage cell fate choice

Chapter 5

Future directions

5.1 Examine the differentiation of other G-CSF receptor mutants

We will continue the study of effect of Erk1/2 activation on differentiation. There are other G-CSF receptors that induce prolonged activation of Erk1/2 in response to G-

CSF. To further confirm the role of Erk1/2 phosphorylation on direction of differentiation, we will examine the differentiation of other G-CSF receptor mutants in response to G-CSF.

5.2 Examine the effect of Egr1 and c-Fos knock down on Gfi1-/- Lin- BM cells.

Treatment with Mek1/2 inhibitors U0126 and PD0325901 repressed Egr1 and c-

Fos mRNA expression in Gfi1-/- Lin- BM cells and restored neutrophil differentiation of

Gfi1-/- Lin- BM cells in response to G-CSF. We hypothesize that silencing of Egr1 and c-

Fos gene expression will also restore neutrophil differentiation of Gfi1-/- Lin- BM cells in response to G-CSF. Therefore, gene knockdown of Egr1 and c-Fos will be performed in

Gfi1-/- Lin- BM cells to further confirm the role of Egr1 and c-Fos in the direction of neutrophil versus macrophage differentiation. 71

5.3 Examine the signaling pathway activating PU.1in response to G-CSF

As mentioned in the study, PU.1 is preferentially activated in response to G-CSF in cells expressing G-CSFR Y729F. PU.1 is important to prime cell fate choice between neutrophil and macrophage lineage. Therefore, it will be interesting and important to study the signaling pathways triggered by G-CSF that activates PU.1 using inhibitors or gene knockdown.

5.4 Examine the effect of PU.1 and c/EBPα on Egr1 and c-Fos

The ratio of PU.1 to c/EBPα determines the direction of development into either neutrophil or macrophage. It has been shown that c-Fos can form heterodimers with c/EBPα. Experiments will be conducted to study whether PU.1 and c/EBPα affect Egr1 and c-Fos protein and mRNA expression. Furthermore, we will examine whether PU.1 or c/EBPα interact with Egr1 or c-Fos to affect lineage-specific gene expression.

References

1. Lodish, H.F., 2003, Molecular cell biology. 5th ed. . New York: W.H. Freeman and Company, 2003. xxxiii, 973 p. 1456.

2. Seita J, W.I., Hematopoietic stem cell: self-revewal versus differentiation. Wiley Interdiscip Rev Syst Biol Med 2010. 2(6): p. 640-53.

3. Duan Z, H.M., Gfi-1 takes center stage in hematopoietic stem cells. Trends Mol Med. , 2005 11(2): p. 49-52.

4. D, M., On hematopoietic stem cell fate. Imunity, 2007. 26(6): p. 669-73.

5. D, M., Hematopoietic cytokines. blood, 2008. 111(2): p. 485-91.

6. L, R., Cytokine receptors and hematopoietic differentiation. Oncogene, 2007. 26(47): p. 6715-23.

7. Orkin SH, Z.L., Hematopoiesis: an evolving paradigm for stem cell biology. cell, 2008. 132(4): p. 631-44.

8. I, W., Stem cell research: paths to cancer therapies and regenerative medicine. JAMA, 2005. 294(11): p. 1359-66.

9. Zhu J, E.S., Hematopoietic cytokines, transcription factors and lineage commitment. Oncogene, 2002. 21(21): p. 3295-313.

10. Maraskovsky E, O.R.L., Teepe M, Corcoran LM, Peschon JJ, Strasser A, Bcl-2 can rescue T lymphocyte development in interleukin-7 receptor-deficient mice but not in mutant rag-1-/- mice. Cell, 1997. 89(7): p. 1011-1019.

11. Akashi K, K.M., von Freeden-Jeffry U, Murray R, Weissman IL, Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice. Cell, 1997. 89(7): p. 1033- 1041.

