Lymphoma Cells I-Binding Factor 1/Blimp-1 Transcription in PU.1

PU.1 Regulates Positive Regulatory Domain I-Binding Factor 1/Blimp-1 Transcription in Lymphoma Cells

This information is current as Shruti Desai, Sophia C. E. Bolick, Michelle Maurin and of September 27, 2021. Kenneth L. Wright J Immunol 2009; 183:5778-5787; Prepublished online 14 October 2009; doi: 10.4049/jimmunol.0901120

http://www.jimmunol.org/content/183/9/5778 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2009/10/13/jimmunol.090112 Material 0.DC1 http://www.jimmunol.org/ References This article cites 48 articles, 31 of which you can access for free at: http://www.jimmunol.org/content/183/9/5778.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

PU.1 Regulates Positive Regulatory Domain I-Binding Factor 1/Blimp-1 Transcription in Lymphoma Cells1

Shruti Desai,2*† Sophia C. E. Bolick,2,3*§ Michelle Maurin,* and Kenneth L. Wright4*†‡§

The human positive regulatory domain I-binding factor 1 (PRDI-BF1) and its murine homolog Blimp-1 promote differentiation of mature B cells into Ab-secreting plasma cells. In contrast, ectopic expression of PRDI-BF1 in lymphoma cells can lead to inhibition of proliferation or apoptosis. However, little is currently known about the regulation of PRDM1, the gene encoding PRDI-BF1. This report establishes that in lymphoma cells stimulation through the BCR rapidly induces endogenous PRDM1 at the level of transcription with minor changes in mRNA stability. The induced PRDM1-encoded protein localizes to its target genes in vivo and suppresses their expression. In vivo genomic footprinting of the PRDM1 promoter in unstimulated lymphoma and myeloma cells reveals multiple common in vivo occupied elements throughout the promoter. Further functional and structural

analysis of the promoter reveals that the promoter is preloaded and poised for activation in the B cell lines. The transcription Downloaded from factor PU.1 is shown to be required for the BCR-induced expression of PRDM1 in lymphoma cells and in PU.1-positive myeloma cells. Activation of PRDM1 is associated with loss of the corepressor transducin-like enhancer of split 4 from the PU.1 complex. These ﬁndings indicate that PRDM1 is poised for activation in lymphoma cells and therefore may be a potential therapeutic target to inhibit lymphoma cell proliferation and survival. The Journal of Immunology, 2009, 183: 5778–5787.

he positive regulatory domain I-binding factor-1 (PRDI- Anti-IgM cross-linking of the BCR has been reported in multi- http://www.jimmunol.org/ BF1),5 encoded by the PRDM1 gene, was originally ple studies to induce apoptosis in lymphoma cells (10–14). This T found to speciﬁcally bind the IFN-␤ promoter and sup- response has been correlated with decreased levels of c-myc (6). press IFN-␤ transcription following viral induction (1). Blimp-1, Inducing PRDI-BF1/Blimp-1 expression in lymphoma cells with the murine homolog of PRDI-BF1, was originally described by histone deacetylase inhibitors also decreased expression of the Turner et al. (2) as a transcription factor that could induce the downstream targets c-myc and BSAP (15). More speciﬁcally, in- differentiation of B cells. PRDI-BF1/Blimp-1 has since been found troduction of PRDI-BF1/Blimp-1 into lymphoma cells can induce to be required for the differentiation of a B cell to a plasma cell (3). apoptosis, suggesting PRDI-BF1 may be an important mediator of During the differentiation of mature B cells to plasma cells, PRDI- the anti-IgM-mediated apoptotic response (16, 17). However, no

BF1 represses multiple genes involved in maintaining the B cell direct link between expression of PRDI-BF1/Blimp-1- and anti- by guest on September 27, 2021 phenotype and in maintaining cellular proliferation, such as CIITA IgM-mediated BCR activation has been described. (4, 5), c-myc (6), and B cell lineage-specific activator protein Recently, PRDM1 expression has been detected in a subset of (BSAP; Ref. 7). Microarray studies have outlined the PRDI-BF1 diffuse large B cell lymphomas (18–20). However, inactivating repression profile and led to the identification of two additional mutations in the PRDM1 coding sequence were described, indi- direct targets, Spi-B and Id3 (8). Additionally, expression of the cating a potential tumor suppressor role for this gene (19, 20). PRDM1 gene has recently been linked to cellular stress and the Similarly, proliferating myeloma cells and myeloma cell lines unfolded protein response in B cells (9). abundantly express the truncated PRDI-BF1 isoform, PRDI-BF1␤, which has impaired function (21). Additionally, Borson et al. (22) demonstrated PRDM1 expression in B cells isolated from my- *H. Lee Moffitt Cancer Center and Research Institute, Tampa, FL 33612; †Cancer Biology Ph.D. Program, ‡Department of Oncologic Sciences, and §Department of eloma patients, whereas normal donors lack expression. The mu- Molecular Medicine, University of South Florida, Tampa, FL 33612 tation status of PRDM1 in these myeloma-derived B cells is as yet Received for publication April 7, 2009. Accepted for publication September 3, 2009. unknown. Together, these findings indicate that PRDI-BF1/ The costs of publication of this article were defrayed in part by the payment of page Blimp-1 may be important to the pathology of various hemopoietic charges. This article must therefore be hereby marked advertisement in accordance malignancies, including lymphoma. with 18 U.S.C. Section 1734 solely to indicate this fact. Very little is known as to the regulation of PRDM1 expression. 1 This work was supported by National Institutes of Health Grants CA114504 and PRDM1 CA080990. Our data now demonstrate that is regulated primarily at the level of transcription both in myeloma cells and in lymphoma 2 These authors contributed equally to the work presented in this report. cells stimulated by cross-linking of the BCR. BCR stimulation 3 Current address: National Institute of Environmental Health Sciences, Laboratory of Molecular Carcinogenesis, 111 TW Alexander Drive, Room C310, Research Triangle leads to rapid increases in newly transcribed PRDM1 RNA levels, Park, NC 27709. whereas mRNA stability is unchanged. Using promoter deletion 4 Address correspondence and reprint requests to Dr. Kenneth L. Wright, H. Lee constructs, we demonstrate several regions of activation in the Moffitt Cancer Center, 12902 Magnolia Drive, MRC-4 East, Tampa, FL 33612. PRDM1 promoter in both lymphoma and myeloma cells. In vivo E-mail address: ken.wright@moffitt.org genomic footprinting demonstrates multiple protein-DNA interac- 5 Abbreviations used in this paper: PRDI-BF1, positive regulatory domain I-binding factor 1; BSAP, B cell lineage-specific activator protein; FWD, forward; REV, re- tions in both lymphoma and myeloma cells. Further analysis of verse; siRNA, small interfering RNA; ChIP, chromatin immunoprecipitation; UTR, these interactions reveals PU.1 binding is functionally important untranslated region; TLE4, transducin-like enhancer of split 4; CBP, CREB-binding for promoter activity in stimulated lymphoma cells. These findings protein; BCL6, B cell lymphoma 6. demonstrate the PRDM1 promoter is poised for rapid activation in Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 lymphoma cells, which suggests that inducing PRDM1 expression www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901120 The Journal of Immunology 5779

