Molecular Studies Did Not Support the Distinctiveness of Malva Alcea and M

Biologia 67/6: 1088—1098, 2012 Section Botany DOI: 10.2478/s11756-012-0107-9

Molecular studies did not support the distinctiveness of Malva alcea and M. excisa (Malvaceae) in Central and Eastern Europe

Zbigniew Celka1*, Monika Szczecinska´ 2,JakubSawicki2 &MyroslavV.Shevera3

1Department of Plant Taxonomy, Faculty of Biology, Adam Mickiewicz University, Umultowska 89,PL-61–614 Pozna´n, Poland; e-mail: [email protected] 2Department of Botany and Nature Protection, University of Warmia and Mazury in Olsztyn, PlacLódzki 1,PL-10–727 Olsztyn, Poland 3Department of Systematics and Floristic of Vascular Plants, M. G. Kholodny Institute of Botany, National Academy of Sciences of Ukraine, Tereshchenkivska 2,Kyiv01601,Ukraine

Abstract: Relics of Malva alcea are found in Central and Western Europe. A similar taxon, M. excisa, is native to the eastern parts of Europe. According to selected sources, the geographical range boundary of the above taxa intersects Poland. Taxonomic research relying on key morphological features (the depth of corolla petal incisions and the type of hairs covering the stem) did not clearly validate the distinctness of those species. Genetic variation between Malva alcea and M. excisa was analyzed using ISSR and ISJ markers. The performed analysis did not reveal statistically significant differences at the level of genetic diversity between M. alcea and M. excisa populations. The obtained genetic identity values (I = 0.985) do not support the identification of eastern populations as a distinct biological species of M. excisa. The applied DNA markers did not reveal species-specific bands supporting molecular identification of those taxa. The obtained genetic identity values were verified by neighbor-joining grouping which showed that M. alcea and M. excisa did not form corresponding clusters, thus pointing to an absence of significant differences between the analyzed taxa. Differences between the above species were not revealed by an analysis of the sequences of chloroplast regions trnH- psbAandrpoC1, either. Key words: Malva alcea; Malva excise; genetic diversity; molecular markers

Introduction ture sources, for example, Marcin of Urz˛edów (1595, after Furmanowa et al. 1959), Syreniusz (1613, af- The genus Malva L. includes about 40 species occur- ter www.zielnik-syrenniusa.art.pl), Jundzill (1791) and ring in Europe, Africa and temperate regions of Asia Kluk (1805–1811). Also, the present literature on the (Mabberley 1997). In European flora, depending on the subject provides information about the use values of literature source, from 11 to 13 species of Malva have these plants (O˙zarowski 1982; Nowiński 1983; Rakhme- been recognized (Dalby 1968; Mosyakin & Fedoronchuk tov 2000; Didukh 2010). 1999; Mirek et al. 2002; Rothmaler et al. 2005). In cen- For many years, species of the genus Malva have tral and eastern Europe, majority of them are alien been the object of scientific interest throughout the species, brought in the Middle Ages (e.g., Malva alcea world. Numerous studies have been carried out to L., M. neglecta Wallr. and M. sylvestris L.), or species date to investigate their biology, ecology and taxonomy which run wild from the present-day cultivation, like, (Bates 1968; Ray 1995, 1998; El Naggar 2001; Tate et. among others, M. verticillata L. (Zaj˛ac 1979; Olyanit- al. 2005). However, the taxonomic status of some mem- skaya, Tzvelev 1996; Mirek et al. 2002; Rothmaler et bers of the genus, including M. excisa Rchb., remains al. 2005; Didukh 2010). uncertain. The Malva species have been used by humans since M. excisa is widely distributed in Central and East- theMiddleAges.Forexample,Malva sylvestris is a ern Europe and in southern Sweden, where it grows species that was recommended for cultivation already on dry hills, in the forest edge zone and in roadsides in the early Medieval sources, such as, among oth- (Iľin 1974; Walas 1959). It is closely related to another ers, Capitulare de Villis (c 800 CE), Leechbook (c 940 member of the genus, M. alcea, a species common in CE) and Lacnunga (c 950 CE) (wyrtig.com). The de- Western Europe. Both species show high morphologi- scriptions of medicinal properties and use of the other cal similarity. The key features which allow to discrim- Malva species can also be found in many old litera- inate between M. excisa and M. alcea are based solely

