DOCSLIB.ORG

ONLINE SUPPLEMENTAL MATERIAL in Addition to This Text Document

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ONLINE SUPPLEMENTAL MATERIAL in Addition to This Text Document ONLINE SUPPLEMENTAL MATERIAL In addition to this text document, Supplemental information contains one table and three figures. In a series of workbook sheets, Table S1 reports unfiltered mass spectrometry data reported, including computational scoring. These data relate to Figure 1B, Figure 3A and Figure 3B. Figure S1. Relates to Figure 2F. SLK luciferase assay (Figure S1 panel A) activates NRF2 signaling in an ETGE-independent manner. NRF2 luciferase assay (Figure S1 panel B) was included as a positive control for ETGE-dependent regulation of NRF2-mediated transcription. Figure S2. Relates to Figure 7A-D, and G. Included in supplemental data to show that there is differential expression of DPP3 across SQCC. Figure S3. Relates to Figure 7E and F. Luciferase data in Figure S3 panel A was completed in KEAP1 knockout mouse embryonic fibroblasts to demonstrate that wild type KEAP1 expression in HEK293T cells does not affect the results. The Western blot depicted in Figure S3 panel B demonstrates that each KEAP1 mutation tested is expressed and binds both NRF2 and DPP3. Supplemental Methods siRNA sequences: DPP3#1 (CAC CAA AUC CAA UGC UCC UCA CAU A), DPP3#2 (GCU UAC CAU CCU GUC UAC CAG AUG A), DPP3#3 (CCC UCC AUU CGU GUG UGU AUU UAG G), NRF2 (GUA AGA AGC CAG AUG UUA A), KEAP1 (GGG CGU GGC UGU CCU CAA U). Control siRNAs were obtained from Life Technologies; sequences are as follows: CGU ACG CGG AAU ACU UCG ATT and UCG AAG UAU UCC GCG UAC GTT. Cell lysis buffers: 0.1% NP40 (10% glycerol, 50mM HEPES, 150 mM NaCl, 2mM EDTA, 0.1% NP-40) containing protease inhibitor mixture (Thermo Scientific) and phosphatase inhibitor (Thermo Scientific). RIPA buffer (1% NP-40, 0.1% SDS, 0.25% sodium deoxycholate, 150mM NaCl, 10% glycerol, 25mM Tris, 2mM EDTA). Additionally, NRF2 ubiquitination experiments were performed in the presence of 2mM N-ethylmaleimide. Cell Staining Buffers: cytoskeletal buffer (5 mM PIPES, pH 6, 137 mM NaCl, 5 mM KCl, 1.1 mM Na2HPO4, 0.4 mM KH2PO4, 0.4 mM MgCl2, 0.4 mM NaHCO3, 2 mM EGTA, 50mM glucose). Antibodies employed for W. blot analysis: anti-FLAG M2 monoclonal (Sigma), anti-HA monoclonal (Roche), anti-FAM117b (ProteinTech, 21768), anti-MAD2L1 (Bethyl, Montgomery TX, A300-301A), anti-MCM3 (Bethyl, A300-192A), anti-SLK (Bethyl, A300-499A), anti-bactin polyclonal (Sigma, A2066), anti-btubulin monoclonal (Sigma, T7816), anti-KEAP1 polyclonal (ProteinTech, Chicago IL), anti-DPP3 polyclonal (abcam, Cambridge MA, 97437), anti-GFP (abcam, ab290), anti-NRF2 H300 polyclonal (Santa Cruz, Santa Cruz CA), and anti-VSV polyclonal (Bethyl, A190-131A). Quantitative PCR primers: GCLM (F: ACAGCGAGGAGCTTCATGATTG, R: CTCCCTGACCAAATCTGGGTTG), HMOX1 (F: GGCCAGCAACAAAGTGCAAGATTC, R: AGCAACTGTCGCCACCAGAAAG), GAPDH (F: ATGGGGAAGGTGAAGGT, R: AAGCTTCCCGTTCTCAG). Protein Identification, Filtering and Bioinformatics: All raw data were converted to mzXML format before a search of the resultant spectra using SorcererTM-SEQUEST® (build 4.0.4, Sage N Research) and the Transproteomic Pipeline (TPP v4.3.1). Data were searched against either the human UniProtKB/Swiss-Prot sequence database (Release 2011_08) or the human IPI database (Version 3.87), both supplemented with common contaminants, i.e. porcine (Swiss-Prot P00761) and bovine (P00760) trypsin, and further concatenated with its reversed copy as a decoy (40,494 total sequences). Search parameters used were a precursor mass between 400 and 4500 amu, up to 2 missed cleavages, precursor-ion tolerance of 3 amu, accurate mass binning within PeptideProphet, semi-tryptic digestion, a static carbamidomethyl cysteine modification, and variable methionine oxidation. False discovery rates (FDR) were determined by ProteinProphet and minimum protein probability cutoffs resulting in a 1% FDR were selected individually for each experiment. PeptideProphet/ProteinProphet results for each AP-MS experiment were stored in a local Prohits database. Prohits performed the mapping of UniProtKB/IPI accession identifiers to Entrez Gene IDs. These results were then imported into Cytoscape v2.8.2 for network visualization and SPOTLITE for interaction prediction. Gene Ontology annotations were imported from NCBI Entrez Gene through Cytoscape. Known protein-protein interactions were extracted from the BioGRID database (Release 3.1.89). .
Load more

Recommended publications
  • A Genomic Screen for Activators of the Antioxidant Response Element
    A genomic screen for activators of the antioxidant response element Yanxia Liu†, Jonathan T. Kern‡, John R. Walker§, Jeffrey A. Johnson‡, Peter G. Schultz§¶ʈ, and Hendrik Luesch†ʈ †Department of Medicinal Chemistry, University of Florida, 1600 Southwest Archer Road, Gainesville, FL 32610; ‡Department of Pharmaceutical Sciences, School of Pharmacy, University of Wisconsin, 777 Highland Avenue, Madison, WI 53705; §Genomics Institute of the Novartis Research Foundation, 10675 John Jay Hopkins Drive, San Diego, CA 92121; and ¶Department of Chemistry, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037 Contributed by Peter G. Schultz, January 31, 2007 (sent for review December 13, 2006) The antioxidant response element (ARE) is a cis-acting regulatory activation, translocates into the nucleus and transcriptionally acti- enhancer element found in the 5؅ flanking region of many phase II vates ARE-dependent genes after recruiting Maf proteins (2). The detoxification enzymes. Up-regulation of ARE-dependent target upstream regulatory mechanisms by which ARE-activating signals genes is known to have neuroprotective effects; yet, the mechanism are linked to Nrf2 remain to be fully elucidated. It has been of activation is largely unknown. By screening an arrayed collection demonstrated that reactive sulfhydryl groups of Keap1 are sensors of Ϸ15,000 full-length expression cDNAs in the human neuroblas- for induction of phase II genes (13), leading to the proposal that the toma cell line IMR-32 with an ARE-luciferase reporter, we have Nrf2/Keap1 interaction represents a cytoplasmic sensor for oxida- identified several cDNAs not previously associated with ARE activa- tive stress. However, 1-phosphatidylinositol 3-kinase (PI3K), tion.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Integrated Bioinformatics Analysis of Aberrantly-Methylated