12. Rieger MA, H.P., Smejkal BM, Eitelhuber AC, Schroeder T, Hematopoietic cytokines can instruct lineage choice. Science, 2009. 325(5937): p. 217-218. 73

13. Akbarzadeh S, L.J., Granulocyte Colony-Stimulating Factor Receptor: Structure and Function. Vitamins and Hormones, 2001. 63: p. 159-191.

14. Fukunaga R, S.Y., Mizushima S, Nagata S, Three different mRNAs encoding human granulocyte colony-stimulating factor receptor. Proc Natl Acad Sci U S A, 1990. 87(22): p. 8702-6.

15. Larsen A, D.T., Curtis BM, Gimpel S, Sims JE, Cosman D, Park L, Sorensen E, March CJ, Smith CA, Expression cloning of a human granulocyte colony- stimulating factor receptor: a structural mosaic of hematopoietin receptor, immunoglobulin, and fibronectin domains. J Exp Med, 1990. 172(6): p. 1559-70.

16. Dong F, v.B.C., Pouwels K, Hoefsloot LH, Löwenberg B, Touw IP, Distinct cytoplasmic regions of the human granulocyte colony-stimulating factor receptor involved in induction of proliferation and maturation. Mol Cell Biol, 1993. 13(12): p. 7774-7781.

17. Ziegler SF, B.T., Morella KK, Mosley B, Gearing DP, Baumann H, Distinct regions of the human granulocyte-colony-stimulating factor receptor cytoplasmic domain are required for proliferation and gene induction. Mol Cell Biol, 1993. 13(4): p. 2384-2390.

18. Ward AC, S.L., de Koning JP, van Aesch Y, Touw IP., Multiple signals mediate proliferation, differentiation, and survival from the granulocyte colony- stimulating factor receptor in myeloid 32D cells. J Biol Chem, 1999. 274(21): p. 14956-14962.

19. Akbarzadeh S, W.A., McPhee DO, Alexander WS, Lieschke GJ, Layton JE, Tyrosine residues of the granulocyte colony-stimulating factor receptor transmit proliferation and differentiation signals in murine bone marrow cells. blood, 2002 99(3): p. 879-887.

20. Nicholson SE, S.R., Novak U, Hilton DJ, Layton JE, Tyrosine residues in the granulocyte colony-stimulating factor (G-CSF) receptor mediate G-CSF-induced differentiation of murine myeloid leukemic (M1) cells. J Biol Chem, 1996. 271(43): p. 26947-53.

21. Hermans MH, v.d.G.G., Antonissen C, Gits J, van Leeuwen D, Ward AC, Touw IP, Signaling mechanisms coupled to tyrosines in the granulocyte colony- stimulating factor receptor orchestrate G-CSF-induced expansion of myeloid progenitor cells. Blood, 2003. 101(7): p. 2584-90.

22. Beekman R, V.M., Sanders MA, van Strien PM, Haanstra JR, Broeders L, Geertsma-Kleinekoort WM, Veerman AJ, Valk PJ, Verhaak RG, Löwenberg B, 74

Touw IP, Sequential gain of mutations in severe congenital neutropenia progressing to acute myeloid leukemia. Blood, 2012. 119(22): p. 5071-7.

23. Touw IP, B.R., Severe congenital neutropenia and chronic neutrophilic leukemia: an intriguing molecular connection unveiled by oncogenic mutations in CSF3R. Haematologica, 2013. 98(10): p. 1490-2.

24. Dong F, B.R., Tidow N, Welte K, Löwenberg B, Touw IP, Mutations in the gene for the granulocyte colony-stimulating-factor receptor in patients with acute myeloid leukemia preceded by severe congenital neutropenia. N Engl J Med, 1995. 333(8): p. 487-493.

25. Dong F, L.X., de Koning JP, Touw IP, Hennighausen L, Larner A, Grimley PM, Stimulation of Stat5 by granulocyte colony-stimulating factor (G-CSF) is modulated by two distinct cytoplasmic regions of the G-CSF receptor. J Immunol, 1998. 161(12): p. 6503-9.

