Percentage methylation F1-Prop-M71 F1-Prop-M71 to acetophenone: t test, P = 0.0158, t = 2.664; OPS to propanol:F0-Ace- t test, (h) MedialPropanol M71 glomerular area in F1 generationDorsal glomerulus (M71-LacZ: F1-Home, = 31; F1-Ace, = 40; F1-Prop, 18 Percentage methylation n n F0-Prop- F1-Home-M71 Percentage OPS to F1-Home-M71 60 Percentage OPS to 60 Acetophenone antibody or that the epigenetic basisglomerular of this inheritance area might in IVF not be offspring (F1-Prop-IVF,Sperm Sperm ( hn) =Medial 23;–100 F1-Ace-IVF, M71 glomerular n = 16; area in F1–100 generation (M71-LacZ: F1-Home,suggest a doublen = 1,00031; dissociation F1-Ace, nand = specificity40; F1-Prop, of the odor association, P = 0.0343, t17 = 2.302). (c–f). F2-Ace-M71 mice whose F0 generation F2-Prop-C57 F2-Ace-C57 = 16;trained ANOVA, F0F2-Prop-C57 < 0.0001,trainedF2-Ace-C57 F0 = 31.68; F1-Home-M71F2-Prop-M71 versus F1-Ace-M71,F2-Ace-M71 < 0.0001; F1-Ace-M71 200 histone based, instead relying on other mechanisms, such as DNA CpG1CpG2 CpG3 CpG4 CpG5CpG6CpG7 CpG8 n P F2,84 P 200 quantitative PCR was performed for the Olfr151 gene. We did not F1-Ace- n = 16; ANOVA, P < 0.0001, F = 31.68; F1-Home-M71 versus F1-Ace-M71, P < 0.0001; F1-Ace-M71 100 test, < 0.001, = 4.083). F1-Prop-(j) Medial M71 glomerular area in 2,84 along with the inheritance of a behavioral sensitivity that is specific Number of M71 OSNs male had been tconditionedP to acetophenonet37 had larger dorsalOlfr151Sperm (overand all medial CpGSperm sites) Olfr151 (individual CpG sites) 100 methylation (as reported above) or non-coding RNA, as has been e f versus F1-Prop-M71,Dorsal P < 0.0001). (i) F1-Ace-M71 mice had a larger number of M71 OSNsNumber of M71 OSNs in the MOE than 0 observe any differencesM71 in histone-mediatedglomeruli33 in the olfactory epigenetic bulb signatures than F2-Prop-M71 mice whose versusall of F1-Prop-M71, them wereF1-Prop-Sperm mated P with< 0.0001). naive females. (i) F1-Ace-M71 Thus, any findings mice hadthat a largerto the F0-conditionednumberh of M71 odor. OSNs in the MOE than 0 demonstrated for the Kit locus . IVF offspring (F1-Prop-IVF, n = 16; F1-Ace-IVF, n = 19; t test,F1-Ace-Sperm P < 0.001, g ef 5,000 around the M71 locus when chromatin was immunoprecipitated Olfr151: odorant* receptor100 F1-Prop-M714,000 and F1-Home-M71**** mice (M71-LacZ: F1-Home, n = 6; F1-Ace, n = 6; F1-Prop, n = 4; ANOVA, F0 generation had been conditioned to propanol.acetophenone Scale100 bar represents at various stages F1-Prop-M71 ofwe gestation obtained increases wereand M71 notF1-Home-M71 glomerular the results * of extrememiceDias &(M71-LacZ: Ressler phenotype 2013 biasing NatureF1-Home, Neuroscienceor a n = To6; furtherF1-Ace, corroborate n = 6; F1-Prop, the enhanced*** n = 4; behavioral ANOVA, sensitivity to the t33 = 5.880). Data are presented as mean s.e.m.*P < 0.05,Medial* with antibodiesDISCUSSION that recognize200 m. histone (g) Dorsal modifications M71 glomerular that either area per- in F2 generation (M71-LacZ: c d 37 P = 0.0001, F2,13 = 18.80; F1-Home-M71 versus4,000 F1-Ace-M71, P < 0.001; F1-Ace-M71 versus F1-Prop-M71, area and preference for acetophenoneP =previously 0.0001, in adolescent existing F offspring = genetic 18.80;. This sensitivity. F1-Home-M71 Both3,000 C57Bl/6J versus and F1-Ace-M71, M71-LacZ F0-conditioned P < 0.001; F1-Ace-M71 odor, we conducted versus an F1-Prop-M71, independent behavioral assay mit (acetylated H3) orF2-Prop, repress (H3trimethyl = 7;** F2-Ace,P < K27)0.01, = to8; transcription*** test,P < < 0.001, 0.0001, **** = 5.926).P < 0.0001. 2,13 Focusing on classical conditioningn in an F0 generationn t before Pconcep- last tstudy13 exemplifies how the olfactory sensitivity and neuroanatomy P < 0.01). Data are presented as21 mean s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. F1-Ace-M71 F1-Prop-M71 (Supplementary Fig. 7). The fact that the M71 locus was not epige- 80 Propanol Dorsal glomerulus 2,000 did notrience immunoprecipitate at the level glomerularof behavior with the andarea relevantneuroanatomy in IVF offspringhistone-modification through (F1-Prop-IVF, subsequent n manipulations= 23; F1-Ace-IVF, of the parentaln = 16; condition between have the occurred strains whenAcetophenone is that the pups the OSNs of the1,000 M71-LacZ mice produce We found that F1-Ace males were able to detect acetophenone at lower trainedPercentage methylation F0 Percentage methylation 60 60 trained F0 F2-Prop-M71 F2-Ace-M71 antibody or that the epigenetic basis of this inheritance might not be Medial glomerulus generations. We foundt test, that P Aversion index –10 ance of these effects. offspringlearning. subjected We conducted to auditorythis cross-fostering fear conditioning study in females acquired, for two consoli- Two mechanismsAversion index could explain how information about the F0- flavors and odors in the mother’s diet during gestation34. In addi- their experimental design. First, paternal diet has been shown to havedated main and purposes.extinguished First, fear we similarly sought to (Supplementary examine whether Fig. these 3a– –15effectsc). wereconditioned odor could be transferred to the subsequently conceived acetophenone,main purposes. not First, necessarily we sought an to increase examine in whether fear to these acetophenone. effects were ** tion, quality of maternal care is transmittedCross-fostering across generations supports in marked inheritance effects on the metabolic ofdated information physiology and extinguished of offspring conceived fear similarly (Supplementary Fig. 3a–15–c). conditioned odor–20 could bemale transferred offspring: to inheritancethe subsequently via the conceived gametes or transmission via a Cross-fostering supports inheritance of information Making any statements about valencespecific specificity to andpaternal the emotional conditioning or could also be inherited via the rodents27. Furthermore, fetal origins of diseases have been proposed after the father’s diet had been manipulatedspecific to7. Second, paternal exposure conditioning to the or could also be inherited via the Our observations of the behavioral and structuralvalue of the changes odor would specific necessitateF0 olfactoryfemale subjecting germ experiencethe F0 line. generation Second, affects to given F1 neuroanatomythe0.01% possibilitymale0.03% offspring:0.06% that mating inheritance withsocial the via route the that gametes is reminiscent or transmission of the transmission via a of maternal care in for a multitude of disordersOur observationsas having their of roots the in behavioral the experience and structuralanti-androgenic changes endocrine specific disruptor female vinclozolin germ line. during Second, embryonic given the possibility that mating with the 0.001% 0.003% 0.006% an appetitive odor-conditioning task. 19 27 of the fetus to the parentalto the environment F0-conditionedto thewhile F0-conditioned odorin utero being35. From retained a gonadal odorin the F2beingsex generation,determination retained and affectsF0 in olfactoryF0fertility the conditioned F2 and generation, behavior experience male in atin least some and four Previouslyaffects way F0altered conditioned F1 maternal neuroanatomy, we reported behavior male toward inthat some the waybehavioral alteredAcetophenonesocial response maternal concentration route (increased behaviorthat is reminiscent toward Propanolrodents concentration of the. To transmission begin to dissociate of maternal these two care possibilities, in we conducted In the F019 generation, we previously reported that olfactory fear 27 chemosensory perspective,the persistence anti-predatory of the behavior structural is transmitted effects after subsequent IVF, argue generations, against social andPreviously it is subsequentlyassociated with, weborn epigenetic reported offspring, changes weFPS that wanted to the acetophenone)to behavioral account for any response differences of F0-Ace (increased Figure conditioned 2 Sensitivity rodents of malesF1 males. To istoward complebegin F0-conditioned to- dissociateexperiments odor. Association these with two thepossibilities, F2 generation we conducted and with IVF-derived mice. Naive the persistence of the structural effects after conditioningIVF, argue2,9,39 adult against males social to acetophenone subsequently increases born FPS when offspring, the we wanted to account for any differences from gravid female cricketstransmission to their offspring and make when a strongthe females case are for transgenerationalin the sperm of descendant inherit male- inoffspring maternal investment. A recent study or information used transfer about the conditioned time with either the concentration of odor on the x axis or an empty 36 FPS to acetophenone) ofmented F0-Ace by conditioned an increase 19 in males the number is comple of acetophenone–responsive- experiments with the F2 generationF1 males (F1-Ace, and with F1-Prop) IVF-derived were mice.mated Naive with naive females to gener- exposed to a high densityance. of a Notably,predatortransmission our. Finally, results indirectly are highly andrelated specificmake to a social ina thestrong defeat olfactory procedure case sensory for in mice transgenerational startle odorand found thatstimuli paternalmight are result transmissionpaired inherit from with our of-acetophenone conditioningin maternal presentation protocol. investment. In the or informationchamber was recorded. transfer An aboutaversion theindex conditioned was computed by subtracting our study is a report that supplementing the mouse maternal diet with depressive-like behavior in subsequently conceived adult offspring. modality towardance. the Notably,F0-conditioned our odor,results and areboth highly F0-Ace specificand F0-mentedF1 in generation,We the byfound olfactory an that, increasewe similarfound sensory that toin the theM71-expressingC57Bl/6J situation numberodor F1-Ace in that which of micemight acetophenone–responsive the OSNs F0(F1-Ace-C57) maleresult in (father) the from MOE the our amount andconditioning ofM71 timeF1 spentglomerular males inprotocol. the (F1-Ace, open areachamber F1-Prop)in from atethe timeF2 were adults spent mated in (F2-Ace,the with naive F2-Prop) females whose to gener- F0 ancestors had been condi- Prop males weremodality subjected toward to the same the shock F0-conditioned training conditions odor, thatM71-expressing andshowedwas both conditioned enhanced F0-Ace OPStoOSNs andacetophenone, (unconditioned) F0-inthe the olfactory MOEF1-AceWe to acetophenonefound andmice bulbs. M71inthat, this To similar comparedglomerularmaternally examine to the odorwhether area situationchamber. in alterations (a )in ateWhen which F2 tested adults in the with the F0 (F2-Ace,acetophenone, neuro male -(father) F2-Prop) F1-Acetioned mice with whose detected either F0 acetophenoneancestors had or been propanol. condi- For the IVF experiment, with C57Bl/6J F1-Home mice (F1-Home-C57) (Fig. 1a). No differ- acetophenone at a lower concentration (0.03%) than F1-Prop mice, with 94 might be deemed stressful and potentially conveyedVOLUME 17 to | NUMBERthe mother. 1 | JANUARY trained 2014 experiment NATURE NEUROSCIEN had an enhancedCEanatomical OPS to acetophenone representation compared of the conditioned odor accompa- sperm from F0 males was collected 10 d after the last conditioning day, Prop males were subjected to the same shocktheences trainingolfactory between conditions bulbs. groups wereTo that examine found whenwas whether conditionedpropanol alterationswas paired to acetophenone, with in theboth neuro groups F1-Ace-eventuallytioned showingmice with inequal either this aversion maternallyacetophenone at the 0.06% concentration or propanol. For the IVF experiment, This argues against the idea that our results might merely be the trans- with F1-Home controls (Fig. 5a). If our behavioral findings were a ( = 0.005 with Bonferroni correction for multiple comparisons). might be deemed stressful and potentiallyanatomical conveyedthe startle, indicating to representation the mother.that the responsenied oftrained the thewas behavioral specific conditioned experiment to acetophenone sensitivity had odor an enhanced accompareportedP -above,OPSsperm to weacetophenone fromused F0standard males compared was and collected IVF was 10 dperformed after the last by conditioningthe Transgenic day, Mouse Facility at Emory mission of a stressful paternal experience to the mother during the result of a ‘social transmission’ -galactosidase mode of information staining transfer, in naive we ( bM71-LacZ) When tested withF1 malespropanol, that F1-Prop had mice nei detected- University propanol at in a lower a location independent of our laboratory at Yerkes where time of co-habitation.This argues To ensure against that ourthe experimental idea that our groups results werenied might(Fig.would the 1b merely ).havebehavioral Similarly, predicted be the F1-Ace-M71 a sensitivitytrans reversal- of showed thewith reported above F1-Homeenhanced result. above, Instead, OPS controls to wewe aceto found used -(Fig. concentrationstandard 5a). If our (0.003%)and behavioral IVF than F1-Acewas findings performed mice, with wereboth by groups athe eventuallyTransgenic Mouse Facility at Emory phenone, but not to propanol,ther compared been withbehaviorally F1-Home-M71 tested and with, showing nor equal exposed aversion to, at theany 0.006% of the concentration con- we (P =conducted 0.0005 with all of the other studies reported. Subsequently con- balanced for bothmission odor and of shock a stressful exposure, paternal many of our experience experiments -galactosidasetothat the the mother F1-Ace-C57(fostered) duringstaining the in naivemaleresult offspring M71-LacZ of stilla ‘social had F1 a highermales transmission’ OPS that had neimode- ofUniversity information in a location transfer, independent we of our laboratory at Yerkes where utilized F0-Prop as the control group rather than F0-Home. F1-Prop-M71to acetophenone (Fig. 1cthan,d). F1-Home-C57(fostered) In contrast,ditioned