    Shen et al. BMC Ophthalmology (2020) 20:119 https://doi.org/10.1186/s12886-020-01392-2 RESEARCH ARTICLE Open Access Integrated bioinformatics analysis of aberrantly-methylated differentially- expressed genes and pathways in age- related macular degeneration Yinchen Shen1,2†,MoLi3†, Kun Liu1,2, Xiaoyin Xu1,2, Shaopin Zhu1,2, Ning Wang1,2, Wenke Guo4, Qianqian Zhao4, Ping Lu4, Fudong Yu4 and Xun Xu1,2* Abstract Background: Age-related macular degeneration (AMD) represents the leading cause of visual impairment in the aging population. The goal of this study was to identify aberrantly-methylated, differentially-expressed genes (MDEGs) in AMD and explore the involved pathways via integrated bioinformatics analysis. Methods: Data from expression profile GSE29801 and methylation profile GSE102952 were obtained from the Gene Expression Omnibus database. We analyzed differentially-methylated genes and differentially-expressed genes using R software. Functional enrichment and protein–protein interaction (PPI) network analysis were performed using the R package and Search Tool for the Retrieval of Interacting Genes online database. Hub genes were identified using Cytoscape. Results: In total, 827 and 592 genes showed high and low expression, respectively, in GSE29801; 4117 hyper-methylated genes and 511 hypo-methylated genes were detected in GSE102952. Based on overlap, we categorized 153 genes as hyper-methylated, low-expression genes (Hyper-LGs) and 24 genes as hypo-methylated, high-expression genes (Hypo-HGs). Four Hyper-LGs (CKB, PPP3CA, TGFB2, SOCS2) overlapped with AMD risk genes in the Public Health Genomics and Precision Health Knowledge Base. KEGG pathway enrichment analysis indicated that Hypo-HGs were enriched in the calcium signaling pathway, whereas Hyper-LGs were enriched in sphingolipid metabolism.
    [Show full text]
  • Proteomic Analysis of Ubiquitin Ligase KEAP1 Reveals Associated Proteins That Inhibit NRF2 Ubiquitination
    Published OnlineFirst February 4, 2013; DOI: 10.1158/0008-5472.CAN-12-4400 Cancer Molecular and Cellular Pathobiology Research Proteomic Analysis of Ubiquitin Ligase KEAP1 Reveals Associated Proteins That Inhibit NRF2 Ubiquitination Bridgid E. Hast1, Dennis Goldfarb2, Kathleen M. Mulvaney1, Michael A. Hast4, Priscila F. Siesser1, Feng Yan1, D. Neil Hayes3, and Michael B. Major1,2 Abstract Somatic mutations in the KEAP1 ubiquitin ligase or its substrate NRF2 (NFE2L2) commonly occur in human cancer, resulting in constitutive NRF2-mediated transcription of cytoprotective genes. However, many tumors display high NRF2 activity in the absence of mutation, supporting the hypothesis that alternative mechanisms of pathway activation exist. Previously, we and others discovered that via a competitive binding mechanism, the proteins WTX (AMER1), PALB2, and SQSTM1 bind KEAP1 to activate NRF2. Proteomic analysis of the KEAP1 protein interaction network revealed a significant enrichment of associated proteins containing an ETGE amino acid motif, which matches the KEAP1 interaction motif found in NRF2. Like WTX, PALB2, and SQSTM1, we found that the dipeptidyl peptidase 3 (DPP3) protein binds KEAP1 via an "ETGE" motif to displace NRF2, thus inhibiting NRF2 ubiquitination and driving NRF2-dependent transcription. Comparing the spectrum of KEAP1-interacting proteins with the genomic profile of 178 squamous cell lung carcinomas characterized by The Cancer Genome Atlas revealed amplification and mRNA overexpression of the DPP3 gene in tumors with high NRF2 activity but lacking NRF2 stabilizing mutations. We further show that tumor-derived mutations in KEAP1 are hypomorphic with respect to NRF2 inhibition and that DPP3 overexpression in the presence of these mutants further promotes NRF2 activation.