26. de Koning JP, D.F., Smith L, Schelen AM, Barge RM, van der Plas DC, Hoefsloot LH, Löwenberg B, Touw IP, The membrane-distal cytoplasmic region of human granulocyte colony-stimulating factor receptor is required for STAT3 but not STAT1 homodimer formation. Blood, 1996. 87(4): p. 1335-42.

27. Zhuang D, Q.Y., Haque SJ, Dong F, Tyrosine 729 of the G-CSF receptor controls the duration of receptor signaling: involvement of SOCS3 and SOCS1. J Leukoc Biol, 2005. 78(4): p. 1008-1015.

28. Ward AC, v.A.Y., Schelen AM, Touw IP, Defective internalization and sustained activation of truncated granulocyte colony-stimulating factor receptor found in severe congenital neutropenia/acute myeloid leukemia. Blood, 1999. 93(2): p. 447-58.

29. van de Geijn GJ, G.J., Aarts LH, Heijmans-Antonissen C, Touw IP, G-CSF receptor truncations found in SCN/AML relieve SOCS3-controlled inhibition of STAT5 but leave suppression of STAT3 intact. Blood, 2004. 104(3): p. 667-74.

30. Hunter MG, A.B., Granulocyte colony-stimulating factor receptor mutations in severe congenital neutropenia transforming to acute myelogenous leukemia confer resistance to apoptosis and enhance cell survival. Blood, 2000. 95(6): p. 2132-7.

31. Maxson JE, G.J., Pollyea DA, Fleischman AG, Agarwal A, Eide CA, Bottomly D, Wilmot B, McWeeney SK, Tognon CE, Pond JB, Collins RH, Goueli B, Oh ST, Deininger MW, Chang BH, Loriaux MM, Druker BJ, Tyner JW, Oncogenic CSF3R Mutations in Chronic Neutrophilic Leukemia and Atypical CML. N Engl J Med, 2013. 368(19): p. 1781-90. 75

32. Barge RM, d.K.J., Pouwels K, Dong F, Löwenberg B, Touw IP, Tryptophan 650 of human granulocyte colony-stimulating factor (G-CSF) receptor, implicated in the activation of JAK2, is also required for G-CSF-mediated activation of signaling complexes of the p21ras route. Blood, 1996. 87(6): p. 2148-2153.

33. S.E Nicholson, U.N., S.F.Ziegler, J.E.Layton, Distinct regions of the granulocyte colony stimulating factor receptor are required for tyrosine phosphorylation of the signaling molecules JAK2, Stat3, and p42, p44MAPK. Blood, 1995. 86(10): p. 3698-3704.

34. Kimura A, R.M., Simone JM, Chen W, Wickre MC, Zhu BM, Hoppe PS, O'Shea JJ, Schroeder T, Hennighausen L, The transcription factors STAT5A/B regulate GM-CSF-mediated granulopoiesis. Blood, 2009. 114(21): p. 4721-4728.

35. Lin WC, S.J., Creamer BA, Triplett AA, Wagner KU., Gain-of-function of Stat5 leads to excessive granulopoiesis and lethal extravasation of granulocytes to the lung. PLoS One, 2013. 8(4): p. e60902.

36. Wang L, A.M., Watowich SS, Forget BG., Cytokine signals through STAT3 promote expression of granulocyte secondary granule proteins in 32D cells. Exp Hematol, 2005. 33(3): p. 308-317.

37. McLemore ML, G.S., Liu F, Archambault A, Poursine-Laurent J, Haug J, Link DC., STAT-3 activation is required for normal G-CSF-dependent proliferation and granulocytic differentiation. Immunity, 2001 14(2): p. 193-204.