F1-Prop-M71 odors. offspring Weshowed found enhanced (Fig. that 5b ), the Bonferroni dorsal correction and medial for multiple M71-specific comparisons) (F1-Ace-C57,ceived IVF n = 16; offspring (F1-Ace-IVF and F1-Prop-IVF) were raised to time of co-habitation. To ensure that ourther experimentalOPS been to propanol, behaviorally groups but not were totested acetophenone with,would nor have(Fig. exposed 1cpredicted,d). These to, adataany reversal ofF1-Prop-C57, the of con the- nabove = we16). conductedDataresult. are presentedInstead, all asof we mean the found ±other s.e.m. (**studiesP < 0.01). reported. Subsequently con- To further address this issue, and to address potential maternal suggesting a biological, ratherglomeruli than social, inmode the of olfactory inheritance. bulb of F1 offspring of acetophenone- adulthood and tissue was collected in this facility. balanced for both odor and shock exposure,ditioned many of odors. our experiments We found that that the thedorsal F1-Ace-C57(fostered) and medial M71-specific male offspring ceived still IVF had offspring a higher (F1-Ace-IVF OPS and F1-Prop-IVF) were raised to transmission, we conducted a cross-fostering study. Sexually naive For the equivalent experimenttrained to visualize F0 males neuroanatomy, (F1-Ace-M71) we per- were significantly increased in size When tested in our behavioral assay, F2-Ace-C57 mice exposed to female mice were conditioned with acetophenone or left in their homeglomeruli formed a insimilar the cross-fostering olfactory bulb experiment of F1 using offspring M71-LacZ of females, acetophenone- adulthood and tissue was collected in this facility. utilized F0-Prop as the control group rather90 than F0-Home. comparedto acetophenone with those thanof the F1-Home-C57(fostered) offspringVOLUME of 17 home | NUMBER cage 1 | or offspringJANUARY propanol- 2014 (Fig. NATURE 5bodors), NEUROSCIEN for the firstCE time showed increased OPS to acetophenone com- cage. They were Tothen further mated with address odor-naive this males issue, for and 10 d, to after addresstrained and used F0potential malesfemale mice (F1-Ace-M71)maternal conditioned suggesting to were propanol significantly as a ourbiological, control increased group rather thanin size social, Whenmode oftested inheritance. in our behavioral assay, F2-Ace-C57 mice exposed to which the male was removed. Subsequent offspring were then dividedcompared (offspring with labeled those as F1-Prop). of thetrained We offspring found F0 malesthat of the home (F1-Home-M71 increased cage dorsal or propanol- and F1-Prop-M71,odors for respectively) the first time showedpared withincreased F2-Prop-C57 OPS to acetophenone mice, whereas com F2-Prop-C57- mice showed into the followingtransmission, groups: offspring we of conductedhome cage mothers a cross-fostering (F1-Home), and study. medial Sexuallyglomerular naivearea persisted Forin F1-Ace the equivalentmice even after experiment they to visualize neuroanatomy, we per- trained F0 males (F1-Home-M71(ANOVA, and P < F1-Prop-M71, 0.0001 for dorsal respectively) and medial glomeruli;pared with Fig. F2-Prop-C57 3a–h). an mice, increased whereas OPS F2-Prop-C57 to propanol ( Fig.mice 4a showed,b). This persistent behavioral offspring of acetophenone-conditionedfemale mice were conditioned mothers (F1-Ace), with acetophenone offspring were or cross-fostered left in their by home mothersThis conditionedformed increase a in tosimilar M71 propanol glomerularcross-fostering (F1-Ace- area experiment was accompanied using M71-LacZ by a signifi females,- sensitivity to the F0-conditioned odor was accompanied by corres- of home cage mothers cross-fostered starting at postnatal day 1 by(ANOVA, M71(fostered)). P < 0.0001 In contrast, for F1-Propdorsal miceand cross-fosteredmedial glomeruli; by mothers Fig. 3a–h). an increased OPS to propanol (Fig. 4a,b). This persistent behavioral cage. They were then mated with odor-naive males for 10 d, aftercant and increase used infemale the numbers mice conditioned of M71 OSNs to propanol in the MOE as our (ANOVA, control groupponding increases in glomerular size in an independent set of F2 mothers conditioned to acetophenone (F1-Home(fostered)), and off-Thisconditioned increase to in acetophenone M71 glomerular (F1-Prop-M71(fostered)) area was accompanied did not show any by a signifi- sensitivity to the F0-conditioned odor was accompanied by corres- which the male was removed. Subsequent offspring were then dividedP < 0.0001;(offspring Fig. labeled 3i). as F1-Prop). We found that the increased dorsalM71-LacZ mice that had no previous exposure to the odors used. spring of acetophenone conditioned mothers cross-fostered by homecant increases increase in M71 in glomerularthe numbers area (Fig. of 5cM71–h). InOSNs summary, in the these MOE cross- (ANOVA, ponding increases in glomerular size in an independent set of F2 cage mothers into(F1-Ace(fostered)) the following (Supplementary groups: offspring Fig. 4). of Notably, home cagefostering mothers results, (F1-Home), taken together withand our medial IVF and F2glomerular studies, strongly area persisted in F1-Ace mice even after they offspring of acetophenone-conditioned mothersP < 0.0001; (F1-Ace), Fig. 3 ioffspring). were cross-fostered by mothers conditionedM71-LacZ to propanol mice that (F1-Ace- had no previous exposure to the odors used. NATURE NEUROSCIENCE VOLUME 17 | NUMBER 1 | JANUARY 2014 91 92 of home cage mothers cross-fostered starting VatOLUME postnatal 17 | NUMBER day 11 | byJANUARY M71(fostered)). 2014 NATURE NEUROSCIEN In contrast,CE F1-Prop mice cross-fostered by mothers mothers conditioned to acetophenone (F1-Home(fostered)),NATURE NEUROSCIEN andCE off- VOLUMEconditioned 17 | NUMBER to acetophenone 1 | JANUARY (F1-Prop-M71(fostered)) 2014 did not show any 91 spring of acetophenone conditioned mothers cross-fostered by home increases in M71 glomerular area (Fig. 5c–h). In summary, these cross- cage mothers (F1-Ace(fostered)) (Supplementary Fig. 4). Notably, fostering results, taken together with our IVF and F2 studies, strongly 92 VOLUME 17 | NUMBER 1 | JANUARY 2014 NATURE NEUROSCIENCE Environmental conditions at critical periods can have transgenerational health effects Overkalix, an isolated communityTransgenerational in northern responses in humans Sweden ME Pembrey et al late 1890-1995. Health and food records 163 a Slow Growth Period 2.0 Poor *** * * 1.0 Risk Ratio Good * ** ** * * Grandsons' Mortality 0.5 †0 42 6 8 10 12 14 16 18 20 Age of Paternal Grandfather (years) * p < 0.05 ** p < 0.02 *** p < 0.01 Slow Growth Period 2.0 *** *** *** Reduced longevity associated** with* cardiovascular diseasePoor and** diabetes * 1.0 Pembrey et al 2006 European Journal of Human Genetics Risk Ratio * ** ** ** Granddaughters' Mortality 0.5 Good ** *** ** †0 42 6 8 10 12 14 16 18 20 Age of Paternal Grandmother (years) b 2.0 Slow Growth Period Good 1.0 Poor Risk Ratio Grandsons' Mortality 0.5 †0 42 6 8 10 12 14 16 18 20 Age of Paternal Grandmother (years) * p < 0.05 ** p < 0.02 *** p < 0.01 Slow Growth Period 2.0 Poor 1.0 Risk Ratio Good Granddaughters' Mortality 0.5 †0 42 6 8 10 12 14 16 18 20 Age of Paternal Grandfather (years) Figure 1 The effect of paternal grandparental food supply (good red filled squares, poor green open squares) at different times in their early life on the mortality rate of their grandchildren. Both (a and b) show¼ on the Y-axis the mortality¼ RR of the grandchildren separated by sex, first the grandsons’ mortality RR and below this, the granddaughters’ mortality RR. The age at which the paternal grandparent was exposed to good or poor food supply is given along the X-axis. The grandchildren’s mean mortality RR results are plotted for both those paternal grandparents who had a good food supply (red) and those who had a poor supply (green) at the specified age on the X-axis. (a) First relates paternal grandfathers’ exposure to his grandsons’ mortality RR and then below the paternal grandmothers’ exposure to her granddaughters’ mortality RR. (b) First relates paternal grandmothers’ exposure to his grandsons’ mortality RR and then below the paternal grandfathers’ exposure to her granddaughters’ mortality RR. The data points were obtained using a 3-year frame, advanced one year at a time, for grandparental age at exposure, to produce rolling means for the grandchild’s (proband’s) mortality RR for both ‘good’ and ‘poor’ ancestral food supply. Exposure to at least 1 year of surfeit of food or to at least 1 year of poor availability during a 3-year period denotes it as exposure to a ‘good’ period or a ‘poor’ period respectively. wFood supply at age 0 years is the mean for the 33-month period from 267 days until the day before the second birthday and therefore includes fetal life. À European Journal of Human Genetics Epigenetic abnormalities associated with certain diseases are influenced by genetic background Chr 6 Chr 21 Chr 21 Chr 1 Chr 2 292 kb 47.6045 mb 47.5815 mb 108.7345 mb 108.7355 mb 113.9925 mb 113.9935 mb 293 kb 47.604 mb 47.605 mb 47.581 mb 47.582 mb 108.735 mb 108.736 mb 113.993 mb Gene DUSP22 SPATC1L SPATC1L SPATC1L SLC25A24 PAX8 CpG DMR 80 60 40 20 Mean % methylation p−value(FDR)=0.018; p−value(FDR)=3.2e−06; p−value(FDR)=7.6e−08; p−value(FDR)=2.8e−12; p−value(FDR)=1.2e−11; R2=0.14 R2=0.34 R2=0.41 R2=0.56 R2=0.54 10 30 50 10 30 50 70 30 50 70 90 40 60 80 10 30 50 70 GA GG AA AG AA AG AA AG GG AA GA GG % Metylation cg26668828 % Metylation cg13012494 % Metylation cg08942192 % Metylation cg12016809 Genotype rs367881881 Genotype rs75666188 Genotype rs62214051 Genotype rs12118280 % Metylation cg11763394 Genotype rs4849179 (Minor Allele: A ; MAF=0.096) (Minor Allele: G ; MAF= 0.057) (Minor Allele: G ; MAF= 0.11) (Minor Allele: G ; MAF= 0.17) (Minor Allele: A ; MAF= 0.32) Herrera et al. in review Chr 4 Chr 6 Chr 7 Chr 6 69.4345 mb 69.4355 mb 32.6325 mb 4.244 mb 4.245 mb 32.7285 mb 32.7295 mb 69.435 mb 69.436 mb 32.632 mb 32.633 mb 4.2445 mb 32.729 mb Gene UGT2B17 HLA-DQB1 SDK1 HLA-DQB2 CpG DMR 80 60 40 20 Mean % methylation p−value(FDR)=2.4e−12; p−value(FDR)=2.3e−29; p−value(FDR)=1e−39; p−value(FDR)=8.4e−38; R2=0.56 R2=0.85 R2=0.93 R2=0.91 50 70 90 20 40 60 20 40 60 40 60 80 AA AG GG AA GA GG AA GA GG AA GA GG % Metylation cg10632656 Genotype rs35307342 % Metylation cg12192813 Genotype kgp6614124 % Metylation cg24441899 Genotype rs1105697 % Metylation cg07180897 Genotype rs9274514 (Minor Allele: G ; MAF= 0.33) (Minor Allele: A ; MAF= 0.25) (Minor Allele: A ; MAF= 0.24) (Minor Allele: A ; MAF= 0.22) Summary • Epigenetic marks are involved in development • DNA methylation at CpG sites is associated with down-regulation of gene expression • Histone acetylation is associated with up-regulation of gene expression • Tissue-specific cell-line memory is established and maintained through epigenetic modifications. • Epigenetic changes can happen during the lifetime of individuals due to interactions with environment • Environment can have effects on epigenome/ phenotype that can be inherited transgenerationally Open Questions in Epigenetic Research Allis et al 2015 Mutations of Epigenetic Machinery Many genes involved in epigenetic machinery have been identified to be mutated in cancer Allis et al 2015
What is Epigenetics? Two views in embryology
Preformationism (17-19th century): each cell contains preformed elements that enlarge during development.
Epigenesis (19th century -): chemical Humunculus reactions among soluble components in Hartsoecker 1695 the cell that execute a complex developmental plan. Chromosomes are Necessary for Development Before the 20th century
Walter Sutton, 1902 Theodor Boveri, 1903 Columbia University University of Würzburg USA Germany • Determined that all chromosomes had to be present for proper embryonic development.
• Development encoded by irreversible changes in chromosomes? Cell Specialization is Reversible Late 20th and early 21st centuries
Skin cell nuclear transfers 99
Central Question: How can a single Original explant fertilized egg give rise to a complex removed Adult frog of \-nu strain Outgrowth of organism with cells of varied as nuclear donor epidermal cells
phenotypes? Parent of 1st transfer Donor cells for recipient eggs Enucleation of nuclear transfer recipient eggs 1st nuclear transfer Cells trypsinized Foot web outgrowth and washed prove frog was 2-nu
Uncleaved Completely cleaved (70 V) Martially cleaved /c o/\ • Gurdon, Laskey & Reeves 1975 (25%)
demonstrated that “cell Dissociated cells for specialization does not involve serial transfer I *^i/ KJpZ* Parent of serial ttransfei r any loss, irreversible activation or Enucleation of 1 recipient eggs recipient eggs Serial nuclear transfer permanent change chromosomal Foot web outgrowth prove frog was 2-nu
genes required for development” Uncleaved Completely cleaved (40/O Partially cleaved (30/0 (30%)
Nuclear transplant tadpole: l-nu diploid from nucleolus and chromosome counts (present in 36% of serial clones) Fig. 2. Plan of serial nuclear transfer experiments, using nuclei from adult skin celJs. Reasons for the various steps are explained in the text (p. 99). The percentages of injected eggs which cleave in different ways are those typically obtained with adult skin cell nuclei. The actual results of the experiments reported here are shown in Tables 1 and 3.
The overall plan of our experiments is illustrated in Fig. 2. Serial transfers were carried out in all cases, and the following comments summarize the reasons for this. A serial nuclear transfer experiment is one in which a donor nucleus is taken from an embryo which has itself resulted from a previous, first-transfer, experiment (Fig. 2). Most of the blastulae obtained from first Surprises in the Genomic Era Late 20th and early 21st centuries
Number of genes • Human Genome Project 2003 Grape 30,434
Human 22,333
• Why so few genes? Chicken 16,736
Fruit fly 14,889
• How do cell lines know and E. coli 4,149
remember their function? Influenza 11 Pertea & Salzberg 2010
• Where does individual variation come from?