* Corresponding author

c 2012 Institute of Botany, Slovak Academy of Sciences Molecular studies of Malva alcea and M. excisa 1089 on the size and type of stem hairs and on the shape Moench (Szczecińska et al. 2009). ISSR (Inter Simple of petal apices (Walas 1959). In the case of M. excisa, Sequence Repeat) markers (Zietkiewicz et al. 1994) are stem hairs are small and stellate and corolla petals are the second category of markers applied in this study. deeply incised or doubly incised, while M. alcea is char- Owing to a high degree of diversity at both the pop- acterized by large, single or trifurcate hairs and slightly ulation and the interspecific level, ISSR markers are incised petals. At present, M. excisa is either treated as widely applied in taxonomic studies (Vanderpoorten et a separate species (Walas 1959; Iľin 1974; Olyanitskaya al. 2003; Dogan et al. 2007) as well as in studies investi- 1999; Majorov 2006) or is considered to be a subspecies gating genetic variation at the species level (Gunnars- of M. alcea (Olyanitskaya 1999; Dalby 1968; Rutkowski son et al. 2005; Liu et al. 2007). The application of the 2004). two types of genotyping markers makes it possible to es- In Poland, M. excisa is very rarely reported timate the variability of the studied species both in the (Cwikli´´ nski & Glowacki 2000), while the floristic mono- non-coding (SSR markers) and coding (ISJ markers) graphs compiled in the territories situated east of the regions of the genome. Two chloroplast regions, non- Polish border, including in Lithuania, Belarus and the codnig trnH-psbA and coding rpoC1, which are candi- Ukraine, almost exclusively report M. excisa, but do date regions for plant bar-coding, characterized by rela- not mention (except in very rare cases) M. alcea (e.g. tively high variability (Newmaster et al. 2008; Erickson Iľin 1974; Tzvelev 2000). In contrast, the floras of the et al. 2008), were also used in the present study. countries located west of the Odra River, do not con- tain M. excisa (De Langhe 1978; Rothmaler et al. 2005). The unclear taxonomic status of both species and the Material and methods problems with their classification result primarily from Species and sampling their high morphological similarity. Another difficulty Malva alcea is found in Central and Western Europe, parts in their classification may be posed by populations from of Southern Europe as well as in the southern parts of east Poland, displaying intermediate features between Sweden (Hultén & Fries 1986). It is a perennial plant the two species, which suggests their hybrid charac- which propagates by seeds. Vegetative reproduction may be ter. There are no sufficient data available to determine achieved by splitting of the main root which undergoes inter- whether M. excisa should be regarded as a separate nal necrosis over time (Lukasiewicz 1962). M. alcea is found predominantly in the areas of Medieval settlement, such as species or as a variety or subspecies of M. alcea. towns, castle ruins and villages. In some regions, it has a ten- Methods that rely on DNA polymorphism have dency to propagate from former cultivations. Outside those been increasingly applied to determine fixed interspe- habitats, the species is encountered in Europe in dry and cific differences and to identify species difficult to dis- warm locations on calcareous, nitrogen-rich soils (Hegi 1925; tinguish based on their anatomical and morphological Heß et al. 1970). It is observed in forest and shrub margins, characteristics. Numerous taxonomic studies using var- in ruderal plant communities, in dry and warm habitats, on ious molecular marker classes have shown that true bi- sunny slopes, along roads and on field boundary strips (As- ological species differ in both qualitative and quantita- cherson & Graebner 1898–1899; Hegi 1925; Hermann 1956; tive terms at the molecular level (Cronberg 1996; Saw- Walas 1959; Garcke 1972; De Langhe et al. 1978; Dostál 1989; Adler et al. 1994; Mossberg et al. 1995). M. alcea is as- icki et al. 2006; Szczecińska et al. 2006). They have fixed sociated with nitrophilous plant communities of the classes species-specific alleles in individual loci, which permit Artemisietea and Chenopodietea in ruderal habitats (Ellen- their easy molecular identification, and they often differ berg 1978; Dostál 1989; Matuszkiewicz 2001; Zarzycki et al. with respect to allele frequencies. 2002; Rothmaler et al. 2005). It is also known to accompany Due to some taxonomic uncertainty concerning xerothermic grasslands and stands of the classes Festuco- species delimitations (Celka et al. 2006; 2007; 2010a, Brometea, Rhamno-Prunetea and Trifolio-Geranietea san- 2010b), we aimed to determine whether the two in- guini (Fijalkowski 1994). vestigated taxa are genetically distinct. The taxonomic Malva excisa is found in Eastern Europe. According status of the species was verified with the use of both to Walas (1959), the western range limit of the species in- genotyping and sequencing methods to support an un- tersects Poland. It occurs in similar habitats to M. alcea, including thickets, meadows, forest margins, orchards, gar- ambiguous evaluation of the taxonomic position of M. dens, along roads and households as a ruderal plant (Iľin excisa. Semi-specific ISJ (Intron-Exon Splice Junction) 1974; Olyanitskaya 1999; Zubkevich 1999; Majorov 2006). markers are based on the sequences which are com- Population abundance was estimated at each locality. monly found in plants and which are indispensable for Genets consisting of several to between ten and twenty ram- post-transcription DNA processing (Weining & Lan- ets were regarded as an individual. Experimental material gridge 1991). ISJ primers are partly complementary was sampled from 20 localities (13 localities of M. alcea and to the sequences on the exon-intron boundary. Those 7ofM. excisa) in 2007 (Fig. 1, Table 1). Samples were col- markers had been successfully used in taxonomic stud- lected from localities representing the entire habitat species of the genera Polygonatum Mill. (Szczecińska et al. trum (settlements, roadsides, roadside ditches, cemeteries, thickets) where mallow is populously represented. To avoid 2006), Orthotrichum Hedw. (Plášek & Sawicki 2010; repeated sampling of the same clone, samples were collected Sawicki et al. 2010), Aneura Dumort. (B˛aczkiewicz et from individuals that were 3 m apart (in small populations) al. 2008), as well as in studies investigating the popu- or 10 m apart (in large populations). Material sampled from lation genetics of Uncinula necator (Schwein.) Burrill 10 individuals in each population was placed in silica gel (Stummer et al. 2000), Chamaedaphne calyculata (L.) (Chase & Hillis 1991). 1090 Z. Celka et al.

Fig. 1. Distribution of sites of sample collection and the hypothetical distribution range of Malva excisa determined on the basis of literature. 1 – sites of sample collection (A – Malva alcea,E–Malva excisa); 2 – hypothetical range of M. excisa; 3 – borders of countries.

Table 1. Studied populations of Malva and their GenBank accession numbers for rpoC1 and trnH-psbAregions:A–M. alcea,E–M. excisa, N – number of plant sampled.

Symbol Population Geographic locality Population size N rpoC1, trnH-psbA

A-1 Teterow (Meclenburg-Vorpommern, Germany) N53◦4722.6 E12◦3552.3 50 7 HM214515, HM214494 A-2 Feldberg (Meclenburg-Vorpommern, Germany) N53◦2034.1 E13◦2729.0 4 4 HM214516, HM214495 A-3 Fürstenwerder (Meclenburg-Vorpommern, Germany) N53◦2236.4 E13◦3406.5 50 6 HM214517, HM214496 A-4 Slawsko (Zachodniopomorskie region, Poland) N54◦2313.9 E16◦4250.6 30 10 HM214518, HM214497 A-5 Skwierzyna (Lubuskie region, Poland) N52◦3536.5 E15◦3137.3 15 7 HM214519, HM214498 A-6 Daleszyn 1 (Wielkopolskie region, Poland) N51◦5600.4 E17◦0005.1 100 10 HM214520, HM214499 A-7 Daleszyn 2 (Wielkopolskie region, Poland) N51◦5546.1 E17◦0005.2 3 3 HM214521, HM214500 A-8 Gostyń (Wielkopolskie region, Poland) N51◦5510.8 E17◦0051.7 15 5 HM214522, HM214493 A-9 Dusina (Wielkopolskie region, Poland) N51◦5517.7 E17◦0115.2 40 10 HM214523, HM214501 A-10 Moj˛ecice (Sl˛´ askie region, Poland) N51◦1728.0 E16◦3541.4 40 10 HM214524, HM214502 A-11 Rapaty (Warmińsko-Mazurski region, Poland) N53◦4353.6 E20◦0929.3 40 10 HM214525, HM214503 A-12 Tum (Lódzkie region, Poland) N52◦0322.5 E19◦1357.9 50 10 HM214526, HM214504 A-13 P˛atnów (Lódzkie region, Poland) N51◦0806.3 E18◦3630.7 15 9 HM214527, HM214505 E-1 Dowspuda (Podlaskie region, Poland) N53◦5731.6 E22◦4920.5 150 10 HM214528, HM214506 E-2 Wirów (Podlaskie region, Poland) N52◦2635.7 E22◦3212.3 25 10 HM214529, HM214507 E-3 Nowosielec (Podkarpackie region, Poland) N50◦2523.5 E22◦0754.8 15 7 HM214530, HM214508 E-4 Rokytne (Rivne region, Ukraine) N51◦1659.4 E27◦1229.2 20 7 HM214531, HM214509 E-5 Gubkiv (Rivne region, Ukraine) N50◦4934.1 E27◦0242.2 15 5 HM214532, HM214510 E-6 Olevsk (Zhytomyr region, Ukraine) N51◦1226.0 E27◦3941.0 20 7 HM214533, HM214511 E-7 Pidluby (Zhytomyr region, Ukraine) N50◦5514.6 E27◦4508.3 20 7 HM214534, HM214512