38. Panopoulos AD, Z.L., Snow JW, Jones DM, Smith AM, El Kasmi KC, Liu F, Goldsmith MA, Link DC, Murray PJ, Watowich SS, STAT3 governs distinct pathways in emergency granulopoiesis and mature neutrophils. blood, 2006. 108(12).

39. Zhang H, N.-J.H., Panopoulos AD, Li HS, Murray PJ, Watowich SS., STAT3 controls myeloid progenitor growth during emergency granulopoiesis. blood, 2010. 116(14): p. 2462-2471.

40. Neubauer H, C.A., Müller M, Wu H, Huffstadt U, Pfeffer K, Jak2 deficiency defines an essential developmental checkpoint in definitive hematopoiesis. cell, 1998. 93(3): p. 397-409.

41. Parganas E, W.D., Stravopodis D, Topham DJ, Marine JC, Teglund S, Vanin EF, Bodner S, Colamonici OR, van Deursen JM, Grosveld G, Ihle JN, Jak2 is essential for signaling through a variety of cytokine receptors. cell, 1998. 93(3): p. 385-95.

42. Geest CR, C.P., MAPK signaling pathways in the regulation of hematopoiesis. J Leukoc Biol, 2009. 86(2): p. 237-250.

43. Miranda MB, M.T., Johnson DE, Importance of MEK-1/-2 signaling in monocytic and granulocytic differentiation of myeloid cell lines. Leukemia, 2002. 16(4): p. 683-692.

44. A, K.-G., Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBP alpha). Blood Cells Mol Dis, 2008. 41(1): p. 77-81.

45. Zhang DE, Z.P., Wang ND, Hetherington CJ, Darlington GJ, Tenen DG, Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein alpha-deficient mice. Proc Natl Acad Sci U S A, 1997. 94(2): p. 569-74.

46. Liu H, K.J., Wang QF, Friedman AD, Reciprocal effects of C/EBPalpha and PKCdelta on JunB expression and monocytic differentiation depend upon the C/EBPalpha basic region. Blood, 2003. 101(10): p. 3885-92.

47. Friedman AD, K.J., Kummalue T, Liu H, Wang QF, Cleaves Regulation of granulocyte and monocyte differentiation by CCAAT/enhancer binding protein alpha. Blood Cells Mol Dis, 2003. 31(3): p. 338-41.

48. Wang W, W.X., Ward AC, Touw IP, Friedman AD, C/EBPalpha and G-CSF receptor signals cooperate to induce the myeloperoxidase and neutrophil elastase genes. Leukemia, 2001. 15(5): p. 779-86.

49. Scott EW, S.M., Anastasi J, Singh H., Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages. Science, 1994. 265(5178): p. 1573-7.

50. McKercher SR, T.B., Anderson KL, Henkel GW, Vestal DJ, Baribault H, Klemsz M, Feeney AJ, Wu GE, Paige CJ, Maki RA., Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. EMBO J, 1996. 15(20): p. 5647-58.

51. Oelgeschläger M, N.I., Lüscher B, Friedman AD., C/EBP, c-Myb, and PU.1 cooperate to regulate the neutrophil elastase promoter. Mol Cell Biol, 1996. 16(9): p. 4717-25.

52. Zhang DE, H.C., Chen HM, Tenen DG, The macrophage transcription factor PU.1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor. Mol Cell BioL, 1994. 14(1): p. 373-81.

53. Wang X, S.E., Sawyers CL, Friedman AD., C/EBPalpha bypasses granulocyte colony-stimulating factor signals to rapidly induce PU.1 gene expression, stimulate granulocytic differentiation, and limit proliferation in 32D cl3 myeloblasts. Blood, 1999. 94(2): p. 560-71.

54. Dahl R, W.J., Lancki D, Laslo P, Iyer SR, Singh H, Simon MC., Regulation of macrophage and neutrophil cell fates by the PU.1:C/EBPalpha ratio and granulocyte colony-stimulating factor. Nat Immunol, 2003. 4(10): p. 1029-1036.