• Are there traits/diseases that cannot be explained by our genetic sequence? Epigenetic Landscape Phenotypic changes occur during development
• Stem cells start with same developmental potential
• Can follow different developmental paths
• Most phenotypic traits are influenced by many genes
• Landscape is shaped by genotype and environment
Waddington 1957 Modern Definition
• Epigenetics: study of stably heritable phenotypes (e.g. gene expression) that result form changes in chromatin, without changes in DNA sequence
Allis et al 2015 Disruption of Epigenetic Landscape Can lead to cancer REVIEWS
a Stem cells evidence has confirmed that stochastic DNA methy- lation alterations in cancer involve large regions of the epigenome190,191. This stochastic epigenetic change does ormal not occur genome-wide. Rather, genome-wide views of development epigenetic variation have shown that large hypomethy- lated blocks, constituting up to one-third of the genome, Neoplasia Cancer contain the most variably methylated regions of the tumour genome190,192. These domains arise early during cancer development191,193,194 and contain the most variably expressed genes regulating cancer- relevant functions190. Moreover, the degree of variation in methylation in early precursor lesions predicts cancer risk193,194, suggesting a Di erentiated states causal link between these epigenetic changes and cancer. Hypomethylated blocks in cancer largely correspond to b partially methylated domains in normal cells as well as LADs and LOCKs (FIG. 2). These regions underlie much of the reported variation in methylation at CpG islands, Feinberg 2016 Nature Reviews Genetics pigenetic shores and distant CpG sites, fuelling phenotypic vari- mediators 191,192 e.g., OCT4, SOX2 ation in cancer . In addition, the degree of vari ation in methylation191, as well as the deviation of the vari- ability in gene expression from the normal correspond- ing tissue, is a predictor of cancer progression195. The combination of ageing and chronic sun exposure — the two leading causes of skin cancer — induces the wide- spread formation of hypomethylated blocks in the epi- dermis at genomic regions that are hypomethylated in pigenetic squamous cell carcinoma and that overlap with colon modi ers cancer- specific hypomethy lated blocks196. These same (e.g., DNMT, TET) regions are the very ones that show further alterations in methylation in squamous cell cancers arising within pigenetic modulators (e.g., APC, STAT3) the same skin. Given the overlap of these regions with LADs and LOCKs, these data also indicate that the inter- | Figure 3 Waddington landscape of phenotypic plasticity in development and cancer. play between altered 3D genome organization, stochastic a | The Waddington landscape of development is adapted to compare cellular states of Nature Reviews | Genetics epigenetic change and impaired differentiation mediate different entropy during normal differentiation (left side of image) and in cancer (right side 196 of image). The developmental potential of normal somatic stem cells (grey balls) positioned the effect of environmental damage with photo-ageing . on the top of the hill correlates with high entropy, which is mediated by cellular heterogeneity (different shades of grey). During differentiation, cells are guided towards Network entropy and nuclear structure. Recent work has well-defined cell fates (light blue and brown balls) with lower entropy, paralleled by a described cellular heterogeneity as network entropy — decrease in transcriptional noise and the stabilization of cell states (deepening of the applied as a measure of signalling pathway promiscuity valleys or canalization). Cancer stem cell (CSC) states (yellow ball) arise when epigenetic — and established that the level of network entropy instability interferes with normal differentiation and leads to the erosion of barriers against provides an estimate of developmental potential160,197. dedifferentiation — for example, via the erosion of large organized chromatin K9 In other words, the high entropy of a heterogeneous pluri- modifications and the emergence of hypomethylated blocks. In a similar manner to normal potent stem cell population maintains a diverse range of differentiation, CSCs with higher entropy occupy higher altitudes on the hill than cancer pathways associated with more mature pheno types in a cells (orange and red balls), although the difference is smaller than between normal stem cells and differentiated progeny. Increased transcriptional noise (shallow valleys) and poised state for activation. Consistent with the signalling stochastic switches between diverse cell states (arrows between valleys) are regulated by entropy model of cellular differentiation, the variability the interplay between epigenetic modulators, modifiers and mediators, the deregulated in the expression of signalling factors and developmen- epigenome and fluctuating environmental cues (for example, inflammation, repeated tal regulators has been experimentally linked to the dif- exposure to carcinogens, ageing or an overactive WNT pathway). Finally, cellular ferentiation potential of ESCs198. In a similar manner to heterogeneity (yellow, orange and red balls) within the tumour eventually enables selection normal differentiation, CSCs display a higher entropy mechanisms to drive the growth of the fittest clone. b | Illustration of the role of epigenetic than cancer cells, although the difference is smaller than modifiers, modulators and mediators on the Waddington landscape described in part a. between normal stem cells and differentiated progeny160. Epigenetic modulators (pink hexagon) regulate the activity of epigenetic modifiers Furthermore, CSCs consistently have a lower entropy (green triangles) that induce the ectopic expression of epigenetic mediators. Mediators than their normal counterparts, indicating the presence dynamically alter the contour of the landscape via feedback loops that target epigenetic modifiers such as chromatin modifications (blue circles), lamin proteins (yellow circles) of dominating oncogenic pathways. This is in agreement and chromosomal interactions (new loop on right). The expression of epigenetic mediators with models suggesting that cancers represent hybrid thus produces a shift in the epigenetic landscape, enabling the sampling of aberrant states between aberrantly increased as well as decreased developmental outcomes displaying increased phenotypic plasticity in neoplastic or epigenetic flexibility188 (FIG. 3a). pre-neoplastic cells. APC, adenomatous polyposis coli; DNMT, DNA methyltransferase; Importantly, transitions between cellular states SOX2, sex-determining Y-box 2; STAT3, signal transducer and activator of transcription 3; of different entropy seem to be regulated epigeneti- TET, TET methylcytosine dioxygenase. cally. Using quantitative RNA fluorescence in situ
NATURE REVIEWS | GENETICS VOLUME 17 | MAY 2016 | 293
Epigenetic marks: DNA is not naked Distinct chromatin configurations give rise to diverse phenotypes
Chromatine remodeling Histone modifications Histone composition variants
non-coding RNAs DNA methylation
Allis et al 2015 DNA Methylation Usually correlated with repression of gene expression
• In many animals occurs mostly on cytosines at CpG dinucleotides DNA methyltransferase DNA demethylase • Most exons and introns are Cytosine 5-methylcytosine highly methylated (70-80%) in vertebrates SAM = S-adenosylmethionine DNA Methylation Usually associated with silencing of gene expression Medvedeva et al. BMCMedvedeva Genomics 2013,et al.15 BMC:119 Genomics 2013, 15:119 Page 3 of 12 Page 3 of 12 http://www.biomedcentral.com/1471-2164/15/119 Model of transcriptionhttp://www.biomedcentral.com/1471-2164/15/119 regulation by CpG methylation Binding of transcription initiation complex is inhibited by methylation
Transcription initiation complex forms Unmethylated Transcription occurs DNA
Transcription initiation complex cannot form Methylated Transcription is inhibited DNA
Medvedeva et al 2013 BMC Genomics Pol = RNA Polymerase; TF = Transcription factor
Figure 1 Schematic representation of the interaction between promoter methylation and transcription of the gene. In the absence of DNA methylation, TFs canFigure bind 1 DNASchematic allowing representation RNA polymerase of to the bind interaction and to start between the transcription. promoter Panel methylationa shows the and following transcription scenario: of the if gene. In the absence of DNA becomes methylated,DNA TFs methylation, are blocked TFs from can binding bind DNA to DNA allowing and thereforeRNA polymerase RNA polymerase to bind and is unable to start to the bind transcription. and to initiate Panel transcription.a shows the following scenario: if Panel b shows the followingDNA becomes scenario: chromatin methylated, modifications TFs are blocked reduce from the binding ability of to TFs DNA to and bind therefore DNA and RNA therefore polymerase RNA polymerase is unable to is bind unable and to to initiate transcription. bind; the repressed conditionPanel b ofshows the chromatin the following is maintained scenario: by chromatin subsequent modifications DNA methylation. reduce thePolII ability is shown of TFs as a to maroon bind DNA pie; and nucleosome therefore is RNA polymerase is unable to shown as a blue cylinder.bind; Plain the (solid) repressed lollipops condition represent of the unmethylated chromatin (methylated)is maintained cytosines. by subsequent TF is shown DNA methylation. as an orange PolII octagon. is shown The as green a maroon pie; nucleosome is hexagon and purple trapezoidshown as are a a blue methyl-binding cylinder. Plain domain (solid) and lollipops Policomb-group represent unmethylated proteins, respectively. (methylated) The brown cytosines. triangle TF is represents shown as an orange octagon. The green an unknown repressor. hexagon and purple trapezoid are a methyl-binding domain and Policomb-group proteins, respectively. The brown triangle represents an unknown repressor.
of their TFBSs [50]. Besides, it was reported that binding Our study shows that a fraction of single CpGs within of some TFs, includingof their Sp1 TFBSs and [50]. CTCF, Besides, is sufficient it was for reportedpromoters that binding exhibits aOur significant study shows negative that correlation a fraction of of single CpGs within maintaining a localof unmethylated some TFs, including state [60-65]. Sp1 Neverthe- and CTCF,their is sufficient methylation for profilespromoters with exhibits the expression a significant profiles negative of correlation of less, this scenario (Figuremaintaining 1b) does a local not unmethylated explain the sensi- state [60-65].neighboring Neverthe- transcriptionaltheir methylation start sites profiles (TSSs) with considered the expression profiles of tivity of certain TFsless, to methylation this scenario of (Figure their TFBSs. 1b) does not explainacross the various sensi- samples.neighboring Moreover, transcriptional we observe start a strong sites (TSSs) considered In this study, wetivity explore of certain the evidence TFs to methylation that supports of theirnegative TFBSs. selection againstacross the various presence samples. of such Moreover, cytosines we observe a strong one of these two scenarios.In this To study, achieve we explore this, we the first evidence test within that supports TFBSs, especiallynegative in their selection core against positions. the Interest- presence of such cytosines whether methylationone of of a these particular two scenarios. cytosine To correlates achieve this,ingly, we we first find test thatwithin repressors TFBSs, are especially more sensitive in their to core the positions. Interest- with transcription.whether This effect methylation may provide of a particular a basis for cytosinepresence correlates of such cytosinesingly, we in find their that binding repressors sites. are more sensitive to the regulation of transcriptionwith transcription. through methylation This effect of may spe- provideThis a basis work for is partpresence of the of FANTOM5 such cytosines project. in their Data binding sites. cific TFBSs. Second,regulation we investigate of transcription whether through some TFs methylationdownloads, of spe- genomicThis tools and work co-published is part of manuscripts the FANTOM5 project. Data are more sensitivecific than TFBSs. others Second, to the presence we investigate of such whetherare collected some TFs at http://fantom.gsc.riken.jp/5/.downloads, genomic tools and co-published manuscripts cytosines in theirare TFBSs more and sensitive what features than others of TFBSs to the presence of such are collected at http://fantom.gsc.riken.jp/5/. can be associatedcytosines with this in sensitivity. their TFBSs To this and end, what we features of TFBSs employed ENCODEcan [66] be data associated on DNA with methylation this sensitivity. ob- ToResults this end, and we discussion tained by reducedemployed representation ENCODE bisulfite [66] data sequencing on DNA methylationOnly a fraction ob- of cytosinesResults exhibits and discussion significant (RRBS) [67]. RRBStained allows by us to reduced identify representation both methylated bisulfitecorrelation sequencing betweenOnly methylation a fraction and of expression cytosines exhibits profiles significant and unmethylated(RRBS) cytosines [67]. quantitatively RRBS allows us at to a identify single bothof a methylatedcorrespondingcorrelation TSS between methylation and expression profiles base pair resolutionand in unmethylated the CCGG context cytosines in quantitatively regions It is at well a known single thatof the a corresponding level of cytosine TSS methylation of with high densitiesbase of rarely pair resolution methylated in cytosines, the CCGG usu- contextpromoters in regions is negativelyIt is well correlated known with that gene the level expression of cytosine methylation of ally co-located withinwith gene high promoters densities of [68]. rarely To methylated evaluate [71]; cytosines, the role usu- of methylationpromoters of is negatively particular CpGscorrelated in the with gene expression genome-wide expressionally co-located across different within gene cell promoters types, we [68].regulation To evaluate of gene[71]; expression the role has of been methylation demonstrated of particular in CpGs in the used FANTOM5genome-wide [69] data obtained expression by cap across analysis different of the cell case types, of ESR1 we [11].regulation The crucial of gene role expression of the location has been of demonstrated in gene expressionused (CAGE) FANTOM5 [70]. FANTOM5 [69] data obtained provides bymethylated cap analysis regions of the relative case of to ESR1 TSSs [11]. is also The widely crucial ac- role of the location of quantitative estimationgene expression of expression (CAGE) in several [70]. hun- FANTOM5cepted. provides The questionmethylated whether methylation regions relative of a particular to TSSs is also widely ac- dreds of different cellquantitative types. estimation of expression incytosine several may hun- affectcepted. expression The remains question unanswered. whether methylation of a particular dreds of different cell types. cytosine may affect expression remains unanswered. REVIEWS
Establishm ent. After erasure, de novo methylation begins in both germ lines at late fetal stages, and continues after Allele 1 CpG birth41,50 (FIGS 3,4).Oocytes are in meiotic arrest and methylation occurs during their growth47,whereas dur- ing spermatogenesis, methylation occurs before meio- sis44,45.Nuclear transplantation experiments indicate that this DNA methylation coincides roughly with the acqui- sition of functional imprints both for autosomal genes and for X chromosome imprinting, at least in oocytes47,51.It is not yet clear which enzymes are respon- Allele 2 CpG sible for de novo methylation in germ cells (BOX 2). Dnmt1 (DNA methyltransferase 1) and its germ-cell- specific isoforms are candidates52,but it is also possible that Dnmt3a or Dnmt3b,which are required for de novo methylation in postimplantation embryos53,carry out this function in germ cells.It is also unclear how Dnmts specifically target DMRs in either female or male germ Methylation cells. DMRs in imprinted genes might be specifically tar- Acetylation geted for de novo methylation in one of the germ lines.It Transcription complex is equally possible that there is general de novo methyla- Figure 2 | Characteristics of imprinted genes. The figure tion in both germ lines and that DMRs are specifically shows a schematic pair of imprinted alleles. Hallmarks of protected from methylation in one germ line but not in imprinted genes such as CpG islands and repeats (arrows) the other.In either case,this would require factors that are indicated. The enlarged region below the chromosomes highlights the allele-specific epigenetic changes, such as recognize DMRs and that are germline-specific. The nucleosomal condensation through deacetylation, and existence of such factors is supported by the observation methylation (allele 1) and opening of the chromatin by that deficiency of Dnmt1 causes loss of imprints post- acetylation and demethylation (allele 2). The transcriptional zygotically, and the imprints cannot be restored by competence of allele 2 is indicated by the binding of a Dnmt1, Dnmt3a or Dnmt3b54. transcription complex. DMRs are generally CpG rich and often fulfil the criteria for CpG islands (see below). However, autoso- ing new insights about the role of methylation mal CpG islands do not become methylated de novo. imprints (for example, Cdkn1c requires a maternal So it is likely that imprinted DMRs are genetically or methylation imprint to be expressed;see below).In epigenetically modified so that de novo methylation addition to methylation imprints, differential replica- can occur. Genetic modification has been previously tion of DNA is also apparently erased in both germ postulated to be due to stretches of unique direct Three lines;different in the enzymesfemale germ carry line this out coincides with repeats that often flank DMRs24.More recent work has CpGdemethylation, methylation but in in mammals the male germline it occurs shown that the repeats are not necessarily unique to substantiallyde novo and later, maintenance after birth49. DMRs but that clusters of known repeat families, such
DNMT3A, DNMT3B de novo methylation, particularly important during development Box 2 | DNA methylation and demethylation De novo methylation DNA methylation in mammals occurs in the dinucleotide CpG. Methyl groups can Dnmt3b Dnmt3a be introduced into unmethylated DNA by the de novo methylation enzymes Dnmt3a and Dnmt1 Dnmt3b (and perhaps others). When DNA is Active demethylation Reik & Walter 2001Maintenance Nature Review Genetics methylation replicated, the methyl group on the template strand is recognized and a new one is introduced on the opposite (daughter) strand by the enzyme Dnmt1, which can be associated with the replication machinery. In the presence of Dnmt1, hemi-methylated DNA becomes Passive demethylation fully methylated and so DNA methylation patterns tend to be maintained (maintenance methylation). Demethylation can occur in the absence of Dnmt1 with continued rounds of DNA replication (passive demethylation), as well as actively (without DNA replication). The nature of demethylases is unknown.