Plants were counted and leaves were sampled at each markers suitable for studying species for which species- locality (Table 1). Additional, two samples of M. moschata specific primers amplifying microsatellite loci (SSR-Simple L. were used as an outgroup based on previous phylogenetic Sequence Repeat) have not yet been developed. Yet con- studies (Garcia et al. 2009). ISSR and ISJ analyses were trary to SSR markers, ISSR primers are complementary to performed on every collected individual, and the sequencing repeated sequences rather than to fragments flanking those of chloroplast regions was carried out on a single individual sequences. More details on ISJ-markers can be found in Saw- from each population. GenBank accession numbers are given icki & Szczecińska (2007). The sequences of ISSR and ISJ in Table 1. primers used for DNA amplification in this study are given in Table 2. Molecular analysis DNA was extracted from 40 mg dry leaf tissue using the ISSR-PCR and ISJ-PCR reactions were performed in DNeasy Plant extraction kit (Qiagen). The isolated DNA 20 µL of a reaction mixture containing 40 ng genomic DNA, ◦ was dissolved in water and stored at −20 C. Two marker 1.0 µM of primer, 1.5 mM MgCl2 , 200 µMeachdATP, categories were used in the analysis of genetic variation: dGTP, dCTP, dTTP, 1× PCR buffer (Sigma, supplied with microsatellite ISSR (Inter Simple Sequence Repeat) mark- polymerase), 1 µL BSA and 1 U Genomic Red Taq poly- ers developed by Zietkiewicz et al. (1994), and ISJ mark- merase (Sigma). ISSR marker reactions were performed un- ers (Weining & Langridge 1991). Similarly to RAPD and der the following thermal conditions: (1) initial denatura- AFLP markers, the target sequence of ISSR and ISJ mark- tion – 5 min at a temperature of 94 ◦C, (2) denaturation – ers does not require prior identification which makes those 1 min at 94 ◦C,(3)annealing–1minat50◦C, (4) elonga- Molecular studies of Malva alcea and M. excisa 1091

Table 2. Sequence of 8 primers successfully used in the ISSR and ISJ analysis and the number of ampliﬁed bands per primer.

Primer Sequence (5’-3’) Number of the ampliﬁed bands Number of polymorphic bands

IS807 (AG)8T1513 IS810 (GA)8T1613 IS813 (CT)8T1613 IS822 (TC)8A76 IS825 (AT)8G1917 IS828 (TG)8A1715 IS831 (ACC)6 16 0 IS834 AT(GAT)5G1815 IS840 ACTTCCCCACAGGTTAACACA 15 15 IS843 CATGGTGTTGGTCATTGTTCCA 17 16 IS846 GGGT(GGGGT)2 G1919 ISJ 2 ACTTACCTGAGGCGCCAC 14 13 ISJ 4 GTCGGCGGACAGGTAAGT 17 14 ISJ 5 CAGGGTCCCACCTGCA 16 15 ISJ 6 ACTTACCTGAGCCAGCGA 14 12

Total 236 196

tion – 1.5 min at 72 ◦C, final elongation – 7 min at 72 ◦C. age of polymorphic loci (P %), the number of alleles per lo- Stages 2–4 were repeated 34 times. The following reaction cus (AE), and genetic diversity (HE). Allele frequency in lo- conditions were applied to ISJ primers: (1) initial denatu- cus was identified in view of band presence or absence. It was ration – 3 min at 94 ◦C, (2) denaturation – 1 min at 94 ◦C, assumed that every observed band resulted from the ampli- (3)annealing–1minat48◦C, (4) elongation – 1.5 min at fication of a single locus, therefore, the number of observed ◦ ◦ 72 C, final elongation – 5 min at 72 C. Stages 2–4 were re- bands corresponded to the number of investigated loci. Only peated 39 times. The products of the ISSR-PCR reaction allele “1” (band present) or allele “0” (band absent) were were separated on 2% agarose gel, and the products of the observed in every locus. Differences in allele frequencies be- ISJ-PCR reaction – on 1.5% agarose gel, followed by DNA tween the investigated populations were determined with staining with ethidium bromide. After rinsing in deionised the use of Statistica 7 (Statsoft, USA). Nei’s unbiased ge- water, agarose gel was analyzed in a transilluminator under netic identity (I) and genetic distance (D) were estimated UV light at a wavelength of 302 nm with the application of for each population pair (Nei 1972). Genetic differentiation the Felix 1010 system. among populations was estimated by Nei’s gene diversity The reproducibility of the ISJ and ISSR markers was statistics (Nei 1973). The amount of gene flow among those checked by randomly selecting 10 samples and amplifying populations was estimated at Nm = (1/Gst – 1)/5 (Slatkin the extracted DNA twice. The error rate was calculated as 1987). The analysis of molecular variance (AMOVA) was the ratio between all differences and all band comparisons used to partition genetic variance within and among species. in ten duplicated ISJ-ISSR profiles (Bonin et al. 2004). The AMOVA analyses were carried out using ARLEQUIN v. 3.0 calculation of the error rate of ISSR and ISJ bands resulted (Excoffier et al. 2006). in seven differences in 1921 comparisons, giving an error rate The correlation between the genetic (D) and geograph- of 0.36%. ical distance (in km) separating the studied populations For the amplification and sequencing of trnH-psbAand was determined by Mantel’s test (Mantel 1967) using AR- rpoC1 we used the primers of Sang et al. 1997 and from LEQUIN v 3.01 (Excoffier et al. 2006) Royal Botanical Garden in Kew website. The chloroplast The neighbor-joining dendrogram was constructed regions were amplified in a volume of 25 µL containing 20 based on the matrix of Nei & Li (1979) genetic distances ◦ mM (NH4)SO4,50mMTris-HCl(pH9.0at25C), 1.5 mM among individuals using PAUP 4 (Swofford 2003). Clade MgCl2,1µL BSA, 200 µM each, dATP, dGTP, dCTP, support for the phenogram was estimated by a bootstrap dTTP, 1.0 µM of each primer, one unit of Taq polymerase analysis with 1000 replicates (Felsenstein 1985). Incongru- (Qiagen) and 1 mL of the DNA solution. The reaction was ◦ ◦ ence between the ISJ and ISSR datasets was assessed by processed at 94 C for 1 min followed by 30 cycles at 94 C comparing clade support on the consensus tree. For exam- for 1 min, 56 ◦C for 1 min, and 72 ◦C for 1.5 min, with a final ◦ ple, if population A was included in clade A with significant extension step of 72 C for 5 min. Finally 5 µL of the ampli- bootstrap support based on ISJ markers, but resolved as a fication products were visualized on 1.5% agarose gel with member of clade B with significant support based on ISSR ethidium bromide staining. Purified PCR products were se- markers, the trees based on these markers were considered quenced in both directions using the ABI BigDye 3.1 Termi- incongruent. nator Cycle Kit (Applied Biosystems) and were then visual- The significance of differences between the studied pop- ized using an ABI Prism 3130 Automated DNA Sequencer ulations with respect to coefficient values was estimated by (Applied Biosystems). an analysis of variance and the LSD test. Principal coordinate analysis (PCO) was performed on the binary data Data analysis matrix using Genalex 6.0. (Peakall & Smouse 2006) to as- Statistical analysis was based on 236 loci. The analyses of sess the dimensionality of data and to describe the major genetic data were performed using PopGene v. 1.32 (Yeh & patterns of variation within and among populations of ana- Boyle 1997) and Arlequin v. 3.01 (Excoffier et al. 2006). The lyzed species. Electropherograms were edited and assembled following parameters were used to estimate genetic diversity using Sequencher 4.5 (Genecodes Inc.). The assembled se- at the population level and at the species level: the percent- quences were aligned manually with BioEdit 7 (Hall 1999). 1092 Z. Celka et al.

Table 3. Genetic diversity of analyzed populations of Malva. Total genetic diversity of M. alcea and M. excisa at the species level; N – the number of ampliﬁed bands per population, P is the percentage of polymorphic loci, AE – the eﬀective number of alleles, HE – Nei’s (1973) gene diversity.