55. Goetz CA, H.I., O'Neil JJ, Burchill MA, Farrar MA, STAT5 activation underlies IL7 receptor-dependent B cell development. J Immunol, 2004. 172(8): p. 4770-8.

56. de la Luz Sierra M, S.S., Gasperini P, Salvucci O, Jiang K, McCormick PJ, Segarra M, Stone J, Maric D, Zhu J, Qian X, Lowy DR, Tosato G, The transcription factor Gfi1 regulates G-CSF signaling and neutrophil development through the Ras activator RasGRP1. Blood, 2010. 115(19): p. 3970-9.

57. DeKoter RP, W.J., Singh H, PU.1 regulates both cytokine-dependent proliferation and differentiation of granulocyte/macrophage progenitors. EMBO J, 1998 17(15): p. 4456-4468.

58. Gilks CB, B.S., Grimes HL, Tsichlis PN, Progression of interleukin-2 (IL-2)- dependent rat T cell lymphoma lines to IL-2-independent growth following activation of a gene (Gfi-1) encoding a novel zinc finger protein. Mol Cell Biol, 1993. 13(3): p. 1759-68.

59. Zweidler-Mckay PA, G.H., Flubacher MM, Tsichlis PN, Gfi-1 encodes a nuclear zinc finger protein that binds DNA and functions as a transcriptional repressor. Mol Cell Biol, 1996. 16(8): p. 4024-34.

60. Grimes HL, C.T., Zweidler-McKay PA, Tong B, Tsichlis PN, The Gfi-1 protooncoprotein contains a novel transcriptional repressor domain, SNAG, and inhibits G1 arrest induced by interleukin-2 withdrawal. Mol Cell Biol, 1996. 16(11): p. 6263-72.

61. Grimes HL, G.C., Chan TO, Porter S, Tsichlis PN, The Gfi-1 protooncoprotein represses Bax expression and inhibits T-cell death. Proc Natl Acad Sci U S A, 1996. 93(25): p. 14569-73.

62. Du P, T.F., Qiu Y, Dong F., GFI1Is Repressed by p53 and Inhibits DNA Damage Induced Apoptosis. PLoS One, 2013. 8(9): p. e73542.

63. Zeng H, Y.R., Kosan C, Klein-Hitpass L, Möröy T., Transcription factor Gfi1 regulates self-renewal and engraftment of hematopoietic stem cells. EMBO J, 2004. 23(20): p. 4116-25. 78

64. Hock H, H.M., Rooke HM, Schindler JW, Saleque S, Fujiwara Y, Orkin SH, Gfi- 1 restricts proliferation and preserves functional integrity of haematopoietic stem cells. Nature, 2004. 431(7011): p. 1002-7.

65. Hock H, H.M., Rooke HM, Traver D, Bronson RT, Cameron S, Orkin SH, Intrinsic requirement for zinc finger transcription factor Gfi-1 in neutrophil differentiation. Immunity, 2003. 18(1): p. 109-20.

66. Karsunky H, Z.H., Schmidt T, Zevnik B, Kluge R, Schmid KW, Dührsen U, Möröy T, Inflammatory reactions and severe neutropenia in mice lacking the transcriptional repressor Gfi1. Nat Genet, 2002. 30(3): p. 295-300.

67. Vassen L, D.U., Kosan C, Zeng H, Möröy T, Growth factor independence 1 (Gfi1) regulates cell-fate decision of a bipotential granulocytic-monocytic precursor defined by expression of Gfi1 and CD48. Am J Blood Res, 2012. 2(4): p. 228-42.

68. Ordoñez-Rueda D, J.F., Mancardi DA, Zhao W, Malzac A, Liang Y, Bertosio E, Grenot P, Blanquet V, Sabrautzki S, de Angelis MH, Méresse S, Duprez E, Bruhns P, Malissen B, Malissen M, A hypomorphic mutation in the Gfi1 transcriptional repressor results in a novel form of neutropenia. Eur J ImmunoL, 2012. 42(9): p. 2395-408.