    [Show full text]
  • A Peripheral Blood Gene Expression Signature to Diagnose Subclinical Acute Rejection
    CLINICAL RESEARCH www.jasn.org A Peripheral Blood Gene Expression Signature to Diagnose Subclinical Acute Rejection Weijia Zhang,1 Zhengzi Yi,1 Karen L. Keung,2 Huimin Shang,3 Chengguo Wei,1 Paolo Cravedi,1 Zeguo Sun,1 Caixia Xi,1 Christopher Woytovich,1 Samira Farouk,1 Weiqing Huang,1 Khadija Banu,1 Lorenzo Gallon,4 Ciara N. Magee,5 Nader Najafian,5 Milagros Samaniego,6 Arjang Djamali ,7 Stephen I. Alexander,2 Ivy A. Rosales,8 Rex Neal Smith,8 Jenny Xiang,3 Evelyne Lerut,9 Dirk Kuypers,10,11 Maarten Naesens ,10,11 Philip J. O’Connell,2 Robert Colvin,8 Madhav C. Menon,1 and Barbara Murphy1 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background In kidney transplant recipients, surveillance biopsies can reveal, despite stable graft function, histologic features of acute rejection and borderline changes that are associated with undesirable graft outcomes. Noninvasive biomarkers of subclinical acute rejection are needed to avoid the risks and costs associated with repeated biopsies. Methods We examined subclinical histologic and functional changes in kidney transplant recipients from the prospective Genomics of Chronic Allograft Rejection (GoCAR) study who underwent surveillance biopsies over 2 years, identifying those with subclinical or borderline acute cellular rejection (ACR) at 3 months (ACR-3) post-transplant. We performed RNA sequencing on whole blood collected from 88 indi- viduals at the time of 3-month surveillance biopsy to identify transcripts associated with ACR-3, developed a novel sequencing-based targeted expression assay, and validated this gene signature in an independent cohort.
    [Show full text]
  • A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Master Autoantigen-ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases Julia Y. Wang1*, Michael W. Roehrl1, Victor B. Roehrl1, and Michael H. Roehrl2* 1 Curandis, New York, USA 2 Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA * Correspondence: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer.
    [Show full text]
  • Population-Haplotype Models for Mapping and Tagging Structural Variation Using Whole Genome Sequencing
    Population-haplotype models for mapping and tagging structural variation using whole genome sequencing Eleni Loizidou Submitted in part fulfilment of the requirements for the degree of Doctor of Philosophy Section of Genomics of Common Disease Department of Medicine Imperial College London, 2018 1 Declaration of originality I hereby declare that the thesis submitted for a Doctor of Philosophy degree is based on my own work. Proper referencing is given to the organisations/cohorts I collaborated with during the project. 2 Copyright Declaration The copyright of this thesis rests with the author and is made available under a Creative Commons Attribution Non-Commercial No Derivatives licence. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the licence terms of this work 3 Abstract The scientific interest in copy number variation (CNV) is rapidly increasing, mainly due to the evidence of phenotypic effects and its contribution to disease susceptibility. Single nucleotide polymorphisms (SNPs) which are abundant in the human genome have been widely investigated in genome-wide association studies (GWAS). Despite the notable genomic effects both CNVs and SNPs have, the correlation between them has been relatively understudied. In the past decade, next generation sequencing (NGS) has been the leading high-throughput technology for investigating CNVs and offers mapping at a high-quality resolution. We created a map of NGS-defined CNVs tagged by SNPs using the 1000 Genomes Project phase 3 (1000G) sequencing data to examine patterns between the two types of variation in protein-coding genes.
    [Show full text]
  • A Genetic Mapping System in Caenorhabditis Elegans Based On
    z A Genetic Mapping System in Caenorhabditis elegansBased on Polymorphic Sequence-Tagged Sites Benjamin D. Williams,* Bertold Schrank,* Chau Huynh,* Ratna Shownkeent and Robert H. Waterston* *Department of Genetics, Washington University School ofMedicine, St. Louis, Missouri631 IO, and ?Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 2QH, United Kingdom Manuscript received December 26, 1991 Accepted for publication March 9, 1992 ABSTRACT We devised an efficient genetic mapping system in the nematode Caenorhabditis elegans which is based upon the differences in number and location of the transposable element Tcl between the Bristol and Bergerac strains. Using the nearly completed physical map of theC. elegans genome, we selected 40 widely distributed sites which contain a Tcl element in the Bergerac strain, but not in the Bristol strain. For each site a polymerase chain reaction assay was designed that can distinguish between the Bergerac Tcl-containing site and the Bristol “empty” site. By combining appropriate assays in a single reaction, one can score multiple sites within single worms. This permits a mutation to be rapidly mapped,first to a linkage group and thento a chromosomal subregion, through analysis of only a small number of progeny from a single interstrain cross. EQUENCE-tagged sites (STSs), which havere- Previously, Tcls have been used in efforts to mo- S cently been proposed as common landmarks for lecularly clone specific genes, both by direct transpo- genomic physical mapping (OLSONet al. 1989), are son tagging(MOERMAN, BENIAN and WATERSTON short, unique genomic regions that areeasily detected 1986) andby genetic mappingof the Bristol/Bergerac by polymerase chain reaction(PCR) amplification Tcl polymorphisms nearest a gene to identify molec- (SAIKIet al.
