(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2013/065046 Al 10 May 2013 (10.05.2013) W P O P C T

(51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 15/113 (2010.01) A01H 5/00 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/82 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (21) International Application Number: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, PCT/IL20 12/05043 1 ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, (22) International Filing Date: NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, 3 1 October 2012 (3 1.10.2012) RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, (25) Filing Language: English ZM, ZW. (26) Publication Language: English 4 Designated States (unless otherwise indicated, for every (30) Priority Data: kind of regional protection available): ARIPO (BW, GH, 61/553,355 31 October 201 1 (3 1. 10.201 1) US GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 61/553,340 31 October 201 1 (3 1. 10.201 1) us TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, (71) Applicants: ROSETTA GREEN LTD. [IL/IL]; 13 Gad EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, Feinstein Street, 7612101 Rechvot (IL). YANAI-AZU- MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, LAY, Osnat; 24A 9 Hadugit Street, 7543571 Ris- TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, hon-Lezion (IL). ML, MR, NE, SN, TD, TG). (72) Inventors: MAOR, Rudy; 11 Kronnenberg Street, Declarations under Rule 4.17 : 7666206 Rechovot (IL). NESHER, Iris; 4 Kitsis Street, — of inventorship (Rule 4.17(iv)) 6948 103 Tel Aviv (IL). NOIVIRT, Orly; 9 HaTaAs Street, 533971 1 Givataim (IL). Published: (74) Agents: G.E EHRLICH (1995) LTD. et al; 11 Mena- — with international search report (Art. 21(3)) chem Begin Road, 5268 1 Ramat Gan (IL). — with sequence listing part of description (Rule 5.2(a)) (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM,

(54) Title: ISOLATED POLYNUCLEOTIDES AND POLYPEPTIDES, TRANSGENIC PLANTS COMPRISING SAME AND USES THEREOF o IN IMPROVINGABIOTIC STRESS TOLERANCE, NITROGEN USE EFFICIENCY, BIOMASS, VIGOR OR YIELD OF PLANTS (57) Abstract: Methods of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant are © provided. According to an aspect the method comprising expressing within the plant an exogenous polynucleotide having a nucleic acid sequence at least 90 % identical to SEQ ID NOs: 103, 101-102, 104-216, 223-227, 264-416, wherein the nucleic acid sequence is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, bio - mass, vigor or yield of the plant. Alternatively, the method comprises, expressing within the plant an exogenous polynucleotide which downregulates an activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence at least 90 % identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-100, 615- 626 and 639, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant. ISOLATED POLYNUCLEOTIDES AND POLYPEPTIDES, TRANSGENIC PLANTS COMPRISING SAME AND USES THEREOF IN IMPROVING ABIOTIC STRESS TOLERANCE, NITROGEN USE EFFICIENCY, BIOMASS, VIGOR OR YIELD OF PLANTS

FIELD AND BACKGROUND OF THE INVENTION The present invention, in some embodiments thereof, relates to isolated polynucleotides and polypeptides, transgenic plants comprising same and uses thereof in improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of plants Abiotic stress (ABST) is a collective term for numerous extreme environmental parameters such as drought, high or low salinity, high or low temperature/light, and nutrient imbalances. The major agricultural crops (corn, rice, wheat, canola and soybean) account for over half of total human caloric intake, giving their overall yield and quality vast importance. Abiotic stress causes more than 50 % yield loss of the above mentioned major crops. Among the various abiotic stresses, drought is the major factor that limits crop productivity worldwide. Furthermore, drought is associated with increase susceptibility to various diseases. Abiotic-stress-induced dehydration or osmotic stress, in the form of reduced availability of water and disruption of turgor pressure, causes irreversible cellular damage. A water-limiting environment at various plant developmental stages may activate various physiological changes. Water deficit, salinity and low/high temperatures are stresses that cause plant cellular dehydration, due to transpiration rate that exceeds water uptake. Drought is known to elicit a response in the plant that mainly affects root architecture, causing activation of plant metabolic pathways driven to maximize water assimilation. Improvement of root architecture, i.e. making branched and longer roots, allows the plant to reach water and nutrient/fertilizer deposits located deeper in the soil by an increase in soil coverage. Thus, genes governing enhancement of root architecture may be used to improve drought tolerance. High salt levels, or salinity, of the soil acts similarly to drought; it prevents roots from extracting water and nutrients and thus reduces the availability of arable land and crop production worldwide, since none of the top five food crops can tolerate excessive salt. Salinity causes a water deficit which leads to osmotic stress (similar to freezing and drought stress) and critically damages biochemical processes. Large land areas throughout the world naturally have high salt levels and thus are currently uncultivable. In regions that rely heavily on agricultural production, soil salinity is a significant problem expected to worsen due to growing population and extreme climatic changes. Since salt accumulates in the upper soil layer where seeds are placed, and may interfere with their germination, salt tolerance is of particular importance early in a plant's lifecycle. Temperature is a critical factor in germination of many crops. Seedlings as well as mature plants that are exposed to excess heat may experience heat shock, which may arise in various organs when transpiration is insufficient to overcome heat stress. Heat shock damages cellular structures and impairs membrane function and overall protein synthesis (except that of heat shock proteins). Heat stress often accompanies conditions of low water availability, such as drought, and the combined stress can fatally alter plant metabolism. Dehydration invokes survival strategies in plants that include structural (lower surface area) as well as cellular content (increase in oil and soluble material) modifications to prevent evaporation and water loss caused by heat, drought, or salinity. There is great variability in responses to abiotic stress among different plant species, but differences also exist among varieties and cultivars within the same plant species. Certain plants are inherently more tolerant to abiotic stress than others, making their genotypes an attractive research subject for potential identification of drought associated genes. The response to any stress may involve both stress specific and common stress pathways, and drains energy from the plant, eventually resulting in lowered yield. Thus, distinguishing between the genes activated in each pathway and subsequent manipulation of only specific relevant genes could lead to a partial stress response without the parallel loss in yield. With a growing world population, increasing demand for food, fuel and fiber, and a changing climate, agriculture faces unprecedented challenges. In general, shortage in water supply is one of the most severe global agricultural problems affecting plant growth and crop yield. To illustrate, large areas of cornfields in the United States may be affected by at least moderate drought in any given year. Excessive efforts are made to alleviate the harmful effects of desertification of the world's arable land. Farmers are seeking advanced, biotechnology-based solutions to enable them to obtain stable high yields and give them the potential to reduce irrigation costs or to grow crops in areas where potable water is a limiting factor. It should be noted that improved ABST will confer plants with improved vigor also under non-stress conditions, resulting in crops having improved biomass and/or yield. Two major small RNA molecules, microRNAs (miRNAs) or small interfering RNAs (siRNAs), potently regulate specific down-regulation/silencing of a target gene, through RNA interference (RNAi). Both miRNAs and siRNAs are oligonucleotides (20-24 bps) processed from longer RNA precursors by Dicer-like ribonucleases, although the source of their precursors is different (i.e., local single RNA molecules with imperfect stem-loop structures for miRNA, and long, double- stranded precursors potentially from bimolecular duplexes for siRNA). Additional characteristics that differentiate miRNAs from siRNAs are their sequence conservation level between related organisms (high in miRNAs, low to non-existent in siRNAs), regulation of genes unrelated to their locus of origin (typical for miRNAs, infrequent in siRNAs) and the genetic requirements for their respective functions are somewhat dissimilar in many organisms. Despite all their differences, miRNAs and siRNAs are overall chemically and functionally similar and both are incorporated into silencing complexes, wherein they can guide post-transcriptional repression of multiple target genes, and thus function catalytically. In contrast to the abundance of genes involved in the responses to abiotic stress in plants, there is limited information on small RNA molecules involved in plant response and adaptation to abiotic stress. Related background art: WO 2011/067745

SUMMARY OF THE INVENTION According to an aspect of some embodiments of the present invention there is provided a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide having a nucleic acid sequence at least 90 % identical to SEQ ID NOs: 103, 101-102, 104-216, 223-227, 264-416, wherein said nucleic acid sequence is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant. According to an aspect of some embodiments of the present invention there is provided a transgenic plant exogenously expressing a polynucleotide having a nucleic acid sequence at least 90 % identical to SEQ ID NOs: 1-216, 223-227, 264-416, 615- 626 or 639, wherein said nucleic acid sequence is capable of regulating abiotic stress tolerance of the plant. According to some embodiments of the invention, said polynucleotide has a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-216, 223- 227, 264-416, 615-626 or 639. According to some embodiments of the invention, said exogenous polynucleotide encodes a precursor of said nucleic acid sequence. According to some embodiments of the invention, said precursor is at least 60 % identical to SEQ ID NO: 217-222, 417-421 or 458-614. According to some embodiments of the invention, said exogenous polynucleotide encodes a miRNA or a precursor thereof. According to some embodiments of the invention, said exogenous polynucleotide encodes a siRNA. According to some embodiments of the invention, said exogenous polynucleotide is selected from the group consisting of SEQ ID NO: 103, 101-102, 104- 216, 217-222, 223-227, 264-416, 417-421 or 458-614. According to an aspect of some embodiments of the present invention there is provided an isolated polynucleotide having a nucleic acid sequence at least 90 % identical to SEQ ID NO: 16-113, 117-216, wherein said nucleic acid sequence is capable of regulating abiotic stress tolerance of a plant. According to some embodiments of the invention, said nucleic acid sequence us as set forth in SEQ ID NO: 16-113, 117-216 According to some embodiments of the invention, said polynucleotide encodes a precursor of said nucleic acid sequence. According to some embodiments of the invention, said polynucleotide encodes a miRNA or a precursor thereof. According to some embodiments of the invention, said polynucleotide encodes a siRNA. According to an aspect of some embodiments of the present invention there is provided a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide which downregulates an activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence at least 90 % identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-100, 615- 626 and 639, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant. According to an aspect of some embodiments of the present invention there is provided a transgenic plant exogenously expressing a polynucleotide which downregulates an activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence at least 90 % identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-100, 615-626 and 639. According to an aspect of some embodiments of the present invention there is provided an isolated polynucleotide which downregulates an activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-100, 615-626 and 639, 627-638 and 640. According to some embodiments of the invention, said polynucleotide encodes a miRNA-Resistant Target as set forth in Tables 14-16. According to some embodiments of the invention, said polynucleotide encoding miRNA-Resistant Target is as set forth in SEQ ID NO: 877-886, 893-913, 1226-1535. According to some embodiments of the invention, said isolated polynucleotide encodes a target mimic as set forth in Tables 17-19. According to some embodiments of the invention, said polynucleotide encoding said target mimic is as set forth in SEQ ID NO:1741-1815. According to an aspect of some embodiments of the present invention there is provided a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide encoding a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1861-1869, 1892-1915, 1921-1924, 1931- 1939, 1952-1963, 2010-2014, 2327-2355, 2763-3040, 3044-3163, 3175-3269, 3313- 3323, 3458-3944 or 3950-3969, wherein said polypeptide is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant. According to an aspect of some embodiments of the present invention there is provided a transgenic plant exogenously expressing a polynucleotide encoding a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1816-2014, 2183-2355, 2500-3969, wherein said polypeptide is capable of regulating nitrogen use efficiency of the plant. According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct comprising a polynucleotide encoding a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1816-2014, 2183-2355, 2500-3969, wherein said polypeptide is capable of regulating abiotic stress tolerance of a plant, and wherein said polynucleotide is under a transcriptional control of a cis-acting regulatory element. According to some embodiments of the invention, said polynucleotide is selected from the group consisting of SEQ ID NO: 2053-2061, 2080-2101, 2106-2109, 2111-2116, 2126-2136, 2178-2182, 2478-2499, 4185-4418, 4422-4527, 4539-4624, 4661-4670, 4787-5213 and 5219-5238. According to some embodiments of the invention, said polypeptide is selected from the group consisting of SEQ ID NO: 1861-1869, 1892-1915, 1921-1924, 1931- 1939, 1952-1963, 2010-2014, 2327-2355, 2763-3040, 3044-3163, 3175-3269, 3313- 3323, 3458-3944 and 3950-3969. According to an aspect of some embodiments of the present invention there is provided a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide which downregulates an activity or expression of a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1816-1860, 1870-1891, 1916-1920, 1925-1930, 1940-1951, 1964-2009, 2183-2326, 2500-2762, 3041-3043, 3164-3174, 3270-3312, 3324-3457, 3945-3949, wherein said polypeptide is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant. According to an aspect of some embodiments of the present invention there is provided a transgenic plant exogenously expressing a polynucleotide which downregulates an activity or expression of a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1816-1860, 1870-1891, 1916-1920, 1925- 1930, 1940-1951, 1964-2009, 2183-2326, 2500-2762, 3041-3043, 3164-3174, 3270- 3312, 3324-3457, 3945-3979, wherein said polypeptide is capable of regulating abiotic stress tolerance of the plant. According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct comprising a polynucleotide which downregulates an activity or expression of a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1816-1860, 1870-1891, 1916-1920, 1925-1930, 1940- 1951, 1964-2009, 2183-2326, 2500-2762, 3041-3043, 3164-3174, 3270-3312, 3324- 3457, 3945-3949, wherein said polypeptide is capable of regulating abiotic stress tolerance of a plant, said nucleic acid sequence being under the regulation of a cis- acting regulatory element. According to some embodiments of the invention, said polynucleotide acts by a mechanism selected from the group consisting of sense suppression, antisense suppression, ribozyme inhibition, gene disruption. According to some embodiments of the invention, said cis-acting regulatory element comprises a promoter. According to some embodiments of the invention, said promoter comprises a tissue-specific promoter. According to some embodiments of the invention, said tissue-specific promoter comprises a root specific promoter. According to some embodiments of the invention, the method further comprises growing the plant under water deprivation conditions. According to some embodiments of the invention, the method further comprises growing the plant under salinity stress. According to some embodiments of the invention, the method further comprises growing the plant under high temperature stress. According to some embodiments of the invention, the method further comprises growing the plant under abiotic stress. According to some embodiments of the invention, said abiotic stress is selected from the group consisting of salinity, drought, water deprivation, flood, etiolation, low temperature, high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, atmospheric pollution and UV irradiation. According to some embodiments of the invention, the plant is a dicotyledon. According to some embodiments of the invention, the plant is a monocotyledon. Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE DRAWINGS Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced. In the drawings: FIG. 1 is a plasmid map of the binary vector pORE-El, which can be used for plant transformation according to some embodiments of the present invention. FIG. 2 is a schematic description of miRNA assay including two steps, stem- loop RT and real-time PCR. Stem-loop RT primers bind to at the 3' portion of miRNA molecules and are reverse transcribed with reverse transcriptase. Then, the RT product is quantified using conventional TaqMan PCR that includes miRNA-specific forward primer and reverse primer. The purpose of tailed forward primer at 5' is to increase its melting temperature (Tm) depending on the sequence composition of miRNA molecules (Slightly modified from Chen et al. 2005, Nucleic Acids Res 33(20):el79). FIGs. 3A-B are schematic illustrations of an artificial miRNA sequence design for predicted siRNA 55507 (SEQ ID NO: 102) on the backbone of ath-miR172a (SEQ ID NO: 453). FIGs. 4A-B are schematic illustrations of an artificial miRNA sequence design for predicted siRNA 55937 (SEQ ID NO: 2) on the backbone of ath-miR319a (SEQ ID NO: 455).