69. Person RE, L.F., Duan Z, Benson KF, Wechsler J, Papadaki HA, Eliopoulos G, Kaufman C, Bertolone SJ, Nakamoto B, Papayannopoulou T, Grimes HL, Horwitz M, Mutations in proto-oncogene GFI1 cause human neutropenia and target ELA2. Nat Genet, 2003. 34(3): p. 308-12.

70. Duan Z, H.M., Targets of the transcriptional repressor oncoprotein Gfi-1. Proc Natl Acad Sci U S A, 2003. 100(10): p. 5932-7.

71. Dahl R, I.S., Owens KS, Cuylear DD, Simon MC, The transcriptional repressor GFI-1 antagonizes PU.1 activity through protein-protein interaction. J Biol Chem, 2007. 282(9): p. 6473-83.

72. Nguyen HQ, H.-L.B., Liebermann DA, The zinc finger transcription factor Egr-1 is essential for and restricts differentiation along the macrophage lineage. Cell, 1993. 72(2): p. 197-209.

73. Krishnaraju K, N.H., Liebermann DA, Hoffman B, The zinc finger transcription factor Egr-1 potentiates macrophage differentiation of hematopoietic cells. Mol Cell Biol, 1995. 15(10): p. 5499-5507.

74. Krishnaraju K, H.B., Liebermann DA, The zinc finger transcription factor Egr-1 activates macrophage differentiation in M1 myeloblastic leukemia cells. Blood, 1998 92(6): p. 1957-1966.

75. Lee SL, W.Y., Milbrandt J., Unimpaired macrophage differentiation and activation in mice lacking the zinc finger transplantation factor NGFI-A (EGR1). Mol Cell Biol, 1996. 16: p. 4566-72.

76. Carter JH, T.W., Early growth response transcriptional regulators are dispensable for macrophage differentiation. J Immunol, 2007. 178(5): p. 3038-47.

77. Laslo P, S.C., Warmflash A, Lancki DW, Lee HJ, Sciammas R, Gantner BN, Dinner AR, Singh H., Multilineage Transcriptional Priming and Determination of Alternate Hematopoietic Cell Fates. Cell, 2006. 126(4): p. 755-66.

78. Lord KA, A.A., Hoffman-Liebermann B, Liebermann DA, Proto-oncogenes of the fos/jun family of transcription factors are positive regulators of myeloid differentiation. Mol Cell Biol, 1993 13(2): p. 841-851.

79. Li J, K.I., Sartorelli AC, Differentiation of WEHI-3B D+ myelomonocytic leukemia cells induced by ectopic expression of the protooncogene c-jun. Cell Growth Differ, 1994. 5(7): p. 743-751.

80. Szabo E, P.L., Birrer MJ., Constitutive cJun expression induces partial macrophage differentiation in U-937 cells. Cell Growth Differ, 1994. 5(4): p. 439-46.

81. Hong S, S.A., Wheelan SJ, Friedman AD., AP-1 protein induction during monopoiesis favors C/EBP: AP-1 heterodimers over C/EBP homodimerization and stimulates FosB transcription. J Leukoc Biol. 2011 2011. 90(4): p. 643-51.

82. Cai DH, W.D., Keefer J, Yeamans C, Hensley K, Friedman AD., C/EBP alpha:AP-1 leucine zipper heterodimers bind novel DNA elements, activate the PU.1 promoter and direct monocyte lineage commitment more potently than C/EBP alpha homodimers or AP-1. Oncogene, 2008. 27(19): p. 2772-9.

83. Jack GD, Z.L., Friedman AD, M-CSF elevates c-Fos and phospho- C/EBPalpha(S21) via ERK whereas G-CSF stimulates SHP2 phosphorylation in marrow progenitors to contribute to myeloid lineage specification. blood, 2009 114(10): p. 2172-2180.