Species Population NP AE HE

M. alcea Teterow 194 37.8 1.233 0.132 Feldberg 160 32.8 1.263 0.142 F¨urstenwerder 196 32.8 1.201 0.117 Slawsko 196 47.9 1.300 0.174 Skwierzyna 176 29.4 1.227 0.124 Daleszyn 1 174 42.0 1.280 0.159 Daleszyn 2 116 16.8 1.111 0.065 Gosty´n 144 32.8 1.178 0.107 Dusina 186 42.0 1.261 0.151 Moj˛ecice 202 48.7 1.307 0.175 Rapaty 196 34.4 1.220 0.125 Tum 196 47.9 1.298 0.174 P˛atnów 182 47.9 1.282 0.170 Species level 232 75.3 1.432 0.246 M. excisa Dowspuda 182 52.1 1.311 0.180 Wirów 196 59.6 1.293 0.170 Nowosielec 168 18.5 1.124 0.071 Rokytne 184 20.2 1.137 0.076 Gubkiv 188 23.5 1.167 0.093 Olevsk 160 22.7 1.150 0.084 Pidluby 190 41.2 1.272 0.153 Species level 234 82.4 1.471 0.270

Total 83.2 1.450 0.259

Table 4. Hierarchical analysis of molecular variance (AMOVA) for populations of Malva alcea and M. excise.

Source of variance d.f. Sum of squares Variance component Total variation (%) P -valuea

Among species 1 48.48 0.00 0.00 0.001 Among populations 18 982.2 5.93 39.00 0.001 Within populations 134 1248.2 9.315 61.00 0.001 aSigniﬁcance tests after 1,000 permutations

Gaps were excluded from all phylogenetic analyses. Max- (IS825-1 and IS825-5), but the occurrence frequency of imum parsimony (MP) analyses of the sequenced regions those alleles was very low, within the range of 0.032 to were conducted using PAUP 4.0b10 (Swofford 2003), em- 0.063. Bands occurring only within a given species but ploying heuristic searches with 1000 random addition repli- showing polymorphism at the intra-specific level were cates and TBR branch swapping. The statistical significance considered to be private allels. of clades within inferred trees was evaluated using the boot- The investigated taxa also showed minor differ- strap method (Felsenstein 1985) with 1000 replicates. ences as regards their genetic variation. M. alcea proved to be slightly less genetically diverse than M. excisa. Results Genetic variation parameters for M. alcea and M. excisa reached P = 75.3, AE = 1.432, HE = 0.246 and Genetic differentiation between M. alcea and M. excisa P = 82.4, AE = 1.471, HE = 0.270, respectively. The The performed analysis did not reveal statistically sig- above findings can be attributed to minor differences in nificant differences at the level of genetic diversity be- allele frequencies observed between populations of each tween M. alcea and M. excisa populations. Both species species. In addition to private alleles, statistically sig- were characterized by a very similar number of ampli- nificant differences in allele frequencies were reported fied loci which reached 232 and 234, respectively (Ta- in only 18 loci. ble 3). The average value of genetic identity between The results of the AMOVA analysis demonstrated M. alcea populations and between M. excisa popula- that the greatest variability coincided with intra- tions was 0.830 and 0.860, respectively. Genetic identity population variability (61%), while there were no differ- between the above species reached I = 0.985. The ap- ences between the studied taxa (Table 4). The absence plied DNA markers did not permit the molecular iden- of differences between M. alcea and M. excisa was also tification of the studied species. None of the 236 ampli- confirmed by the neighbor-joining grouping method fied bands proved to be species-specific. M. alcea was (Fig. 2), based on the Nei’s genetic distance. Popula- characterized by 4 private alleles (IS825-17, IS825-21, tions representing both taxa did not generate two sep- IS828-8 and ISJ5-4), and M. excisa – by 2 private alleles arate clusters. The results of the neighbor-joining anal- Molecular studies of Malva alcea and M. excisa 1093

Fig. 2. Phenogram based on Nei’s (1972) genetic distance for the analysed populations of Malva alcea and M. excisa, based on ISSR and ISJ markers. Bootstrap support values are given above branches.

Fig. 3. Principal coordinates analysis of Malva alcea and M. excisa populations. ysis were complementary with the data obtained in the producing an average of 15.7 bands per primer. The PCO analysis (Fig. 3). highest effectiveness in terms of the number of revealed loci was reported in respect of two ISSR primers: IS825 Molecular diversity within populations and IS846, which revealed 19 loci each, while the small- An analysis of the genetic diversity of 15 M. alcea and est number of loci (7) was amplified by primer IS822 7 M. excisa populations performed with the application (Table 2). of ISSR and ISJ markers revealed a total of 236 loci, The applied markers proved to be relatively poly- 1094 Z. Celka et al. morphic in reference to the investigated species. 83% Mantel’s test did not reveal any correlations (P < 0.05 of 236 amplified loci were polymorphic. However, the r = −0.204) between the geographical and genetic dis- studied populations differed significantly as regards the tance separating the studied populations. The highest number of revealed loci and their polymorphism. The genetic distance (0.316) was observed between the sam- Moj˛ecice population was characterized by the largest ples from Skwierzyna and the Daleszyn 2 population number of bands (202), while the smallest number of which were not separated by the longest geographic bands (116) was amplified for the Daleszyn 2 popula- distance. The genetic distance between two most ge- tion. The highest number of polymorphic loci in the ographically isolated populations was 0.241. studied M. alcea and M. excisa populations was revealed in the Wirów population (59.6%), while the low- Grouping of individuals est polymorphism values (18.6%) were noted in the Based on the NJ analysis, the majority of individuals Daleszyn 2 population. Molecular diversity calculated were grouped according to their population classifica- based on polymorphic ISSR and ISJ bands was relation (Fig. 4). Only populations A-7 and A-8 formed a tively high at AE = 1.45, HE = 0.259 (Table 3). The common, undeveloped clade. Several populations could analyzed populations differed significantly as regards be easily divided into subpopulations. This was partic- the value of genetic diversity parameters. The Daleszyn ularly noticeable in population A-13 whose represen- 2 population and the Rokytne and Nowosielec popula- tatives formed two different groups. A less clear-cult tions were characterized by a low level of genetic di- division into subpopulations was noted in populations versity (AE = 1.11, HE = 0.064) and the following ge- A-9 and E-2. Similarly as in the analysis at the popu- netic diversity parameters were reported: AE = 1.13, lation level, M. alcea and M. excisa individuals did not HE = 0.076; AE = 1.24, HE = 0.712, respectively. form separate groups. The highest level of genetic diversity was observed in respect of the Dowspuda population (AE = 1.311, Sequence data of chloroplast regions HE = 0.180). The genetic diversity level determined for The length of the trnH-psbA region ranged from 498 bp each studied population was correlated with population in M. alcea and M. excisa to 508 bp in M. moschata.Ex- size (r = 0.75, P > 0.05) cept for one sample of M. excisa from Gubkiv (one dele- tion of T), no variation was found among the analyzed Molecular differentiation between populations individuals of M. alcea and M. excisa. Samples of those An analysis of the genetic diversity of M. alcea and M. species differ from the M. moschata outgroup with re- excisa populations has shown that 61% of the observed spect to 10 substitutions and 17 indels. The length of variation accounts for inter-population diversity and the rpoC1 gene ranged from 672 to 674 bp. Two in- 39% for intra-population diversity. The number of mi- del positions were found in M. alcea and M. excisa, but grants calculated based on the GST coefficient was low, they did not correspond to their taxonomical affiliation. at Nm = 0.409. The high proportion of inter-population Only one substitution was found in a sample of M. ex- diversity in the investigated species is due mostly to cisa from Rokytne (Ukraine), and M. moschata differed differences in allele frequency noted between particular from M. alcea and M. excisa in terms of one fixed substi- populations. Statistically significant differences were re- tution. Since no parsimony-informative sites were found ported in respect of around 80% of the analyzed alle- in M. alcea and M. excisa populations, the Maximum les. The analyzed populations were characterized by a Parsimony phylogenetic tree is not presented. low share of high-frequency alleles which were found in 50% and more of the studied populations. The highest Discussion share of the above alleles was observed in the Gubkiv and Fürstenwerder populations (32 alleles), while only The results of this experiment do not validate the 2 high-frequency alleles were found in the Olevsk and taxonomic distinctness of M. alcea and M. excisa. Daleszyn 2 populations. The remaining populations had The obtained genetic identity values (I = 0.985) do from 6 to 20 such alleles. The experiment revealed prac- not support the identification of eastern populations tically no alleles which were specific to a given popu- as a distinct biological species. Similar results were lation and were absent from other populations. Only 6 reported by Dodd & Helernum (2006) for two sub- private bands were noted in the total number of 236 species of Delphinium variegatum Torrey & A. Gray.: revealed loci. Two specific bands were characteristic of sspthornei Munz and ssp. kinkiense (Munz) M. J. the Wirów population, while the Moj˛ecice and Feldberg Warnock (I = 0.997), and by Godt & Hamrick (1999) populations had two private bands each. for two subspecies of Saracenia rubra: ssp. rubra Walter Genetic differences between the analyzed popula- and ssp. alabamensis (Case & Case) Schnell (I = 0.900). tions were also validated by the average genetic iden- The genetic identity index, calculated based on DNA tity index which reached I = 0.828. The lowest degree markers, should be less than 0.7 for distinct biologi- of genetic identity (I = 0.729) was noted between the cal species (Zieliński & Polok 2005). Subject to the ap- Daleszyn 2 population and the Skwierzyna population, plied DNA markers, genetic identity values for Polygo- while the Feldberg and P˛atnów populations proved to natum Mill. (Solomon seal) species of the section Odor- be most similar (I = 0.959). ata ranged from 0.25 to 0.72, with an average of 0.57 A statistical analysis performed with the use of (Szczecińska et al. 2006). Similar results were reported Molecular studies of Malva alcea and M. excisa 1095