in lymphoma cells may be a viable target to inhibit lymphoma Transfections and luciferase assays progression. Cells were transfected by electroporation using the Gene Pulser II (Bio- Rad). Cells (1 ϫ 107) were pulsed with 250 V at a capacitance of 1070 ␮F. Materials and Methods Transfections for luciferase assays were done with 10 ␮g of luciferase reporter construct and 50 ng of the internal control plasmid pRL-TK. Fire- Cell lines and reagents fly luciferase activity was normalized to Renilla luciferase activity in all The CA46 EBV-negative Burkitt’s lymphoma and RPMI8226 multiple experiments. For small interfering RNA (siRNA) knockdown experiments myeloma cell lines were maintained in RPMI (Invitrogen) supplemented in CA46, cells were transfected with 3 ␮g of control nontargeting siRNA with 10% FBS (HyClone), and 1% penicillin/streptomycin (Invitrogen). or PU.1 siRNA (Dharmacon) for 24 h. Live cells were separated using a Goat anti-human IgM Ab (Southern Biotechnology) was used at 10 ␮g/ml. Ficoll gradient and treated with 10 ␮g of anti-IgM for 24 h. For siRNA Actinomycin D (Sigma-Aldrich) was used at 10 ␮g/ml. knockdown experiments in RPMI8226, cells were transfected with 2 ␮gof control nontargeting siRNA or PU.1 siRNA (Dharmacon) for 48 h. B cell isolation Dimethyl sulfate in vivo footprinting B cells were isolated from healthy human donors. Briefly, PBMCs were isolated by Ficoll separation and incubated with anti-CD19 microbeads In vivo methylation of cells with dimethyl sulfate and subsequent iso- (Miltenyi Biotec) followed by magnetic separation using MS columns. The lation of DNA were done as previously described (27, 28). Primers purified cells were routinely Ͼ90% B cells as confirmed by flow cytometry for the ligation-mediated PCR were as follows: proximal promoter, analysis for CD20. Isolated B cells were activated by coculture with irra- PRDLOW2 primer 1, 5Ј-GTACCTGGGGATTTGAGC-3Ј; PRDLOW2 diated CD40L-expressing L cells (23) in the presence of cytokines IL-2 (20 primer 2, 5Ј-AGGAACGTGCGCCCCCTAATTCTGCCGC-3Ј; PRD U/ml), IL-4 (50 ng/ml), IL-10 (50 ng/ml), and IL-12 (2 ng/ml) for 4 days. LOW2 primer 3, 5Ј-CGTGCGCCCCCTAATTCTGCCGCGCCAG-3Ј;

The cells were then divided into two ﬂasks, contents of one stimulated with distal promoter, PRD C1, 5Ј-CAAGAAGCAAACATGTGAAG-3Ј; PRD Downloaded from anti-IgM and those of the other unstimulated for 24 h. C2, 5Ј-GCAAACATGTGAAGGACTTTACATTCCAAC-3Ј; PRD C3, 5Ј- GAAGGACTTTACATTCCAACACTCTGTGTC TG-3Ј; distal promoter, Apoptosis assay PRD H1, 5Ј-GAGTCAGCACCACAATG-3Ј; PRD H2, 5Ј-CAATGTAG TCATACTGAAGGCTGGC-3Ј; PRD H3, 5Ј-TCATACTGAAGGCTGG Cells were treated with anti-IgM continuously for 24 h, followed by an- CC TGCTGTTC-3Ј. nexin V-PE and 7-aminoactinomycin D staining per the manufacturer’s protocol (BD Pharmingen). ToPro3 staining was used to detect dead cells.

Flow cytometry acquisition was done on a FACSCalibur and analyzed with Nuclear extract preparation and EMSAs http://www.jimmunol.org/ CellQuest software (BD Biosciences). Nuclear extracts were prepared according to the method of Dignam et al. (29) and performed essentially as described previously (26). The P.H oli- Quantitative PCR gonucleotide is 5Ј-GATCCAGAGTTTGATTCTAAAAGGGAAGTGAA Ј Nascent RNA was isolated as previously described (24, 25). mRNA was ATACTCTTTAAC-3 . The mutant P.H oligonucleotide contains the same Ј isolated from cells using TriZol reagent (Invitrogen). One microgram of mutation as in construct p2618-mutP.H. The Sp1 oligonucleotide is 5 -GA Ј RNA was treated with DNase using RQ1 DNase (Promega), followed by TCTGGCCACGCCCCCACTTCGCGC-3 , and the Sp1 mutant oligonu- Ј Ј first-strand cDNA synthesis using the iScript cDNA synthesis kit (Bio- cleotide is 5 -GATCTGGCCACaaaaaCACTTCGCG-3 . Abs to Sp1, Rad). One-twentieth of the final cDNA reaction volume was used in each Ikaros, ATF1 (Santa Cruz Biotechnology), and PU.1 (BD Pharmingen) ␮ PCR reaction. PRDM1 mRNA levels were confirmed using two distinct were used at 0.2–1.0 g. primer sets: PRDM1-set 1 forward (FWD), 5Ј-TACATACCAAAGGGCA by guest on September 27, 2021 CACG-3Ј; PRDM1-set 1 reverse (REV), 5Ј-TGAAGCTCCCCTCTGGAA Chromatin immunoprecipitation (ChIP) TA-3Ј; PRDM1-set 2 was described previously (20). Additional PRDM1- specific primer pairs used to detect mRNA decay rates were: PRDM1-set After 24 h of treatment with anti-IgM or control (no treatment), cells were B FWD, 5Ј-ATCTCAGGGCATGAACAAGG-3Ј; PRDM1-set B REV, 5Ј- cross-linked with 1% formaldehyde for 10 min at room temperature, and ATGGGAAGGCTATGCAAACA-3Ј; PRDM1-set C FWD, 5Ј-GGCACC the reaction was stopped by the addition of glycine to a final concentration CTTGCCTACTGTAA-3Ј; PRDM1-set C REV, 5Ј-CTTCCTCCCTGGTT of 0.125 M. Cells were washed twice with ice cold PBS and resuspended GTTTTG-3Ј. Control primer sets used were: GAPDH FWD, 5Ј-GAAGGT in ice cold TX-100, Nonidet P-40 buffer (10 mM Tris (pH 8.1), 10 mM GAAGGTCGGAGT-3Ј; and GAPDH REV, 5Ј-GAAGATGGTGATGGGA EDTA, 0.5 M EGTA, 0.25% TX-100, 0.5% Nonidet P-40, 1 mM PMSF, 6 TTTC-3Ј; and ␤-actin (Realtimeprimers.com). Quantitative PCR reactions 0.5ϫ protease inhibitors) at a density of 4 ϫ 10 cells/ml. Cells were were performed with iQ SYBR Green Supermix (Bio-Rad) using an resuspended in 10 ml of ice cold salt-wash buffer (10 mM Tris (pH 8.1), 1 iCycler (Bio-Rad). mM EDTA, 0.5 M EGTA, 200 mM NaCl,1 mM PMSF, 0.5ϫ protease inhibitors) and incubated for 10 min at 4°C. Cells were lysed by adding DNA constructs sonication buffer (10 mM Tris (pH 8.1), 1 mM EDTA, 0.5 M EGTA, 1% SDS, 1 mM PMSF, 1ϫ protease inhibitors) at a cell density of 1 ϫ 106 The PRDM1 promoter construct p2618, originally referred to as PRDM1␣, cells/30 ␮l. Lysate was sonicated using a water bath sonicator (Diagenode). was cloned as previously described (21). Using p2618 as a cloning tem- ChIP was conducted using 2 ϫ 106 cells and 5 ␮g of Ab: IgG (Upstate); plate, p521 was subcloned using a NheI/SmaI digest to remove the 521-bp PU.1 (Santa Cruz Biotechnology); transducin-like enhancer of split 4 fragment, blunt-ended, and cloned into pGL3 basic. p1648 was cloned by (TLE4; Santa Cruz Biotechnology). Immunoprecipitated chromatin was digesting p2618 with BglII to yield a 1648-bp fragment, which was then washed sequentially with low salt wash (20 mM Tris (pH 8.1), 2 mM ligated into pGL3 basic. p1921 was cloned by digesting p2618 with KpnI/ EDTA, 150 mM NaCl, 0.1% SDS, 1% Triton X-100), high salt wash (20 PacI to remove 703 bp. p2391 was derived from p2618 by digestion with mM Tris (pH 8.1), 2 mM EDTA, 500 mM NaCl, 0.1% SDS, 1% Triton HindIII to remove 2391 bp and cloned into pGL3 basic. p983 and p2041 X-100) and LiCl wash (10 mM Tris (pH 8.1), 250 mM LiCl, 1% Nonidet were cloned by PCR. P-40, 1% sodium deoxycholic acid, 1 mM EDTA). DNA was eluted with Site-directed mutagenesis was done by PCR cloning the mutated se- elution buffer (10 mM Tris (pH 8), 1% SDS, 1 mM EDTA), and cross-links quence into the p1921 or p2618 constructs. Briefly, mutations were intro- were reversed by incubating with 312 mM NaCl at 65°C for 4 h. The duced using a common p2618 forward or reverse primer, paired with either immunoprecipitated DNA was treated with RNase (Ambion) at 37°C a reverse or forward primer, respectively, containing the site mutation. and proteinase K (Roche) for1hat45°C. The DNA was purified with Primer sets used are as follows, with the mutated bases indicated in bold Qiagen PCR spin columns. Purified DNA was analyzed by quantitative lower case letters: PRD 2618 FWD, 5Ј-TTCCTATTATGGAGCAAGCT PCR using the following primers: PRD_PU.1-binding site FWD, 5Ј- TCC-3Ј; PRD 2618 REV, 5Ј-CATTTCTCCTTCGACCTGCA-3Ј;H3mut ACTCACCAGCAGTTGCATGA-3Ј; PRD_PU.1-binding site REV, 5Ј- FWD, 5Ј-ATTCTAAAAGGaAcGTtAAATACTCTTTAAC-3Ј; and H3 CAGTCTCACTTGCAGATGTTAAAGA-3Ј; and proximal PRDM1 mut REV, 5Ј-GTTAAAGAGTATTTaACgTtCCTTTTAGAAT-3Ј. PCR FWD 5Ј-AGGACCAGACAGCTCCACTG-3Ј; proximal PRDM1 REV, products were gel purified, paired with their respective mutation partner, 5Ј-GCTCAAATCCCCAGGTACAA-3Ј. Primers to the HLA-DRA pro- and amplified using p2618 common primers. p1921 mut P.H was derived moter or an exon myoglobin locus were used as negative controls for from the p2618 mut P.H construct by digesting with KpnI/PacI. All mu- specificity. ChIP data are calculated as relative occupancy, i.e., tations were confirmed by sequencing. Cross-species homology was com- 2Ct-IgG Ϫ Ct-specific Ab. All the primer sets were run using an annealing pared using GenomeVISTA (26). temperature of 60°C. 5780 REGULATION OF HUMAN PRDM1 GENE TRANSCRIPTION