84. Gobert Gosse S1, B.C., Liu WQ, Garbay C, Mouchiroud G, M-CSF stimulated differentiation requires persistent MEK activity and MAPK phosphorylation independent of Grb2-Sos association and phosphatidylinositol 3-kinase activity. Cell Signal, 2005. 17(11): p. 1352-1362. 80

85. Stavridis MP, L.J., Collins BJ, Storey KG, A discrete period of FGF-induced Erk1/2 signalling is required for vertebrate neural specification. Development, 2007. 134(16): p. 2889-2894.

86. Hong S, S.A., Wheelan SJ, Friedman AD, AP-1 protein induction during monopoiesis favors C/EBP: AP-1 heterodimers over C/EBP homodimerization and stimulates FosB transcription. J Leukoc Biol, 2011. 90(4): p. 643-651.

87. Zarebski A, V.C., Baktula AM, Bourdeau T, Horman SR, Basu S, Bertolone SJ, Horwitz M, Hildeman DA, Trent JO, Grimes HL, Mutations in growth factor independent-1 associated with human neutropenia block murine granulopoiesis through colony stimulating factor-1. Immunity, 2008. 28(3): p. 370-80.

88. Hsu CL, K.K., Kondo M., Activation of mitogen-activated protein kinase kinase (MEK)/extracellular signal regulated kinase (ERK) signaling pathway is involved in myeloid lineage commitment. Blood, 2007. 110(5): p. 1420-1428.

89. Ebisuya M, K.K., Nishida E, The duration, magnitude and compartmentalization of ERK MAP kinase activity: mechanisms for providing signaling specificity. J Cell Sci, 2005 118(Pt 14): p. 2997-3002.

90. Matsumura I, N.K., Wakao H, Hattori S, Hashimoto K, Sugahara H, Kato T, Miyazaki H, Hirano T, Kanakura Y., Involvement of Prolonged Ras Activation in Thrombopoietin-Induced Megakaryocytic Differentiation of a Human Factor- Dependent Hematopoietic Cell Line. Mol Cell Biol, 1998. 18(7): p. 4282-90.

91. Bourgin-Hierle C, G.-G.S., Thérier J, Grasset MF, Mouchiroud G., Src-family kinases play an essential role in differentiation signaling downstream of macrophage colony-stimulating factor receptors mediating persistent phosphorylation of phospholipase C-gamma2 and MAP kinases ERK1 and ERK2. Leukemia, 2008. 22(1): p. 161-9.

92. Okazaki K, S.N., The Mos/MAP kinase pathway stabilizes c-Fos by phosphorylation and augments its transforming activity in NIH 3T3 cells. EMBO J, 1995. 14(20): p. 5048-5059.

93. Ito T, N.C., Nishiyama M, Matsuda H, Maeda K, Akizawa Y, Tsuboi R, Okumura K, Ogawa H, Mast cells acquire monocyte-specific gene expression and monocyte-like morphology by overproduction of PU.1. J Immunol, 2005. 174(1): p. 376-83.

94. Radomska HS, B.D., Zheng R, Zhang P, Dayaram T, Yamamoto Y, Sternberg DW, Lokker N, Giese NA, Bohlander SK, Schnittger S, Delmotte MH, Davis RJ, Small D, Hiddemann W, Gilliland DG, Tenen DG, Block of C/EBP alpha function

by phosphorylation in acute myeloid leukemia with FLT3 activating mutations. J Exp Med, 2006. 203(2): p. 371-81.

95. Spooner CJ, C.J., Pujadas E, Laslo P, Singh H., A recurrent network involving the transcription factors PU.1 and Gfi1 orchestrates innate and adaptive immune cell fates. Immunity, 2009 31(4): p. 576-86.

Appendix A

List of cell lines

32D: Murine myeloblast cells

FDCP-mix A4: Murine multipotent stem cells