24 | JANUARY 2001 | VO LUME 2 www.nature.com/reviews/genetics © 2001 Macmillan Magazines Ltd REVIEWS REVIEWS
Establishm ent. After erasure, de novo methylation begins Establishm ent. After erasure, de novo methylation begins in both germ lines at late fetal stages, and continues after Allele 1 CpG in both germ lines at late fetal stages, and continues after Allele 1 CpG birth41,50 (FIGS 3,4).Oocytes are in meiotic arrest and birth41,50 (FIGS 3,4).Oocytes are in meiotic arrest and methylation occurs during their growth47,whereas dur- methylation occurs during their growth47,whereas dur- ing spermatogenesis, methylation occurs before meio- ing spermatogenesis, methylation occurs before meio- sis44,45.Nuclear transplantation experiments indicate that sis44,45.Nuclear transplantation experiments indicate that thisthis DNADNA methylationmethylation coincides coincides roughly roughly with with the the acqui- acqui- sitionsition ofof functional functional imprints imprints both both for for autosomal autosomal genes genes andand for for X X chromosome chromosome imprinting, imprinting, at at least least in in 47,51 oocytesoocytes47,51.It.It is is not not yet yet clear clear which which enzymes enzymes are are respon- respon- Allele 2 CpG sible for de novo methylation in germ cells (BOX 2). Allele 2 CpG sible for de novo methylation in germ cells (BOX 2). Dnmt1Dnmt1(DNA(DNA methyltransferase methyltransferase 1) 1) and and its its germ-cell- germ-cell- 52 specificspecific isoformsisoforms are are candidates candidates52,but,but it it is is also also possible possible thatthat Dnmt3aDnmt3aoror Dnmt3b Dnmt3b,which,which are are required required for for de de novo novo 53 methylationmethylation in in postimplantation postimplantation embryos embryos53,carry,carry out out thisthis functionfunction in in germ germ cells.It cells.It is is also also unclear unclear how how Dnmts Dnmts specificallyspecifically target target DMRs DMRs in in either either female female or or male male germ germ MethylationMethylation cells. DMRs in imprinted genes might be specifically tar- Acetylation cells. DMRs in imprinted genes might be specifically tar- Acetylation getedgeted forfor dede novo novomethylationmethylation in in one one of of the the germ germ lines.It lines.It TranscriptionTranscription complex isis equallyequally possiblepossible that that there there is is general general de de novo novomethyla-methyla- FigureFigure 22 || CharacteristicsCharacteristics of imprinted genes.genes. TheThe figurefigure tiontion inin bothboth germ germ lines lines and and that that DMRs DMRs are are specifically specifically shows a schematic pair of imprinted alleles. Hallmarks of shows a schematic pair of imprinted alleles. Hallmarks of protectedprotected fromfrom methylation methylation in in one one germ germ line line but but not not in in imprintedimprinted genesgenes suchsuch as CpG islands andand repeatsrepeats (arrows)(arrows) the other.In either case,this would require factors that are indicated. The enlarged region below the chromosomes the other.In either case,this would require factors that are indicated. The enlarged region below the chromosomes recognize DMRs and that are germline-specific. The highlightshighlights thethe allele-specific epigenetic changes, suchsuch asas recognize DMRs and that are germline-specific. The existence of such factors is supported by the observation nucleosomalnucleosomal condensationcondensation through deacetylation, andand existence of such factors is supported by the observation methylationmethylation (allele(allele 1) and opening of the chromatin byby thatthat deficiencydeficiency of of Dnmt1 Dnmt1 causes causes loss loss of of imprints imprints post- post- acetylationacetylation andand demethylation (allele 2). The transcriptionaltranscriptional zygotically,zygotically, and and thethe imprintsimprints cannotcannot bebe restored restored by by competencecompetence ofof allele 2 is indicated by the bindingbinding ofof aa Dnmt1,Dnmt1, Dnmt3a Dnmt3a or or Dnmt3b Dnmt3b5454.. transcription complex. transcription complex. DMRsDMRs areare generallygenerally CpG CpG rich rich and and often often fulfil fulfil the the criteriacriteria forfor CpGCpG islands islands (see (see below). below). However, However, autoso- autoso- inging new new insights insights about the role of of methylation methylation malmal CpGCpG islandsislands do do not not become become methylated methylated de de novo novo.. imprintsimprints (for(for example, Cdkn1c requires aa maternalmaternal SoSo itit isis likelylikely thatthat imprinted imprinted DMRs DMRs are are genetically genetically or or methylationmethylation imprint to be expressed;see below).Inbelow).In epigeneticallyepigenetically modified modified so so that that de de novo novomethylationmethylation Three differentadditionaddition enzymes toto methylationmethylation imprints, carry differential outreplica-replica- cancan occur.occur. Genetic Genetic modification modification has has been been previously previously tiontion ofof DNA DNA is also apparently erased inin bothboth germgerm postulatedpostulated toto bebe duedue toto stretchesstretches ofof unique unique direct direct CpG methylationlines;lines; in in thethe female in germmammals line this coincidescoincides withwith repeatsrepeats thatthat oftenoften flank flank DMRs DMRs2424.More.More recent recent work work has has demethylation,demethylation, but in the male germline itit occursoccurs shownshown thatthat thethe repeats repeats are are not not necessarily necessarily unique unique to to de novosubstantiallysubstantially and maintenance later, after birth49. DMRsDMRs butbut thatthat clusters clusters of of known known repeat repeat families, families, such such
DNMT1 maintenance methylation, central for maintaining cellularBoxBox identity 22 ||DNADNA methylationmethylation andand demethylationdemethylation DeDe novonovo methylation DNADNA methylationmethylation in in mammals mammals occurs occurs in in the the dinucleotidedinucleotide CpG. CpG. Methyl Methyl groups groups can can Dnmt3bDnmt3b Dnmt3a bebe introducedintroduced into into unmethylated unmethylated DNA DNA by by the the dede novonovomethylationmethylation enzymes enzymes Dnmt3a Dnmt3a and and Dnmt1Dnmt1 Dnmt3bDnmt3b (and (and perhaps perhaps others). others). When When DNA DNA is is ActiveActive demethylationdemethylation Maintenance methylationmethylation replicated,replicated, the the methyl methyl group group on on the the template template Methylates Cytosine adjacent to strandstrand isis recognized recognized and and a a new new one one is is 5-methylcytosine in newly introducedintroduced on on the the opposite opposite (daughter) (daughter) strand strand byby thethe enzymeenzyme Dnmt1, Dnmt1, which which can can be be associated associated synthesized DNA strands of withwith thethe replication replication machinery. machinery. In In the the presence presence dividing cells ofof Dnmt1, Dnmt1, hemi-methylated hemi-methylated DNA DNA becomes becomes PassivePassive demethylation fullyfully methylatedmethylated and and so so DNA DNA methylation methylation Reik & Walter 2001 Nature Review Genetics patternspatterns tend tend to to be be maintained maintained (maintenance (maintenance methylation).methylation). Demethylation Demethylation can can occur occur in in the the absenceabsence of of Dnmt1 Dnmt1 with with continued continued rounds rounds of of DNADNA replicationreplication (passive (passive demethylation), demethylation), as as wellwell asas activelyactively (without (without DNA DNA replication). replication). TheThe naturenature of of demethylases demethylases is is unknown. unknown.
2424 || JANUARYJANUARY 20012001 || VOVO LUME LUME 22 www.nature.com/reviews/geneticswww.nature.com/reviews/genetics © 2001 MacmillanMacmillan MagazinesMagazines LtdLtd Epigenetic marks: DNA is not naked Distinct chromatin configurations give rise to diverse phenotypes
Histone modifications
DNA methylation
Allis et al 2015 Histone modifications
• Chromatin polymer is composed of nucleosome units
• Each unit consists of an octamer of core histone proteins wrapped by 147bp of DNA Allis et al 2015 Histone Modifications >50 different kinds of post-transcriptional modifications
• Majority of know covalent modifications occur on histone tails (some do occur in globular domains)
• Many occur at specific sites and residues
Allis et al 2015 Histone Acetylation Usually associated with activation of gene expression
Verdin & Ott (2015) Nature Reviews Molecular Cell Biology X-chromosome inactivation Example of epigenetic mechanisms
https://www.youtube.com/watch?v=BD6h-wDj7bw RESEARCH ARTICLE
E017 E002 a IMR90 E008 track to learn the model) and repressor NRSF; transcribed states show- E001 E015 E014 E016 ES cell E003 E024 E020 E019 ing H3K79me1 and H3K79me2 and associated with the 59 ends of genes E018 iPSC E021 E022 E007 E009 E010 E013 ES-deriv. E012 and introns; and a large number of putative regulatory and neighbour- E011 E004 E005 E006 E062 E034 E045 E033 ing regions showing diverse acetylation marks even in the absence of E044 E043 E039 Blood & E041 E042 E040 T cell E037 E048 the H3K4 methylation signatures characteristic of enhancer and pro- E038 E047 E029 E031 E035 HSC & E051 E050 E036 moter regions. E032 B cell E046 E030 E026 E049 E025 Mesench. E023 E052 We used chromatin states to study the relationship between histone E055 E056 E059 E061 E057 Epithelial E058 E028 E027 modification patterns, RNA expression levels, DNA methylation and E054 E053 E112 E093 E071 19,23,44,45 E074 E068 E069 DNA accessibility. Consistent with previous studies , we found E072 E067 Brain E073 E070 E082 E081 E063 E100 low DNA methylation and high accessibility in promoter states, high E108 E107 Muscle E089 E090 E083 E104 E095 Heart E105 DNA methylation and low accessibility in transcribed states, and inter- E065 E078 E076 TissuesE103 can be described in terms Sm. musc. E111 E092 E085 E084 mediate DNAmethylation and accessibility inenhancer states (Fig. 4d, e E109 E106 E075 E101 Digestive E102 E110 E077 E079 and Extended Data Fig. 3a, b). These differences in methylation level E094 E099 E086 E088 E097 E087 of their epigenome E080 Other E091 were stronger for higher-expression genes than for lower-expression E066 E098 E096 E113
Chromatin state annotations in 127 epigenomes E114 E115 E116 E117 genes, leading to a more pronounced DNA methylation profile (Extended E118 E119 E120 Vastly moreENCODE E121complex than description of genomic DNA sequence E122 E123 E124 2012 E125 Data Fig. 3c, Supplementary Fig. 5 and Supplementary Table 4f). Genes E126 E127 E128 E129 FAM205B ATP8B5P SIT1 ~3.5-MbNPR2 RECK regionRNF38 onMELK chromosome PAX5 9 GRHPR FRMPD1 SHB ALDH1B1 proximal to H3K27ac-marked enhancers show significantly higher expres- Chrom. states RefSeq genes FAM205B ATP8B5P SIT1 NPR2 RECK RNF38 MELK PAX5 GRHPR FRMPD1 SHB ALDH1B1 RNA-seq sion levels (Extended Data Fig. 3d), and conversely, higher-expression b H3K36me3 H4K20me1 genes were significantly more likely to be neighbouring H3K27ac- H3K79me2 H3K79me1 containing enhancers (Extended Data Fig. 3e). H3K9me1 DNase DGF Chromatin states sometimes captured differences in RNA express- Input H3K4me3 ion that are missed by DNA methylation or accessibility. For example, H3K9ac H3K56ac H2A.Z TxFlnk, Enh, TssBiv and BivFlnk states show similar distributions of H2AK9ac H2BK5ac H3K4me2 DNA accessibility but widely differing enrichments for expressed genes H3K18ac H3K4me1 (Fig. 4c, d). Enh and ReprPC states show intermediate DNA methyla- H3K27ac H4K5ac H4K8ac tion, but very different distributions of DNA accessibility and different H3K4ac H3K14ac H3K23ac enrichments for expressed genes (Fig. 4c–e). Lack of DNA methylation,
IMR90 fetal lung f broblasts H2AK5ac H4K91ac typically associated with de-repression, is associated with both the active H2BK120ac H2BK12ac H2BK15ac TssA promoter state and the bivalent TssBiv and BivFlnk states. Bivalent H2BK20ac H3K27me3 H3K9me3 states TssBiv and BivFlnk also show overall lower DNA methylation WGBS Hi-C and higher DNA accessibility than enhancer states Enh and EnhG, and Roadmap Epigenomics Consortium 2015 Nature cd binding by both activating and repressive regulatory factors (Extended H3K4me1 Data Fig. 2b). These results also held for alternative methylation mea- surement platforms (Extended Data Fig. 4a–c), and for the 18-state chro-
33 data sets in IMR90 lung fbroblasts matin state model (Extended Data Fig. 4d, e). Overall, these results H3K4me3 highlight the complex relationship between DNA methylation, DNA
semonegipe ecnere semonegipe accessibility and RNA transcription and the value of interpreting DNA methylation and DNA accessibility in the context of integrated chro- DNase matin states that better distinguish active and repressed regions. Given the intermediate methylation levels of tissue-specific enhan- fer 721 fer cer regions, we directly annotated intermediate methylation regions, RNA-seq 31,46 WGBS based on 25 complementary DNA methylation assays of MeDIP and MRE-seq22,39 from 9 reference epigenomes47. This resulted in more Genome-wide measurements for all marks H3K4me1 than 18,000 intermediate methylation regions, showing 57% CpG meth- WGBS H3K4me3 ylation on average, that are strongly enriched in genes, enhancer chro- DNase Individual mark data sets across epigenomes RNA-seq matin states (EnhBiv, EnhG, Enh) and evolutionarily conserved regions. Chromatin states Intermediate methylation was associated with intermediate levels of Figure 3 | Epigenomic information across tissues and marks. a, Chromatin active histone modifications and DNase I hypersensitivity. Near TSSs, state annotations across 127 reference epigenomes (rows, Fig. 2) in a ,3.5-Mb intermediate methylation correlated with intermediate gene expres- region on chromosome 9. Promoters are primarily constitutive (red vertical sion, and in exons it was associated with an intermediate level of exon lines), while enhancers are highly dynamic (dispersed yellow regions). inclusion47. Intermediate methylation signatures were equally strong b, Signal tracks for IMR90 showing RNA-seq, a total of 28 histone modification within tissue samples, peripheral blood and purified cell types, suggest- marks, whole-genome bisulfite DNA methylation, DNA accessibility, digital ing that intermediate methylation is not simply reflecting differential genomic footprints (DGF), input DNA and chromatin conformation information72. c, Individual epigenomic marks across all epigenomes in which methylation between cell types, but probably reflects a stable state of they are available. d, Relationship of figure panels highlights data set dimensions. cell-to-cell variability within a population of cells of the same type. Epigenomic differences during lineage specification accessibility (Extended Data Fig. 3a), lower methylation (Extended Data We next studied the relationship between DNA methylation dynam- Fig. 3b) and higher transcription factor binding (Extended Data Fig. 2c) ics and histone modifications across 95 epigenomes with methylation than enhancers lacking H3K27ac. In a subset of 7 epigenomes with an data, extending previous studies that focused on individual lineages19,48–50. average of 24 epigenomic marks, we learned separate 50-state chro- We found that the distribution of methylation levels for CpGs in some matin state models based on all the available histone marks and DNA chromatin states varied significantly across tissue and cell type (Fig. 4g, accessibility in each epigenome (Supplementary Fig. 4), which addi- Extended Data Fig. 4f and Supplementary Table 4a). For example, tionally distinguished: a DNase state with distinct transcription factor TssAFlnk states were largely unmethylated in terminally differentiated binding enrichments (Supplementary Fig. 4f), including for mediator/ cells and tissues, but frequently methylated for several pluripotent and cohesin components43 (even though CTCF was not included as an input embryonic-stem-cell-derived cells (Bonferroni-corrected F-test P , 0.01);
320 | NATURE | VOL 518 | 19 FEBRUARY 2015 ©2015 Macmillan Publishers Limited. All rights reserved Tissues have unique epigenomes (chromatin states) RESEARCH ARTICLE
Oesophagus Brain RESEARCH ARTICLE Heart Angular gyrus Aorta Anterior caudate Left ventricle Brain Spinal cord Cingulate gyrus Right ventricle Stomach Right atrium Hippocampus middle Thymus
Thymus E017 Adrenal E002Heart Inferior temporal lobe a IMR90 E008 track to learn the model) and repressor NRSF; transcribed states show- E001 E015 Aorta E014 Kidney Lung E016 Substantia nigra ES cell E003 Right, left, E024 E020Lung E019 Renal cortex, ing H3K79me1 and H3K79me2 and associated with the 59 ends of genes Adipose E018 Dorsolateral iPSC Right,E021 left E022 Renal pelvis E007 E009 Prefrontal cortex E010 Breast CordE013 blood ES-deriv. E012 Small intestine and introns; and a large number of putative regulatory and neighbour- Myoepithelial E011 + Blood B cellsE004 (CD19 ) + E005 vHMEC Stem cells (CD34 ) E006 + T cellsE062 (CD3 ) Large intestine + E034 Progenitor enriched B cells (CD19 ) E045 E033 ing regions showing diverse acetylation marks even in the absence of + + + E044 Luminal epithelial T cells (CD3 , CD4 , CD8 ) E043Liver E039 Skeletal muscle + Blood & E041 Granuloytes (CD15 ) E042 Duodenum mucosa E040 Back, trunk, arm, leg PBMCs T cell SpleenE037 E048 the H3K4 methylation signatures characteristic of enhancer and pro- E038 + E047 Liver NK cells (CD56 ) E029 Gonad E031 PlacentaE035 HSC & E051 Ovaries, testes Stomach mucosa E050 Spleen E036 moter regions. E032 B cell E046 E030 Sigmoid colon E026 Duodenum smooth muscle E049 E025 Mesench. E023 Ovary E052 We used chromatin states to study the relationship between histone E055 Stomach E056 E059 E061 Smooth muscle E057 Colon Epithelial E058 E028 Smooth muscle E027 modification patterns, RNA expression levels, DNA methylation and E054 Kidney E053 Mucosa E112 E093 E071 19,23,44,45 E074 Pancreas E068 Osteoblasts E069 DNA accessibility. Consistent with previous studies , we found E072 E067 Small intestine Brain E073 E070 Rectum E082 E081 Smooth muscle Germinal matrixE063 Psoas muscle E100 low DNA methylation and high accessibility in promoter states, high E108 Mucosa E107 Muscle E089 E090 Muscle E083 E104 E095 Heart E105 DNA methylation and low accessibility in transcribed states, and inter- E065 E078 E076 E103 iPS cells Sm. musc. E111 E092 E085 6.9, 18c, 19.11, 20b, 15b E084 mediate DNAmethylation and accessibility inenhancer states (Fig. 4d, e E109 E106 E075 E101 Trophoblast Digestive E102 E110 E077 E079 and Extended Data Fig. 3a, b). These differences in methylation level E094 ES cells E099 E086 H1, H9, I3, W A7, HUES6, E088 E097 E087 HUES48, HUES64, 4star E080 Other E091 were stronger for higher-expression genes than for lower-expression E066 E098 E096 Neuronal progenitors E113