does not significantly increase the presence of late apoptotic or dead cells (control 3% vs anti-IgM 5%) as detected by ToPro3 staining. This finding is similar to that reported by Kaptein et al. (13) in which BCR cross-linking of CA46 cells induced growth arrest and limited apoptosis along with a decrease in c-myc expression. This treatment also significantly increases PRDM1 mRNA levels ϳ8-fold above untreated controls ( p Ͻ 0.05; Fig. 1B). The induction of PRDM1 is also detectable at the protein expression level as revealed by immunoblot analysis (Fig. 1C). We have previously reported that a PRDM1-␤ isoform can also be expressed from a distinct promoter within intron 3 (21). Neither mRNA nor protein for the PRDM1-␤ isoform was detected in the anti-IgM-treated cells (data not shown). Whether or not the PRDM1 protein is functional after induction was determined by examining its ability to silence target gene promoters. The steady- state levels of BSAP and c-myc mRNA were examined by real-time quantitative RT-PCR. Expression of both genes decreased after BCR cross-linking consistent with suppression by PRDM1 (Fig. 1D). The observed 2-fold level of suppression is consistent with previous re-

ports using overexpression of murine PRDM1 (Blimp-1; Refs. 7 and Downloaded from 30). Given the rapid turnover rate of c-myc mRNA (31), this may suggest that PRDM1 can attenuate expression of some target genes but does not necessarily silence them.

PRDM1 regulation occurs at the transcriptional level

The mechanism by which PRDM1 expression is induced in lym- http://www.jimmunol.org/ phoma cells is unknown and could occur at multiple levels. We first examined basal levels of nascent RNA production in both lymphoma and myeloma cells. Nascent RNAs, defined as those RNAs still in the process of being transcribed, are an accurate measure of endogenous transcriptional activity (25). The nascent RNA were purified from nuclei after extensive washing to remove the released transcripts and quantified by real-time RT-PCR with specific primers directed to the 5Ј end of the RNA transcript. Lev- by guest on September 27, 2021 els of nascent RNA production in CA46 lymphoma cells are significantly lower than that measured in myeloma cells (Fig. 2A). This finding is consistent with the high level of PRDM1 protein FIGURE 1. Anti-IgM (␣IgM) treatment induces PRDM1 (PRDI-BF1) expression in myeloma cells (Fig. 1C). Stimulation of the lym- and apoptosis in CA46 lymphoma cells. A, Treatment with anti-IgM (10 ␮g/ phoma cells with anti-IgM increased production of PRDM1 nas- ml) for 24 h induces apoptosis ϳ60% above the control in CA46 lymphoma cent RNA 3-fold after 1 and 4 h (Fig. 2B), indicating a rapid cells as assessed by annexin V staining followed by FACS. Data are repre- transcriptional activation. Changes in mRNA stability could also sentative of three independent experiments. Gray histogram, untreated control contribute to the increase in PRDM1 levels. mRNA stability cells; black outlined histogram, treated cells. Max, Maximum. B, Treatment of changes were directly measured by inducing PRDM1 mRNA for CA46 lymphoma cells for 24 h with 10 ␮g/ml anti-IgM induces PRDM1 1 h and then blocking subsequent transcription initiation with ac- mRNA levels as assessed by quantitative RT-PCR. Data are the means of three experiments normalized to GAPDH with SEM (p Ͻ 0.05). C, Immunoblot tinomycin D. The mRNA half-life was indistinguishable before analysis of PRDI-BF1 protein expression. CA46 lymphoma cells express and after anti-IgM treatment of the lymphoma cells (Fig. 2C). The PRDI-BF1 protein only after treatment with anti-IgM for 24 h. The RPMI8226 mRNA half-life was very short (Ͻ1 h) in the lymphoma cells and myeloma cell line constitutively expresses PRDI-BF1 and serves as a positive Ͻ2-fold longer in the myeloma cells. This is consistent with the control. D, Quantitative RT-PCR analysis of PRDI-BF1 target genes BSAP recent genome-wide analysis of mRNA decay rates in mouse em- and c-myc. Anti-IgM exposure represses mRNA steady state levels. Data are bryonic stem cells in which PRDM1 was one of the rare transcripts means of three independent experiments with SEM (p Ͻ 0.05 for c-myc). with a Ͻ1-h half-life (32). The PRDM1 mRNA is present in three predominant molecular weights which vary only in the length of the 3Ј-untranslated region (UTR; Refs. 21 and 33). Using real-time Results PCR probes spanning the 3Ј-UTR, we determined that the largest Induction of PRDM1 expression and activity in lymphoma cells mRNA species had a slightly faster decay rate but that this was not affected by anti-IgM treatment (supplemental Fig. 2).6 Similarly, a Burkitt’s lymphoma cell lines respond to signaling through the BCR proximal 3Ј-UTR probe that detects each of the mRNA species via anti-IgM treatment by undergoing either growth arrest or apopto- showed a similar decay rate and no change upon anti-IgM expo- sis. Similarly, although most Burkitt’s lymphoma cell lines lack de- sure. Although this does not exclude changes in a minor mRNA tectable levels of PRDM1, ectopic expression of PRDM1 leads to species, it indicates that anti-IgM does not have a major role in growth arrest or apoptosis (16, 17). To dissect the regulation of altering PRDM1 mRNA stability. Together, these data indicate PRDM1 in B cell lymphoma, we have initially investigated the effects regulation of PRDM1 occurs primarily at the level of transcription, of BCR cross-linking of the EBV-negative lymphoma line, CA46. A 24-h exposure to anti-IgM results in a significant increase in annexin V staining, indicative of the early stages of apoptosis (Fig. 1A) but 6 The online version of this article contains supplemental material. The Journal of Immunology 5781 Downloaded from http://www.jimmunol.org/