Fig. 4. Neighbor-joining phenogram of the ISJ-ISSR phenotypes of individuals from populations of Malva alcea and M. excisa. Bootstrap values are given above supported branches. in an analysis of species of the genus Pistacia L. per- which testifies to the absence of significant differences formed with the use of AFLP markers, where genetic between those taxa. In most cases, even closely re- identity between species pairs ranged from 0.34 to 0.76 lated species have marker alleles. As regards P. multi- (Kafkas 2006). Species of the genus Orobanche L., an- florum (L.) All and P. odoratum (Mill.) Druce, closely alyzed with the application of RAPD markers, showed related species of the genus Polygonatum,thenumber genetic identity values in the range of 0.39 to 0.92, but of species-specific markers ranged, subject to the ap- species-specific bands were determined even in the most plied marker class, from 12 (ISJ markers) to 30 (RAPD closely related species of O. aegyptiaca Pers. and O. cre- markers), accounting for more than 22% of all amplified nata Forssk. (Paran et al. 1997). loci (Szczecińska et al. 2006). An even higher number of The observed genetic identity parameters were also marker bands were determined in an analysis of sibling validated by neighbor-joining grouping where M. alcea species of the liverwortAneura pinguis (L.) Dumort., and M. excisa populations did not form corresponding where as many as 41 of the 112 analyzed bands sup- clusters, thus pointing to an absence of significant dif- ported molecular identification of each cryptic species ferences between the two taxa. (B˛aczkiewicz et al. 2008). As regards the analyzed mal- Even in very closely related species of the genus low species, only 6 private alleles were found, but the Sphagnum L., which were characterized by a very high frequency of their occurrence in particular populations degree of genetic identity (Cronberg 1996; Cronberg were low. Molecular markers which enable identifica- 1998; Sawicki & Zieliński 2008) and where no differences tion of a given taxon are often found also for taxonomic in the analyzed DNA sequences were found (Shaw & ranks below the species level. Cox 2005), populations of particular species were iden- Species at an early stage of divergence often do tified by UPGMA grouping (Sawicki & Zieliński 2008). not have specific alleles. The frequency of particular True taxonomic species usually have specific molec- alleles may differ in taxa at an early stage of specia- ular markers that allow their molecular identification. tion. Despite a high degree of genetic identity and the Species-specific markers supporting the molecular iden- absence of specific markers, the good botanical species tification of M. alcea and M. excisa were not found, of Lolium perenne L. and L. multiflorum Lam. differed 1096 Z. Celka et al. significantly with respect to both allele frequency in the be characterized by simple (unibranched), bifurcate (2- analyzed loci and a significant number of private alleles branched) and stellate (multi-branched, multicellular) (Polok 2005). The above requirement was not met by hairs. Stellate hairs vary in the number of branches M. alcea and M. excisa, either. A statistical analysis (from three to ten). A hair analysis of 18 M. alcea pop- revealed significant differences in the frequency of only ulations from Central and Eastern Europe has shown 28 alleles, including private alleles, which raises serious that simple, bifurcate and stellate hairs cover the stem doubts as regards the taxonomic status of M. excisa. in all studied populations. Simple and bifurcate hairs An analysis of the sequences of chloroplast regions were more frequently observed in the lower parts of trnH-psbAandrpoC1 did not enable the molecular the stem, while stellar hairs occurred mainly in the identification of M. alcea and M. excisa, although the upper section of the stem (Celka, personal communi- analyzed cpDNA regions are among the most variable cation). The Principal Coordinate Analysis of hairs in in the plant world (Newmaster et al. 2008; Erickson et the upper and lower parts of the stem has revealed that al. 2008) and have been widely used as plant barcodes specimens from the majority of the investigated popu- (Edwards et al. 2008; Sawicki et. al. 2009). The trnH- lations belong to a single, large group, while differences psbAandtrnL-F spacers were the most variables chloro- were noted in respect of several specimens from vari- plast sequences in phylogenetic studies of the genus ous populations. Two main groups were determined in Malva, which did not include M. excisa (Garcia et al. the graphic representation of the Manhattan difference, 2009). Despite the absence of differences between M. computed by Ward’s method, but specimens from dif- alcea and M. excisa, both analyzed regions supported ferent populations and various geographic regions were the molecular identification of M. moschata which is intermixed in each group (Celka, personal communica- closely related to M. alcea (Garcia et al. 2009). The tion). present sequencing results correspond to those obtained The performed molecular analyses and the results using genome-scan markers, and provides further ev- of previous morphological studies investigating the di- idence that M. alcea and M. excisa share a common versity of corolla petals and stem hairs did not re- gene pool. veal significant differences between Malva alcea and The results of this experiment are consistent with populations termed as M. excisa. M. alcea is consid- the findings of previous taxonomic studies investigat- ered a highly diverse species (Walas 1959; Dalby 1968; ing M. alcea and M. excisa. A mere analysis of varia- Hlavaček 1982; Slavík 1992), but its different forms are tions in corolla petals and hairs does not support the not geographically or ecologically correlated. The above identification of two distinct species of M. alcea and can be attributed to the fact that M. alcea was a cul- M. excisa in Central and Eastern Europe (Celka et al. tivated species in the past, with a tendency to prop- 2006, 2007). The key characteristics that differentiate agate to anthropogenic habitats in both Medieval and M. alcea and M. excisa are the depth of corolla petal contemporary times. The conducted genetic and mor- incisionsandthetypeofhairscoveringthestem.The phological analyses clearly indicate that the name M. apex of corolla petals has a deep, single or double inci- excisa should be treated as a synonym of M. alcea,and sion in M. excisa, while a shallow and gentle incision is not as a separate taxonomic unit. characteristic of M. alcea (Walas 1959; Iľin 1974). Stud- ies investigating variations in corolla petals of Central and East European mallows have shown that the in- Acknowledgements vestigated attributes (the length and width of petals, The authors would like to thank Maria Drapikowska, PhD the length from the petal base to the incision point, for her help in collecting materials. Scientific work was fi- the depth of incision, the ratio of petal length to inci- nanced from the resources earmarked for science in years sion depth) are complementary in those populations. 2005–2008 as the Research Project No. 2 P04G 050 29. Some East European mallow specimens and populations are more similar to Central European populations than to those found in the Ukraine. The ratio of petal References length to incision depth, which should be the highest for the Ukrainian population (M. excisa), reached its maxi- Adler W., Oswald K. & Fischer R. 1994. Exkursionsflora von Osterreich.¨ Verlag Eugen Ulmer, Stuttgart und Wien, 1180 mum value in reference to the Central European mallow pp. (Celka et al. 2007). The other key attribute differenti- Ascherson P. & Graebner P. 1898–1899. Flora des Nordost- ating the two species is the presence of hairs along the deutschen Flachlandes (ausser Ostpreussen). Verlag von entire stem (Walas 1959; Iľin 1974) or only in its upper Gebrüder Borntraeger, Berlin, xii+875 pp. part (Tzvelev 2000). The stem of M. excisa is covered Bates D.M. 1968. Generic relationships in the Malvaceae, tribe Malveae. Gentes Herbarum 10: 117–135. with only stellate hairs (small, with clinging branches B˛aczkiewicz A., Sawicki J., Buczkowska K., Polok K. & Zieliński and large, with protruding branches), while the stem of R. 2008. Application of different DNA markers in studies on M. alcea features unifurcate, bifurcate and trifurcate cryptic species of Aneura pinguis (Hepaticae, Metzgeriales). hairs (with long branches) and tufted-stellate hairs. Cryptogamie Bryologie 29: 3–21. Studies investigating hair types (Celka et al. 2006) have Bonin A., Bellemain E., Bronken Eidesen P., Pompanon F., Brochmann C. & Taberlet P. 2004. How to track and assess shown that in accordance with the plant hair termi- genotyping errors in population genetic studies. Mol. Ecol. nology proposed by Payne (1978), mallow plants may 13: 3261–3273. Molecular studies of Malva alcea and M. excisa 1097