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION The present invention, in some embodiments thereof, relates to isolated polynucleotides and polypeptides, transgenic plants comprising same and uses thereof in improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of plants Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. A number of abnormal environment parameters such as drought, salinity, cold, freezing, high temperature, anoxia, high light intensity and nutrient imbalances etc. are collectively termed as abiotic stresses. Abiotic stresses lead to dehydration or osmotic stress through reduced availability of water for vital cellular functions and maintenance of turgor pressure. Stomata closure, reduced supply of C0 2 and slower rate of biochemical reactions during prolonged periods of dehydration, high light intensity, high and low temperatures lead to high production of Reactive Oxygen Intermediates (ROI) in the chloroplasts causing irreversible cellular damage and photo inhibition. Understanding the molecular mechanism for providing protection against biotic and abiotic stresses may lead to the identification of genes associated with stress tolerance. Optimum homeostasis is always a key to living organisms for adjusted environments. While reducing the present invention to practice, the present inventors have uncovered dsRNA sequences that are differentially expressed in maize plants grown under abiotic stress conditions including, salt stress, heat stress and drought, versus maize plants grown under optimal conditions. Following extensive experimentation and screening the present inventors have identified double stranded RNA interfering (RNAi) molecules including siRNA and miRNA sequences that are upregulated or downregulated in roots and leaves, and suggest using same or sequences controlling same in the generation of transgenic plants having improved abiotic stress tolerance. Each of the above mechanisms may affect water uptake as well as salt absorption and therefore embodiments of the invention further relate to enhancement of abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant. Thus, according to an aspect of the invention there is provided a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide having a nucleic acid sequence at least, 80 , 85 , 90 , 95 % or even 100 % identical to SEQ ID NOs: 101-216, 217-222, 223-227, 264-416 (Mature all upregulated sequences and homologs of Tables 1-8), wherein said nucleic acid sequence is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant The phrase "abiotic stress" as used herein refers to any adverse effect on metabolism, growth, viability and/or reproduction of a plant. Abiotic stress can be induced by any of suboptimal environmental growth conditions such as, for example, water deficit or drought, flooding, freezing, low or high temperature, strong winds, heavy metal toxicity, anaerobiosis, high or low nutrient levels (e.g. nutrient deficiency), high or low salt levels (e.g. salinity), atmospheric pollution, high or low light intensities (e.g. insufficient light) or UV irradiation. Abiotic stress may be a short term effect (e.g. acute effect, e.g. lasting for about a week) or alternatively may be persistent (e.g. chronic effect, e.g. lasting for example 10 days or more). The present invention contemplates situations in which there is a single abiotic stress condition or alternatively situations in which two or more abiotic stresses occur. According to an exemplary embodiment the abiotic stress refers to salinity. According to another exemplary embodiment the abiotic stress refers to drought. According to yet another exemplary embodiment the abiotic stress refers to high temperature. As used herein the phrase "abiotic stress tolerance" or ABST refers to the ability of a plant to endure an abiotic stress without exhibiting substantial physiological or physical damage (e.g. alteration in metabolism, growth, viability and/or reproducibility of the plant). It will be appreciated that since genes that affect abiotic stress tolerance often modulate any one of root architecture; plant metabolic pathways which may affect nitrogen absorption or localization; and plant surface permeability, it is also suggested that the biomolecular sequences (i.e., nucleic acid and amino acid sequences) of the present invention may also regulate nitrogen use efficiency of the plant. As used herein the phrase "nitrogen use efficiency (NUE)" refers to a measure of crop production per unit of nitrogen fertilizer input. Fertilizer use efficiency (FUE) is a measure of NUE. Crop production can be measured by biomass, vigor or yield. The plant's nitrogen use efficiency is typically a result of an alteration in at least one of the uptake, spread, absorbance, accumulation, relocation (within the plant) and use of nitrogen absorbed by the plant. Improved abiotic stress tolerance or NUE is with respect to that of a non-transgenic plant (i.e., lacking the transgene of the transgenic plant) of the same species and of the same developmental stage and grown under the same conditions. As used herein the phrase "nitrogen-limiting conditions" refers to growth conditions which include a level (e.g., concentration) of nitrogen (e.g., ammonium or nitrate) applied which is below the level needed for optimal plant metabolism, growth, reproduction and/or viability. As used herein the term/phrase "biomass", "biomass of a plant" or "plant biomass" refers to the amount (e.g., measured in grams of air-dry tissue) of a tissue produced from the plant in a growing season. An increase in plant biomass can be in the whole plant or in parts thereof such as aboveground (e.g. harvestable) parts, vegetative biomass, roots and/or seeds. As used herein the term/phrase "vigor", "vigor of a plant" or "plant vigor" refers to the amount (e.g., measured by weight) of tissue produced by the plant in a given time. Increased vigor could determine or affect the plant yield or the yield per growing time or growing area. In addition, early vigor (e.g. seed and/or seedling) results in improved field stand. As used herein the term/phrase "yield", "yield of a plant" or "plant yield" refers to the amount (e.g., as determined by weight or size) or quantity (e.g., numbers) of tissues or organs produced per plant or per growing season. Increased yield of a plant can affect the economic benefit one can obtain from the plant in a certain growing area and/or growing time. According to an exemplary embodiment the yield is measured by cellulose content. According to another exemplary embodiment the yield is measured by oil content. According to another exemplary embodiment the yield is measured by protein content. According to another exemplary embodiment, the yield is measured by seed number per plant or part thereof (e.g., kernel). A plant yield can be affected by various parameters including, but not limited to, plant biomass; plant vigor; plant growth rate; seed yield; seed or grain quantity; seed or grain quality; oil yield; content of oil, starch and/or protein in harvested organs (e.g., seeds or vegetative parts of the plant); number of flowers (e.g. florets) per panicle (e.g. expressed as a ratio of number of filled seeds over number of primary panicles); harvest index; number of plants grown per area; number and size of harvested organs per plant and per area; number of plants per growing area (e.g. density); number of harvested organs in field; total leaf area; carbon assimilation and carbon partitioning (e.g. the distribution/allocation of carbon within the plant); resistance to shade; number of harvestable organs (e.g. seeds), seeds per pod, weight per seed; and modified architecture [such as increase stalk diameter, thickness or improvement of physical properties (e.g. elasticity)] . As used herein the term "improving" or "increasing" refers to at least about 2 , at least about 3 , at least about 4 , at least about 5 , at least about 10 , at least about 15 , at least about 20 , at least about 25 , at least about 30 , at least about 35 , at least about 40 , at least about 45 , at least about 50 , at least about 60 , at least about 70 , at least about 80 , at least about 90 % or greater increase in nitrogen use efficiency, in tolerance to abiotic stress, in yield, in biomass or in vigor of a plant, as compared to a native or wild-type plants [i.e., plants not genetically modified to express the bio-molecules (e.g., polynucleotides) of the invention, e.g., a non- transformed plant of the same species and of the same developmental stage which is grown under the same growth conditions as the transformed plant]. Improved plant abiotic stress tolerance is translated in the field into harvesting similar quantities of yield, while growing on less than optimal conditions (e.g., salinity, heat, cold, drought etc.) or harvesting higher yield when growing under optimal growth conditions. Improved plant nitrogen use efficiency is translated in the field into either harvesting similar quantities of yield, while implementing less fertilizers, or increased yields gained by implementing the same levels of fertilizers. Thus, improved NUE or FUE has a direct effect on plant yield in the field. Likewise, improved ABST refers to harvesting similar quantities of yield, while negating the need for growth under regulated conditions such as in a green-house or under irrigation. The term "plant" as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, roots (including tubers), and isolated plant cells, tissues and organs. The plant may be in any form including suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores. As used herein the phrase "plant cell" refers to plant cells which are derived and isolated from disintegrated plant cell tissue or plant cell cultures. As used herein the phrase "plant cell culture" refers to any type of native (naturally occurring) plant cells, plant cell lines and genetically modified plant cells, which are not assembled to form a complete plant, such that at least one biological structure of a plant is not present. Optionally, the plant cell culture of this aspect of the present invention may comprise a particular type of a plant cell or a plurality of different types of plant cells. It should be noted that optionally plant cultures featuring a particular type of plant cell may be originally derived from a plurality of different types of such plant cells. Any commercially or scientifically valuable plant is envisaged in accordance with these embodiments of the invention. Plants that are particularly useful in the methods of the invention include all plants which belong to the super family Viridiplantae, in particular monocotyledonous and dicotyledonous plants including a fodder or forage legume, ornamental plant, food crop, tree, or shrub selected from the list comprising Acacia spp., Acer spp., Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp, Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chacoomeles spp., Cinnamomum cassia, Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneaster serotina, Crataegus spp., Cucumis spp., Cupressus spp., Cyathea dealbata, Cydonia oblonga, Cryptomeria japonica, Cymbopogon spp., Cynthea dealbata, Cydonia oblonga, Dalbergia monetaria, Davallia divaricata, Desmodium spp., Dicksonia squarosa, Dibeteropogon amplectens, Dioclea spp, Dolichos spp., Dorycnium rectum, Echinochloa pyramidalis, Ehraffia spp., Eleusine coracana, Eragrestis spp., Erythrina spp., Eucalyptus spp., Euclea schimperi, Eulalia vi/losa, Pagopyrum spp., Feijoa sellowlana, Fragaria spp., Flemingia spp, Freycinetia banksli, Geranium thunbergii, GinAgo biloba, Glycine javanica, Gliricidia spp, Gossypium hirsutum, Grevillea spp., Guibourtia coleosperma, Hedysarum spp., Hemaffhia altissima, Heteropogon contoffus, Hordeum vulgare, Hyparrhenia