FIGURE 2. PRDI-BF1 regulation occurs at the level of transcription. A, Relative levels of active transcription as measured by nascent RNA levels were determined by quantitative RT-PCR. Levels in U266 myeloma cells are signiﬁcantly higher than those of unstimulated CA46 lymphoma cells. by guest on September 27, 2021 Data represent three independent experiments with SEM (p Ͻ 0.005). B, FIGURE 3. Characterization of PRDM1 promoter activity. RPMI8226 Anti-IgM (␣IgM) induces nascent PRDM1 RNA synthesis as early as 1 h. myeloma cells (A) and CA46 lymphoma cells (B) were transiently trans- CA46 cells were stimulated with 10 ␮g/ml anti-IgM for 1 or 4 h before fected with the indicated PRDM1 promoter deletion constructs fused to a harvest of nascent RNA and analysis by quantitative RT-PCR. Data rep- luciferase reporter gene. C, CA46 lymphoma cells were transiently trans- resent three independent experiments with SEM. C, Stability of PRDM1 fected with p2618 construct and stimulated with anti-IgM for 24 h. Lucif- mRNA is unchanged on treatment with anti-IgM. CA46 cells were pre- erase activity was measured 42 h after transfection. Data are normalized to treated for 1 h with anti-IgM, followed by a inhibition of transcription with expression of a cotransfected minimal thymidine kinase promoter-Renilla actinomycin D. PRDM1 mRNA levels were determined by quantitative luciferase construct. Construct names along the x-axis represent the number RT-PCR of cells harvested at 15-min intervals over 2 h. Data are the means of PRDM1 promoter base pairs upstream of the transcription start site of at least three experiments with SEM. included in the construct. The region between Ϫ1528 and Ϫ1921 relative to the transcription start site was required for maximal transcription activity in both cell types. Data are the means of three independent experiments whereas the mRNA has a relatively short half-life in both stimu- with SEM. A schematic of the promoter is shown in supplemental Fig. 1. lated lymphoma cells and myeloma cells.

Characterization of PRDM1 promoter activity region between Ϫ1528 and Ϫ1921 bp, but larger constructs show Because PRDM1 expression is primarily regulated at the level of a partial but consistent inhibition of activity. The overall level of transcription, we cloned the human promoter to assess the regions promoter activity in the lymphoma cell line was lower than that in necessary for activity. Using a series of promoter deletion con- the myeloma cell lines, consistent with the levels of nascent RNAs structs spanning 2618 bp upstream of the transcription start site, detected at the endogenous promoter in Fig. 2A. However, com- potential regulatory regions were identified in lymphoma and my- paring activity in two different cell lines requires the assumption eloma cells (for schematic, see supplemental Fig. 1). PRDM1 pro- that a cotransfected minimal thymidine kinase promoter has sim- moter constructs containing 521, 863, or 1528 bp display robust ilar activity in both cell lines. This common assumption has not and similar promoter activity in the myeloma cell line, RPMI8226 been proven for these cell lines. The effect of anti-IgM treatment (Fig. 3A). Addition of promoter sequences up to 1921 bp results in was next examined in the CA46 lymphoma cell line. Constructs a significantly higher level of activity. Similar results were ob- containing 2618 bp of the promoter were analyzed 24 h after stim- tained in a second myeloma cell line, U266 (data not shown). ulation. Stimulation resulted in a small but not statistically signif- PRDM1 promoter activity was also analyzed in the lymphoma cell icant increase in promoter luciferase activity (Fig. 3C). This find- line CA46 (Fig. 3B). The pattern of promoter activity in the un- ing may indicate that a region required for induction lies outside of stimulated lymphoma cells is similar to that observed in the my- the 2618-bp promoter. One likely candidate is the intronic regions eloma cell lines. The 521-bp promoter was sufficient for activity, previously shown to bind the repressor B cell lymphoma 6 (BCL6) and the activity increased significantly with the addition of the (34, 35). It is also possible that the transiently transfected promoter 5782 REGULATION OF HUMAN PRDM1 GENE TRANSCRIPTION Downloaded from http://www.jimmunol.org/

FIGURE 4. In vivo genomic footprinting of the PRDM1 promoter reveals multiple protein-DNA interactions. The RPMI8226 myeloma and CA46 lymphoma cell lines were analyzed with eight different primer sets to reveal interactions across the proximal 2618 bp of the PRDM1 promoter. Three regions that revealed contacts are shown: A, ϩ15 to Ϫ170 bp; B, Ϫ1717 to Ϫ1951 bp; and C, Ϫ1889 to Ϫ2072 bp. In each pane, the control lanes (cont.) show the guanine residue sequence from deproteinized in vitro methylated DNA. The DMS lanes show the in vivo methylated residues. Protections () and enhancements (●) are shown on the right side of each footprint panel and are indicated in the sequence below. Clusters of contacts have been assigned arbitrary names as indicated along the left side and are boxed in the sequence. Bent arrow in A, position of the transcription start site. A schematic of the footprint primers is shown in supplemental Fig. 1. by guest on September 27, 2021 constructs do not fully recapitulate the chromatin structure of the endogenous gene. This may prevent further activation of these promoter constructs by anti-IgM. However, these results reveal that the lymphoma cells have the necessary components to tran- scribe the PRDM1 gene.

In vivo protein-DNA interactions occur across the PRDM1 promoter To define the important cis-acting DNA elements within the PRDM1 promoter, high resolution mapping of the protein-DNA contact sites was done by in vivo genomic footprinting. Unstimu- lated CA46 lymphoma cells and RPMI8226 myeloma cells were treated briefly with dimethyl sulfate to induce limited methylation of guanine residues. Close protein-DNA interactions have been demonstrated to inhibit or enhance the methylation activity, which can be visualized after chemical cleavage and resolution by sequencing gel electrophoresis. These footprints of altered methylation represent the contact points of transcription factors bound to the promoter. Examination of the first 237-bp region proximal to the transcription start site demonstrated factor binding in both the lymphoma and myeloma cells (Fig. 4A). Four clusters of interac- FIGURE 5. Sp1 interacts at the PRDM1 proximal promoter. EMSA tion are detected and labeled with brackets on the left side of the using an oligonucleotide spanning the Sp1 consensus sequence identi- Ϫ Ϫ sequence. These contacts are indistinguishable between the two fied at position 52 to 43 in the PRDM1 promoter. Lanes 1 and 2 ␮ cell types. Closest to the transcription start site, nine strongly pro- contain 0 and 2 l of nuclear extract, respectively. The binding reactions in lanes 3 and 4 were incubated with the specific Ab indicated at tected guanine residues map across a sequence with homology to the top of each lane. Unlabeled competitor oligonucleotides as indicated an Sp1 consensus binding element. Sp1 binding to this element at the top of lanes 5–10 were added to the binding reaction at 150- or was confirmed by in vitro EMSA and specific Ab reactivity (Fig. 300-fold molar excess. Bottom, Sequence of the Sp1 oligonucleotide 5). This extends the recent findings by Mora-Lopez et al. (36) and and the mutant (mt) probe. wt, Wild type; labeled arrowhead, Sp1- establishes Sp1 as a regulator of PRDM1 transcription in vivo. containing complex; smaller arrowhead, a related specific GC-box bind- Three additional occupied sites have been designated P.A, P.B, ing protein antigenically unrelated to Sp1; ␣, anti. The Journal of Immunology 5783 Downloaded from http://www.jimmunol.org/

FIGURE 6. Site P.H is a PU.1 factor-binding site. A, In vitro binding assays were done using an oligonucleotide containing the P.H site sequence identified at position Ϫ1745 to Ϫ1737 of the PRDM1 promoter and CA46 nuclear extracts. Lanes 1 and 4 contain 2 ␮l of nuclear extract. Unlabeled competitor oligonucleotides as indicated at the top of lanes 5–10 were added to the binding reaction at 150- or 300-fold molar excess. A single complex indicated by an arrowhead is specifically competed by the wild-type (wt) but not a mutant (mt) or unrelated oligonucleotide. In lanes 2 and 3, Abs as indicated at the top were added to the binding reaction. The formation of the specific P.H complex is inhibited by addition of PU.1 Ab. Bottom, Wild type and mutant P.H site sequences. B, ChIP was performed in CA46 lymphoma cells (left) and RPMI8226 myeloma cells (right) using PU.1 Ab and quantitative PCR primers spanning the P.H site. PU.1 binding at the P.H. site was significantly higher than on the negative control promoter HLA-DRA (DRA). Data are means of three independent experiments with SEM (p Ͻ 0.01). C, ChIP in activated primary human B cells. The experiment is as described in B except a myoglobin B locus is shown as the negative control. Lanes labeled ␣IgM (for anti-IgM) were treated for 24 h with anti-IgM, whereas lanes labeled control by guest on September 27, 2021 (cont.) were mock treated for 24 h. PU.1 binding is specifically detected at the P.H site and is not altered by anti-IgM treatment. Similar data were obtained in two independent donor samples. D, Immunoblot analysis of PU.1 expression.