Chromatin state annotations in 127 epigenomes E114 E115 E116 E117 genes, leading to a more pronounced DNA methylation profile (Extended Mesodermal progenitors E118 Skin E119 Ganglion eminence E120 ES cell ENCODE E121 E122 Mesenchymal stem cells E123 Marrow derived Skin keratinocyte derived primary E124 2012 E125 Data Fig. 3c, Supplementary Fig. 5 and Supplementary Table 4f). Genes derived E126 E127 Skin fbroblasts Ectoderm cultured neurospheresE128 mesenchymal cells E129 Endoderm Cortex derived primary FAM205BChondrocytes ATP8B5P SIT1 NPR2 RECK RNF38SkinMELK melanocytes PAX5 GRHPR FRMPD1 SHB ALDH1B1 proximal to H3K27ac-marked enhancers show significantly higher expres- culturedChrom. neurospheres states RefSeq genes FAM205B ATP8B5P SIT1 NPR2 RECK RNF38 MELK PAX5 GRHPR FRMPD1 SHB ALDH1B1 RNA-seq sion levels (Extended Data Fig. 3d), and conversely, higher-expression Figure 1 | Tissues and cell types profiled in the Roadmap Epigenomics immuneb lineages,H3K36me3 ES cells and iPS cells, and differentiated lineages derived from Consortium. Primary tissues and cell types representative of all major lineages ES cells. BoxH4K20me1 colours match groups shown in Fig. 2b. Epigenome identifiers genes were significantly more likely to be neighbouring H3K27ac- Roadmap Epigenomics Consortium 2015 Nature H3K79me2 in the human body were profiled, including multiple brain, heart, muscle, (EIDs, Fig. 2c)H3K79me1 for each sample are shown in Extended Data Fig. 1. containing enhancers (Extended Data Fig. 3e). H3K9me1 gastrointestinal tract, adipose, skin and reproductive samples, as well as DNase DGF Chromatin states sometimes captured differences in RNA express- Input H3K4me3 ion that are missed by DNA methylation or accessibility. For example, expression. In addition, we study the role of regulatory regions in human 277 DNA methylationH3K9ac data sets, and 166 RNA-seq data sets, encom- H3K56ac disease by relating our epigenomic annotations to genetic variants asso- passing a totalH2A.Z of 150.21 billion mapped sequencing reads correspond- TxFlnk, Enh, TssBiv and BivFlnk states show similar distributions of H2AK9ac ciated with common traits and disorders. These analyses demonstrate ing to 3,174-foldH2BK5ac coverage of the human genome. H3K4me2 DNA accessibility but widely differing enrichments for expressed genes the importance and wide applicability of our data resource, and lead to Here, we focusH3K18ac on a subset of 1,936 data sets (Fig. 2) comprising 111 H3K4me1 (Fig. 4c, d). Enh and ReprPC states show intermediate DNA methyla- important insights into epigenomics, differentiation and disease. Specific reference epigenomesH3K27ac (Fig. 2a–d), which we define as having a core set H4K5ac highlights of our findings are given below. of five histoneH4K8ac modification marks (Fig. 2e). The five marks consist of: tion, but very different distributions of DNA accessibility and different H3K4ac . Histone mark combinations show distinct levels of DNA methyla- histone H3 lysineH3K14ac 4 trimethylation (H3K4me3), associated with pro- enrichments for expressed genes (Fig. 4c–e). Lack of DNA methylation, H3K23ac10,24 tion and accessibility, and predict differences in RNA expression moter regionsIMR90 fetal lung f broblasts H2AK5ac; H3 lysine 4 monomethylation (H3K4me1), associ- H4K91ac typically associated with de-repression, is associated with both the active H2BK120ac 10 levels that are not reflected in either accessibility or methylation. ated with enhancerH2BK12ac regions ; H3 lysine 36 trimethylation (H3K36me3), H2BK15ac TssA promoter state and the bivalent TssBiv and BivFlnk states. Bivalent . Megabase-scale regions with distinct epigenomic signatures show associatedH2BK20ac with transcribed regions; H3 lysine 27 trimethylation strong differences in activity, gene density and nuclear lamina asso- H3K27me3 25 (H3K27me3),H3K9me3 associated with Polycomb repression ; and H3 lysine 9 states TssBiv and BivFlnk also show overall lower DNA methylation ciations, suggesting distinct chromosomal domains. trimethylationWGBS (H3K9me3), associated with heterochromatin regions26. Hi-C and higher DNA accessibility than enhancer states Enh and EnhG, and . Approximately 5% of each reference epigenome shows enhancer and Selected epigenomes also contain a subset of additional epigenomic binding by both activating and repressive regulatory factors (Extended promoter signatures, which are twofold enriched for evolutionarily marks,cd including:H3K4me1 acetylation marks H3K27ac and H3K9ac, associated conserved non-exonic elements on average. with increased activation of enhancer and promoter regions27–29 (Fig.2f); Data Fig. 2b). These results also held for alternative methylation mea- . Epigenomic data sets can be imputed at high resolution from exist- DNase hypersensitivity7,18, denoting regions of accessible chromatin surement platforms (Extended Data Fig. 4a–c), and for the 18-state chro- ing data, completing missing marks in additional cell types, and commonly associated with regulator binding (Fig. 2g); DNA methyla- matin state model (Extended Data Fig. 4d, e). Overall, these results providing a more robust signal even for observed data sets. tion,typicallyH3K4me3 associated with repressed regulatory33 data sets regions in IMR90 or lung active fbroblasts gene . Dynamics of epigenomic marks in their relevant chromatin states transcripts4,30 and profiled using whole-genome bisulfite sequencing highlight the complex relationship between DNA methylation, DNA 19 20 allow a data-driven approach to learn biologically meaningful rela- (WGBS) ,reduced-representationbisulfitesequencing(RRBS)ecnere semonegipe , and accessibility and RNA transcription and the value of interpreting DNA tionships between cell types, tissues and lineages. mCRF-combined31 methylation-sensitive restriction enzyme (MRE)22 methylation and DNA accessibility in the context of integrated chro- . Enhancers with coordinated activity patterns across tissues are enriched and immunoprecipitationDNase based21 assays (Fig. 2h); and RNA expres- for common gene functions and human phenotypes, suggesting that sion levels8, measured using RNA-seq and gene expression microarrays matin states that better distinguish active and repressed regions. they represent coordinately regulated modules. (Fig. 2i). Our definition of 111 reference epigenomes is very similar to Given the intermediate methylation levels of tissue-specific enhan- . Regulatory motifs are enriched in tissue-specific enhancers, enhancer that used by the International Human721 Epigenome fer Consortium (IHEC), cer regions, we directly annotated intermediate methylation regions, modules and DNA accessibility footprints, providing an important which requiredRNA-seq RNA-seq, WGBS and H3K27ac that are only available 31,46 resource for gene-regulatory studies. in a subset of epigenomes here. Lastly, an additional 16 histone modi- WGBS based on 25 complementary DNA methylation assays of MeDIP 22,39 47 . Genetic variants associated with diverse traits show epigenomic enrich- fication marks on average were profiled across 7 deeply covered cell and MRE-seq from 9 reference epigenomes . This resulted in more ments in trait-relevant tissues, providing an important resource for types (Fig. 2j). Genome-wide measurements for all marks H3K4me1 than 18,000 intermediate methylation regions, showing 57% CpG meth- understanding the molecular basis of human disease. We jointlyWGBS processed and analysed our 111 reference epigenomes H3K4me3 ylation on average, that are strongly enriched in genes, enhancer chro- 9,23 DNase with 16Individual mark data sets across epigenomes additional epigenomes from ENCODE .Wegeneratedgenome- Reference epigenome mapping across tissues and cell types RNA-seq matin states (EnhBiv, EnhG, Enh) and evolutionarily conserved regions. wide normalized coverage tracks, peaks and broad enriched domainsChromatin states The REMCs generated a total of 2,805 genome-wide data sets, includ- for ChIP-seq and DNase-seq7,32, normalized gene expression values for Intermediate methylation was associated with intermediate levels of 33 31,34,35 ing 1,821 histone modification data sets, 360 DNA accessibility data sets, RNA-seqFigure, and 3 | fractionalEpigenomic methylation information levels for across each CpG tissues site and. marks. a, Chromatin active histone modifications and DNase I hypersensitivity. Near TSSs,
318 | NATURE | VOL 518 | 19 FEBRUARY 2015 state annotations across 127 reference epigenomes (rows, Fig. 2) in a ,3.5-Mb intermediate methylation correlated with intermediate gene expres- ©2015 Macmillan Publishers Limited.region All rights on reserved chromosome 9. Promoters are primarily constitutive (red vertical sion, and in exons it was associated with an intermediate level of exon lines), while enhancers are highly dynamic (dispersed yellow regions). inclusion47. Intermediate methylation signatures were equally strong b, Signal tracks for IMR90 showing RNA-seq, a total of 28 histone modification within tissue samples, peripheral blood and purified cell types, suggest- marks, whole-genome bisulfite DNA methylation, DNA accessibility, digital ing that intermediate methylation is not simply reflecting differential genomic footprints (DGF), input DNA and chromatin conformation information72. c, Individual epigenomic marks across all epigenomes in which methylation between cell types, but probably reflects a stable state of they are available. d, Relationship of figure panels highlights data set dimensions. cell-to-cell variability within a population of cells of the same type. Epigenomic differences during lineage specification accessibility (Extended Data Fig. 3a), lower methylation (Extended Data We next studied the relationship between DNA methylation dynam- Fig. 3b) and higher transcription factor binding (Extended Data Fig. 2c) ics and histone modifications across 95 epigenomes with methylation than enhancers lacking H3K27ac. In a subset of 7 epigenomes with an data, extending previous studies that focused on individual lineages19,48–50. average of 24 epigenomic marks, we learned separate 50-state chro- We found that the distribution of methylation levels for CpGs in some matin state models based on all the available histone marks and DNA chromatin states varied significantly across tissue and cell type (Fig. 4g, accessibility in each epigenome (Supplementary Fig. 4), which addi- Extended Data Fig. 4f and Supplementary Table 4a). For example, tionally distinguished: a DNase state with distinct transcription factor TssAFlnk states were largely unmethylated in terminally differentiated binding enrichments (Supplementary Fig. 4f), including for mediator/ cells and tissues, but frequently methylated for several pluripotent and cohesin components43 (even though CTCF was not included as an input embryonic-stem-cell-derived cells (Bonferroni-corrected F-test P , 0.01);
320 | NATURE | VOL 518 | 19 FEBRUARY 2015 ©2015 Macmillan Publishers Limited. All rights reserved Table 1. Summary of DNA sequences with methylation changes identified by AIMS in MZ twin pairs
CpG methylation,* % SEE COMMENTARY No. Locus Accession Function Chr. loc. CpGs Twin A Twin B Change
Alu-Sx AC006271 — 19p13.2 30 72.1 55.3 16.8 Alu-Sp U14572 — 19p13ϩ3 17 68.1 29.9 38.2 Alu-E2F3 AF547386 — 6p22 2 81.8 100 18.2 PKD1P2 NGϽ002795 Polycystic kidney disease 1 16p13 7 90.9 83.5 7.4 Alu-Sc U14571 — 8p11ϩ1 4 66.6 63.3 3.3 GUK1 BC006249 Guanylate kinase 1 1q42 18 2.8 9.7 6.9
Chr. loc., chromosome location; —, unknown. *Twelve clones per locus.
we performed ANOVA (see Table 4, which is published as sup- single-copy genes. To confirm that these sequences featured DNA porting information on the PNAS web site). ANOVA was used to methylation differences in the twins, we carried out bisulfite compare two parameters: individual epigenetic values, to compare genomic sequencing of multiple clones. The analysis of four dif- epigenetic variability in the entire population, and ESD between ferent Alu sequences and two single-copy genes demonstrated that twins, as a measure of variability between twin pairs. First, we in those MZ twin pairs from which they were isolated, one sibling analyzed the descriptive epigenetic values for each individual and had dense CpG hypermethylation, whereas the other was predom- compared it with the rest of the population, organized into young inantly hypomethylated at that particular sequence (Fig. 2B). Most (Ͻ28 years old) vs. old (Ͼ28 years old) age-groups. Statistical importantly, for both Alus and single-copy genes, differential Epigeneticanalysis of individual descriptive parameters differences provides information methylation arise was associated over with a different life expression time of that about variability within the whole population and in the two age particular sequence in the MZ twin pair, the presence of DNA groups. Second, we used the ESDInteractions to test whether older vs. youngerwith themethylation environment being associated with silencing or reduced expression. MZ twins are significantly more different within their pairs. We Table 1 summarizes the results. found that the epigenetic variability among individuals is high and
similar (see Table 5, which is published as supporting information MEDICAL SCIENCES on the PNAS web site), regardless of the age group to which individuals belong (Pearson test, P Ͼ 0.05). In contrast, the variance corresponding to the ESD in the older MZ twin group is signifi- cantly higher than that obtained for the younger group (Pearson test, P Ͻ 0.05). These results suggest that older twins are epige-Chr1 netically more different between pairs than younger twins, and this difference is not associated with an increased variance in the descriptive epigenetic parameters of the older population. Finally, we also found that those twin pairs who, according to the questionnaire, had spent less of their lifetime together andϽor had amoredifferentnaturalhealth–medicalhistorywerethosewho also showed the greatest differences in levels of 5mC DNA and acetylation of histones H3 and H4 levels (Pearson test, P Ͻ Chr30.05). Genomic Screening and Loci Identification of DNA Methylation Dif- ferences in MZ Twin Pairs. We next examined where in the MZ twin genomes these epigenetic differences arose by using a global methylation DNA fingerprinting technique, AIMS (9). The AIMS approach provides a methylation fingerprint constituted by multiple anonymous bands or tags, representing DNA sequences flankedChr12 by two methylated sites, which can be isolated. An illustrative AIMS result in a MZ twin pair is shown in Fig. 2A.Approximately600 AIMS bands were resolved in the gels, and we found that between 0.5% and 35% of the bands were different (on the basis of their presence or absence) within MZ twin pairs. Those MZ twins with the most differential AIMS bands were those with the greatestChr17 differences in 5mC DNA levels and acetylation levels of histones H3 and H4 (Pearson test, P Ͻ 0.05). Most importantly, the twin pairs with the most differential AIMS bands corresponded to MZ twins 3-year old twins 50-year old twins who were older,Monozygotic had spent less of their twins lifetimes together, or had Fig. 3. Mapping chromosomal regions with differential DNA methylation in different natural health–medical histories (Pearson test, P Ͻ 0.05). MZ twins by using comparative genomic hybridization for methylated DNA. We then selected a subset of 53 AIMS bands differentially Competitive hybridization onto normal metaphaseMethylation chromosomes of the AIMS present in MZ twin pairs for further characterization. These bandsFraga etproducts al 2005 generated PNAS from 3- and 50-year-old twin pairs. Examples of the hybrid- were cloned, sequenced, and blasted against multiple sequence ization of chromosomes 1, 3, 12, and 17 are displayed. The 50-year-old twin pair databases. We found that 43% (23 of 53) of the clones matched Alu shows abundant changes in the pattern of DNA methylation observed by the presence of green and red signals that indicate hypermethylation and hypom- sequences (mainly from the Alu 6, Alu 7, and Alu 8 subfamilies), ethylation events, whereas the 3-year-old twins have a very similar distribution of 9% (5 of 53) matched other repetitive sequences (2 LINEs, 2 MER, DNA methylation indicated by the presence of the yellow color obtained by equal and 1 MIR), 34% (18 of 53) matched ESTs deposited in databases, amounts of the green and red dyes. Significant DNA methylation changes are and 13% (7 of 53) of the clones corresponded to identified indicated as thick red and green blocks in the ideograms.