Celka Z., Drapikowska M., Buczkowska K., B˛aczkiewicz A. & Garcke A. 1972. Illustrierte Flora Deutschland und angrenzende Marciniak J. 2006. Morphological variability of Malva alcea Gebiete. Verlag Paul Parey, Berlin und Hamburg, 1607 pp. L. populations from Poland. Scrip. Fac. Rer. Natur. Univ. Garcia P.E., Schonswetter P., Aquilar J.F., Feline G.N. & Ostrav. 163: 159–165. Schneeweiss G.M. 2009. Five molecular markers reveal exten- Celka Z., Drapikowska M., Ogrodowicz K., Shevera M.V. & sive morphological homoplasy and reticulate evolution in the Szkudlarz P. 2007. Differentiation of petals in the Malva alcea Malva alliance (Malvaceae). Mol. Phyl. Evol. 50: 226–239. populations from the region of Central and Eastern Europe. Godt M.J.W. & Hamrick J.L. 1999. Genetic divergence among Biodiv.Res.Conserv.5–8: 17–24. infraspecific taxa of Sarracenia purpurea. Syst. Bot. 23: 427– Celka Z., Buczkowska K., B˛aczkiewicz A. & Drapikowska M. 438. 2010a. Genetic Differentiation Among Geographically Close Gunnarsson U., Hassel K. & Soderstrom L. 2005. Genetic struc- Populations of Malva alcea. Acta Biol. Cracov. Ser. Bot. ture of the endangered peat moss Sphagnum angermanicum 52(2): 32–41. in Sweden: a result of historic or contemporary processes? Celka Z., Szczecińska M. & Sawicki J. 2010b. Genetic relation- Bryologist 108: 194–203. ships between some of Malva species as determined with ISSR Hall T.A. 1999. BioEdit: a user-friendly biological sequence align- andISJmarkers.Biodiv.Res.Conserv.19: 23–32. ment editor and analysis program for Windows 95/98/NT. Chase M.W. & Hillis H.H. 1991. Silica gel: an ideal material for Nucl.Acids.Symp.Ser.41: 95–98. field preservation of leaf samples for DNA studies. Taxon 40: Hegi G. 1925. Malvaceae. In: Illustrierte Flora von Mitteleuropa. 215–220. J. F. Lehmanns Verlag, München 5: 453–498. Cronberg N. 1996. Isozyme evidence of relationships within Hermann F. 1956. Flora von Nord- und Mitteleuropa. Gustav Sphagnum sect. Acutifolia (Sphagnaceae, Bryophyta). Pl. Fischer Verlag, Stuttgart. 203: Syst. Evol. 41–64. Heß H.E., Landolt E. & Hierzel R. 1970. Flora der Schweiz und Cronberg N. 1998. Population structure and intraspecific differ- angrenzender Gebiete. Band 2: Nymphaeaceae bis Primu- entiation of the peat moss sister species Sphagnum rubellum laceae. Birkhäuser Verlag, Basel und Stuttgart, 956 pp. and S. capillifolium (Sphagnaceae) in northern Europe. Pl. Hlavaček A. 1982. Malvaceae Juss. Slezovité. In: Futák J. & 209: Syst. Evol. 139–158. Bertová L. (eds), Flora Slóvenska. VEDA, vydavateľstvo ´ Cwikliński E. & Glowacki Z. 2000. Atlas florystyczny Doliny Slovenskej akadémie vied, Bratislava 3: 372–405. Bugu. Rozmieszczenie ro´slin naczyniowych. In: Faliński ´ Hultén E. & Fries M. 1986. Atlas of North European vascular J.B., Cwikliński E. & Glowacki Z. (eds), Atlas geobotan- plants. North of the Tropic of Cancer. I-III. Koeltz Scientific iczny Doliny Bugu. Phytocoenosis 12(N.S.) Suppl. Cartogr. Books, Königstein, xvi+1172 pp. 12: Geobot. 73–316. Iľin M.M. 1974. Family C. Malvaceae Juss. In: Shishkin B.K. Dalby D.H. 1968. Malva L. pp. 249–251. In: Tutin T.G., Hey- & Bobrov E.G. (eds), Flora of the U.S.S.R. Izdateľstwo wood V.H., Burges N.A., Moore D.M., Valentine D.H., Wal- Akademii Nauk SSSR, Moskwa-Leningrad, Israel Program for ters S.M. & Weeb D.A. (eds), Flora Europea. Rosaceae to Scientific Translations, Jerusalem 15: 21–127. Umbelliferae. Cambridge University Press, Cambridge. Jundzill B.S. 1791. Opisanie ro´slin w prowincyi W. X. L. natu- De Langhe J-E., Delvosalle L., Duvigneaud J., Lambinon J. & ralnie rosn˛acych wedlug ukladu Linneusza. W Drukarni J.K. Van den Berghen C. 1978. Nouvelle Flore de la Belgique, du Mci y Rzeplitey u XX. Piarów, 584 pp. Grand-Duché de Luxemburg, du Nord de la France et des