and P.C. These contact sites do not have obvious homology with PRDM1-luciferase construct in either lymphoma or myeloma cell known elements. lines (data not shown). Site P.D associated with contacts at Ϫ2038 The distal promoter region from Ϫ1497 to Ϫ2641 bp was next and Ϫ2032 only in the lymphoma cell line. examined by genomic footprinting using eight overlapping primer sets. Five additional clusters of contact were detected in the distal PU.1 binds to the P.H site and regulates PRDM1 promoter promoter (Fig. 4, B and C, and data not shown). The region that activity conferred transcriptional activation (Ϫ1528 to Ϫ1921) contained To identify the transacting factor bound at site P.H, both in vivo three contacts designated P.J, P.H, and P.G. Site-P.J, associated and in vitro assays were used. First EMSA binding assays were with contacts at Ϫ1805 and Ϫ1802 and site-P.G associated with performed with a 30-bp probe spanning the P.H site in conjunction contacts at Ϫ1648, Ϫ1645, Ϫ1643, and Ϫ1641 overlap with AP1 with nuclear extracts from CA46 lymphoma cells (Fig. 6A). A consensus sequences. Both of these sites were previously predicted fast-migrating protein-DNA complex was detected which was spe- due to sequence homology by Vasanwala et al. (37), but neither ciﬁcally competed by unlabeled P.H probe but not a mutated P.H direct assessment of AP1 binding nor functional activity in B cells probe. The P.H site has homology to consensus Ets family binding or unstimulated myeloma cell lines were done. These sites show sequences. Ab to PU.1 induced the formation of a supershifted conservation across species (supplemental Fig. 3). Our data dem- protein-DNA complex, indicating that PU.1 is contained within the onstrate that both sites are occupied in vivo. Site P.H associated complex bound to P.H in vitro (Fig. 6A). Similar results were with strong contacts at Ϫ1733, Ϫ1732, Ϫ1731, and Ϫ1728 has obtained with nuclear extracts from the myeloma cell line sequence homology to consensus binding sites for Ets family RPMI8226 (data not shown). members known to regulate multiple genes in the B cell lineage. PU.1 association at the P.H site was also measured at the These sites also show conservation across species (supplemental endogenous PRDM1 promoter. ChIP was performed with Abs Fig. 3). The region associated with a partial repression of tran- speciﬁc to PU.1, and association with the P.H site was assessed scription in the lymphoma cell line (Ϫ1921 to Ϫ2618) contained by quantitative PCR (Fig. 6B). In lymphoma cells, PU.1 factor only two consistent clusters of in vivo contacts, designated sites binding at the PRDM1 promoter was ϳ9-fold greater than the P.D and P.F. Site P.F was strongly protected in the CA46 lym- negative control promoter HLA-DRA. Similarly, PU.1 binding phoma cell line and weakly protected in the myeloma cell line. was also observed in the myeloma cell line. We next examined Mutation of the P.F site did not effect promoter activity of the 2618 normal primary B cells for PU.1 binding in vivo. ChIP analysis 5784 REGULATION OF HUMAN PRDM1 GENE TRANSCRIPTION Downloaded from http://www.jimmunol.org/

FIGURE 8. Site P.H and transcription factor PU.1 are involved in transcriptional regulation of PRDI-BF1 in myeloma cells. A, RPMI8226 myeloma cells were transfected with either wild-type or mutant site P.H p2618 PRDM1 promoter luciferase constructs. In addition, the cells received

siRNA against PU.1 or the nontargeting control as indicated below each by guest on September 27, 2021 graph. siRNA against PU.1 diminished wild-type promoter activity. Mu- tation of the P.H site also significantly lowered transcription but addition of FIGURE 7. Site P.H and transcription factor PU.1 are involved in anti- siRNA to PU.1 did not further diminish activity in the context of a mutated IgM-mediated transcriptional activation of PRDM1. A, The p1921 and P.H site. Data are normalized as in Fig. 3 and represent four independent p2618 PRDM1 promoter-luciferase constructs containing a wild-type (wt) experiment with SEM shown. B, Endogenous PRDM1 mRNA levels are or mutated (mut) sequence at the P.H site were transfected into CA46 cells. decreased by siRNA knockdown of PU.1 in RPMI8226 cells. mRNA was Mutation of the P.H site in either construct decreased promoter activity. assayed 48 h after transfection of either a nontargeting siRNA or a PU.1- The mutation is the same as shown in Fig. 6A. The lane marker denoted as specific siRNA. Levels were measured by quantitative RT-PCR and shown basic represents the activity from the promoterless vector, pGL3-Basic. as the average of three independent experiments with SEM. C, Immunoblot Promoter activity was normalized as in Fig. 3 and represents six indepen- of PU.1 expression after siRNA knockdown in RPMI 8226 cells. dent experiments with SEM. B, Endogenous PRDM1 expression is inhibited by loss of PU.1. CA46 lymphoma cells transfected with either nontargeting control siRNA or an siRNA specific to PU.1 for 24 h and then reduction in transcriptional activity, indicating that this site is re- ␣ either stimulated with anti-IgM ( IgM) or untreated (control) for an addi- quired for maximal activity of the PRDM1 promoter (Fig. 7A). tional 24 h. PRDM1 mRNA was assessed by quantitative RT-PCR. Data PU.1 function in the activation of the endogenous PRDM1 gene was normalized to GAPDH and shown as fold induction relative to un- was also examined by inhibiting PU.1 protein expression using treated (control) sample. Data are the means of three independent experiments with SEM. C, Immunoblot analysis of PU.1 and PRDI-BF1 expres- siRNA. CA46 lymphoma cells were transiently transfected with sion. PU.1 siRNA decreased PU.1 protein levels and diminished induction the PU.1-specific siRNA and incubated with or without anti-IgM of PRDI-BF1 in response to anti-IgM. Experimental conditions are as in B. stimulation. Anti-IgM-mediated induction of endogenous PRDM1 mRNA is significantly abrogated by PU.1 knockdown (Fig. 7B). Furthermore, induction of PRDM1 protein was also inhibited by clearly identified PU.1 binding at the region of the P.H site, but the reduction in PU.1 expression (Fig. 7C). The low level of ap- essentially no binding was observed at the negative control lo- optosis as assessed by poly(ADP-ribose) polymerase cleavage was cus (Fig. 6C). PU.1 binding was unchanged by anti-IgM treat- not altered by PU.1 knockdown (data not shown). This indicates ment. Consistent with this finding, the level of PU.1 protein that PU.1 is involved in anti-IgM-induced transcription of PRDM1 expression in the primary B cells did not change with anti-IgM and that additional factors also contribute to the activity. treatment (Fig. 6D). Similarly, to demonstrate the involvement of PU.1 in the ex- Functional assessment of site P.H. was performed initially by pression of PRDM1 in myeloma cells, RPMI8226 were cotrans- mutating the site in the context of either the p1921 and p2618 fected with PRDM1 full-length luciferase-promoter construct and PRDM1 promoter-luciferase constructs. Transfection of these mu- siRNA specific for PU.1. PU.1 knockdown in these cells decreases tated constructs into the lymphoma cell line revealed an ϳ50% the PRDM1 promoter activity by ϳ60% (Fig. 8A). Mutation of the The Journal of Immunology 5785

coactivator CBP were variable with a general increase in binding observed upon stimulation. However, the results for CBP did not reach statistical signiﬁcance (data not shown).