rufa, Hypericum erectum, Hypeffhelia dissolute, Indigo incamata, Iris spp., Leptarrhena pyrolifolia, Lespediza spp., Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lotonus bainesli, Lotus spp., Macrotyloma axillare, Malus spp., Manihot esculenta, Medicago saliva, Metasequoia glyptostroboides, Musa sapientum, Nicotianum spp., Onobrychis spp., Ornithopus spp., Oryza spp., Peltophorum africanum, Pennisetum spp., Persea gratissima, Petunia spp., Phaseolus spp., Phoenix canadensis, Phormium cookianum, Photinia spp., Picea glauca, Pinus spp., Pisum sativam, Podocarpus totara, Pogonarthria fleckii, Pogonaffhria squarrosa, Populus spp., Prosopis cineraria, Pseudotsuga menziesii, Pterolobium stellatum, Pyrus communis, Quercus spp., Rhaphiolepsis umbellata, Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes spp., Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp., Schyzachyrium sanguineum, Sciadopitys vefficillata, Sequoia sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia spp., Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Tadehagi spp, Taxodium distichum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga heterophylla, Vaccinium spp., Vicia spp., Vitis vinifera, Watsonia pyramidata, Zantedeschia aethiopica, Zea mays, amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, collard greens, flax, kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, straw, sugar beet, sugar cane, sunflower, tomato, squash tea, maize, wheat, barley, rye, oat, peanut, pea, lentil and alfalfa, cotton, rapeseed, canola, pepper, sunflower, tobacco, eggplant, eucalyptus, a tree, an ornamental plant, a perennial grass and a forage crop. Alternatively algae and other non-Viridiplantae can be used for the methods of the present invention. According to some embodiments of the invention, the plant used by the method of the invention is a crop plant including, but not limited to, cotton, Brassica vegetables, oilseed rape, sesame, olive tree, palm oil, banana, wheat, corn or maize, barley, alfalfa, peanuts, sunflowers, rice, oats, sugarcane, soybean, turf grasses, barley, rye, sorghum, sugar cane, chicory, lettuce, tomato, zucchini, bell pepper, eggplant, cucumber, melon, watermelon, beans, hibiscus, okra, apple, rose, strawberry, chile, garlic, pea, lentil , canola, mums, arabidopsis, broccoli, cabbage, beet, quinoa, spinach, squash, onion, leek, tobacco, potato, sugarbeet, papaya, pineapple, mango, Arabidopsis thaliana, and also plants used in horticulture, floriculture or forestry, such as, but not limited to, poplar, fir, eucalyptus, pine, an ornamental plant, a perennial grass and a forage crop, coniferous plants, moss, algae, as well as other plants listed in World Wide Web (dot) nationmaster (dot) com/encyclopedia/Plantae. According to a specific embodiment of the present invention, the plant comprises corn. According to a specific embodiment of the present invention, the plant comprises sorghum. As used herein, the phrase "exogenous polynucleotide" refers to a heterologous nucleic acid sequence which may not be naturally expressed within the plant or which overexpression in the plant is desired. The exogenous polynucleotide may be introduced into the plant in a stable or transient manner, so as to produce a ribonucleic acid (RNA) molecule. It should be noted that the exogenous polynucleotide may comprise a nucleic acid sequence which is identical or partially homologous to an endogenous nucleic acid sequence of the plant. As mentioned the present teachings are based on the identification of RNA interfering molecular sequences (dsRNA) which modulate abiotic stress tolerance of plants. According to some embodiments of the present aspect of the invention, the exogenous polynucleotide encodes an RNA interfering molecule. Since its initial implementation, remarkable progress has been made in plant genetic engineering, and successful enhancements of commercially important crop plants have been reported (e.g., corn, cotton, soybean, canola, tomato). RNA interference (RNAi) is a remarkably potent technique and has steadily been established as the leading method for specific down-regulation/silencing of a target gene, through manipulation of one of two small RNA molecules, microRNAs (miRNAs) or small interfering RNAs (siRNAs). Both miRNAs and siRNAs are oligonucleotides (20-24 bps, i.e., the mature molecule) processed from longer RNA precursors by Dicer-like ribonucleases, although the source of their precursors is different (i.e., local single RNA molecules with imperfect stem-loop structures for miRNA, and long, double-stranded precursors potentially from bimolecular duplexes for siRNA). Additional characteristics that differentiate miRNAs from siRNAs are their sequence conservation level between related organisms (high in miRNAs, low to non-existent in siRNAs), regulation of genes unrelated to their locus of origin (typical for miRNAs, infrequent in siRNAs) and the genetic requirements for their respective functions are somewhat dissimilar in many organisms (Jones-Rhoades et ah, 2006, Ann Rev Plant Biol 57:19-53). Despite all their differences, miRNAs and siRNAs are overall chemically and functionally similar and both are incorporated into silencing complexes, wherein they can guide post-transcriptional repression of multiple target genes, and thus function catalytically.

Thus, the exogenous polynucleotide encodes a dsRNA interfering molecule or a precursor thereof. According to some embodiments the exogenous polynucleotide encodes a miRNA or a precursor thereof. According to other embodiments the exogenous polynucleotide encodes a siRNA or a precursor thereof. As used herein, the phrase "siRNA" (also referred to herein interchangeably as "small interfering RNA" or "silencing RNA", is a class of double- stranded RNA molecules, 20-25 nucleotides in length. The most notable role of siRNA is its involvement in the RNA interference (RNAi) pathway, where it interferes with the expression of a specific gene. The siRNA precursor relates to a long dsRNA structure (at least 90 % complementarity) of at least 30 bp. As used herein, the phrase "microRNA (also referred to herein interchangeably as "miRNA" or "miR") or a precursor thereof" refers to a microRNA (miRNA) molecule acting as a post-transcriptional regulator. Typically, the miRNA molecules are RNA molecules of about 20 to 22 nucleotides in length which can be loaded into a RISC complex and which direct the cleavage of another RNA molecule, wherein the other RNA molecule comprises a nucleotide sequence essentially complementary to the nucleotide sequence of the miRNA molecule. Typically, a miRNA molecule is processed from a "pre-miRNA" or as used herein a precursor of a pre-miRNA molecule by proteins, such as DCL proteins, present in any plant cell and loaded onto a RISC complex where it can guide the cleavage of the target RNA molecules. Pre-microRNA molecules are typically processed from pri-microRNA molecules (primary transcripts). The single stranded RNA segments flanking the pre- microRNA are important for processing of the pri-miRNA into the pre-miRNA. The cleavage site appears to be determined by the distance from the stem-ssRNA junction (Han et al. 2006, Cell 125, 887-901, 887-901). As used herein, a "pre-miRNA" molecule is an RNA molecule of about 100 to about 200 nucleotides, preferably about 100 to about 130 nucleotides which can adopt a secondary structure comprising a double stranded RNA stem and a single stranded RNA loop (also referred to as "hairpin") and further comprising the nucleotide sequence of the miRNA (and its complement sequence) in the double stranded RNA stem. According to a specific embodiment, the miRNA and its complement are located about 10 to about 20 nucleotides from the free ends of the miRNA double stranded RNA stem. The length and sequence of the single stranded loop region are not critical and may vary considerably, e.g. between 30 and 50 nt in length. The complementarity between the miRNA and its complement need not be perfect and about 1 to 3 bulges of unpaired nucleotides can be tolerated. The secondary structure adopted by an RNA molecule can be predicted by computer algorithms conventional in the art such as mFOLD. The particular strand of the double stranded RNA stem from the pre-miRNA which is released by DCL activity and loaded onto the RISC complex is determined by the degree of complementarity at the 5' end, whereby the strand which at its 5' end is the least involved in hydrogen bounding between the nucleotides of the different strands of the cleaved dsRNA stem is loaded onto the RISC complex and will determine the sequence specificity of the target RNA molecule degradation. However, if empirically the miRNA molecule from a particular synthetic pre-miRNA molecule is not functional (because the "wrong" strand is loaded on the RISC complex), it will be immediately evident that this problem can be solved by exchanging the position of the miRNA molecule and its complement on the respective strands of the dsRNA stem of the pre- miRNA molecule. As is known in the art, binding between A and U involving two hydrogen bounds, or G and U involving two hydrogen bounds is less strong that between G and C involving three hydrogen bounds. Exemplary hairpin sequences are provided in Tables 1-8, below. Naturally occurring miRNA molecules may be comprised within their naturally occurring pre-miRNA molecules but they can also be introduced into existing pre- miRNA molecule scaffolds by exchanging the nucleotide sequence of the miRNA molecule normally processed from such existing pre-miRNA molecule for the nucleotide sequence of another miRNA of interest. The scaffold of the pre-miRNA can also be completely synthetic. Likewise, synthetic miRNA molecules may be comprised within, and processed from, existing pre-miRNA molecule scaffolds or synthetic pre- miRNA scaffolds. Some pre-miRNA scaffolds may be preferred over others for their efficiency to be correctly processed into the designed microRNAs, particularly when expressed as a chimeric gene wherein other DNA regions, such as untranslated leader sequences or transcription termination and polyadenylation regions are incorporated in the primary transcript in addition to the pre-microRNA. According to the present teachings, the dsRNA molecules may be naturally occurring or synthetic. Basically, siRNA and miRNA behave the same. Each can cleave perfectly complementary mRNA targets and decrease the expression of partially complementary targets. Thus, the present teachings contemplate expressing an exogenous polynucleotide having a nucleic acid sequence at least 80 %, 85 %, 90 %, 9 1 %, 92 %, 93 %, 94 , 95 %, 96 %, 97 %, 98 % 99 % or 100 % identical to SEQ ID NOs. 101-216, 217-222, 223- 227, 264-416 (Tables 1-8), provided that they regulate abiotic stress tolerance (e.g., heat stress, drought or salinity). Assays for testing the efficacy of transgenes on abiotic stress tolerance are further described hereinbelow. Alternatively or additionally, the present teachings contemplate expressing an exogenous polynucleotide having a nucleic acid sequence at least 65%, 50 %, 75 %, 80 %, 85 %, 90 %, 9 1 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 % 99 % or 100 % identical to SEQ ID NOs. 217-222, 417-421, 458-614 (hairpin sequences of Tables 1-8 representing the core maize genes which were upregulated), provided that they regulate abiotic stress tolerance (e.g., heat stress, drought or salinity). Tables 1-8 below illustrate exemplary miRNA sequences and precursors thereof which over expression are associated with modulation of abiotic stress tolerance. For example, dsRNA sequences which are up-regulated during salinity stress are listed in Tables 3, 4 and 7. dsRNA sequences which are up-regulated during heat stress are listed in Tables 5 and 8.