Ré- Kafkas S. 2006. Phylogenetic analysis of the genus Pistacia by gions voisines (Ptéridophytes et Spermatophytes). Edition du AFLP markers. Pl. Syst. Evol. 262: 113–124. Patrimoine du Jardin botanique national de Belgique. Meise, Kluk K. 1805–1811. Dykcyonarz ro´slinny. Warszawa: Drukarnia 900 pp. Xi˛e˙zy Piarów, 214+156+196 pp. Didukh Ya. P. (ed.) 2010. Ecoflora of Ukraine. Kyiv, M. G. Kholodny Institute of Botany, 442 pp. Liu X-Q., Gituru R.W. & Chen L-Q. 2007. Genetic variation in the endangered fern Adiantum reniforme var. sinense (Adi- Dodd S.C. & Helenurm K. 2002. Genetic diversity in Delphinium antaceae) in China. Ann. Bot. Fenn. 44: 25–32. variegatum (Ranunculaceae): A comparison of two insular endemic subspecies and their widespread mainland relative. Lukasiewicz A. 1962. Morfologiczno-rozwojowe typy bylin. PTPN, 27: Am.J.Bot.89: 613–622. Prace Kom. Biol. 1–399. Dogan B., Duran A. & Hakki E.E. 2007. Phylogenetic analysis Majorov S.R. 2006. Malvaceae, pp. 361–364. In: Maevski˘ı of Jurinea (Asteraceae) species from Turkey based on ISSR P.F.(ed.), Flora sredne˘ı polosy evrope˘ısko˘ı chasti Rossii. amplification. Ann. Bot. Fenn. 44: 353–358. Moskva: Tovarishchestvo nauchnykh izdani˘ıKMK. Dostál J. 1989 Nová květena ČSSR, 2. Academia, Praha, Mabberley D.J. 1997. The plant-book. Cambridge University 1548+viii pp. Press, Cambridge, 858 pp. Edwards D., Horn A., Taylor D., Savolainen V. & Hawkins Mantel N. 1967. The detection of disease clustering and general- 27: J.A. 2008. DNA barcoding of a large genus, Aspalathus L. ized regression approach. Cancer. Res. 209–220. (Fabaceae). Taxon 57: 1317–1327. Marcin of Urz˛edów. 1595. Herbarz Polski. Drukarnia Lazarzowa, El Naggar S.M. 2001. Systematic implications of seed coat sculp- Kraków. ture in Malvaceae. Pak. Biol. Sci. 4: 822–828. Matuszkiewicz W. 2001. Przewodnik do oznaczania zbiorowisk Ellenberg H. 1978. Vegetation Mitteleuropas mit den Alpen in ro´slinnych Polski. In: Faliński J. B. (ed.). Vademecum Geob- ökologischer Sicht. Verlag Eugen Ulmer, Stuttgart, 981 pp. otanicum, 3. Wyd. Nauk. PWN, Warszawa, 537 pp. . Erickson D.L., Spouge J., Resch A., Weigt L.A. & Kress W.J. Mirek Z., Pi˛eko´s-Mirkowa H., Zaj˛ac A. & Zaj˛ac M. 2002. Flow- 2008. DNA barcoding in land plants: developing standards ering plants and pteridophytes of Poland. A checklist. In: to quantify and maximize success. Taxon 57: 1304–1316. Mirek Z. (ed), Biodiversity of Poland, 1. W. Szafer Institute Excoffier L., Guillaume L. & Schneider S. 2006. Arlequin ver. of Botany, Polish Academy of Sciences, Kraków. 442 pp. 3.11: an integrated software package for population genetics Mossberg B., Stenberg L. & Ericsson S. 1995. Gyldendals store data analysis. Computational and Molecular Population Ge- nordiske flora. Gyldendal norsk vorlag, Oslo, 695 pp. netic Lab, University of Berne, Berne. Mosyakin S.L. & Fedoronchuk M.M. 1999. Vascular plants of Felsenstein J. 1985. Confidence limits on phylogenies: An ap- Ukraine a nomenclatural checklist. M. G. Kholodny Institute proach using the bootstrap. Evolution 39: 783–791. of Botany, Kiev, 346 pp. Fijalkowski D. 1994. Flora ro´slin naczyniowych Lubelszczyzny. Nei M. 1972. Genetic distance between populations. Am. Nat. Lubel. Tow. Nauk., Lublin, 389 pp. 106: 238–292. Furmanowa M., Michalska Z., Parczewski A. & Zar˛ebska I. 1959. Nei M. 1973. Analysis of gene diversity in subdivided populations. Lecznictwo renesansowe w Polsce na podstawie “Herbarza” Proc. Natl. Acad. Sci. USA 70: 3321–3323. Marcina z Urz˛edowa. Studia i Materialy z Dziejów Nauki Pol- Nei M. & Li W-H. 1979. Mathematical model for studying genetic skiej. Seria B – Historia nauk biologicznych i medycznych 2: variation in terms of restriction endonucleases. Proc. Natl. 233–313. Acad. Sci. USA 76: 5269–5273. 1098 Z. Celka et al.