Discussion The transcription factor PRDI-BF1/Blimp-1 is required for the differentiation of a mature B cell to a plasma cell (3). It does this by directly repressing downstream targets, which in turn has a wide- spread effect on further downstream targets (40). These downstream effector cascades have been well studied; however, very little is known as to how PRDI-BF1/Blimp-1 expression is regulated. This study demonstrates a direct link between BCR cross-linking by anti-IgM and transcriptional activation of PRDI-BF1/ Blimp-1. Treatment of CA46 lymphoma cells with anti-IgM sig- niﬁcantly up-regulated PRDM1 mRNA and protein levels and induced apoptosis. This is consistent with observations in other B

cell lymphoma cell lines (10–14). One previous study using the Downloaded from EBV-negative CA46 cell line reported that this line was unique in responding to anti-IgM with only growth arrest, raising the possibility that EBV-negative B cell lymphomas were heterogeneous in the apoptosis response (13). However, this report used very late FIGURE 9. ChIP of PU.1 and TLE4 at the distal PRDM1 promoter. A, markers of apoptosis (DNA fragmentation), whereas we measured

ChIP assay using a PU.1 Ab to detect binding at the P.H site before and early markers, suggesting that only the kinetics of apoptosis in- http://www.jimmunol.org/ after anti-IgM (␣IgM) stimulation. CA46 cells were left unstimulated (con- duction may vary. The anti-IgM-induced growth arrest and apo- trol) or stimulated with anti-IgM for 24 h before harvest. Binding was ptosis has been linked to down-regulation of c-myc (13). This is assessed by quantitative PCR using primers surrounding the P.H site or consistent with the induction of PRDI-BF1/Blimp-1 and its known located at the proximal PRDM1 promoter. PU.1 binding at the P.H site on role in directly repressing c-myc transcription (6). Suppression of PRDM1 distal promoter is unaffected by anti-IgM treatment. Data repre- PRDI-BF1 target genes was ϳ2-fold, which is consistent with present the means of six (P.H site) or four (prox. promoter) independent ex- vious reports using overexpression of murine PRDM1 (Blimp-1; periments with SEM. B, ChIP assay using TLE4 Ab to detect binding at Refs. 7 and 30). The lower levels of PRDI-BF1 induced by anti- P.H site. The same samples assessed in A were reassessed for TLE4 binding. TLE4 binding at the P.H site significantly decreases upon treatment IgM treatment could also be responsible for the attenuation of the by guest on September 27, 2021 with anti-IgM. Data are the means of four independent experiments suppressive activity of PRDI-BF1/Blimp-1. Alternatively, post- with SEM. translational modifications of PRDI-BF1 after anti-IgM treatment could alter the functional activity of PRDI-BF1, although no such modifications have been described to date. Future investigations of P.H site results in a Ͼ80% loss of PRDM1 promoter activity. PRDI-BF1/Blimp-1 posttranslational modifications may reveal ad- Knockdown of PU.1 does not further alter PRDM1 transcription in ditional levels PRDI-BF1/Blimp-1 regulation. The increase in the context of a mutated P.H site. This confirms that the P.H site PRDM1 expression occurs primarily at the level of transcription, is functional in myeloma cells and that PU.1 exerts its effects given that we did not detect any change in mRNA stability but through the P.H site. Loss of PU.1 also decreases endogenous actively transcribing nascent RNA levels were induced within 1 h. PRDM1 mRNA levels in the RPMI8226 cell line (Fig. 8B), further Unexpectedly, in vivo genomic footprinting revealed that the confirming a role for PU.1 in regulating PRDM1 transcription. PRDM1 promoter was extensively occupied by transcription factors even in the absence of stimulation or promoter activity. To- Loss of TLE4 at the P.H site in response to transcriptional gether these findings indicate that the PRDM1 promoter is in an stimulation open and poised state in the lymphoma cells. This provides support PU.1 has been described to function both as an activator of tran- that therapeutic approaches to trigger endogenous PRDM1 expres- scription and as a repressor (38, 39). These divergent activities sion are feasible and could be a viable approach to induce apo- have been linked to differential PU.1-mediated recruitment of the ptosis in lymphoma cells. Furthermore, PRDI-BF1 has been shown corepressor TLE4 and the coactivator CREB-binding protein to be an important target in immunotherapy of myeloma by induc- (CBP). The observed PU.1-dependent activation in response to tion of PRDI-BF1-specific CTLs, an approach that could also be anti-IgM might be due to changes in PU.1 binding to the PRDM1 exploited to kill lymphomas after PRDI-BF1 induction (41). promoter or to changes in the coactivator or corepressors recruited The transcription factors and cis-acting elements controlling by PU.1. To address this question, we used chromatin immuno- PRDM1 promoter activity have only begun to be investigated. A precipitation to profile binding of the factors in response to anti- region of the murine PRDM1 promoter spanning Ϫ918 to ϩ207 bp IgM. PU.1 binding at the P.H site is robust and unchanged by was previously shown to have minimal promoter activity but did anti-IgM treatment (Fig. 9A). Minimal binding was detected near not confer any cell type-specific activity (33). This is consistent the transcription start site of PRDM1 confirming the localized re- with our finding that the sequences between Ϫ1528 and Ϫ1921 bp cruitment of PU.1 to the P.H site. In contrast chromatin immuno- of the human promoter are required for activation of the promoter precipitation of the corepressor TLE4 revealed a significant loss of in lymphoma and myeloma cells. In vivo genomic footprinting of binding in response to the activation stimulus (Fig. 9B). This is the proximal promoter region revealed four occupied elements consistent with a loss of repressive activity and the observed in- within the first 170 bp. These include a bound Sp1 site proximal to crease in PRDM1 transcription. Similar analyses with Abs to the the transcription initiation point, consistent with the absence of a 5786 REGULATION OF HUMAN PRDM1 GENE TRANSCRIPTION canonical TATA box element and the recent findings by Mora- BCL6 binding to intron 5 of human PRDM1 or introns 3 and 5 of Lopez et al. (36). In vivo genomic footprinting of the upstream murine PRDM1 is consistent with the absence of a dominant re- activation domain revealed three occupied elements in both lym- pression domain detected by our promoter studies (34, 35). Our phoma and myeloma cells. Sites P.J and P.G both have homology studies revealed that the distal region of the promoter (Ϫ1921 to to an AP1 consensus binding site sequence. These sites were pre- Ϫ2686 bp) partially decreased overall promoter activity in the B viously predicted by sequence homology (37). Investigation of the cell line. This region contained only two clear in vivo occupied murine PRDM1 promoter has also provided evidence that c-fos elements, and the site P.D was observed only in the B cell line but can regulate the gene (42). The authors identified an AP1-binding not in the myeloma line. The factor binding at site P.D remains to site at a region homologous to the site we designated P.G and be elucidated, but the sequence does have partial homology to the demonstrated that c-fos can bind to this site. c-fos was required for transcription repressor zinc finger E-box binding homeobox 1 maximal activity of the murine PRDM1 promoter. Together, these (ZEB1; Ref. 48). findings strongly support that the PRDM1 gene expression is di- In conclusion, we have demonstrated PRDM1 regulation occurs rectly regulated by AP1 through sites P.J and P.G. primarily at the transcriptional level in lymphoma and myeloma The third in vivo occupied element within the PRDM1 promoter cells. We show for the first time that PRDM1 is transcriptionally required for transcriptional activation is site P.H. In vivo ChIP regulated by PU.1 and the corepressor TLE4. Furthermore, we assays and in vitro DNA binding assays established that Ets family have shown that two AP1 sites and an Sp1 site within the PRDM1 member PU.1 specifically binds to site P.H. Basal and anti-IgM promoter are occupied in vivo. Importantly, we report that the stimulated PRDM1 promoter activity was significantly inhibited promoter is poised for activation in lymphoma cells, suggesting by mutating the P.H site in lymphoma cells. Additionally, knock- that inducing PRDI-BF1 expression in lymphoma cells lacking Downloaded from down of PU.1 expression by siRNA decreased PRDM1 transcrip- PRDM1 gene mutations is a viable therapeutic approach to induction after BCR cross-linking by anti-IgM. This indicates that PU.1 ing apoptosis in these cells. and the Ets site is a critical and required component of the PRDM1 promoter, which must be present for the promoter to fully respond Acknowledgments to anti-IgM stimulation. However, this site is not sufficient for the We thank the H. Lee Moffitt Cancer Center Flow Cytometry and Molecular