dsRNA sequences which are up-regulated during drought are listed in Tables 1, 2 and 6. Likewise, Tables 1-8 provide similarly acting siRNA sequences. The present invention envisages the use of homologous and orthologous sequences of the above RNA interfering molecules. At the precursor level use of homologous sequences can be done to a much broader extend. Thus, in such precursor sequences the degree of homology may be lower in all those sequences not including the mature miRNA or siRNA segment therein. As used herein, the phrase "stem-loop precursor" refers to a stem loop precursor RNA structure from which the miRNA can be processed. In the case of siRNA, the precursor is typically devoid of a stem-loop structure. Pre-microRNA molecules are typically processed from pri-microRNA molecules (primary transcripts). The single stranded RNA segments flanking the pre- microRNA are important for processing of the pri-miRNA into the pre-miRNA. The cleavage site appears to be determined by the distance from the stem-ssRNA junction (Han et al. 2006, Cell 125, 887-901, 887-901). As used herein, a "pre-miRNA" molecule is an RNA molecule of about 100 to about 200 nucleotides, preferably about 100 to about 130 nucleotides which can adopt a secondary structure comprising a double stranded RNA stem and a single stranded RNA loop (also referred to as "hairpin") and further comprising the nucleotide sequence of the miRNA (and its complement sequence) in the double stranded RNA stem. According to a specific embodiment, the miRNA and its complement are located about 10 to about 20 nucleotides from the free ends of the miRNA double stranded RNA stem. The length and sequence of the single stranded loop region are not critical and may vary considerably, e.g. between 30 and 50 nt in length. The complementarity between the miRNA and its complement need not be perfect and about 1 to 3 bulges of unpaired nucleotides can be tolerated. The secondary structure adopted by an RNA molecule can be predicted by computer algorithms conventional in the art such as mFOLD. The particular strand of the double stranded RNA stem from the pre-miRNA which is released by DCL activity and loaded onto the RISC complex is determined by the degree of complementarity at the 5' end, whereby the strand which at its 5' end is the least involved in hydrogen bonding between the nucleotides of the different strands of the cleaved dsRNA stem is loaded onto the RISC complex and will determine the sequence specificity of the target RNA molecule for degradation. However, if empirically the miRNA molecule from a particular synthetic pre-miRNA molecule is not functional (because the "wrong" strand is loaded on the RISC complex), it will be immediately evident that this problem can be solved by exchanging the position of the miRNA molecule and its complement on the respective strands of the dsRNA stem of the pre-miRNA molecule. As is known in the art, binding between A and U involving two hydrogen bonds, or G and U involving two hydrogen bonds is less strong than between G and C involving three hydrogen bonds. Thus, according to a specific embodiment, the exogenous polynucleotide encodes a stem-loop precursor of the nucleic acid sequence. Such a stem-loop precursor can be at least about 60 , at least about 65 , at least about 70 , at least about 75 , at least about 80 , at least about 85 , at least about 90 , at least about 95 % or more identical to SEQ ID NOs: 417-421, 458-614 (homolog precursors which are upregulated as in Tables 1-8), provided that it regulates abiotic stress tolerance (e.g., drought, salinity or heat stress). Identity (e.g., percent identity) can be determined using any homology comparison software, including for example, the BlastN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters. Homology (e.g., percent homology, identity + similarity) can be determined using any homology comparison software, including for example, the TBLASTN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters. According to some embodiments of the invention, the term "homology" or "homologous" refers to identity of two or more nucleic acid sequences; or identity of two or more amino acid sequences. Homologous sequences include both orthologous and paralogous sequences. The term "paralogous" relates to gene-duplications within the genome of a species leading to paralogous genes. The term "orthologous" relates to homologous genes in different organisms due to ancestral relationship. One option to identify orthologues in monocot plant species is by performing a reciprocal blast search. This may be done by a first blast involving blasting the sequence-of-interest against any sequence database, such as the publicly available NCBI database which may be found at: Hypertext Transfer Protocol://W orld Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov. The blast results may be filtered. The full-length sequences of either the filtered results or the non-filtered results are then blasted back (second blast) against the sequences of the organism from which the sequence-of- interest is derived. The results of the first and second blasts are then compared. An orthologue is identified when the sequence resulting in the highest score (best hit) in the first blast identifies in the second blast the query sequence (the original sequence-of- interest) as the best hit. Using the same rational a paralogue (homolog to a gene in the same organism) is found. In case of large sequence families, the ClustalW program may be used [Hypertext Transfer Protocol://World Wide Web (dot) ebi (dot) ac (dot) uk/Tools/clustalw2/index (dot) html], followed by a neighbor-joining tree (Hypertext Transfer Protocol://en (dot) wikipedia (dot) org/wiki/Neighbor-joining) which helps visualizing the clustering. The miRNA or precursor sequence can be provided to the plant as naked RNA or expressed from a nucleic acid expression construct, where it is operaly linked to a regulatory sequence. Interestingly, while screening for RNAi regulatory sequences, the present inventors have identified a number of miRNA and siRNA sequences which have never been described before. Thus, according to an aspect of the invention there is provided an isolated polynucleotide having a nucleic acid sequence at least 80 , 85 % 90 , 9 1 , 92 , 93 , 94 , 95 , 96 , 97 , 98 % 99 % or 100 % identical to SEQ ID NO: 16-113, 117-216 (Tables 1-8 predicted dsRNA which are either upregulated or downregulated), wherein said nucleic acid sequence is capable of regulating abiotic stress tolerance of a plant (e.g., salinity, drought or heat stress). According to a specific embodiment, the isolated polynucleotide encodes a stem- loop precursor of the nucleic acid sequence. According to a specific embodiment, the stem-loop precursor is at least about 60 , at least about 65 , at least about 70 , at least about 75 , at least about 80 , at least about 85 , at least about 90 , at least about 95 % or more identical to the precursor sequence, provided that it is capable of regulating abiotic stress tolerance of a plant (e.g., salinity, drought or heat stress). According to a specific embodiment, the stem-loop precursor is selected from the group of precursor sequences of SEQ ID NOs: 101-113 and 117-216 (mature of predicted upregulated). According to a specific embodiment, the stem-loop precursor is selected from the group of precursor sequences of SEQ ID NOs: 16-100. As mentioned, the present inventors have also identified RNAi sequences which are down regulated under abiotic stress conditions (e.g., salinity, drought or heat stress). Thus, according to an aspect of the invention there is provided a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide which downregulates an activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence at least 90 % homologous to the sequence selected from the group consisting of SEQ ID NOs: 1-100, 615-626, 639 (Tables 1-8 MATURE DOWN-REGULATED), thereby improving, abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant. Precursor hairpin sequences of those miRs are provided in SEQ ID NOs: 627-638 and 640 and homologous sequences (i.e., at least 60 , at least about 65 , at least about 70 , at least about 75 , at least about 80 , at least about 85 , at least about 90 , at least about 95 % or more identical to the precursor sequence). There are various approaches to down regulate RNAi sequences. As used herein the term "down-regulation" refers to reduced activity or expression of the dsRNA (at least 10 , 20 , 30 , 50 , 60 , 70 , 80 , 90 % or 100 % reduction in activity or expression) as compared to its activity or expression in a plant of the same species and the same developmental stage not expressing the exogenous polynucleotide. Nucleic acid agents that down-regulate miR activity include, but are not limited to, a target mimic, a micro-RNA resistant gene and a miRNA inhibitor. The target mimic or micro-RNA resistant target is essentially complementary to the microRNA provided that one or more of following mismatches are allowed: (a) a mismatch between the nucleotide at the 5' end of the microRNA and the corresponding nucleotide sequence in the target mimic or micro-RNA resistant target; (b) a mismatch between any one of the nucleotides in position 1 to position 9 of the microRNA and the corresponding nucleotide sequence in the target mimic or micro-RNA resistant target; or (c) three mismatches between any one of the nucleotides in position 12 to position 2 1 of the microRNA and the corresponding nucleotide sequence in the target mimic or micro-RNA resistant target provided that there are no more than two consecutive mismatches. The target mimic RNA is essentially similar to the target RNA modified to render it resistant to miRNA induced cleavage, e.g. by modifying the sequence thereof such that a variation is introduced in the nucleotide of the target sequence complementary to the nucleotides 10 or 11 of the miRNA resulting in a mismatch. Alternatively, a microRNA-resistant target may be implemented. Thus, a silent mutation may be introduced in the microRNA binding site of the target gene so that the DNA and resulting RNA sequences are changed in a way that prevents microRNA binding, but the amino acid sequence of the protein is unchanged. Thus, a new sequence can be synthesized instead of the existing binding site, in which the DNA sequence is changed, resulting in lack of miRNA binding to its target. Tables 14-19 below provide non-limiting examples of target mimics and target resistant sequences that can be used to down-regulate the activity of the miRs/siRNAs of the invention. According to a specific embodiment, the target mimic or micro-RNA resistant target is linked to the promoter naturally associated with the pre-miRNA recognizing the target gene and introduced into the plant cell. In this way, the miRNA target mimic or micro-RNA resistant target RNA will be expressed under the same circumstances as the miRNA and the target mimic or micro-RNA resistant target RNA will substitute for the non-target mimic/micro-RNA resistant target RNA degraded by the miRNA induced cleavage. Non-functional miRNA alleles or miRNA resistant target genes may also be introduced by homologous recombination to substitute the miRNA encoding alleles or miRNA sensitive target genes. While further reducing the present invention to practice, the present inventors have uncovered through extensive experimentation and screening genes that are targeted by the dsRNA sequences of the present teachings and suggest overexpressing these genes or sequences controlling same in the generation of transgenic plants having improved agricultural traits. Thus, according to an aspect of the invention there is provided a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide encoding a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1861-1869, 1892-1915, 1921-1924, 1931-1939, 1952-1963, 2010-2014, 2327-2355, 2763-3040, 3044-3163, 3175-3269, 3313-3323, 3458-3944 or 3950-3969 (targets of down-regulated miRs of Tables 1-8), wherein said polypeptide is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant. Generally, the tables provided in the Examples section are to be considered an integral part of the specification. As used herein a "target gene" refers to a gene that is processed by microRNA or siRNA activity. Typically the gene encodes a polypeptide which expression is downregulated due to microRNA/siRNA processing. Target genes are typically identified using the WMD3 website http://wmd3dotweigelworlddotorg/) . As mentioned, the method of the present invention is performed by expressing within a plant an exogenous polynucleotide encoding a target gene of the RNA interfering molecules uncovered by the present inventors, as explained below. As used herein, the phrase "expressing within the plant an exogenous polynucleotide" refers to upregulating the expression level of an exogenous polynucleotide within the plant e.g., by introducing the exogenous polynucleotide into a plant or plant cell and expressing by recombinant means, as described in detail hereinbelow. As used herein "expressing" refers to expression at the mRNA level (e.g., in case the target gene expresses an mRNA product but no protein or in the case of expressing the dsRNA) or at the polypeptide level of the desired exogenous polynucleotide. As used herein, the phrase "exogenous polynucleotide" refers to a heterologous nucleic acid sequence which may not be naturally expressed within the plant or which overexpression in the plant is desired (i.e., overexpression of an endogenous gene). The exogenous polynucleotide may be introduced into the plant in a stable or transient manner, so as to produce a ribonucleic acid (RNA) molecule and/or a polypeptide molecule. The exogenous polynucleotide may comprise a nucleic acid sequence which is identical or partially homologous to an endogenous nucleic acid sequence expressed within the plant. The term "endogenous" as used herein refers to any polynucleotide or polypeptide which is present and/or naturally expressed within a plant or a cell thereof. As used herein the term "polynucleotide" refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence (e.g. sequence isolated from a chromosome) and/or a composite polynucleotide sequences (e.g., a combination of the above). This term includes polynucleotides and/or oligonucleotides derived from naturally occurring nucleic acid molecules (e.g., RNA or DNA), synthetic polynucleotide and/or oligonucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone), as well as synthetic polynucleotides and/or oligonucleotides having non- naturally occurring portions, which function similarly to the respective naturally occurring portions. The term "isolated" refers to at least partially separated from the natural environment e.g., from a plant cell. Nucleic acid sequences of the polypeptides of some embodiments of the invention may be optimized for expression in a specific plant host. Examples of such sequence modifications include, but are not limited to, an altered G/C content to more closely approach that typically found in the plant species of interest, and the removal of codons atypically found in the plant species commonly referred to as codon optimization. The phrase "codon