Newmaster S.G., Fazekas A.J., Steeves R.A.D. & Janovec J. 2008. Slavík B. 1992. Malvaceae Juss. slézovité. In: Hejný S. & Slavík Testing candidate plant barcode regions in the Myristicaceae. B. (eds), Květena České Republiky. Academia, Praha 3: 282– Mol. Ecol. Res. 8: 480–490. 316. Nowiński M. 1983. Dzieje upraw i ro´slin leczniczych. Państwowe StatSoft Inc. 2003 STATISTICA (data analysis software system), Wyd. Rolnicze i Le´sne, Warszawa, 332 pp. version 6. www.statsoft.com. Olyanitskaya L.G. 1999. Malvaceae, pp. 141–143. In: Prokudin Stummer B.E., Zanker T. & Scott E.S. 2000. Genetic diversity Yu.N., Dobrochaeva D.N., Zaverukha B.V., Chopik V.I., Pro- in population Uncinula necator: comparison of RFLP- and topova V.V. & Kpitskaya L.I. (eds), Opredeliteľ vysshikh ras- PCR-based approaches. Mycol. Res. 104: 44–52. teni˘ı Ukrainy. M G Kholodny Institute of Botany of the Na- Swofford D.L. 2003. PAUP: Phylogenetic Analysis Using Parsi- tional Academy of Sciences of Ukraine, Kyiv. mony (and Other Methods) (Sinauer, Sunderland, MA), 4.0 Olyanitskaya L.G., Tzvelev N.N. 1996. Malvaceae, pp. 231–255. Beta. In: Tzvelev N.N. (eds), Flora Europae Orientalis. Mir i Semia Syreniusz 1613. Zielnik Simona Syrenniusa z 1613 r. www.zielnik- Petrokoli. syrenniusa.art.pl. (accessed 12.09.2009). O˙zarowski A. 1982. Ro´sliny lecznicze stosowane w fitoterapii, pp. SzczecińskaM.,SawickiJ.,PolokK.,Holdyński Cz. & Zieliński 44–282. In: O˙zarowski A. (ed.), Ziololecznictwo. Państwowy R. 2006. Comparison of the Polygonatum species from Poland Zaklad Wyd. Lekarskich, Warszawa. on the basis of different DNA markers. Ann. Bot. Fenn. 43: Paran I., Gidoni D. & Jacobsohn R. 1997. Variation between and 379–388. within broomrape (Orobanche) revealed by RAPD markers. Szczecińska M., Sawicki J., W˛asowicz K. & Holdyński Cz. 2009. Heredity 78: 68–74. Genetic variation of the relict and endangered populations of Payne W.W. 1978. A glossary of plant hair terminology. Brittonia Chamaedaphne calyculata (Ericaceae) in Poland. Dendrobi- 30: 239–255. ology 62: 23–33. Peakall R. & Smouse P.L. 2006. GENALEX 6: genetic analysis in Tate J.A., Fuertes Aguila J., Wagstaff S.J., La Duke J.C., Bodo Excel. Population genetic software for teaching and research. Slotta T.A. & Simpson B.B. 2005. Phylogenetic relationships Mol. Ecol. Not. 6: 288–295. within the tribe Malveae (Malvaceae, subfamily Malvoideae) Plášek V. & Sawicki J. 2010. Is the hairy vaginula an diagnostic as inferred from ITS sequence data. Am. J. Bot. 92: 584–602. feature in the taxonomy of the genus Orthotrichum?Acta Tzvelev N.N. 2000. Manual of the vascular plants of north-west Soc. Bot. Pol. 79: 73–80. Russia (Leningrad, Pskov and Novgorod provinces). State Polok K. 2005. Evolutionary status of close related Lolium L. Chemical-Pharmaceutical Academy Press, St.-Petersburg, taxa, pp. 37–56. In: Prus-GlowackiW.&PawlaczykE.(eds), 781 pp. Variability and Evolution – New Perspectives. Adam Mick- Walas J. 1959. Malvaceae, Slazowate,´ pp. 278–301. In Szafer W. & iewicz University Press, Poznań. Pawlowski B. (eds), Flora polska. Ro´sliny naczyniowe Polski Rakhmetov D.B. 2000. Kormovye maľvy v agrofitotsenozakh iziemo´sciennych. PWN, Warszawa. lesostepi Ukrainy: introduktsiya, biologiya, sorta, vozdely- Weining S. & Langridge P. 1991 Identification and mapping of vanie. Kyiv, Fitosotsiotsentr, 288 pp. polymorphisms in cereals based on polymerase chain reaction. Ray M.F. 1995. Systematics of Lavatera and Malva (Malvaceae, Theor. Appl. Genet. 82: 209–216. Malveae) – a new perspective. Pl. Syst. Evol. 198: 29–53. wyrtig.com. Plants Listed in Six 9th and 10th Century Medieval Ray M.F. 1998. New Combinations in Malva (Malvaceae: Manuscripts. http://wyrtig.com/Early%20Plants/ Malveae). Novon 8: 288–295. PlantsInMSS.htm (accessed 28.04.2012). Rothmaler W., Jäger E.J. & Werner K. 2005. Exkursionsflora von Vanderpoorten A., Hedenas L. & Jacquemart A-L. 2003. Differen- Deutschland. Band 4 Gefäßpflanzen: Kritischer Band. Else- tiation in DNA fingerprinting and morphology among species vier, Spektrum Akademischer Verlag, Heidelberg, 980 pp. of the pleurocarpous moss genus, Rhytidiadelphus (Hylocomi- Rutkowski L. 2004. Klucz do oznaczania ro´slin naczyniowych Pol- aceae). Taxon 52: 229–236. ski ni˙zowej. Wyd. Nauk. PWN, Warszawa, 814 pp. Yeh F.C. & Boyle T.J.B. 1997. Population genetic analysis of Sawicki J., Szczecińska M., Korniak T. & Holdyński Cz. 2006. codominant and dominant markers and quantitative traits. Genetic variation within and between an isolated popula- Belg. J. Bot. 129: 157. tion of Phyteuma spicatum L. ssp. coeruleum R. Schulz near Zaj˛ac A. 1979. Pochodzenie archeofitów wyst˛epuj˛acych w Polsce. Mr˛agowo (northeastern Poland) and populations of P. spica- Rozprawy habil. UJ 29: 1–213. tum L. ssp. spicatum. Biodiv. Res. Conserv. 1–2: 50–53. Zarzycki K., Trzcińska-Tacik H., Ró˙zański W., Szel˛ag Z., Wolek J. Sawicki J. & Szczecińska M. 2007. Semi-specific intron-exon splice & Korzeniak U. 2002. Ecological indicator values of vascular junction markers in bryophyte studies. Biodiv. Res. Conserv. plants of Poland. In: Mirek Z. (ed.), Biodiversity of Poland, 5–6: 25–30. 2. W. Szafer Institute of Botany, Polish Academy of Sciences, Sawicki J. & Zieliński R. 2008. Phylogenetic relationships be- Kraków, 183 pp. tween five Sphagnum species of the section Acutifolia Based Zieliński R. & Polok K. 2005. Molecular evolution and taxonomy on DNA markers. Cas. Slez. Muz. Opava. 57: 63–80. of plants, pp. 37–56. In: Prus-Glowacki W. & Pawlaczyk E. Sawicki J., Plášek V. & Szczecińska M. 2009. Molecular evidence (eds), Variability and Evolution – New Perspectives. Adam do not support the current division of Orthotrichum subgenus Mickiewicz University Press, Poznań. Gymnoporus. Pl. Syst. Evol. 279: 125–137. Zietkiewicz E., Rafalski A. & Labuda D. 1994. Genomic fin- Sawicki J., Plášek, V. & Szczecińska M. 2010. Molecular studies gerprinting by simple sequence repeat (SSR)-anchored poly- resolved Nyholmiella (Orthotrichaceae) as separated genus. merase chain reaction amplification. Genomics 20: 176–183. J. Syst. Evol. 48: 183–194. Zubkevich G.I. 1999. Malvaceae Juss., pp. 133–135. In: Parfenov Shaw A.J. & Cox C.J. 2005. Variation in “biodiversity value” V.I. (ed.), Opredeliteľ vysshikh rasteni˘ı Belarusi. Izdatel‘stvo of peatmoss species in Sphagnum section Acutifolia (Sphag- Diza˘ıi PRO, Minsk. naceae). Am. J. Bot. 92: 1774–1783. Slatkin M. 1987. Gene flow and the geographic structure of nat- Received November 21, 2011 ural populations. Science 236: 787–792. Accepted May 22, 2012