anti-IgM response. These data do not exclude the possibility that Biology Core Facilities. http://www.jimmunol.org/ other Ets family members may also function in regulating PRDM1 expression such as Elf-1 which has a DNA recognition sequence Disclosures similar to that of PU.1. In the myeloma cell line RPMI8226, the The authors have no financial conflict of interest. P.H site and PU.1 expression were also required for maximal promoter activity. PU.1 has an important role in regulating early B References 1. Keller, A. D., and T. Maniatis. 1991. Identification and characterization of a cell development and continues to be expressed throughout B cell novel repressor of ␤-interferon gene expression. Genes Dev. 5: 868–879. maturation (43). A recent report has shown that PU.1 is also ex- 2. Turner, C. A., Jr., D. H. Mack, and M. M. Davis. 1994. Blimp-1, a novel zinc pressed in primary human plasma cells but that expression in my- finger-containing protein that can drive the maturation of B lymphocytes into

immunoglobulin-secreting cells. Cell 77: 297–306. by guest on September 27, 2021 eloma cells and cell lines is variable (44). Our results suggest that 3. Shapiro-Shelef, M., K. I. Lin, L. J. McHeyzer-Williams, J. Liao, PU.1 may contribute to the initial activation of PRDM1 expression M. G. McHeyzer-Williams, and K. Calame. 2003. Blimp-1 is required for the in B cells. Furthermore, PRDM1 expression in myeloma cells is formation of immunoglobulin secreting plasma cells and pre-plasma memory B cells. Immunity 19: 607–620. significantly enhanced by PU.1. PU.1 is bifunctional and can either 4. Piskurich, J. F., K. I. Lin, Y. Lin, Y. Wang, J. P. Ting, and K. Calame. 2000. increase or repress transcription of its target promoters (39, 45). BLIMP-I mediates extinction of major histocompatibility class II transactivator expression in plasma cells. Nat. Immunol. 1: 526–532. This opposing activity is mediated by differential recruitment of 5. Ghosh, N., I. Gyory, G. Wright, J. Wood, and K. L. Wright. 2001. Positive coregulators by PU.1. The coactivator CBP, a histone acetyltrans- regulatory domain I binding factor 1 silences class II transactivator expression in ferase, binds to PU.1 and promotes activation of the promoter (39). multiple myeloma cells. J. Biol. Chem. 276: 15264–15268. 6. Lin, Y., K. Wong, and K. Calame. 1997. Repression of c-myc transcription by In contrast, PU.1 can also recruit TLE4, a corepressor which in Blimp-1, an inducer of terminal B cell differentiation. Science 276: 596–599. turn recruits the histone deacetylases HDAC1 and HDAC2 (38). 7. Lin, K. I., C. Angelin-Duclos, T. C. Kuo, and K. Calame. 2002. Blimp-1-depen- We observed TLE4 recruitment to the PRDM1 promoter at the dent repression of Pax-5 is required for differentiation of B cells to immunoglobulin M-secreting plasma cells. Mol. Cell Biol. 22: 4771–4780. region of PU.1 binding. This recruitment was significantly dimin- 8. Shaffer, A. L., K. I. Lin, T. C. Kuo, X. Yu, E. M. Hurt, A. Rosenwald, ished upon activation by anti-IgM, whereas CBP binding was J. M. Giltnane, L. Yang, H. Zhao, K. Calame, and L. M. Staudt. 2002. Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene largely unaffected. This indicates that the components of the PU.1 expression program. Immunity 17: 51–62. complex bound at the PRDM1 promoter are modulated by BCR 9. Doody, G. M., S. Stephenson, and R. M. Tooze. 2006. BLIMP-1 is a target of cross-linking to promote gene activation. Conversely, knockdown cellular stress and downstream of the unfolded protein response. Eur. J. Immunol. 36: 1572–1582. of PU.1 in unstimulated B cells did not induce PRDM1 expression, 10. Benhamou, L. E., P. A. Cazenave, and P. Sarthou. 1990. Anti-immunoglobulins suggesting that the PU.1-TLE4 complex is not acting as a domi- induce death by apoptosis in WEHI-231 B lymphoma cells. Eur. J. Immunol. 20: nant repressor. 1405–1407. 11. Carey, G. B., and D. W. Scott. 2001. Role of phosphatidylinositol 3-kinase in BCL6 can repress PRDM1 expression (46). Vasanwala et al. anti-IgM- and anti-IgD-induced apoptosis in B cell lymphomas. J. Immunol. 166: (37) showed that AP1 and BCL6 could interact and suggested that 1618–1626. 12. Hasbold, J., and G. G. Klaus. 1990. Anti-immunoglobulin antibodies induce ap- the two AP1-like sites, which we have designated as P.J and P.G, optosis in immature B cell lymphomas. Eur. J. Immunol. 20: 1685–1690. may mediate BCL6 repression of PRDM1. Bach2 has also been 13. Kaptein, J. S., C. K. Lin, C. L. Wang, T. T. Nguyen, C. I. Kalunta, E. Park, suggested to repress murine PRDM1 though association with v- F. S. Chen, and P. M. Lad. 1996. Anti-IgM-mediated regulation of c-myc and its possible relationship to apoptosis. J. Biol. Chem. 271: 18875–18884. maf avian musculoaponeurotic fibrosarcoma oncogene homolog k 14. Zupo, S., L. Isnardi, M. Megna, R. Massara, F. Malavasi, M. Dono, E. Cosulich, (avian) bound at the site homologous to site P.G (47). Our in vivo and M. Ferrarini. 1996. CD38 expression distinguishes two groups of B-cell data support the hypothesis that the sites are bound by transcription chronic lymphocytic leukemias with different responses to anti-IgM antibodies and propensity to apoptosis. Blood 88: 1365–1374. factors, but the region conferred activation, not repression, in the 15. Lee, S. C., A. Bottaro, and R. A. Insel. 2003. Activation of terminal B cell BCL6-positive CA46 cell line. This suggests that BCL6 does not differentiation by inhibition of histone deacetylation. Mol. Immunol. 39: 923–932. 16. Knodel, M., A. W. Kuss, D. Lindemann, I. Berberich, and A. Schimpl. 1999. repress through these elements, although cell line differences be- Reversal of Blimp-1-mediated apoptosis by A1, a member of the Bcl-2 family. tween the reports may have an effect. Recent direct evidence of Eur. J. Immunol. 29: 2988–2998. The Journal of Immunology 5787