optimization" refers to the selection of appropriate DNA nucleotides for use within a structural gene or fragment thereof that approaches codon usage within the plant of interest. Therefore, an optimized gene or nucleic acid sequence refers to a gene in which the nucleotide sequence of a native or naturally occurring gene has been modified in order to utilize statistically-preferred or statistically-favored codons within the plant. The nucleotide sequence typically is examined at the DNA level and the coding region optimized for expression in the plant species determined using any suitable procedure, for example as described in Sardana et al. (1996, Plant Cell Reports 15:677-681). In this method, the standard deviation of codon usage, a measure of codon usage bias, may be calculated by first finding the squared proportional deviation of usage of each codon of the native gene relative to that of highly expressed plant genes, followed by a calculation of the average squared deviation. The formula used is: 1 SDCU = n = 1 N [ ( Xn - Yn ) / Yn ] 2 / N, where Xn refers to the frequency of usage of codon n in highly expressed plant genes, where Yn to the frequency of usage of codon n in the gene of interest and N refers to the total number of codons in the gene of interest. A table of codon usage from highly expressed genes of dicotyledonous plants is compiled using the data of Murray et al. (1989, Nuc Acids Res. 17:477-498). One method of optimizing the nucleic acid sequence in accordance with the preferred codon usage for a particular plant cell type is based on the direct use, without performing any extra statistical calculations, of codon optimization tables such as those provided on-line at the Codon Usage Database through the NIAS (National Institute of Agrobiological Sciences) DNA bank in Japan (www.kazusa.or.jp/codon/). The Codon Usage Database contains codon usage tables for a number of different species, with each codon usage table having been statistically determined based on the data present in Genbank. By using the above tables to determine the most preferred or most favored codons for each amino acid in a particular species (for example, rice), a naturally- occurring nucleotide sequence encoding a protein of interest can be codon optimized for that particular plant species. This is effected by replacing codons that may have a low statistical incidence in the particular species genome with corresponding codons, in regard to an amino acid, that are statistically more favored. However, one or more less- favored codons may be selected to delete existing restriction sites, to create new ones at potentially useful junctions (5' and 3' ends to add signal peptide or termination cassettes, internal sites that might be used to cut and splice segments together to produce a correct full-length sequence), or to eliminate nucleotide sequences that may negatively effect mRNA stability or expression. The naturally-occurring encoding nucleotide sequence may already, in advance of any modification, contain a number of codons that correspond to a statistically- favored codon in a particular plant species. Therefore, codon optimization of the native nucleotide sequence may comprise determining which codons, within the native nucleotide sequence, are not statistically-favored with regards to a particular plant, and modifying these codons in accordance with a codon usage table of the particular plant to produce a codon optimized derivative. A modified nucleotide sequence may be fully or partially optimized for plant codon usage provided that the protein encoded by the modified nucleotide sequence is produced at a level higher than the protein encoded by the corresponding naturally occurring or native gene. Construction of synthetic genes by altering the codon usage is described in for example PCT Patent Application 93/07278. Target genes which are contemplated according to the present teachings are provided in the polynucleotide sequences encoding polypeptides which comprise amino acid sequences as set forth in SEQ ID NO:1816-2014, 2183-2355, 2501-3970. However the present teachings also relate to orthologs or homologs at least about 60 , at least about 65 , at least about 70 , at least about 75 , at least about 80 , at least about 85 , at least about 90 , or at least about 95 % or more identical or similar to SEQ ID NO: 1816-2014, 2183-2355, 2500-3969. Parameters for determining the level of identity are provided hereinbelow. Alternatively or additionally, target genes which are contemplated according to the present teachings are provided in the polynucleotide sequences which comprise nucleic acid sequences as set forth in SEQ ID NO: 2015-2182, 2356-2499, 3970-5236. However the present teachings also relate to orthologs or homologs at least about 60 , at least about 65 , at least about 70 , at least about 75 , at least about 80 , at least about 85 , at least about 90 , or at least about 95 % or more identical or similar to SEQ ID NO: 2015-2182, 2356-2499, 3970-5236 (Tables 20-22). Homology (e.g., percent homology, identity + similarity) can be determined using any homology comparison software, including for example, the TBLASTN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters, when starting from a polypeptide sequence; or the tBLASTX algorithm (available via the NCBI) such as by using default parameters, which compares the six-frame conceptual translation products of a nucleotide query sequence (both strands) against a protein sequence database. According to some embodiments of the invention, the term "homology" or "homologous" refers to identity of two or more nucleic acid sequences; or identity of two or more amino acid sequences. Homologous sequences include both orthologous and paralogous sequences. The term "paralogous" relates to gene-duplications within the genome of a species leading to paralogous genes. The term "orthologous" relates to homologous genes in different organisms due to ancestral relationship. One option to identify orthologues in monocot plant species is by performing a reciprocal blast search. This may be done by a first blast involving blasting the sequence-of-interest against any sequence database, such as the publicly available NCBI database which may be found at: Hypertext Transfer Protocol://W orld Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov. The blast results may be filtered. The full-length sequences of either the filtered results or the non-filtered results are then blasted back (second blast) against the sequences of the organism from which the sequence-of- interest is derived. The results of the first and second blasts are then compared. An orthologue is identified when the sequence resulting in the highest score (best hit) in the first blast identifies in the second blast the query sequence (the original sequence-of- interest) as the best hit. Using the same rational a paralogue (homolog to a gene in the same organism) is found. In case of large sequence families, the ClustalW program may be used [Hypertext Transfer Protocol://World Wide Web (dot) ebi (dot) ac (dot) uk/Tools/clustalw2/index (dot) html], followed by a neighbor-joining tree (Hypertext Transfer Protocol://en (dot) wikipedia (dot) org/wiki/Neighbor-joining) which helps visualizing the clustering. As mentioned the present inventors have also identified genes which down- regulation may be done in order to improve their NUE, biomass, vigor, yield and abiotic stress tolerance. Thus, according to an aspect of the invention there is provided a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide which downregulates an activity or expression of a polypeptide having an amino acid sequence at least 80 , 85 , 90 , 95 , or 100 % homologous to SEQ ID NOs: 1816-1860, 1870-1891, 1916-1920, 1925-1930, 1940-1951, 1964-2009, 2183-2326, 2500-2762, 3041-3043, 3164-3174, 3270-3312, 3324-3457, 3945-3949 (targets of upregulated miRs shown in Tables 20-22), wherein said polypeptide is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant. Down regulation of activity or expression is by at least 10 , 20 , 30 , 40 ,

50 , 60 , 70 , 80 , 90 % or even complete (100 ) loss of activity or expression. Assays for measuring gene expression can be effected at the protein level (e.g,. Western blot, ELISA) or at the mRNA level such as by RT-PCR. According to a specific embodiment the amino acid sequence of the target gene is as set forth in SEQ ID NOs: 1816-1860, 1870-1891, 1916-1920, 1925-1930, 1940- 1951, 1964-2009, 2183-2326, 2500-2762, 3041-3043, 3164-3174, 3270-3312, 3324- 3457, 3945-3949 (targets of upregulated miRs, Tables 20-22). Alternatively or additionally, the amino acid sequence of the target gene is encoded by a polynucleotide sequence as set forth in SEQ ID NOs: 2015-2052, 2062- 2079, 2102-2105, 2110, 2117-2125, 2137-2177, 2356-2477, 3970-4184, 4421-4421, 4528-4538, 4625-4660, 4671-4786, 5214-5218 (targets of upregulated miRs, Tables 20- 22). Examples of polynucleotide downregulating agents that inhibit (also referred to herein as inhibitors or nucleic acid agents) the expression of a target gene are given below.

1. Polynucleotide-Based Inhibition of Gene Expression. It will be appreciated, that any of these methods when specifically referring to downregulating expression/activity of the target genes can be used, at least in part, to downregulate expression or activity of endogenous RNA molecules i. Sense Suppression/Cosuppression In some embodiments of the invention, inhibition of the expression of target gene may be obtained by sense suppression or cosuppression. For cosuppression, an expression cassette is designed to express an RNA molecule corresponding to all or part of a messenger RNA encoding a target gene in the "sense" orientation. Over-expression of the RNA molecule can result in reduced expression of the native gene. Accordingly, multiple plant lines transformed with the cosuppression expression cassette are screened to identify those that show the greatest inhibition of target gene expression. The polynucleotide used for cosuppression may correspond to all or part of the sequence encoding the target gene, all or part of the 5' and/or 3' untranslated region of a target transcript, or all or part of both the coding sequence and the untranslated regions of a transcript encoding the target gene. In some embodiments where the polynucleotide comprises all or part of the coding region for the target gene, the expression cassette is designed to eliminate the start codon of the polynucleotide so that no protein product will be transcribed. Cosuppression may be used to inhibit the expression of plant genes to produce plants having undetectable protein levels for the proteins encoded by these genes. See, for example, Broin, et al., (2002) Plant Cell 15:1517-1532. Cosuppression may also be used to inhibit the expression of multiple proteins in the same plant. Methods for using cosuppression to inhibit the expression of endogenous genes in plants are described in Flavell, et al., (1995) Proc. Natl. Acad. Sci. USA 91:3590-3596; Jorgensen, et al., (1996) Plant Mol. Biol. 31:957-973; Johansen and Carrington, (2001) Plant Physiol. 126:930-938; Broin, et al., (2002) Plant Cell 15:1517-1532; Stoutjesdijk, et al., (2002) Plant Physiol. 129:1723-1731; Yu, et al., (2003) Phytochemistry 63:753-763; and U.S. Pat. Nos. 5,035,323, 5,283,185 and 5,952,657; each of which is herein incorporated by reference. The efficiency of cosuppression may be increased by including a poly-dt region in the expression cassette at a position 3' to the sense sequence and 5' of the polyadenylation signal. See, US Patent Publication Number 20020058815, herein incorporated by reference. Typically, such a nucleotide sequence has substantial sequence identity to the sequence of the transcript of the endogenous gene, optimally greater than about 65 % sequence identity, more optimally greater than about 85 % sequence identity, most optimally greater than about 95 % sequence identity. See, U.S. Pat. Nos. 5,283,185 and 5,035,323; herein incorporated by reference. Transcriptional gene silencing (TGS) may be accomplished through use of hpRNA constructs wherein the inverted repeat of the hairpin shares sequence identity with the promoter region of a gene to be silenced. Processing of the hpRNA into short RNAs which can interact with the homologous promoter region may trigger degradation or methylation to result in silencing. (Aufsatz, et al., (2002) PNAS 99(4): 16499-16506; Mette, et al., (2000) EMBO J. 19(19):5194-5201) ii. Antisense Suppression In some embodiments of the invention, inhibition of the expression of the target gene may be obtained by antisense suppression. For antisense suppression, the expression cassette is designed to express an RNA molecule complementary to all or part of a messenger RNA encoding the target gene. Over-expression of the antisense RNA molecule can result in reduced expression of the native gene. Accordingly, multiple plant lines transformed with the antisense suppression expression cassette are screened to identify those that show the greatest inhibition of target gene expression. The polynucleotide for use in antisense suppression may correspond to all or part of the complement of the sequence encoding the target gene, all or part of the complement of the 5' and/or 3' untranslated region of the target gene transcript, or all or part of the complement of both the coding sequence and the untranslated regions of a transcript encoding the target gene. In addition, the antisense polynucleotide may be fully complementary (i.e., 100% identical to the complement of the target sequence) or partially complementary (i.e., less than 100% identical to the complement of the target sequence) to the target sequence. Antisense suppression may be used to inhibit the expression of multiple proteins in the same plant. Furthermore, portions of the antisense nucleotides may be used to disrupt the expression of the target gene. Generally, sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, 300, 500, 550, 500, 550 or greater may be used. Methods for using antisense suppression to inhibit the expression of endogenous genes in plants are described, for example, in Liu, et al., (2002) Plant Physiol. 129:1732-1753 and U.S. Pat. No. 5,759,829, which is herein incorporated by reference. Efficiency of antisense suppression may be increased by including a poly-dt region in the expression cassette at a position 3' to the antisense sequence and 5' of the polyadenylation signal. See, US Patent Publication Number 20020058815. iii. Double-Stranded RNA Interference In some embodiments of the invention, inhibition of the expression of a target gene may be obtained by double- stranded RNA (dsRNA) interference. For dsRNA interference, a sense RNA molecule like that described above for cosuppression and an antisense RNA molecule that is fully or partially complementary to the sense RNA molecule are expressed in the same cell, resulting in inhibition of the expression of the corresponding endogenous messenger RNA. Expression of the sense and antisense molecules can be accomplished by designing the expression cassette to comprise both a sense sequence and an antisense sequence. Alternatively, separate expression cassettes may be used for the sense and antisense sequences. Multiple plant lines transformed with the dsRNA interference expression cassette or expression cassettes are then screened to identify plant lines that show the greatest inhibition of target gene expression. Methods for using dsRNA interference to inhibit the expression of endogenous plant genes are described in Waterhouse, et al., (1998) Proc. Natl. Acad. Sci. USA 95:13959-13965, Liu, et al., (2002) Plant Physiol. 