    [Show full text]
  • Dynamics of Meiotic Sex Chromosome Inactivation And
    bioRxiv preprint doi: https://doi.org/10.1101/665372; this version posted July 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 Dynamics of Meiotic Sex Chromosome Inactivation 2 and Pachytene Activation in Mice Spermatogenesis 3 4 Ábel Vértesy1,2; Javier Frias-Aldeguer1,4; Zeliha Sahin1,3; Nicolas Rivron1,4; Alexander van 5 Oudenaarden1,2 and Niels Geijsen1,5 6 7 1. Hubrecht Institute-KNAW (Royal Netherlands Academy of Arts and Sciences) and 8 University Medical Center, 3584 CT Utrecht, The Netherlands 9 2. Department of Genetics, Center for Molecular Medicine, Cancer Genomics Netherlands, 10 University Medical Center Utrecht, The Netherlands 11 3. Amsterdam UMC, University of Amsterdam, Clinical Genetics, Amsterdam Medical 12 Research, Meibergdreef 9, Amsterdam, Netherlands 13 4. MERLN Institute for Technology-Inspired Regenerative Medicine, Maastricht University, 14 The Netherlands 15 5. Faculty of Veterinary Medicine, Clinical Sciences of Companion Animals, Utrecht 16 University, The Netherlands 17 18 Abstract 19 During germ cell development, cells undergo a drastic switch from mitosis to meiosis to 20 form haploid germ cells. Sequencing and computational technologies now allow studying 21 development at the single-cell level. Here we developed a multiplexed trajectory 22 reconstruction to create a high-resolution developmental map of spermatogonia and 23 prophase-I spermatocytes from testes of a Dazl-GFP reporter mouse. We identified three 24 main transitions in the meiotic prophase-I: meiotic entry, the meiotic sex chromosome 25 inactivation (MSCI), and concomitant pachytene activation.
    [Show full text]
  • Comparative Genome Analysis Between the Atlantic Salmon Sex Chromosome and the Genomes of Other Teleosts
    COMPARATIVE GENOME ANALYSIS BETWEEN THE ATLANTIC SALMON SEX CHROMOSOME AND THE GENOMES OF OTHER TELEOSTS by Teng-Kai (Kevin) Huang B. Sc., Simon Fraser University, 2006 THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE In the Department of Molecular Biology and Biochemistry © Teng-Kai (Kevin) Huang 2009 SIMON FRASER UNIVERSITY Spring 2009 All rights reserved. This work may not be reproduced jill whole or in part, by photocopy or other means, without permission of the author. APPROVAL Name: Teng-Kai (Kevin) Huang Degree: Master of Science Title of Thesis: Comparative Genome Analysis between the Atlantic Salmon Sex Chromosome and the Genomes of Other Teleosts Examining Committee: Chair: Dr. Andrew J. Bennet Professor, Department of Chemistry Dr. William S. Davidson Senior Supervisor Professor, Department of Molecular Biology and Biochemistry Dr. Jack N. Chen Supervisor Associate Professor, Department of Molecular Biology and Biochemistry Dr. Norbert H. Haunerland Supervisor Professor, Department of Biological Sciences Dr. Fiona S. L. Brinkman Public Examiner Associate Professor, Department of Molecular Biology and Biochemistry Date Defended!Approved: ii SIMON FRASER UNIVERSITY LIBRARY Declaration of Partial Copyright Licence The author, whose copyright is declared on the title page of this work, has granted to Simon Fraser University the right to lend this thesis, project or extended essay to users of the Simon Flraser University Library, and to make partial or single copies only for such users or in response to a request from the library of any other university, or other educational institution, on its own behalf or for one of its users.