Fraga et al. PNAS Ͼ July 26, 2005 Ͼ vol. 102 Ͼ no. 30 Ͼ 10607 Epigenetic Predictor of Age
MassArray (Sequenom) for the Edaradd gene and by pyrosequenc- model was fit on all but one subject and its prediction was related ing for NPTX2 and Tom1L1. For NPTX2, the pyrosequencing to the truly observed age of the left-out subject. The predicted method provided methylation data for five additional CpG sites in values are highly correlated with the observed age in males the promoter.Molecular The results of Cell the validation experiments correlated (r = 0.83, p = 3.3610213, n = 47, Figure S2), females (r = 0.75, very strongly with the array data for all three genes (Edaradd p = 2.461024, n = 19, Figure S3), and in the combined sample r = 0.96,Genome-wide NPTX2 r = 0.92, Tom1L1 Methylationr = 0.90, n = 23), Profilesproviding a and(r = 0.83, Humanp = 2.2610 Aging216, n = 66, Figure 3). For the male only or technical replication of the array data in the twin sample. The female only models, the average absolute differences between the correlation between the degree of methylation and age of all three predicted and the observed age (the error) are 5.3 years and 6.2 genes was preserved in the subset of twins and was also found in the years, and for the combined sample this is 5.2 years. Even when independent male sample, providing a biological replication. In only the male and female replication samples were used, females, Edaradd and Tom1L1 were significantly correlated with discarding all twin data, the accuracy of the model remained at age, but NPTX2Molecular was not. The correlation Cell results are shown in 5.3 years, and the predicted values correlated highly with the 2 Figure 2. A multivariate linear regression model using Edaradd, observed age (r = 0.85, p = 1.701610 13, n = 45, Figure S4). Edaradd squaredGenome-wide and NPTX2 showed that these Methylation two markers To Profiles test whether additional and data Human pointsexample, on the Aging microarrayFigure could 2B highlights two individuals whose age is explain 76% (or R2 = 0.76) of the variance in age of males and 70% improve the accuracy of the model, we performedvastly over- lasso penalized or underpredicted on the basis of their methylation in females. When considering males and females together the model regression to screen for the top predictors of age [13,14]. The top explained 73% of the variance in age. five predictors were tested, and onlydata. three To were examine found to whether these differencesMolecular reflect Celltrue biolog- contribute significantly to the regression model:ical differences Edaradd, NPTX2, in the state of the individual (i.e., versus measure- A leave-one-out analysis forms an accurate epigenetic and ELN. The first two predictors were alreadyGenome-wide part of the model. Methylation Profiles and Human Aging predictor of age Using the microarray methylation datament for these error two genes, or the intrinsic variability), we used the aging model to Epigenetic drift is anaverage indicator error is 4.7 years (r = 0.77, p = 1.029 6of10207, nage= 34). To provide an unbiased estimate of predictive accuracy for age, Adding the ELN methylation data improvedquantify the accuracy each of our individual’s apparent methylomic aging rate we used a leave-one-out analysis where the multivariate regression model, reducing the average error(AMAR), to 3.5 years defined (r = 0.87, as the ratio of the predicted age, based on p = 2.2610211, n = 34, Figure S5). Results were nearly identical example, Figure 2B highlights two individuals whose age is methylation data, to the chronological age. We then tested for when all twin samples were treated as unrelated individuals, and vastly over- or underpredicted on the basis of their methylation Edaradd when averaged values for each pair wereassociations used. The distribution between of AMAR and possibly relevant clinical methylation values for ELN was considered too narrow for further validation using pyrosequencing or MassArrayfactors, analysis. including genderdata. and To examineBMI. Analysis whether of ethnicity these and differences reflect true biolog- diabetes status was not possible due to correlations with batch Discussion ical differences in the state of the individual (i.e., versus measure- variables (Figure S3). We found that gender, but not BMI had In this high density, genomewide screen of CpG methylation of ment error or intrinsic variability), we used the aging model to 6 twins, we identified 88 CpG sites nearsignificant 80 genes for which contributions the to aging rate (F test, p = 6 3 10Ͻ , percent methylation in saliva is significantly correlated with age. quantify each individual’s apparent methylomic aging rate These are highly enriched for genes knownp > 0.05,to influenceExperimental age- Procedures). The methylome of men related diseases—mainly cardiovascularappeared and neurological to disease. age approximately(AMAR), defined 4% faster as than the that ratio of women of the predicted age, based on NPTX2 Ten of these 88 CpG sites were shown earlier to be correlated with age in whole blood and in isolated CD4+(Figureand CD14+ 2cellsD), as even well thoughmethylation the overall data, distributions to the of chronological age were age. We then tested for [8]. We validated three genes in a samplenot of unrelated significantly males and different between the men and women in the females, which confirmed our findings in these replicate samples. associations between AMAR and possibly relevant clinical Remarkably, the methylation values forcohort the validated (p genes > 0.05, are KSfactors, test). Likewise, including the gender validation and cohort BMI. Analysis of ethnicity and linear with age over a span of five decadesconfirmed and in three the separate increased aging rate for men (p < 0.05), but was sample sets. Based on this observation, we were able to build a diabetes status was not possible due to correlations with batch model that can predict the age of ainconclusive subject based on for the BMI (p > 0.05). This complements a previous
% Methylation n=656 methylation status of just two cytosines in the genome, explaining variables (Figure S3). We found that gender, but not BMI had 73% of the variance in age. finding of an epigenetic signal for BMI that does not change 6 Tom1L1 Of the validated genes, Neuronalwith Pentraxin age II (Feinberg (NPTX2) etsignificant al., 2010). contributions to aging rate (F test, p = 6 3 10Ͻ , methylation has been shown to be upregulated in pancreatic cancer [15], and its expression is increasedAs in Parkinson’s genetic disease associationsp > 0.05, have beenExperimental previously reported Procedures with ). The methylome of men [16]. Its methylation status was recentlyhuman shown to belongevity correlated and aging phenotypes (Atzmon et al., 2006; with age in blood as well [8]. Mutations in the Edar associated appeared to age approximately 4% faster than that of women death domain (Edaradd) can cause loss ofSuh hair, et sweat al., glands, 2008 and; Willcox et al., 2008; Wheeler et al., 2009), we teeth [17], and it can reduce the speedexamined of wound healing whether [18]. the(Figure model 2 couldD), even distinguish though aging the rates overall for distributions of age were Further research should focus on their role in ageing, and age- related diseases. individuals with differentnot genetic significantly variants. different For this purpose, between we the men and women in the The lack of epigenetic drift withinobtained each monozygotic whole-exome pair sequences for 252 of the individuals in Figure 2. Percentage methylation versus age for three markers contrasts with a previous study [3]. The main difference between cohort (p > 0.05, KS test). Likewise, the validation cohort validated in three sampleAge sets. Original twin samples are blue, male the two studies is that we focused on CpGour sites methylome close to functional study at 153 coverage. After sequence process- controlFigure samples are 2. red, Model female control Predictions samples green. and Linear Clinical trendlines Variablesgene transcription start sites whereas Fraga and colleagues confirmed the increased aging rate for men (p < 0.05), but was are shown in the colors of the individual sample sets a) Edaradd investigated random sites, most of whichFigureing were 4. and located Multitissue quality in non- Support control, these sequences yielded 10,694 Bocklandtr = 2 et0.81(A) al (twins), A 2011 flowr = 2 chart 0.73PLoS (male of controls),theONE datar = 2 (green0.75 (female boxes) controls) and analyses (red ovals)Hannum used to et al 2013 Molecularinconclusive Cell for BMI (p > 0.05). This complements a previous b) NPTX2 rFigure= 0.52 (twins), 3. Geneticr = 0.79 (male Effects controls), on Methylomicr = 0.03 (female Agingfunctional repeated sequences (e.g., Alu(A) repeats).common Predictions This suggests of single-nucleotide age that made by the full agingvariants model across on the TCGA the control population controls)generate c)(A) Tom1L1 We aging surveyedr = 20.70 predictions (twins), genomicr = (blue2 variants0.49 boxes). (male for controls), an associationwhile drift with may age-associated occur randomly withsamples. age in non-coding, There is a repeat- high correlation between chronological and predicted age, rich DNA regions, the critical regulatory(Experimental portions of the genome Proceduresfinding). As of a negative an epigenetic control, we signal confirmed for BMI that does not change r = 20.24(B) (female Amethylation comparison controls). markers. of predicted Eight genetic and actual variants, ages corresponding for all individuals to 14 based meQTLs, on the but each tissue has a different linear intercept and slope. doi:10.1371/journal.pone.0014821.g002 remain under strict epigenetic control throughout life. agingwere model. chosen for validation. Of these, seven were significant in the validation (B)that After adjusting none of the the intercept geneticwith and slope variants age of each (Feinberg were tissue, significant the error et of al., the predictors model 2010). of (C) Out-of-samplecohort and two showed predictions an association for individuals with AMAR. in the validation cohort. is similarage itself, to that which of the original is to be whole-blood expected data. since Age predictions the genome made sequence on PLoS ONE | www.plosone.org 3 June 2011 | Volume 6 | Issue 6 | e14821 As genetic associations have been previously reported with (D) Apparent(B) A plot of methylomic the trend between aging rate the methylation (AMAR) for marker each individual, cg27367526 based (STEAP2) on the canceris considered samples are presented to be relatively in Figure S2 static. over the course of a lifetime. agingand model age. The without state clinical of variant variables. rs42663 The (GTPBP10) distribution causes of aging an offset rates in shows this (C)On Age the predictions other madehand, on one matchedhuman might normal expect longevity and tumor to find samples and genetic from aging variants TCGA. phenotypes that (Atzmon et al., 2006; relationship. Predictions are adjusted for the linear offset of the parent tissue (breast, faster aging for men than women. A table of the markers used in the aging modulate the methylationSuh of et age-associated al., 2008; Willcox markers, et i.e., al., meth- 2008; Wheeler et al., 2009), we model(C) Ais second provided example in Table for S3 cg18404041. and rs2230534 (ITIH1, NEK4). kidney, lung, or skin). (D)ylation Tumor samples quantitative-trait show a significant loci increase or meQTLs in AMAR. (Bell et al., 2011). Testing SeeSee also alsoFiguresTable S2 S4 andfor a S3 tableand ofTable confirmed S3. genetic associations. examined whether the model could distinguish aging rates for Seeeach also Figure genetic S4 and variantTable forindividuals S5. association with with the different top age-associated genetic variants. For this purpose, we DNA. This meQTL thus captures a cis relationship in which methylation markers,obtained we identified whole-exome 303 meQTLs ( sequencesExperimental for 252 of the individuals in Wers140692 validated influences this model the on methylation the secondary state cohort, of MBD4 consisting. That DNAProcedures damage through, FDR < oxidative 0.05, Figure stress 3 inA). mammalian For validation, cells ( weHart- selected ofMBD4 an additionalplays a role 174 in independent human aging samples. is supported These by previous samples wigeight and genetic Schlepegrell, variants 1995our (corresponding; methylomeKarthikeyan et to study al., 14 2002 meQTLs) at). 15 These3 tocoverage. test in After sequence process- wereworkFigure processed linking 2.MBD4 Modelin theto same DNA Predictions repair, manner as as well and the as Clinical primary work showing cohort Variables that and meQTLsa validation represent cohort genetic ofing 322 variants individuals and that quality appear from our to control, broadly methylation influ- these study. sequences yielded 10,694 weremutations(A) then A flow used and chart knockdowns to predict of the ageof dataMBD4 based (greenlead on to boxes) increased the original and genomic analyses model (redenceThis ovals) the analysis aging used methylome found to thatcommon and seven may of besingle-nucleotide eight good genetic candidates variants for (corre- variants across the population instabilitygenerate (Bellacosa aging predictions et al., 1999; (blueBertoni boxes). et al., 2009). further age-associated disease and longevity research. (i.e., as trained on the original cohort). The predictions were sponding to seven meQTLs)(Experimental remained Procedures highly significant). As in a the negative control, we confirmed highlyOf(B) accurate, the A comparison seven withvalidated a of correlation meQTLs,predicted three between and were actual age identified ages and for predicted that all had individualsvalidation based cohort on the (FDR < 0.05, Table S4). While all of these vari- agea of statisticallyaging 91% andmodel. significantan error of association 4.9 years (Figure not only 2C). with The age significance but also A Multitissueants acted Diagnostic in cis withthat their none meQTLs of the (within genetic 150 variants kbp), we were significant predictors of of thewith(C) aging aging Out-of-sample model rate (AMAR, was also predictions FDR confirmed < 0.05, forFigures by individuals the 3 dataB and set in 3C). presented the One validation is Ourconfirmed cohort. aging model that was none derived directlyage from itself, modified whole which blood, the CpG is which to site be is oradvan- expected associated since the genome sequence the genetic marker rs2230534, which is a synonymous mutation tageous in the design of practical diagnostics and for testing in Heyn(D) Apparent et al., verifying methylomic the age aging association rate (AMAR) of 70 for ofeach the individual, 71 probe based sequence on the of the associated methylation marker. in the gene NEK4, and has a cis association with the methylation samples collected fromis other considered studies. To to investigate be relatively whether static over the course of a lifetime. markersaging (Heyn model et al., without 2012 clinical). Furthermore, variables. the The model distribution was able of agingThe rates methylation shows marker cg27193080 was one of those found marker cg18404041. The NEK family of kinases plays a key role our aging model was representativeOn the other of other hand, tissues, one17 might we ob- expect to find genetic variants that to fully separate old and young individuals in the Heyn et al. to be significantly associated with age (p < 10Ͻ ), and its meth- infaster cell-cycle aging regulation for men and than cancer women. (Moniz A table et al., of 2011 the). markers The tained used DNA in the methylation aging profilesmodulate for 368 the individuals methylation in the control of age-associated markers, i.e., meth- study,secondmodel even variant for is provided profiles is rs2818384, obtained in Table which via S3. bisulfate is a synonymous sequencing mutation rather categoryylation fractionof The Cancer was found Genome to be Atlasinfluenced (TCGA) by ( theCollins single-nucleo- and ylation quantitative-trait21 loci or meQTLs (Bell et al., 2011). Testing thanin theSee gene bead-chip alsoJAKMIP3Figures technologyand S2 and has S3a usedcisandassociation inTable this study S3 with. (Figure the methyl- S2). Barker,tide polymorphism 2007), including (SNP) 83 breast, variant 183 rs140692 kidney, (p 60 < lung, 10Ͻ and)(Figure 42 3B). ation marker cg05652533. Copy-number variants in JAKMIP3 skinThis samples. meQTL