129:1732-1753, and WO 99/59029, WO 99/53050, WO 99/61631, and WO 00/59035; iv. Hairpin RNA Interference and Intron-Containing Hairpin RNA Interference In some embodiments of the invention, inhibition of the expression of one or more target gene may be obtained by hairpin RNA (hpRNA) interference or intron- containing hairpin RNA (ihpRNA) interference. These methods are highly efficient at downregulating the expression of endogenous genes. See, Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 5:29-38 and the references cited therein. For hpRNA interference, the expression cassette is designed to express an RNA molecule that hybridizes with itself to form a hairpin structure that comprises a single- stranded loop region and a base-paired stem. The base-paired stem region comprises a sense sequence corresponding to all or part of the endogenous messenger RNA encoding the gene whose expression is to be inhibited, and an antisense sequence that is fully or partially complementary to the sense sequence. Thus, the base-paired stem region of the molecule generally determines the specificity of the RNA interference. hpRNA molecules are highly efficient at inhibiting the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations of plants. See, for example, Chuang and Meyerowitz, (2000) Proc. Natl. Acad. Sci. USA 97:5985- 5990; Stoutjesdijk, et al., (2002) Plant Physiol. 129:1723-1731; and Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 5:29-38. Methods for using hpRNA interference to inhibit or silence the expression of genes are described, for example, in Chuang and Meyerowitz, (2000) Proc. Natl. Acad. Sci. USA 97:5985-5990; Stoutjesdijk, et al., (2002) Plant Physiol. 129:1723-1731; Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 5:29-38; Pandolfini, et al., BMC Biotechnology 3:7, and US Patent Publication Number 20030175965; each of which is herein incorporated by reference. A transient assay for the efficiency of hpRNA constructs to silence gene expression in vivo has been described by Panstruga, et al., (2003) Mol. Biol. Rep. 30:135-150, herein incorporated by reference. ForihpRNA, the interfering molecules have the same general structure as for hpRNA, but the RNA molecule additionally comprises an intron that is capable of being spliced in the cell in which the ihpRNA is expressed. The use of an intron minimizes the size of the loop in the hairpin RNA molecule following splicing, and this increases the efficiency of interference. See, for example, Smith, et al., (2000) Nature 507:319-320. In fact, Smith, et al., show 100 % suppression of endogenous gene expression using ihpRNA-mediated interference. Methods for using ihpRNA interference to inhibit the expression of endogenous plant genes are described, for example, in Smith, et al., (2000) Nature 507:319-320; Wesley, et al., (2001) Plant J. 27:581-590; Wang and Waterhouse, (2001) Curr. Opin. Plant Biol. 5:156-150; Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 5:29-38; Helliwell and Waterhouse, (2003) Methods 30:289- 295, and US Patent Publication Number 20030180955, each of which is herein incorporated by reference. The expression cassette for hpRNA interference may also be designed such that the sense sequence and the antisense sequence do not correspond to an endogenous RNA. In this embodiment, the sense and antisense sequence flank a loop sequence that comprises a nucleotide sequence corresponding to all or part of the endogenous messenger RNA of the target gene. Thus, it is the loop region that determines the specificity of the RNA interference. See, for example, WO 02/00905, herein incorporated by reference. v. Amplicon-Mediated Interference Amplicon expression cassettes comprise a plant virus-derived sequence that contains all or part of the target gene but generally not all of the genes of the native virus. The viral sequences present in the transcription product of the expression cassette allow the transcription product to direct its own replication. The transcripts produced by the amplicon may be either sense or antisense relative to the target sequence (i.e., the messenger RNA for target gene). Methods of using amplicons to inhibit the expression of endogenous plant genes are described, for example, in Angell and Baulcombe, (1997) EMBO J. 16:3675-3685, Angell and Baulcombe, (1999) Plant J. 20:357-362, and U.S. Pat. No. 6,656,805, each of which is herein incorporated by reference. vi. Ribozymes In some embodiments, the polynucleotide expressed by the expression cassette of the invention is catalytic RNA or has ribozyme activity specific for the messenger RNA of target gene. Thus, the polynucleotide causes the degradation of the endogenous messenger RNA, resulting in reduced expression of the target gene. This method is described, for example, in U.S. Pat. No. 5,987,071, herein incorporated by reference. 2. Gene Disruption In some embodiments of the present invention, the activity of a miRNA or a target gene is reduced or eliminated by disrupting the gene encoding the target polypeptide. The gene encoding the target polypeptide may be disrupted by any method known in the art. For example, in one embodiment, the gene is disrupted by transposon tagging. In another embodiment, the gene is disrupted by mutagenizing plants using random or targeted mutagenesis, and selecting for plants that have reduced response regulator activity. Recombinant expression is effected by cloning the nucleic acid of interest (e.g., miRNA, target gene, silencing agent etc) into a nucleic acid expression construct under the expression of a plant promoter. In other embodiments of the invention, synthetic single stranded nucleic acids are used as miRNA inhibitors. A miRNA inhibitor is typically between about 17 to 25 nucleotides in length and comprises a 5' to 3' sequence that is at least 90 % complementary to the 5' to 3' sequence of a mature miRNA. In certain embodiments, a miRNA inhibitor molecule is 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, or any range derivable therein. Moreover, a miRNA inhibitor has a sequence (from 5' to 3') that is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100 % complementary, or any range derivable therein, to the 5' to 3' sequence of a mature miRNA, particularly a mature, naturally occurring miRNA. As mentioned, the polynucleotide sequences of the invention can be provided to the plant as naked RNA or expressed from a nucleic acid expression construct, where it is operaly linked to a regulatory sequence. According to a specific embodiment of the invention, there is provided a nucleic acid construct comprising a nucleic acid sequence encoding a miRNA or siRNA or a precursor thereof as described herein, said nucleic acid sequence being under a transcriptional control of a regulatory sequence such as a fiber-cell specific promoter. Alternatively or additionally, there is provided a nucleic acid construct comprising a nucleic acid sequence encoding an inhibitor of the miRNA or siRNA sequences as described herein (e.g., target mimic, miR resistant target or miR inhibitor), said nucleic acid sequence being under a transcriptional control of a regulatory sequence such as a tissue (e.g., root) specific promoter. An exemplary nucleic acid construct which can be used for plant transformation include, the pORE E2 binary vector (Figure 1) in which the relevant polynucleotide sequence is ligated under the transcriptional control of a promoter. A coding nucleic acid sequence is "operably linked" or "transcriptionally linked to a regulatory sequence (e.g., promoter)" if the regulatory sequence is capable of exerting a regulatory effect on the coding sequence linked thereto. Thus the regulatory sequence controls the transcription of the miRNA or precursor thereof. The term "regulatory sequence", as used herein, means any DNA, that is involved in driving transcription and controlling (i.e., regulating) the timing and level of transcription of a given DNA sequence, such as a DNA coding for a miRNA or siRNA, precursor or inhibitor of same. For example, a 5' regulatory region (or "promoter region") is a DNA sequence located upstream (i.e., 5') of a coding sequence and which comprises the promoter and the 5'-untranslated leader sequence. A 3' regulatory region is a DNA sequence located downstream (i.e., 3') of the coding sequence and which comprises suitable transcription termination (and/or regulation) signals, including one or more polyadenylation signals. For the purpose of the invention, the promoter is a plant-expressible promoter. As used herein, the term "plant-expressible promoter" means a DNA sequence which is capable of controlling (initiating) transcription in a plant cell. This includes any promoter of plant origin, but also any promoter of non-plant origin which is capable of directing transcription in a plant cell, i.e., certain promoters of viral or bacterial origin Thus, any suitable promoter sequence can be used by the nucleic acid construct of the present invention. According to some embodiments of the invention, the promoter is a constitutive promoter, a tissue-specific promoter or an inducible promoter (e.g. an abiotic stress-inducible promoter). Suitable constitutive promoters include, for example, hydroperoxide lyase (HPL) promoter, CaMV 35S promoter (Odell et al, Nature 313:810-812, 1985); maize Ubi 1 (Christensen et al, Plant Sol. Biol. 18:675-689, 1992); rice actin (McElroy et al., Plant Cell 2:163-171, 1990); pEMU (Last et al, Theor. Appl. Genet. 8 1 :581-588, 1991); CaMV 19S (Nilsson et al, Physiol. Plant 100:456-462, 1997); GOS2 (de Pater et al, Plant J Nov;2(6):837-44, 1992); ubiquitin (Christensen et al, Plant Mol. Biol. 18: 675- 689, 1992); Rice cyclophilin (Bucholz et al, Plant Mol Biol. 25(5):837-43, 1994); Maize H3 histone (Lepetit et al, Mol. Gen. Genet. 231 : 276-285, 1992); Actin 2 (An et al, Plant J. 10(1);107-121, 1996) and Synthetic Super MAS (Ni et al., The Plant Journal 7: 661-76, 1995). Other constitutive promoters include those in U.S. Pat. Nos. 5,659,026, 5,608,149; 5.608,144; 5,604,121; 5.569,597: 5.466,785; 5,399,680; 5,268,463; and 5,608,142. Suitable tissue- specific promoters include, but not limited to, leaf-specific promoters [such as described, for example, by Yamamoto et al., Plant J. 12:255-265, 1997; Kwon et al., Plant Physiol. 105:357-67, 1994; Yamamoto et al., Plant Cell Physiol. 35:773-778, 1994; Gotor et al., Plant J. 3:509-18, 1993; Orozco et al., Plant Mol. Biol. 23:1129-1138, 1993; and Matsuoka et al., Proc. Natl. Acad. Sci. USA 90:9586-9590, 1993], seed-preferred promoters [e.g., from seed specific genes (Simon, et al., Plant Mol. Biol. 5. 191, 1985; Scofield, et al., J. Biol. Chem. 262: 12202, 1987; Baszczynski, et al., Plant Mol. Biol. 14: 633, 1990), Brazil Nut albumin (Pearson' et al., Plant Mol. Biol. 18: 235- 245, 1992), legumin (Ellis, et al. Plant Mol. Biol. 10: 203- 214, 1988), Glutelin (rice) (Takaiwa, et al., Mol. Gen. Genet. 208: 15-22, 1986; Takaiwa, et al., FEBS Letts. 221 : 43-47, 1987), Zein (Matzke et al., Plant Mol Biol, 143)323-32 1990), napA (Stalberg, et al., Planta 199: 515-519, 1996), Wheat SPA (Albanietal, Plant Cell, 9: 171- 184, 1997), sunflower oleosin (Cummins, etal, Plant Mol. Biol. 19: 873- 876, 1992)], endosperm specific promoters [e.g., wheat LMW and HMW, glutenin-1 (Mol Gen Genet 216:81-90, 1989; NAR 17:461-2), wheat a, b and g gliadins (EMB03: 1409-15, 1984), Barley ltrl promoter, barley Bl, C, D hordein (Theor Appl Gen 98:1253-62, 1999; Plant J 4:343-55, 1993; Mol Gen Genet 250:750- 60, 1996), Barley DOF (Mena et al., The Plant Journal, 116(1): 53- 62, 1998), Biz2 (EP99106056.7), Synthetic promoter (Vicente-Carbajosa et al., Plant J. 13: 629-640, 1998), rice prolamin NRP33, rice -globulin GIb-I (Wu et al., Plant Cell Physiology 39(8) 885- 889, 1998), rice alpha- globulin REB/OHP-1 (Nakase et al. Plant Mol. Biol. 33: 513-S22, 1997), rice ADP-glucose PP (Trans Res 6:157-68, 1997), maize ESR gene family (Plant J 12:235-46, 1997), sorghum gamma- kafirin (PMB 32:1029-35, 1996); e.g., the Napin promoter], embryo specific promoters [e.g., rice OSH1 (Sato et al, Proc. Natl. Acad. Sci. USA, 93: 8 117-8122), KNOX (Postma-Haarsma et al, Plant Mol. Biol. 39:257-71, 1999), rice oleosin (Wu et at, J. Biochem., 123:386, 1998)], and flower- specific promoters [e.g., AtPRP4, chalene synthase (chsA) (Van der Meer, et al., Plant Mol. Biol. 15, 95-109, 1990), LAT52 (Twell et al., Mol. Gen Genet. 217:240-245; 1989), apetala- 3]. Also contemplated are root-specific promoters such as the ROOTP promoter described in Vissenberg K, et al. Plant Cell Physiol. 2005 January; 46(1): 192- 200. The nucleic acid construct of some embodiments of the invention can further include an appropriate selectable marker and/or an origin of replication. The nucleic acid construct of some embodiments of the invention can be utilized to stably or transiently transform plant cells. In stable transformation, the exogenous polynucleotide is integrated into the plant genome and as such it represents a stable and inherited trait. In transient transformation, the exogenous polynucleotide is expressed by the cell transformed but it is not integrated into the genome and as such it represents a transient trait. When naked RNA or DNA is introduced into a cell, the polynucleotides may be synthesized using any method known in the art, including either enzymatic syntheses or solid-phase syntheses. These are especially useful in the case of short polynucleotide sequences with or without modifications as explained above. Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example: Sambrook, J. and Russell, D. W. (2001), "Molecular Cloning: A Laboratory Manual"; Ausubel, R. M. et al., eds. (1994, 1989), "Current Protocols in Molecular Biology," Volumes I-III, John Wiley & Sons, Baltimore, Maryland; Perbal, B. (1988), "A Practical Guide to Molecular Cloning," John Wiley & Sons, New York; and Gait, M. J., ed. (1984), "Oligonucleotide Synthesis"; utilizing solid-phase chemistry, e.g. cyanoethyl phosphoramidite followed by deprotection, desalting, and purification by, for example, an automated trityl-on method or HPLC. There are various methods of introducing foreign genes into both monocotyledonous and dicotyledonous plants (Potrykus, L, Annu. Rev. Plant. Physiol, Plant. Mol. Biol. (1991) 42:205-225; Shimamoto et al., Nature (1989) 338:274-276). The principle methods of causing stable integration of exogenous DNA into plant genomic DNA include two main approaches: (i) Agrobacterium-mediated gene transfer (e.g., T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes); see for example, Klee et al. (1987) Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 2- 25; Gatenby, in Plant Biotechnology, eds. Kung, S, and Arntzen, C. J., Butterworth Publishers, Boston, Mass. (1989) p. 93-112. (ii) Direct DNA uptake: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 52-68; including methods for direct uptake of DNA into protoplasts, Toriyama, K. et al. (1988) Bio/Technology 6:1072-1074. DNA uptake induced by brief electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988) 7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection into plant cells or tissues by particle bombardment, Klein et al. Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology (1988) 6:923- 926; Sanford, Physiol. Plant. (1990) 79:206-209; by the use of micropipette systems: Neuhaus et al., Theor. Appl. Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79:213-217; glass fibers or silicon carbide whisker transformation of cell cultures, embryos or callus tissue, U.S. Pat. No. 5,464,765 or by the direct incubation of DNA with germinating pollen, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad. Sci. USA (1986) 83:715-719. The Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiation of whole plant differentiation. See, e.g., Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicotyledonous plants. According to a specific embodiment of the present invention, the exogenous polynucleotide is introduced into the plant by infecting the plant with a bacteria, such as using a floral dip transformation method (as described in further detail in Example 5, of the Examples section which follows). There are various methods of direct DNA transfer into plant cells. In electroporation, the protoplasts are briefly exposed to a strong electric field. In microinjection, the DNA is mechanically injected directly into the cells using very small micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues. Following stable transformation plant propagation is exercised. The most common method of plant propagation is by seed. Regeneration by seed propagation, however, has the deficiency that due to heterozygosity there is a lack of uniformity in the crop, since seeds are produced by plants according to the genetic variances governed by Mendelian rules. Basically, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the transformed plant be produced such that the regenerated plant has the identical traits and characteristics of the parent transgenic plant. For this reason it is preferred that the transformed plant be regenerated by micropropagation which provides a rapid, consistent reproduction of the transformed plants. Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. The new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant. Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant. The advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced. Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages. Thus, the micropropagation process involves four basic stages: Stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening. During stage one, initial tissue culturing, the tissue culture is established and certified contaminant- free. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals. During stage three, the tissue samples grown in stage two are divided and grown into individual plantlets. At stage four, the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that it can be grown in the natural environment. Although stable transformation is presently preferred, transient transformation of leaf cells, meristematic cells or the whole plant is also envisaged by the present invention. Transient transformation can be effected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses. Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, Tobacco mosaic virus (TMV), brome mosaic virus (BMV) and Bean Common Mosaic Virus (BV or BCMV). Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (bean golden mosaic virus; BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants are described in WO 87/06261. According to some embodiments of the invention, the virus used for transient transformations is avirulent and thus is incapable of causing severe symptoms such as reduced growth rate, mosaic, ring spots, leaf roll, yellowing, streaking, pox formation, tumor formation and pitting. A suitable avirulent virus may be a naturally occurring avirulent virus or an artificially attenuated virus. Virus attenuation may be effected by using methods well known in the art including, but not limited to, sub-lethal heating, chemical treatment or by directed mutagenesis techniques such as described, for example, by Kurihara and Watanabe (Molecular Plant Pathology 4:259- 269, 2003), Galon et al. (1992), Atreya et al. (1992) and Huet et al. (1994). Suitable virus strains can be obtained from available sources such as, for example, the American Type culture Collection (ATCC) or by isolation from infected plants. Isolation of viruses from infected plant tissues can be effected by techniques well known in the art such as described, for example by Foster and Tatlor, Eds. "Plant Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), Vol 81)", Humana Press, 1998. Briefly, tissues of an infected plant believed to contain a high concentration of a suitable virus, preferably young leaves and flower petals, are ground in a buffer solution (e.g., phosphate buffer solution) to produce a virus infected sap which can be used in subsequent inoculations. Construction of plant RNA viruses for the introduction and expression of non- viral exogenous polynucleotide sequences in plants is demonstrated by the above references as well as by Dawson, W. O. et al, Virology (1989) 172:285-292; Takamatsu et al. EMBO J. (1987) 6:307-311; French et al. Science (1986) 231 :1294-1297; Takamatsu et al. FEBS Letters (1990) 269:73-76; and U.S. Pat. No. 5,316,931. When the virus is a DNA virus, suitable modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat proteins which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA. In one embodiment, a plant viral nucleic acid is provided in which the native coat protein coding sequence has been deleted from a viral nucleic acid, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral nucleic acid, and ensuring a systemic infection of the host by the recombinant plant viral nucleic acid, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the non-native nucleic acid sequence within it, such that a protein is produced. The recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or nucleic acid sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Non-native (foreign) nucleic acid sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included. The non-native nucleic acid sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products. In a second embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non- native coat protein coding sequence. In a third embodiment, a recombinant plant viral nucleic acid is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native nucleic acid sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that the sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product. In a fourth embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence. The viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus. The recombinant plant viral nucleic acid or recombinant plant virus is used to infect appropriate host plants. The recombinant plant viral nucleic acid is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (isolated nucleic acid) in the host to produce the desired sequence. In addition to the above, the nucleic acid molecule of the present invention can also be introduced into a chloroplast genome thereby enabling chloroplast expression. A technique for introducing exogenous nucleic acid sequences to the genome of the chloroplasts is known. This technique involves the following procedures. First, plant cells are chemically treated so as to reduce the number of chloroplasts per cell to about one. Then, the exogenous nucleic acid is introduced via particle bombardment into the cells with the aim of introducing at least one exogenous nucleic acid molecule into the chloroplasts. The exogenous nucleic acid is selected such that it is integratable into the chloroplast's genome via homologous recombination which is readily effected by enzymes inherent to the chloroplast. To this end, the exogenous nucleic acid includes, in addition to a gene of interest, at least one nucleic acid stretch which is derived from the chloroplast's genome. In addition, the exogenous nucleic acid includes a selectable marker, which serves by sequential selection procedures to ascertain that all or substantially all of the copies of the chloroplast genomes following such selection will include the exogenous nucleic acid. Further details relating to this technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507 which are incorporated herein by reference. Regardless of the method of transformation, propagation or regeneration, the present invention also contemplates a transgenic plant exogenously expressing the polynucleotide of the invention. According to a specific embodiment, the transgenic plant exogenously expresses a polynucleotide having a nucleic acid sequence at least 80 , 85 , 90 % , 95 % or even 100 % identical to SEQ ID NOs: 1-216, 217-222, 223-227, 264-416, 417-421, 458-614, 615-626, 627-638, 639 or 640 (Tables 1-8), wherein said nucleic acid sequence is capable of regulating abiotic stress tolerance (e.g., salinity, heat stress or drought) of the plant. According to further embodiments, the exogenous polynucleotide encodes a precursor of said nucleic acid sequence. According to yet further embodiments, the stem-loop precursor is at least 60 , 65 , 70 , 75 , 80 , 85 , 90 % , 95 % or even 100 % identical to SEQ ID NO: 217-222, 417-421, 458-614, 627-638 or 640 (precursor sequences of Tables 1-8) but importantly comprises a sequence that is at least 90 % identical to SEQ ID NOs: 1-216, 217-222, 223-227, 264-416, 615-626 or 639 (Tables 1-8 including all the mature sequences). More specifically the exogenous polynucleotide is selected from the group consisting of SEQ ID NO: 1-216, 217-222, 223-227, 264-416, 417-421, 458-614, 615- 626, 627-638, 639 or 640. Alternatively, there is provided a transgenic plant exogenously expressing a polynucleotide which downregulates an activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-100, 615-626, 627-638, 639 or 640. More specifically, the transgenic plant expresses the nucleic acid agent of Tables 14-19. Even more specifically, to improve the agricultural traits of the transgenic plant, it expresses a nucleic acid agent of Tables 14, 15a, 16a and 17-19. Also provided are transgenic plants over expressing the target gene of the invention such as exogenously expressing polypeptide sequences which comprise amino acid sequence selected from the group consisting of SEQ ID NOs: 1816-1860, 1870- 1891, 1916-1920, 1925-1930, 1940-1951, 1964-2009, 2183-2326, 2500-2762, 3041- 3043, 3164-3174, 3270-3312, 3324-3457, 3945-3949 (targets of upregulated dsRNAs of Tables 20-22) or homologs/orthologs of same (at least about 60 , 65 , 70 , 75 , 80 , 85 , 90 % , 95 % or higher level of homology as described above). Accordingly, the present teachings also contemplate nucleic acid expression constructs and plants which comprise the same expressing polynucleotide sequences at least about 60 , 65 , 70 , 75 , 80 , 85 , 90 % , 95 % or higher level of identity to SEQ ID NOs: 2015-2052, 2062-2079, 2102-2105, 2110, 2117-2125, 2137- 2177, 2355-2477, 3970-4184, 4419-4421, 4528-4539, 4625-4660, 4671-4786, 5214- 5218 (targets of upregulated dsRNAs of Tables 20-22). Also contemplated are transgenic plants which express any of the polynucleotide or polypeptide sequences of the present invention (SEQ ID NOs: 1-640, 877-886, 893- 913, 932-1012, 1226-1535, 1617-5237 and homologs thereof). This is important for analyzing the significance of those sequences in regulating abiotic stress tolerance and biomass, NUE, vigor or yield. Also contemplated are hybrids of the above described transgenic plants. A "hybrid plant" refers to a plant or a part thereof resulting from a cross between two parent plants, wherein one parent is a genetically engineered plant of the invention (transgenic plant expressing an exogenous RNAi sequence or a precursor thereof). Such a cross can occur naturally by, for example, sexual reproduction, or artificially by, for example, in vitro nuclear fusion. Methods of plant breeding are well-known and within the level of one of ordinary skill in the art of plant biology. Since abiotic stress tolerance, nitrogen use efficiency as well as yield, vigor or biomass of the plant can involve multiple genes acting additively or in synergy (see, for example, in Quesda et al., Plant Physiol. 130:951-063, 2002), the invention also envisages expressing a plurality of exogenous polynucleotides in a single host plant to thereby achieve superior effect on abiotic stress tolerance, efficiency of nitrogen use, yield, vigor and biomass of the plant. Expressing a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing multiple nucleic acid constructs, each including a different exogenous polynucleotide, into a single plant cell. The transformed cell can then be regenerated into a mature plant using the methods described hereinabove. Alternatively, expressing a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing into a single plant-cell a single nucleic-acid construct including a plurality of different exogenous polynucleotides. Such a construct can be designed with a single promoter sequence which can transcribe a polycistronic messenger RNA including all the different exogenous polynucleotide sequences. Alternatively, the construct can include several promoter sequences each linked to a different exogenous polynucleotide sequence. The plant cell transformed with the construct including a plurality of different exogenous polynucleotides can be regenerated into a mature plant, using the methods described hereinabove. Alternatively, expressing a plurality of exogenous polynucleotides can be effected by introducing different nucleic acid constructs, including different exogenous polynucleotides, into a plurality of plants. The regenerated transformed plants can then be cross-bred and resultant progeny selected for superior yield or fiber traits as described above, using conventional plant breeding techniques. Expression of the miRNAs/siRNAs of the present invention or precursors thereof can be qualified using methods which are well known in the art such as those involving gene amplification e.g., PCR or RT-PCR or Northern blot or in-situ hybridization. According to some embodiments of the invention, the plant expressing the exogenous polynucleotide(s) is grown under stress (abiotic) or normal conditions (e.g., biotic conditions and/or abiotic conditions with sufficient water, optimal temperature and salt). Such conditions, which depend on the plant being grown, are known to those skilled in the art of agriculture, and are further, described above. Examples 7-9 hereinbelow provides specific assays for measuring abiotic stress tolerance. According to some embodiments of the invention, the method further comprises growing the plant expressing the exogenous polynucleotide(s) under abiotic stress or nitrogen limiting conditions. Non-limiting examples of abiotic stress conditions include, water deprivation, drought, excess of water (e.g., flood, waterlogging), freezing, low