17. Messika, E. J., P. S. Lu, Y. J. Sung, T. Yao, J. T. Chi, Y. H. Chien, and 34. Parekh, S., J. M. Polo, R. Shaknovich, P. Juszczynski, P. Lev, S. M. Ranuncolo, M. M. Davis. 1998. Differential effect of B lymphocyte-induced maturation pro- Y. Yin, U. Klein, G. Cattoretti, R. Dalla Favera, M. A. Shipp, and A. Melnick. tein (Blimp-1) expression on cell fate during B cell development. J. Exp. Med. 2007. BCL6 programs lymphoma cells for survival and differentiation through 188: 515–525. distinct biochemical mechanisms. Blood 110: 2067–2074. 18. Garcia, J. F., G. Roncador, J. F. Garcia, A. I. Sanz, L. Maestre, E. Lucas, 35. Tunyaplin, C., A. L. Shaffer, C. D. Angelin-Duclos, X. Yu, L. M. Staudt, and S. Montes-Moreno, R. Fernandez Victoria, J. L. Martinez-Torrecuadrara, K. L. Calame. 2004. Direct repression of prdm1 by Bcl-6 inhibits plasmacytic T. Marafioti, D. Y. Mason, and M. A. Piris. 2006. PRDM1/BLIMP-1 expression differentiation. J. Immunol. 173: 1158–1165. Haematologica in multiple B and T-cell lymphoma. 91: 467–474. 36. Mora-Lopez, F., N. Pedreno-Horrillo, L. Delgado-Perez, J. A. Brieva, and 19. Pasqualucci, L., M. Compagno, J. Houldsworth, S. Monti, A. Grunn, A. Campos-Caro. 2008. Transcription of PRDM1, the master regulator for plasma S. V. Nandula, J. C. Aster, V. V. Murty, M. A. Shipp, and R. Dalla-Favera. 2006. cell differentiation, depends on an SP1/SP3/EGR-1 GC-box. Eur. J. Immunol. 38: PRDM1/BLIMP1 Inactivation of the gene in diffuse large B cell lymphoma. 2316–2324. J. Exp. Med. 203: 311–317. 20. Tam, W., M. Gomez, A. Chadburn, J. W. Lee, W. C. Chan, and D. M. Knowles. 37. Vasanwala, F. H., S. Kusam, L. M. Toney, and A. L. Dent. 2002. Repression of 2006. Mutational analysis of PRDM1 indicates a tumor-suppressor role in diffuse AP-1 function: a mechanism for the regulation of Blimp-1 expression and B large B-cell lymphomas. Blood 107: 4090–4100. lymphocyte differentiation by the B cell lymphoma-6 protooncogene. J. Immunol. 21. Gyory, I., G. Fejer, N. Ghosh, E. Seto, and K. L. Wright. 2003. Identification of 169: 1922–1929. a functionally impaired positive regulatory domain I binding factor 1 transcrip- 38. Linderson, Y., D. Eberhard, S. Malin, A. Johansson, M. Busslinger, and tion repressor in myeloma cell lines. J. Immunol. 170: 3125–3133. S. Pettersson. 2004. Corecruitment of the Grg4 repressor by PU.1 is critical for 22. Borson, N. D., M. Q. Lacy, and P. J. Wettstein. 2002. Altered mRNA expression Pax5-mediated repression of B-cell-specific genes. EMBO Rep. 5: 291–296. of Pax5 and Blimp-1 in B cells in multiple myeloma. Blood 100: 4629–4639. 39. Yamamoto, H., F. Kihara-Negishi, T. Yamada, Y. Hashimoto, and T. Oikawa. 23. Garrone, P., E. M. Neidhardt, E. Garcia, L. Galibert, C. van Kooten, and 1999. Physical and functional interactions between the transcription factor PU.1 J. Banchereau. 1995. Fas ligation induces apoptosis of CD40-activated human B and the coactivator CBP. Oncogene 18: 1495–1501. lymphocytes. J. Exp. Med. 182: 1265–1273. 40. Shapiro-Shelef, M., and K. Calame. 2005. Regulation of plasma-cell develop- 24. Kuchtey, J., M. Pennini, R. K. Pai, and C. V. Harding. 2003. CpG DNA induces ment. Nat. Rev. Immunol. 5: 230–242. a class II transactivator-independent increase in class II MHC by stabilizing class

41. Lotz, C., S. A. Mutallib, N. Oehlrich, U. Liewer, E. A. Ferreira, M. Moos, Downloaded from II MHC mRNA in B lymphocytes. J. Immunol. 171: 2320–2325. M. Hundemer, S. Schneider, S. Strand, C. Huber, H. Goldschmidt, and 25. Wuarin, J., and U. Schibler. 1994. Physical isolation of nascent RNA chains M. Theobald. 2005. Targeting positive regulatory domain I-binding factor 1 and transcribed by RNA polymerase II: evidence for cotranscriptional splicing. Mol. X box-binding protein 1 transcription factors by multiple myeloma-reactive CTL. Cell Biol. 14: 7219–7225. J. Immunol. 175: 1301–1309. 26. Couronne, O., A. Poliakov, N. Bray, T. Ishkhanov, D. Ryaboy, E. Rubin, L. Pachter, and I. Dubchak. 2003. Strategies and tools for whole-genome align- 42. Ohkubo, Y., M. Arima, E. Arguni, S. Okada, K. Yamashita, S. Asari, S. Obata, ments. Genome Res. 13: 73–80. A. Sakamoto, M. Hatano, J. O-Wang, M. Ebara, H. Saisho, and T. Tokuhisa. 27. Ghosh, N., J. F. Piskurich, G. Wright, K. Hassani, J. P. Ting, and K. L. Wright. 2005. A role for c-fos/activator protein 1 in B lymphocyte terminal differentiation. J. Immunol. 174: 7703–7710. 1999. A novel element and a TEF-2-like element activate the major histocom- http://www.jimmunol.org/ patibility complex class II transactivator in B-lymphocytes. J. Biol. Chem. 274: 43. Scott, E. W., M. C. Simon, J. Anastasi, and H. Singh. 1994. Requirement of 32342–32350. transcription factor PU.1 in the development of multiple hematopoietic lineages. 28. Pfeifer, G. P., R. L. Tanguay, S. D. Steigerwald, and A. D. Riggs. 1990. In vivo Science 265: 1573–1577. footprint and methylation analysis by PCR-aided genomic sequencing: compar- 44. Tatetsu, H., S. Ueno, H. Hata, Y. Yamada, M. Takeya, H. Mitsuya, D. G. Tenen, ison of active and inactive X chromosomal DNA at the CpG island and promoter and Y. Okuno. 2007. Down-regulation of PU.1 by methylation of distal regula- of human PGK-1. Genes Dev. 4: 1277–1287. tory elements and the promoter is required for myeloma cell growth. Cancer Res. 29. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription 67: 5328–5336. initiation by RNA pol II in a soluble extract from isolated mammalian nuclei. 45. Suzuki, M., T. Yamada, F. Kihara-Negishi, T. Sakurai, and T. Oikawa. 2003. Nucleic Acids Res. 11: 1475–1488. Direct association between PU.1 and MeCP2 that recruits mSin3A-HDAC com- 30. Lin, Y., K.-K. Wong, and K. Calame. 1997. Repression of c-myc Transcription plex for PU.1-mediated transcriptional repression. Oncogene 22: 8688–8698. by Blimp-1, an inducer of terminal B cell differentiation. Science 276: 596–599. 46. Shaffer, A. L., X. Yu, Y. He, J. Boldrick, E. P. Chan, and L. M. Staudt. 2000. 31. Dani, C., J. M. Blanchard, M. Piechaczyk, S. El Sabouty, L. Marty, and by guest on September 27, 2021 P. Jeanteur. 1984. Extreme instability of myc mRNA in normal and transformed BCL-6 represses genes that function in lymphocyte differentiation, inﬂammation, Immunity human cells. Proc. Natl. Acad. Sci. USA 81: 7046–7050. and cell cycle control. 13: 199–212. 32. Sharova, L. V., A. A. Sharov, T. Nedorezov, Y. Piao, N. Shaik, and M. S. Ko. 47. Ochiai, K., Y. Katoh, T. Ikura, Y. Hoshikawa, T. Noda, H. Karasuyama, 2009. Database for mRNA half-life of 19,977 genes obtained by DNA microarray S. Tashiro, A. Muto, and K. Igarashi. 2006. Plasmacytic transcription factor analysis of pluripotent and differentiating mouse embryonic stem cells. DNA Res. Blimp-1 is repressed by Bach2 in B cells. J. Biol. Chem. 281: 38226–38234. 16: 45–58. 48. Genetta, T., D. Ruezinsky, and T. Kadesch. 1994. Displacement of an E-box- 33. Tunyaplin, C., M. A. Shapiro, and K. L. Calame. 2000. Characterization of the B binding repressor by basic helix-loop-helix proteins: implications for B-cell spec- lymphocyte-induced maturation protein-1 (Blimp-1) gene, mRNA isoforms and iﬁcity of the immunoglobulin heavy-chain enhancer. Mol. Cell Biol. 14: basal promoter. Nucleic Acids Res. 28: 4846–4855. 6153–6163.