An was aging particularly modeleach based genetic interesting on both variant as our both primary for the association SNP and and the with the top age-associated Methylomehave been Aging previously Rate associated and Its Associations with glioblastoma (Xiong validationmethylation cohorts marker demonstrated mappedmethylation tostrong the markers, predictivegene methyl-CpG power we identified for binding 303 meQTLs (Experimental et al., 2010). The final variant found to influence AMAR is chronological age in these samples (expected value R = 0.72), While theWe aging validated model is able this to model predict on the the age secondary of most individ- cohort,domain consisting protein 4 (MBD4Procedures, with the SNP, FDR in an < intron 0.05, andFigure the meth- 3A). For validation, we selected ualsrs42663, with high which accuracy, is a missense it is equally mutation valuable in the as gene a toolGTPBP10 for identi- althoughylation eachmarker tissue just upstream had a clear of the linear coding offset region), (intercept one and of the few fyingandof individual associates an additional outliers with cg27367526 who 174 do not independentin followthe gene theSTEAP2. expectation. samples. STEAP2 For Theseslope)known from samples genes the expectation encodingeight (Figure a protein genetic 4A). that This variants canoffset bind was (corresponding to consis- methylated to 14 meQTLs) to test in is knownwere to processed play a role in in maintaining the same homeostasis manner ofas iron the and primarytent within cohort a tissue, and evena across validation different cohort batches of of 322 the TCGA individuals from our methylation study. copper—metals that serve as essential components of the mito- data. We adjusted for each tissue trend using a simple linear were then used to predict age based on the original model This analysis found that seven of eight genetic variants (corre- chondrial respiratory chain (Ohgami et al., 2006). Studies have Molecularmodel, producing Cell 49, 359–367, age predictions January with 24, 2013 an errorª2013 comparable Elsevier Inc.to 361 shown(i.e., that as perturbations trained on of the iron original concentrations cohort). can induce The predictionsthat found in blood were (Figuresponding 4B). Furthermore, to seven predicted meQTLs) AMARs remained highly significant in the highly accurate, with a correlation between age and predicted validation cohort (FDR < 0.05, Table S4). While all of these vari- 362ageMolecular of 91% Cell and49, 359–367, an error January of 4.9 24, years 2013 ª (2013Figure Elsevier 2C). Inc. The significance ants acted in cis with their meQTLs (within 150 kbp), we of the aging model was also confirmed by the data set presented confirmed that none directly modified the CpG site or associated in Heyn et al., verifying the age association of 70 of the 71 probe sequence of the associated methylation marker. markers (Heyn et al., 2012). Furthermore, the model was able The methylation marker cg27193080 was one of those found 17 to fully separate old and young individuals in the Heyn et al. to be significantly associated with age (p < 10Ͻ ), and its meth- study, even for profiles obtained via bisulfate sequencing rather ylation fraction was found to be influenced by the single-nucleo- 21 than the bead-chip technology used in this study (Figure S2). tide polymorphism (SNP) variant rs140692 (p < 10Ͻ )(Figure 3B). This meQTL was particularly interesting as both the SNP and the Methylome Aging Rate and Its Associations methylation marker mapped to the gene methyl-CpG binding While the aging model is able to predict the age of most individ- domain protein 4 (MBD4, with the SNP in an intron and the meth- uals with high accuracy, it is equally valuable as a tool for identi- ylation marker just upstream of the coding region), one of the few fying individual outliers who do not follow the expectation. For known genes encoding a protein that can bind to methylated
Molecular Cell 49, 359–367, January 24, 2013 ª2013 Elsevier Inc. 361 ARTICLES
a Figure 1 Maternal care alters cytosine 1 11 14 15 16 17 18 19 110 11 2 methylation of GR promoter. (a) Sequence map of the exon 17 GR promoter including the 17 CpG dinucleotides (bold) and the NGFI-A binding Maternal behavior influences adult behaviorregion16 (encircled). (b,c) Methylation analysis of the 17 CpG dinucleotides of the exon 17 GR promoter region from adult high- and low-LG- through 1681 epigenetic programming ccc ABN offspring (6–10 clones sequenced/animal; 1 2 3 4 5 6 7 1741 ctctgctagtgtgacacactt cg cgcaactc cgcagttgg cggg cg cggaccacccctg c n =4 animals/group; *P < 0.01). (b) Percentage 1801 ggctctgc8cggctggctgtcaccct9cgggggctctggctgc10cgaccca11cgggg12cgggct 1861 c13cgag14cggtt ccaagcct15cggagtggg16cggggg17cgggagggagcctgggagaa of cytosine residues that were methylated (mean s.e.m.) for the first 15 CpG dinucleotides Non-attentiveLow LG-ABN mothers± (*P < 0.05). (c) Percentage of methylated 5« 3« AttentiveHigh LG-ABN mothers 1st week of life cytosines (mean ± s.e.m.)ARTICLES for the 5′ (site 16) and bc* 3′ (site 17) CpG dinucleotides within the NGFI-A 100 Low-LG/ABN 100 binding sequence (*P < 0.0001). (d) The effect * * High-LG-ABN of cross-fostering the offspring of high- and low- 80 80 ing (>3 fold) of NGFI-A protein to the hippocampal exon 17 GR * * LG-ABN mothers on cytosine methylation of the promoter in the adult offspring of60 TSA-treated low-LG-ABN moth- 60 5′ and 3′ CpG dinucleotides within the NGFI-A * * binding sequence of the exon 17 GR promoter ers compared with the vehicle-treated40 offspring* of low-LG-ABN 40 gene in adult hippocampi (n =5 animals/group). mothers (Fig. 3); there were no significant differences between TSA- L-L: animals born to and reared by low-LG-ABN C-methylation (%) C-methylation (%) 20 20 mothers; H-H: animals born to and reared by treated offspring of low-LG-ABN mothers and either TSA- or vehi- high-LG-ABN mothers; H-L: animals born to 0 0 cle-treated offspring of high-LG-ABN1234 dams.56789101112131415 As expected, TSA 5« 3« high-LG-ABN mothers and reared by low-LG-ABN Glucocorticoid Receptor treatment did not change histone H3-K9 acetylationRegion or NGFI-A (GR) in offspring promoter CpG dinucleotide mothers; L-H: animals born to low-LG-ABN mothers and reared by high-LG-ABN mothers. binding in the adult offspring of high-LG-ABN mothers, because ( ) Percentage of cytosine methylation (mean deLow-LG/ABN e ± High-LG/ABN s.e.m.) of the 5 and 3 CpG dinucleotides within the GR exon 17 promoterhttp://www.nature.com/natureneuroscience region in the offspring of high-LG-ABN ′ ′ 5« CpG dinucleotide 3« CpG dinucleotide mothers is normally associated with acetylated histones and highly 5« CpG dinucleotide 3« CpG dinucleotide the NGFI-A binding region of the exon 17 GR 100 promoter gene in the offspring of high- or low- 100 100 100 bound with NGFI-A. 80 80 80 80 LG-ABN mothers (n =5 animals/group; 60 To determine whether TSA60 treatment reverses60 the maternal effect 60 P < 0.001) as a function of age. There were no 40 40 40 40 * differences at any postnatal age in level of 20 20 20 * * 20
on methylation within specific CpG dinucleotides on the exon 1 expression 7 in offspring cytosine methylation of the 3′ CpG (site 17). 0 0 0 GR promoter 0 C-methylation (%) Jay Smith/DISCOVERC-methylation (%) GR promoter, we mapped the differencesL-L H-H H-L in L-H methylationL-L H-H H-L using L-H the E20 P1 P6 P21 P90 E20 P1 P6 P21 P90 sodium bisulfite technique, focusing on the NGFI-A consensus Age (d) sequence within the exon 17 region (Fig. 1a). Statistical analysis of Weaver et al 2004 Nature Neuroscience the data across all 17 sites revealed a significant effect of Group adulthood. Gene expression is controlled by the epigenome, which is sites of the exon 17 GR promoter sequence (Fig. 1b,c). A two-way (F = 93.2, P < 0.0001), Treatmentcomprised ( ofF = chromatin 52.8, P < structure0.0001)17 andand Region DNA methylation18.We ANOVA revealed a highly significant effect of Group (F = 55.9, (F = 30.4, P < 0.0001), ast estedwell theas ahypothesis significant that Group maternal × Trcareeatment alters DNA × methylation of P < 0.0001) and Region (F = 27.7, P < 0.0001), as well as a significant Region interaction (F = 2.1,the GRP =0 exon.01), 17 promoter, Group × andTreatment that these interac- changes are stably main- Group × Region interaction effect (F = 27.7, P <0.0001). ©2004 Nature Publishing Group Group Publishing Nature ©2004 tion (F = 19.9, P < 0.0001),tained Group into adulthood × Region and interaction associated with (F differences= 4.1, in GR expres- Importantly, the cytosine residue within the 5′ CpG dinucleotide sion and HPA responses to stress. (site 16) of the NGFI-A consensus sequence (Fig. 1c) is always P < 0.0001) and Treatment × Region interaction (F = 2.8, methylated in the offspring of low-LG-ABN mothers, and rarely P < 0.0001). The results againRESULTS revealed significant differences in the methylated in the offspring of high-LG-ABN dams. In contrast, the methylation of a numberMaternal of regions care andof themethylation exon 17 ofGR exon promoter 17 promoter 3′ CpG dinucleotide (site 17) remains methylated, regardless of dif- http://www.nature.com/natureneuroscience sequence (Fig. 4) with significantDNA methylation differences is a stable, within epigenomic the 5′ CpG mark (site at CpG dinucleotides ferences in maternal care. Dissected hippocampi inevitably contain 18–20 16) and 3′ CpG (site 17)often dinucleotides associated with of stable the variationsNGFI-A inconsensus gene transcription .Two glial cells as well as neurons. Considering the pronounced effect of sequence (Fig. 4b). Statisticalkinds ofanalysis changes of in the DNA data methylation from these are knowntwo to affect gene maternal care on the methylation status of the 5′ CpG dinucleotide expression: regional, non-site specific DNA methylation around a of the NGFI-A response element (>90%), the effect of maternal care sites revealed a highly promoter significant19 and effect site-specific of Group methylation. (F =Hy 43.8,pomethylation of CpG must include neuronal as well as glial cells; both populations express P < 0.0001), Treatment (F = 65.3, P < 0.0001) and Region 23,24 25 dinucleotides of regulatory regions of genes is associatedFigure with 5 activeTSA eliminatesGR and the NGFI-A maternalgenes. effect on hippocampal GR chromatin structure and transcriptional activity18,20.Thus, the (F = 113.3, P < 0.0001), as well as a significant Group × Treatment expression and HPA responses to stress. (a) Top: a representative western methylation pattern is a stable signature of the epigenomic status of a Cross-fostering reveals epigenetic marking by maternal behavior interaction (F = 16.0, P < 0.0001), Group × Region interaction blot showing absolute levels of electrophoresed hippocampal GR regulatory sequence. We focused on the methylation state of the exon Our findings suggest that specific sites within the exon 1 GR pro- (F = 37.8, P < 0.0001) and Treatment × Region interaction (F = 4.5, immunoreactivity (IR) from vehicle- and TSA (100 ng/ml)-treated adult7 1 GR promoter, which is activated in the hippocampus in offspring moter are differentially methylated as a function of maternal behav- P =0.04). Post-hoc analysis7 revealed that TSA treatment signifi- offspring of high- or low-LG-ABN mothers. Molecular weight markers of high-LG-ABN mothers. ior, but these findings are merely correlational. To directly examine (SeeBlue, Santa Cruz Biotech) correspond to a single major band at 92 cantly decreased the degreeTo ofdetermine cytosine whether methylation DNA methy withinlation ofthe specific 5′ target sites on the relation between maternal behavior and DNA methylation kDa. The middle panel shows the membrane reprobed for α-tubulin IR, (site 16) CpG dinucleotidethe GR of promoter the NGFI-A change binding in response region to maternal of the care, we mapped within the exon 1 promoter, we performed an adoption study in illustrating absolute levels of electrophoresed7 hippocampal protein bound exon 1 GR promoter in differencesthe offspring in the of methylation low-LG-ABN status mothersof individual in cytosines within which the biological offspring of high- or low-LG-ABN mothers 7 to the transfer membrane. Molecular weight markers correspond to a single comparison to vehicle-treatedthe CpG low-LG-ABN dinucleotides ofmothers the exon (* 17Ppromoter < 0.001). from hippocampal were cross-fostered to either high- or low-LG-ABN dams within 12 h major band at ∼60 kDa 9and the intensity of the signal was similar in all ©2004 Nature Publishing Group Group Publishing Nature ©2004 tissue from the adult offspring of high- and low-LG-ABN mothers. of birth .Cross-fostering produced a pattern of exon 1 promoter TSA treatment produced ‘demethylation’ of the 5′ CpG (site 16) lanes. The lower panel shows quantitative densitometric analysis (relative7 We used sodium bisulfite mapping21,22,with a particular interest in methylation that was associated with the rearing mother (F = 4.8, and 3′ CpG (site 17) dinucleotidesthe region around in the theoffspring NGFI-A of consensus low-LG-ABN sequence (opticalFig. 1a ).density, The ROD)P < 0.05; of GRFig. IR 1d levels) and thusfrom reversed samples the (n difference=5 animals/group; in methylation at *P < 0.001). ( ) Plasma corticosterone responses7 (mean s.e.m.) to a mothers, and hypomethylationresults showedof the significant3′ CpG (site differences 17) dinucleotide in the methylation of specific bspecific cytosines, notably at the 5′ CpG dinucleotide± (site 16) of the in the offspring of high-LG-ABN mothers (Fig. 4b). These findings 20-min period of restraint stress (solid bar) in vehicle- and TSA suggest that TSA treatment can reverse the hypermethylated status of (100 ng/ml)-treated adult offspring of high- or low-LG-ABN mothers 848 (n = 10 animals/group;VOLUME *P < 70.01). | NUMBER 8 | AUGUST 2004 NATURE NEUROSCIENCE the exon 17 GR promoter in the offspring of low-LG-ABN mothers. TSA treatment resulted in a more extensive change in DNA methyla- tion than maternal care per se, since the 3′ CpG (site 17) dinu- cleotide, which is unaffected by maternal behavior, is partially NGFI-A response element, we found that methylation of the cyto- ‘demethylated’ in response to TSA treatment in both cohorts sine within the 5′ CpG dinucleotide (site 16) completely eliminated (Fig. 4b). Also, as in the original study (Fig. 1b), maternal care altered the binding of NGFI-A, whereas methylation of the cytosine within the methylation status of other CpG dinucleotides in the exon 17 the 3′ CpG dinucleotide (site 17) only slightly reduced NGFI-A pro- sequence; in the case of sites 1, 2, 5, 12, 14 and 15, these effects were tein binding (I.C.G.W., M.S. & M.J.M., unpublished data). similarly reversed with central TSA infusion. The significance of these sites for transcription factor binding is currently unknown and Reversal of maternal effect on GR expression thus a focus of ongoing studies. Thus, stable DNA methylation GR gene expression in the hippocampus is increased in the adult marking by maternal behavior is reversible in the adult offspring offspring of high- compared with low-LG-ABN mothers7,9.We hippocampus by pharmacological modulation of chromatin struc- suggest that such differences are mediated by the differential ture. While TSA altered the methylation of the both the 5′ and 3′ methylation of the 5′ CpG dinucleotide (site 16) of the NGFI-A CpG sites within the NGFI-A response element, the former appears consensus sequence in the exon 17 GR promoter and the subse- to be critical for the effect on NGFI-A binding to the exon 17 pro- quent alteration of histone acetylation and NGFI-A binding to the moter. In a previous in vitro study using electrophilic mobility shift exon 17 sequence. If the differential epigenetic marking regulates 31 assays (EMSA) with purified recombinant NGFI-A protein and the expression of the exon 17 GR promoter in high- versus low-LG differentially methylated oligonucleotide sequences containing the offspring, then reversal of the epigenetic marking should be accom-
NATURE NEUROSCIENCE VOLUME 7 | NUMBER 8 | AUGUST 2004 851 Childhood care influences adult behavior throughARTICLES epigenetic programming ARTICLES
ab* * primers used for bisulfite mapping were identical to the published ab60 n.s.* n.s. sequence19, thus eliminating potential primer bias between subjects in 1.8 1.2 sodium bisulfite mapping. 50 1.6 1.0 Control SuicideThe nonabused rat homologSuicide of the abused exon 1F NR3C1 promoter, the exon 17 40 1.4 n.s. 50 region, is differentially methylated as** ## a function of variations in 1.2 40 0.8 30 maternal care4,17,22. Cytosine methylation is a highly stable epigenetic 1.0 30 0.6 mark that regulates gene expression via its effects on transcription 20 0.8 && ## && ## & ## 20 23,24 ## 25