    [Show full text]
  • Ψ These Authors Contributed Equally to This Work. Proteomic Analysis Of
    Author Manuscript Published OnlineFirst on February 4, 2013; DOI: 10.1158/0008-5472.CAN-12-4400 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Proteomic analysis of ubiquitin ligase KEAP1 reveals associated proteins that inhibit NRF2 ubiquitination ψ ψ Bridgid E. Hast1, Dennis Goldfarb1,2 , Kathleen M. Mulvaney1, , Michael A. Hast3, Priscila F. Siesser1, Feng Yan1, D. Neil Hayes4 and Michael B. Major1,2 1Department of Cell Biology and Physiology, Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill School of Medicine, Box#7295, Chapel Hill, NC 27599, USA. 2Department of Computer Science, University of North Carolina at Chapel Hill, Box#3175, Chapel Hill, NC 27599, USA. 3Department of Biochemistry, Duke University Medical Center, Box #3711, Durham NC, 27710, USA. 4Department of Internal Medicine and Otolaryngology, Division of Medical Oncology, Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill School of Medicine, Box#7295, Chapel Hill, NC 27599, USA. Corresponding author: Michael B. Major Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill Box#7295 Chapel Hill, NC 27599 Email: [email protected] Phone: 919-966-9258 Fax: 919-966-8212 Running title: DPP3 binds KEAP1 to activate NRF2 Word count: 5985 The authors declare no conflicts of interest. ψ These authors contributed equally to this work. Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2013 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 4, 2013; DOI: 10.1158/0008-5472.CAN-12-4400 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Signals of Recent Positive Selection in a Worldwide Sample of Human Populations
    Downloaded from genome.cshlp.org on October 7, 2021 - Published by Cold Spring Harbor Laboratory Press Letter Signals of recent positive selection in a worldwide sample of human populations Joseph K. Pickrell,1,13 Graham Coop,1,12,13 John Novembre,1,2 Sridhar Kudaravalli,1 Jun Z. Li,3 Devin Absher,4 Balaji S. Srinivasan,5,6,7,8 Gregory S. Barsh,9 Richard M. Myers ,4 Marcus W. Feldman,10 and Jonathan K. Pritchard1,11,13 1Department of Human Genetics, The University of Chicago, Chicago, Illinois 60637, USA; 2Department of Ecology and Evolutionary Biology, University of California, Los Angeles, Los Angeles, California 90095, USA; 3Department of Human Genetics, University of Michigan, Ann Arbor, Michigan 48109, USA; 4HudsonAlpha Institute for Biotechnology, Huntsville, Alabama 35806, USA; 5Stanford Genome Technology Center, Stanford University, Stanford, California 94305, USA; 6Program in Biomedical Informatics, Stanford University, Stanford, California 94305, USA; 7Department of Computer Science, Stanford University, Stanford, California 94305, USA; 8Department of Statistics, Stanford University, Stanford, California 94305, USA; 9Department of Genetics, Stanford University, Stanford, California 94305, USA; 10Department of Biological Sciences, Stanford University, Stanford, California 94305, USA; 11Howard Hughes Medical Institute, The University of Chicago, Chicago, Illinois 60637, USA Genome-wide scans for recent positive selection in humans have yielded insight into the mechanisms underlying the extensive phenotypic diversity in our species, but have focused on a limited number of populations. Here, we present an analysis of recent selection in a global sample of 53 populations, using genotype data from the Human Genome Diversity- CEPH Panel. We refine the geographic distributions of known selective sweeps, and find extensive overlap between these distributions for populations in the same continental region but limited overlap between populations outside these groupings.
    [Show full text]