• Abstract and Figures
• Public Full-text

Egypt. J. Plant Prot. Res. Inst. (2020), 3 (1): 215 - 236 Egyptian Journal of Plant Protection Research Institute www.ejppri.eg.net Taxonomy of genus Brachymeria species (Hymenoptera: Chalcididae) in Egyptian fauna Mohammed, Abd El-Salam¹; Fawzy, F. Shalaby²; Eman, I. El-Sebaey¹ and Adel, A. Hafez² ¹Plant Protection Research Institute, Agricultural Research Center, Dokki, Giza, Egypt. ²Faculty of Agriculture, Banha University , Egypt. ARTICLE INFO Abstract: Article History Brachymeria Westwood (Hymenoptera: Received: 29/ 1 / 2020 Chalcididae) is widely distributed and it considered the Accepted: 26/ 3/2020 most common genus of chalcid parasites of many pests of Keywords agricultural importance in Egypt. The valid species of Chalcididae, Brachymeria which are studied : B. aegyptiaca Masi, B. Brachymeria, parasitoid, albicrus Klug , B. ancilla Masi, B. brevicornis Klug, B. hosts , distribution, excarinata Gahan, B. femorata Panzer , B. fonscolombei description keys, Dufour , B. kassalensis Kirby, B. libyca Masi as the first Egyptian fauna and record in Egypt , B. minuta Linnaeus, B. somalica Masi , Polymerase chain B. vicina Walker , and recorded from Egypt. This study is reaction (PCR) . including description which support by illustration photography; distribution data and key of 12 Brachymeria species. The hosts of some species in Egypt are showed .DNA sequences of B. femorata obtained. Introduction Chalcidids comprise a very of this genus are primary important beneficial group of parasitoids endoparasitoids of families Lepidoptera; .Many species of the family are important Diptera and Coloeoptera. On the other parasitoids that have been used hand , sometime hyperparasitic species successfully for the biological control of are found on parasitize on Diptera many insect pest species. The genus (Tachinidae) and Hymenoptera Brachymeria Westwood , belongs to the (ichneumonid). Therefore the subfamily Chalcidinae. Apparently, there identification of the species concerned are almost 300 species of Brachymeria in are highly important of many host- the world (Noyes, 2011). Brachymeria parasite which study for biological parasitize of the mature larvae and pupae control involving this genus (Joseph et with wide range species of various al., 1973). Accurate techniques to detect orders. They play significant role in the and identify parasitoids are a prerequisite ecosystem of various economic important for understanding and managing host– crops. In Egypt Brachymeria includes the parasitoid needed to interactions: for most common and wide taxa distributed example, they are measure and monitor of the family Chalcididae .Many species parasitism rates (Agusti et al., 2005). 215 Abd El-Salam et al., 2020 Today parasitoids have been detected 2.Genetic method: within hosts of Diptera, Lepidoptera, Due to the relative numerical Heteroptera, and Coloeoptera by DNA- abundance of B. femorata parasitoid in based methods. These studies, utilizing the field and their accessibility in some the Polymerase Chain Reaction (PCR) areas were used in the genetic experiment ,have shown that parasitoid detection is as fallow: possible at high specificity and sensitivity 2.1.Collected the parasitoids : level (Greenstone, 2006). Studies on the Pieris rapae (L.) (Lepidoptera : taxonomy, ecology and genetic of Pieridae) pupae collected from the fields parasitoids can be supply the basic of cabbage , (1/2 Fadden) , located in information which necessary for Qaha , Qalyubia during September and biological control and for its efficient october, pupa stages of cabbage worm operations as strategy point undertaking were collected in cloth bags, closed with integrated control plan in Egypt. rubber band and transferred to laboratory. Materials and methods The collected parasitoid pupae were 1. Morphological methods: confined individually in test tube (1.5× The taxonomic study of family 1.5 cm.), covered by muslin cloth and Chalcididae in Egypt depending on tighted with a rubber band . A droplets specimens which collected from the field of pure bee honey were put inside the survey and as well as the materials which glass tube wall for feeding by emerged kept in the main reference insect parasitoids and kept under laboratory collections in Egypt . The Egyptian insect condition . Six live individuals from the collection included, Ministry of parasitoid were used for the experiment. Agriculture, Ain Shams University , All the follow steps are specific to Cairo University , and Al-Azhar protocols of each of GeneJET Genomic University. The identifications or DNA Purification Kit #K0721, #K0722. compare of specimens and terms were, (Zilinskiene, 2012) and PCR Purification mostly, carried out using Bouček (1952, Spin Protocol (QIAquick Spin 1956 and 1988); Habu (1960); Masi Handbook03/2008). (1929 and 1936); Nikol’skaya (1952); 2.2. Primer28s : Joseph et al. (1973) and Narendran and F(GACCCGTCTTGAAACACGGA3’)R Achterberg (2016). Descriptions of all (5’ TGCGAAGGAACCAGCTACTA 3’) specimens were based mainly upon 2.3. Machines used: external morphological characters of the The PCR machine used is “Veriti adult males and females whatever 96 Well Thermal Cycler” from Applied available . Some parts of insects Biosystems. The sequencer details is measured by the gradual lens, then “3500 Genetic Analyzer” Applied compare them. Using the Sony lens 20.1 Biosystems. Gel documentation (G:BOX) Mega pixels .The different body (SYNGENE model 680XHR) Made in orientation of the insects were UK. Species and related species were photography as well as the parts in the identified by the GeneBank. description object. All examination, Results and discussion descriptions, distinction, measurement 1. Key of Brachymeria species in Egypt: process and Photographer operations 1- Preorbital carina and postorbital carina for specimens were made by use of a present……………………….………….…3 stereoscopic binocular microscope. - Preorbital carina and postorbital carina absent…………………… B. albicrus Klug. 216 Egypt. J. Plant Prot. Res. Inst. (2020), 3 (1): 215- 236 2-Preorbital carina present and postorbital 2.1. Brachymeria aegyptiacae Masi, carina absent…………………………...….7 1931 (Figure ,1) : - Preorbital carina absent and postorbital Body : Length 4.0 mm, black, with carina present…………………….....…8 short erected silver hairs. 3-Sixth abdominal tergite weakly pitted and Head: Flat dorsally ,provided with three sparsely bristled………………………......4 bright yellow ocelli, compound eyes - Sixth abdominal tergite with coarse dense punctures and covered with dense yellow, dim , ovate and protruding ; face bristles…………………………………6 with minute sculpture ; scrobe area deep 4- Hind femora length more than or at least dark; epistoma tubercle obliterate, 1.80-2.00 times of width, with apical patch; clypeus margin motivate ; postorbital hind tibia red, with sub basal and apical carina thin and perpendicular. occiput patches. apical patch of hind femora ;sub little oblique behind eyes and narrow; basal and apical patches of the hind tibia ocelli small ,circular and scattered, whitish.……….…….B. fonscolombei Dufour. compound eyes small developed and into - Hind femora length equal or less 1.80 circle; width of ocellar area equal three times of width, mostly black, apical fourth of inter-ocular space width at level yellow; hind tibia mostly black. Apical of hind ocelli; scrobe cavity narrow; and subbasal part yellow or brownish- yellow. …………………..…………….5 interorbital space high equal wide ; 5-scape, mostly light color, hind femur with antenna black yellowish ;radical strong, expanded yellow spot apically, and dark parts small and yellow , scape brown ;pedicel of tibiae reddish …….B. brevicorinis Klug. bright brown, ball shaped and elongate; -scape dorsally dark color and tibiae dark flagellum dark brown and 9 parts brownish black ……..B. minuta L. flagellomeres, 1st and 2nd flagellomere 6- Hind femur less elongate ,shiny, covered elongate, other seven flagellomeres long with pubescence, with one big reddish patch, equal width ; club rounded end. and apical with yellowish ring ; provided Thorax: Long equal one and half times with 12 black teeth ……...B. vicina Walker of width with dense shallow punctured ; -Hind femur more elongate, weakly pronotum black, basal ridge, interrupted shining , outer part pubescence, brownish red and yellow; provided with 11 dark in middle with angle apically and brown teeth ……….…...B.ancilla Masi rounded in median third ; parapsidal 7-Hind tibia black with basal slightly reddish furrows deep ; scutellum convex , and clear yellowish patches subbasally and flatten, with rounded apical; scutellum apically , scrobe extended to front with complete apex ; scutum and ocellus.………….…..….. B. excarinata Gahan scutellum contiguous and symmetrically; - Hind tibia yellowish, scorbe slightly distant propodeum plated; thorax sloping from front ocellus…......B.somalica Masi gradually behind scutellum ; tegula 8 -Hind coxae dentate below. B. kassalensis yellowish and triangular shaped with Kirby. silver short hairs distally; forewing with - Hind coxa not dentate below…….…9 marginal vein length equal one-half of 9- Antenna, mostly black….……….… 10 -Antenna completely orange - reddish sub –marginal vein , three times of post …………………….………B. libyca Masi marginal vein , and equal four times of 10- Hind femur black in median dorsal stigma vein length ; veins brown and ……………….…..……..B. femorata Panzer submarginal base yellow ;leg yellowish - Hind femur black, opaque with small and brown, covered with soft short hairs yellow mark apically....B.

Load more

  22

Copy Link