promoter (GR) promoter factor& binding . We used sodium** bisulfite mapping to examine the
/GAPDH (log(conc)) 0.6 0.4 /GAPDH (log(conc)) Methylation
Methylated clones (%) Methylated 10
10 F
promoter (GR) promoter methylation status of individual CpG dinucleotides in the NR3C1 total 0.4
0 Gene expression Glucocorticoid Receptor
GR1 0.2 Methylation (frequency) Methylation 0GR promoter sequence extracted from the hippocampal tissue of the same 0.2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38
Glucocorticoid Receptor CpG site 0 0 subjects used for glucocorticoid receptor expression analysis. Sodium Control Suicide Suicide Control Suicide Suicide Control Suicideabused Suicide nonabused abused nonabused abused bisulfite mapping revealed a significant effect on the percentage of nonabused methylated clones (that is, the number of clones with at least one Figure 1 Hippocampal glucocorticoid receptor expression. (a,b)Mean± Figure 2 Methylation of the NR3C1 promoter in the hippocampus. Twenty clones were sequencedmethylated for CpG each subject site divided for methylation by the total mapping. number (a of) Mean clones) ± s.e.m. between s.e.m. expression levels of total glucocorticoid receptor (GR) mRNA (a)and groups (F 3.47, P o 0.05). Post hoc tests revealed a significant percentage of methylated clones for suicide victims with a history of childhood abuse (n 12), suicide¼ victims without a history of childhood abuse (n 12) glucocorticoid receptor 1F (GR1F) in 12 suicide victims with a history of ¼difference between suicide victims with a history of¼ childhood and controls (childhoodn 12). abuse,The methylation 12 nonabused percentage suicide victims was calculated and 12 control as the subjects number ( ofb). clones with at least one methylated CpG site divided by the total ¼ McGowan et al 2009 Nature Neuroscience abuse compared with nonabused suicide victims (P 0.05) or controls number of clonesOutliers (* indicates excluded fromP r analysis0.05; n.s. included indicatesn not2 control statistically subjects, significant).n 1 (b) Methylation of the NR3C1 promoter region, showing the frequency ¼ ¼ ¼ of methylationsuicide observed victims at each with CpGa history site of for childhood suicide victims abuse for with glucocorticoid a history of receptor childhood abuse,(P o suicide0.05). Therevictims was with no no difference history of childhood in the percentage abuse and of methylated control subjects1 and (*P ano additional0.05, **Pno 0.001,1 suicide abused victim suicideswith a history versus of childhood controls; & abuse,P o 0.05,clones&&P o between0.001, non-abused suicide victims suicides without versus childhood controls; abuse#P o 0.05, and controls F ¼ ##P o 0.001,and abusedn 3 suicides nonabused versus suicide non-abused victims for suicides; overall levels Bonferroni of glucocorticoidpost hoc comparisons).(P 4 0.05; Fig. 2a). Methylation was limited to specific sites, with no ¼ receptor. * indicates P o 0.05; n.s. indicates not statistically significant. clone showing global methylation (Fig. 2b). There were no significant correlations between levels of exon 1F methylation and age at death expression. The use of HEK293 cells allowed us to concurrently effect of(r group0.15, (FP 417.12,0.05),P braino 0.0001) pH (r and0.08, aP significant4 0.05) or interaction postmortem ¼ ¼ ¼ transfect a numberexpression of and expression increased vectors HPA with activity, high weefficiency. hypothesized The between that interval CpG site(PMI, andr group0.24, P (F4 0.05;13.44,TableP 1o). 0.0001). In NGFI-A ¼ ¼ absence of plasmidsuicide victims replication would during show the decreased transient expression transfection both assay of gluco-recognition elements, methylation was observed at CpG sites 12, 13, 30, precludes thecorticoid loss of methylation receptor and via glucocorticoid passive demethylation receptor 127F. compared with31 and 32Patch (Fig. methylation 2b). We therefore of the NR3C1 examinedpromoter whether such selective, site- Luciferasecontrol expression subjects. was measured in the presence or absence of specificDNA differences methylation in methylation of a limited could number alter of transcriptional sites in the exon activation 1F NR3C1 NGFI-A fromWe the examined unmethylated the expressionNR3C1 promoter of total glucocorticoid plasmid compared receptorthrough and promoter the NR3C1 waspromoter. associated with Two decreased deletion constructs expression of the the glucocorti-NR3C1 glucocorticoid receptor 1 using quantitative reverse transcription PCR coid receptor 1 variant and of total glucocorticoid receptor mRNA in with a methylated version. ThereF was a significant effect of testing promoter were generatedF in which selected CpG dinucleotides were (qRT-PCR) with RNA extracted from hippocampal tissue of suicide suicide victims with a history of childhood abuse. Defining a causal condition on the transcriptional activity of the exon 1 NR3C1 patch-methylated (Fig. 3a). CpG sites 12 and 13 were methylated in the completers with (n 12) and without (n 12) a historyF of childhood relation between the methylation status and transcriptional efficiency ¼ ¼ promoter (Fabuse110.6, and fromP o 0.0001; controlsFig. (n 3b12).). Post There hoc wasanalysis a significant revealed effect255-bp on of construct, the NR3C1 whereaspromoter the is 125-bp therefore promoter of great constructimportance. was We methy- hypothe- ¼ ¼ that the transcriptionalglucocorticoid activity receptor of expressionthe unmethylated (F 3.17,NR3C1P 0.05).promoterPost hoc testslated atsized CpG that sites DNA 30, 31 methylation and 32. Thus, regulates each deletion the expression construct of included the NR3C1 ¼ ¼ 28 was significantlyshowed increased that expression in the presence of total glucocorticoid of the NGFI-A receptor expression mRNAat was leastpromoter one known through or putative alterations NGFI-A in transcription binding site factor. binding. The vector (NR3C1significantlyversus NR3C1 reduced + in EGR1 suicide; P victimso 0.0001). with a Furthermore, history of childhoodWe usedtranscription patch methylation factor NGFI-A to regulatesexamine the whether expression selective of Nr3c1 methyla-promo- methylationabuse of the relativeNR3C1 topromoter nonabused (the suicide entire victimsNR3C1 orconstruct controls ( wasP o 0.05);tion atter specific in the sites rat, an reduces effect that NGFI-A is inhibited binding by DNA to and methylation transactivation17.Toour methylated therein vitro wasand no ligated difference to between an unmethylated nonabused vector suicide before victimsthrough and knowledge, the exon 1 theF NR3C1 regulationpromoter. of NGFI-A We found (also known an effect as of Zif268, methyla- EGR1, transfection,controlsNR3C1-M (P 4) reduced0.05; Fig. basal 1a). transcriptional There was also activity a significant of the effecttion on statusKrox-24 on transcription and ZENK) has factor–induced not been studied gene in the expression human hippocampus, from the NR3C1 constructthe expression (NR3C1 ofversus transcriptsNR3C1-M containing, P o 0.05). the exon Methylation 1F NR3C1 ofpromoterNR3C1althoughpromoter there (Fig. is evidence 3c). For that the its 125-bp expression construct, is downregulated there was in a the 26 the NR3C1 construct(F 3.58, alsoP o blunted0.05). NGFI-APost hoc inductiontests revealed of transcription that glucocorticoidsignificantprefrontal effect cortex of methylation in schizophrenia status (.TheF NR3C157.6, Ppromotero 0.0001) contains and a ¼ ¼ (NR3C1 + EGR1receptorversus 1F expressionNR3C1-M was + significantly EGR1, P lower0.0001). in samples from suicide number of canonical and noncanonical NGFI-A recognition elements o 17 These resultsvictims indicate with that a history methylation of childhood attenuates abuse NGFI-A compared induction with suicide (Fig. 3a). We wondered whether, as in the rat , NGFI-A could regulate of gene expressionvictims without through childhood the NR3C1 abuse orpromoter. controls ( However,P o 0.05). the Similar to gene transcription through the NR3C1 promoter and whether this the findings with total glucocorticoid receptor mRNA expression, therea effect might be influenced by the methylation status of the promoter. decreased glucocorticoid receptor transcription observed in suicide 1-D 1-E 1-B 1-F 1-G 1-C3,1-C2,1-C3 1-H 2 was no difference between nonabused suicide victims and controls We used a transient transfection assay in human HEK293 cells to victims with a history of childhood abuse was associated with differ- (P 4 0.05; Fig. 1b). examine transcriptional activity of a NR3C1 promoter ligated to a ences in methylationWe examined levels occurring the relationship only at specific between sites glucocorticoid in the exon 1F receptor promoter-less firefly luciferase expression vector (pGEM-LUC, NR3C1 promoterexpression (Fig. and 2b). psychiatric An ANOVA diagnoses examining (Table the 1 methylation). Mood disorders of and Promega; Fig. 3a) in the presence or absence of ectopic NGFI-A CpG dinucleotidessubstance across abuse the disorders exon are1F NR3C1 risk factorspromoter for suicide revealed and have a been significant effectlinked of to CpG alterations site (F of glucocorticoid13.86, P o 0.0001), receptor a expression significant12.There ¼ Table 1 Demographic characteristics and psychiatric diagnoses were no significant effects of psychopathology, even after controlling for childhood abuse status, on overall glucocorticoid receptor or Abused suicide Nonabused suicide Control Figure 3 In vitroglucocorticoidanalysis of NR3C1 receptorpromoter 1F expression methylation. (P 4 0.05). (a) The relative position of the NR3C1 variant and the promoter sequence, showing the bcMale/female 12/0 12/0 12/0 location of theGenotyping CpG dinucleotides. and methylation The 255-bp analysis (., solid underline) and 14,000Age (years) 34.24,000 ± 10 33.8 ± 11 35.8 ± 12 3,500 125-bp (,, broken underline) deletion constructs are shown, along with 12,000PMI (h) 24.6 ± 5.8 39.0 ± 25.7 23.5 ± 6.0 Because alterations in glucocorticoid receptor 1F activity could be 3,000 specific CpG dinucleotides that were methylated in each deletion construct, 10,000pH 6.3 ± 0.24 6.5 ± 0.29 6.5 ± 0.22 derived from nucleotide sequence variation and/or epigenetic mod- 2,500 as indicated by circles. Boxes represent known or putative canonical (solid- 8,000 ifications, we sequenced the NR3C1 promoter region from each Childhood abuse/neglect 12/02,000 (100%) 0/12 (0%) 0/12 (0%) lined box) and noncanonical (broken-lined box) NGFI-A–binding sites, with 6,000 subject. No sequence variation was seen among subjects and all of Mood disorder 8/121,500 (67%) 8/12 (67%) 0/12 (0%) the shaded area indicating the beginning of the exon. (b,c) Mean ± s.e.m. 4,000 the sequences were identical to those published previously19. Moreover, Alcohol/drug abuse disorder 9/121,000 (75%) 6/12 (50%) 5/12 (42%) levels of luciferase expression in HEK293 cells. Results are shown after the 2,000 500 for each subject, the genomic sequences targeted for binding by the Data are presented as mean ± s.d. subtraction of expression of the promoter in the antisense orientation. 0 Luminance (arbitrary units) 0 Luminance (arbitrary units)
(b) The full NR3C1 promoter was either unmethylated (hGR) or completely hGR 255 bp 125 bp patch methylated (hGR PatchM) and transfected in the presence or absence 255 bp M 125 bp M of NGFI-A. (c)NATURE The 255-bp NEUROSCIENCE and 125-bp NR3C1VOLUMEdeletion 12 [ NUMBER construct 3 were[ MARCH either 2009 hGR PatchM 343 hGR + NGFI-A 255 bp + NGFI-A 125 bp + NGFI-A unmethylated (255 bp or 125 bp) or methylated (255 bp M or 125 bp M), as 255 bp M + NGFI-A 125 bp M + NGFI-A shown in a, and transfected either in the presence or absence of NGFI-A. hGR PatchM + NGFI-A
344 VOLUME 12 [ NUMBER 3 [ MARCH 2009 NATURE NEUROSCIENCE ARTICLES ARTICLES ARTICLES
Figure 6 Methylation of odorant receptor genes in sperm DNA from a Olfr151 (over all CpG sites) b Olfr151 (individual CpG sites) conditioned F0 and odor naive F1 males. (a) Bisulfite sequencing of F0-Prop-Sperm * F0-Ace-Sperm CpG di-nucleotides in the Olfr151 (M71) gene in F0 sperm revealed that 100 100 F0-Ace mouse DNA (n = 12) was hypomethylatedARTICLE compared with S Environmentala Dorsal *bulb conditionsb a Dorsal can bulb chaveb g c g h h that of F0-Prop mice (n = 10) (t test, P = 0.0323, t16 = 2.344). 6,000 6,000 8,000 8,000 ARTICLE(b) A particularS CpG di-nucleotide in the Olfr151 (M71) gene in 80 ARTICLE80 S F0 sperm was hypomethylated in F0-Ace mice (n = 12) compared with transgenerational effects *** * *** * **** **** **** **** F0-Prop mice (n = 10) (P = 0.003, Bonferroni corrected). (c) We found 6,000 no differences in methylation between F0-Ace ( = 12) and F0-Prop F160 60 6,000 n Percentage methylation Percentage methylation 4,000 4,000 Figure 6(n Methylation= 10) mice across of odorant all of thereceptor CpG di-nucleotides genesFigure in sperm 4 queried Behavioral DNA infrom the Olfr6 sensitivity Olfr151and (overneuroanatomical all CpG sites) conditionedchangesOlfr151 (individualare fear inherited response CpG sites) a b CpG1CpG2CpG3CpG4CpG5CpG6CpG7CpG8CpG9 a b conditionedgene inF0 F0 and sperm odor ( Pnaive > 0.05). F1 males. (d) Across (a) Bisulfitespecific CpG sequencing di-nucleotides of in F0-Prop- F0-Ace- F0-Prop-Sperm Figure 1 Behavioral sensitivity to odor is specific to the paternally in F2 and IVF-derived generations.Sperm (a,b) ResponsesSperm a of300 F2-C57Bl/6J b 300 150 4,000 4,000 CpG di-nucleotidesthe Olfr6 gene, in wethe found Olfr151 no differences (M71) gene in inmethylation F0 sperm between revealed F0-Ace that * F0-Ace-Sperm* 300 conditioned odor. (a,b) Responses of individual C57Bl/6J F1 male (pixels) 100 Medial bulb Medial bulb (pixels)
100 (pixels) d e d f e* f * (pixels) F0-Ace (mousen = 12) DNA and F0-Prop(n = 12) ( nwas = 10) hypomethylated mice (Bonferronimales compared revealed corrected). with (e that) Bisulfite F2-Ace-C57 c Olfr6mice (over allhad CpG sites)an enhancedd 200 sensitivityOlfr6 *(individual CpG to sites) 200 offspring conceived2,000100 after the F0 male was fear conditioned2,000 with sequencing of the Olfr151 (M71) gene in F1 sperm revealed that F1-Ace F0-Prop-Sperm 200 that of F0-Prop mice (n = 10) (t test, P = 0.0323, t16 = 2.344). F0-Ace-Sperm acetophenone. F1-Ace-C57 mice had an enhanced sensitivity to 2,000 2,000 mouse DNA (n = 4) was hypomethylatedacetophenone compared with that comparedof F1-Prop with100 F2-Prop-C57 mice (a).100 In contrast, 100 50 (b) A particular CpG di-nucleotide in the Olfr151 (M71) gene in 80 80 Dorsal glomerulus area acetophenoneDorsal glomerulus area (a), but not to propanol (control odor, b) compared with Medial glomerulus area mice ( = 4) ( test, = 0.0153, = 2.763). (f) Bisulfite sequencing 100 Medial glomerulus area F0 sperm wasn hypomethylatedt P in F0-Acet14 miceF2-Prop-C57 ( = 12) compared mice with had an enhanced sensitivity to propanol compared propanol n 0 0 0 of CpG di-nucleotides in the Olfr151 (M71) gene in F1 sperm revealed acetophenone F1-Home-C57 mice (F1-Ace-C57,0 n = 16; F1-Home-C57,0 n = 13; t test, 0 0 F0-Prop mice (n = 10) (P = 0.003, Bonferroni corrected). (c) We found 80 80 propanol Percentage OPS to that two particular CpG di-nucleotideswith in the F2-Ace-C57Olfr151 (M71) gene mice were (b; F2-Prop-C57, n = 8; F2-Ace-C57, n = 12; OPS Percentage OPS to 0 no differences in methylation between F0-Ace ( = 12) and F0-Prop 60 F1-Home60 F1-PropF1-Home F1-AceF1-Prop P = 0.043, t27 = –502.123).F1-Ace (c,d) Responses of M71-LacZ F1 male offspring Percentage methylation –100 n –100 acetophenone hypomethylated in F1-Ace mice (n = 4) compared with F1-Prop mice Percentage methylation ( = 10) mice across all of the CpG di-nucleotidesto acetophenone: queried in the t test, P = 0.0158, t18 = 2.664; OPS toF1-Home-C57 propanol: F1-Ace-C57 t test, F1-Home-C57 F1-Ace-C57 conceived after the F0 male was fear conditioned with acetophenone or n Olfr6 Percentage OPS to ( = 4) ( = 0.002, Bonferroni corrected). Data are presented as Percentage OPS to n P 60 60 CpG1CpG2CpG3CpG4CpG5CpG6CpG7CpG8CpG9 –100 –100 Percentage methylation gene in F0 sperm (P > 0.05). (d) Across specific CpG di-nucleotides in F0-Prop- F0-Ace- Percentage methylation propanol. F1-Ace-M71 mice had an enhanced sensitivity to acetophenone (c), mean s.e.m. *P