temperature, high temperature, strong winds, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, salinity, atmospheric pollution, intense light, insufficient light, or UV irradiation, etiolation and atmospheric pollution. Thus, the invention encompasses plants exogenously expressing the polynucleotide(s), the nucleic acid constructs of the invention. Methods of determining the level in the plant of the RNA transcribed from the exogenous polynucleotide are well known in the art and include, for example, Northern blot analysis, reverse transcription polymerase chain reaction (RT-PCR) analysis (including quantitative, semi-quantitative or real-time RT-PCR) and RNA-m situ hybridization. The sequence information and annotations uncovered by the present teachings can be harnessed in favor of classical breeding. Thus, sub-sequence data of those polynucleotides described above, can be used as markers for marker assisted selection (MAS), in which a marker is used for indirect selection of a genetic determinant or determinants of a trait of interest (e.g., tolerance to abiotic stress). Nucleic acid data of the present teachings (DNA or RNA sequence) may contain or be linked to polymorphic sites or genetic markers on the genome such as restriction fragment length polymorphism (RFLP), microsatellites and single nucleotide polymorphism (SNP), DNA fingerprinting (DFP), amplified fragment length polymorphism (AFLP), expression level polymorphism, and any other polymorphism at the DNA or RNA sequence. Examples of marker assisted selections include, but are not limited to, selection for a morphological trait (e.g., a gene that affects form, coloration, male sterility or resistance such as the presence or absence of awn, leaf sheath coloration, height, grain color, aroma of rice); selection for a biochemical trait (e.g., a gene that encodes a protein that can be extracted and observed; for example, isozymes and storage proteins); selection for a biological trait (e.g., pathogen races or insect biotypes based on host pathogen or host parasite interaction can be used as a marker since the genetic constitution of an organism can affect its susceptibility to pathogens or parasites). The polynucleotides described hereinabove can be used in a wide range of economical plants, in a safe and cost effective manner. Plant lines exogenously expressing the polynucleotide of the invention can be screened to identify those that show the greatest increase of the desired plant trait. Thus, according to an additional embodiment of the present invention, there is provided a method of evaluating a trait of a plant, the method comprising: (a) expressing in a plant or a portion thereof the nucleic acid construct; and (b) evaluating a trait of a plant as compared to a wild type plant of the same type; thereby evaluating the trait of the plant. Thus, the effect of the transgene (the exogenous polynucleotide) on different plant characteristics may be determined any method known to one of ordinary skill in the art. Thus, for example, tolerance to abiotic stress conditions may be compared in transformed plants {i.e., expressing the transgene) compared to non-transformed (wild type) plants exposed to the same stress conditions (e.g. water deprivation, salt stress e.g. salinity, suboptimal temperature, osmotic stress, and the like), using the following assays. Methods of qualifying plants as being tolerant or having improved tolerance to abiotic stress or limiting nitrogen levels are well known in the art and are further described hereinbelow. Fertilizer use efficiency - To analyze whether the transgenic plants are more responsive to fertilizers, plants are grown in agar plates or pots with a limited amount of fertilizer, as described, for example, in Yanagisawa et al (Proc Natl Acad Sci U S A. 2004; 101:7833-8). The plants are analyzed for their overall size, time to flowering, yield, protein content of shoot and/or grain. The parameters checked are the overall size of the mature plant, its wet and dry weight, the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Other parameters that may be tested are: the chlorophyll content of leaves (as nitrogen plant status and the degree of leaf verdure is highly correlated), amino acid and the total protein content of the seeds or other plant parts such as leaves or shoots, oil content, etc. Similarly, instead of providing nitrogen at limiting amounts, phosphate or potassium can be added at increasing concentrations. Again, the same parameters measured are the same as listed above. In this way, nitrogen use efficiency (NUE), phosphate use efficiency (PUE) and potassium use efficiency (KUE) are assessed, checking the ability of the transgenic plants to thrive under nutrient restraining conditions. Nitrogen use efficiency - To analyze whether the transgenic plants (e.g., Arabidopsis plants) are more responsive to nitrogen, plant are grown in 0.75-3 millimolar (mM, nitrogen deficient conditions) or 6-10 mM (optimal nitrogen concentration). Plants are allowed to grow for additional 25 days or until seed production. The plants are then analyzed for their overall size, time to flowering, yield, protein content of shoot and/or grain/ seed production. The parameters checked can be the overall size of the plant, wet and dry weight, the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Other parameters that may be tested are: the chlorophyll content of leaves (as nitrogen plant status and the degree of leaf greenness is highly correlated), amino acid and the total protein content of the seeds or other plant parts such as leaves or shoots and oil content. Transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher measured parameters levels than wild-type plants, are identified as nitrogen use efficient plants. Nitrogen Use efficiency assay using plantlets - The assay is done according to Yanagisawa-S. et al. with minor modifications ("Metabolic engineering with Dofl transcription factor in plants: Improved nitrogen assimilation and growth under low- nitrogen conditions" Proc. Natl. Acad. Sci. USA 101, 7833-7838). Briefly, transgenic plants which are grown for 7-10 days in 0.5 x MS [Murashige-Skoog] supplemented with a selection agent are transferred to two nitrogen-limiting conditions: MS media in which the combined nitrogen concentration (NH4NO3 and KNO3) was 0.75 mM (nitrogen deficient conditions) or 6-15 mM (optimal nitrogen concentration). Plants are allowed to grow for additional 30-40 days and then photographed, individually removed from the Agar (the shoot without the roots) and immediately weighed (fresh weight) for later statistical analysis. Constructs for which only T l seeds are available are sown on selective media and at least 20 seedlings (each one representing an independent transformation event) are carefully transferred to the nitrogen-limiting media. For constructs for which T2 seeds are available, different transformation events are analyzed. Usually, 20 randomly selected plants from each event are transferred to the nitrogen-limiting media allowed to grow for 3-4 additional weeks and individually weighed at the end of that period. Transgenic plants are compared to control plants grown in parallel under the same conditions. Mock- transgenic plants expressing the uidA reporter gene (GUS) under the same promoter or transgenic plants carrying the same promoter but lacking a reporter gene are used as control. Nitrogen determination - The procedure for N (nitrogen) concentration determination in the structural parts of the plants involves the potassium persulfate digestion method to convert organic N to NO3 (Purcell and King 1996 Argon. J. 88:111-

113, the modified Cd mediated reduction of N0 3 to N0 2 (Vodovotz 1996 Biotechniques 20:390-394) and the measurement of nitrite by the Griess assay (Vodovotz 1996, supra). The absorbance values are measured at 550 nm against a standard curve of NaN0 2. The procedure is described in details in Samonte et al. 2006 Agron. J. 98:168-176. Tolerance to abiotic stress (e.g. tolerance to drought or salinity) can be evaluated by determining the differences in physiological and/or physical condition, including but not limited to, vigor, growth, size, or root length, or specifically, leaf color or leaf area size of the transgenic plant compared to a non-modified plant of the same species grown under the same conditions. Other techniques for evaluating tolerance to abiotic stress include, but are not limited to, measuring chlorophyll fluorescence, photosynthetic rates and gas exchange rates. Further assays for evaluating tolerance to abiotic stress are provided hereinbelow and in the Examples section which follows. Drought tolerance assay - Soil-based drought screens are performed with plants overexpressing the polynucleotides detailed above. Seeds from control Arabidopsis plants, or other transgenic plants overexpressing nucleic acid of the invention are germinated and transferred to pots. Drought stress is obtained after irrigation is ceased. Transgenic and control plants are compared to each other when the majority of the control plants develop severe wilting. Plants are re-watered after obtaining a significant fraction of the control plants displaying a severe wilting. Plants are ranked comparing to controls for each of two criteria: tolerance to the drought conditions and recovery (survival) following re-watering. Quantitative parameters of tolerance measured include, but are not limited to, the average wet and dry weight, growth rate, leaf size, leaf coverage (overall leaf area), the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher biomass than wild-type plants, are identified as drought stress tolerant plants Salinity tolerance assay - Transgenic plants with tolerance to high salt concentrations are expected to exhibit better germination, seedling vigor or growth in high salt. Salt stress can be effected in many ways such as, for example, by irrigating the plants with a hyperosmotic solution, by cultivating the plants hydroponically in a hyperosmotic growth solution (e.g., Hoagland solution with added salt), or by culturing the plants in a hyperosmotic growth medium [e.g., 50 % Murashige-Skoog medium (MS medium) with added salt]. Since different plants vary considerably in their tolerance to salinity, the salt concentration in the irrigation water, growth solution, or growth medium can be adjusted according to the specific characteristics of the specific plant cultivar or variety, so as to inflict a mild or moderate effect on the physiology and/or morphology of the plants (for guidelines as to appropriate concentration see, Bernstein and Kafkafi, Root Growth Under Salinity Stress In: Plant Roots, The Hidden Half 3rd ed. Waisel Y, Eshel A and Kafkafi U. (editors) Marcel Dekker Inc., New York, 2002, and reference therein). For example, a salinity tolerance test can be performed by irrigating plants at different developmental stages with increasing concentrations of sodium chloride (for example 50 mM, 150 mM, 300 mM NaCl) applied from the bottom and from above to ensure even dispersal of salt. Following exposure to the stress condition the plants are frequently monitored until substantial physiological and/or morphological effects appear in wild type plants. Thus, the external phenotypic appearance, degree of chlorosis and overall success to reach maturity and yield progeny are compared between control and transgenic plants. Quantitative parameters of tolerance measured include, but are not limited to, the average wet and dry weight, growth rate, leaf size, leaf coverage (overall leaf area), the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher biomass than wild-type plants, are identified as abiotic stress tolerant plants. Osmotic tolerance test - Osmotic stress assays (including sodium chloride and PEG assays) are conducted to determine if an osmotic stress phenotype was sodium chloride-specific or if it was a general osmotic stress related phenotype. Plants which are tolerant to osmotic stress may have more tolerance to drought and/or freezing. For salt and osmotic stress experiments, the medium is supplemented for example with 50 mM, 100 mM, 200 mM NaCl or 15 , 20 % or 25 % PEG. Cold stress tolerance - One way to analyze cold stress is as follows. Mature (25 day old) plants are transferred to 4 °C chambers for 1 or 2 weeks, with constitutive light. Later on plants are moved back to greenhouse. Two weeks later damages from chilling period, resulting in growth retardation and other phenotypes, are compared between control and transgenic plants, by measuring plant weight (wet and dry), and by comparing growth rates measured as time to flowering, plant size, yield, and the like. Heat stress tolerance - One way to measure heat stress tolerance is by exposing the plants to temperatures above 34 °C for a certain period. Plant tolerance is examined after transferring the plants back to 22 °C for recovery and evaluation after 5 days relative to internal controls (non-transgenic plants) or plants not exposed to neither cold or heat stress. The biomass, vigor and yield of the plant can also be evaluated using any method known to one of ordinary skill in the art. Thus, for example, plant vigor can be calculated by the increase in growth parameters such as leaf area, fiber length, rosette diameter, plant fresh weight and the like per time. As mentioned, the increase of plant yield can be determined by various parameters. For example, increased yield of rice may be manifested by an increase in one or more of the following: number of plants per growing area, number of panicles per plant, number of spikelets per panicle, number of flowers per panicle, increase in the seed filling rate, increase in thousand kernel weight (1000-weight), increase oil content per seed, increase starch content per seed, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture. Similarly, increased yield of soybean may be manifested by an increase in one or more of the following: number of plants per growing area, number of pods per plant, number of seeds per pod, increase in the seed filling rate, increase in thousand seed weight (1000-weight), reduce pod shattering, increase oil content per seed, increase protein content per seed, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture. Thus, the present invention is of high agricultural value for increasing tolerance of plants to abiotic stress as well as promoting the yield, biomass and vigor of commercially desired crops. According to another embodiment of the present invention, there is provided a food or feed comprising the plants or a portion thereof of the present invention. In a further aspect the invention, the transgenic plants of the present invention or parts thereof are comprised in a food or feed product (e.g., dry, liquid, paste). A food or feed product is any ingestible preparation containing the transgenic plants, or parts thereof, of the present invention, or preparations made from these plants. Thus, the plants or preparations are suitable for human (or animal) consumption, i.e. the transgenic plants or parts thereof are more readily digested. Feed products of the present invention further include a oil or a beverage adapted for animal consumption. It will be appreciated that the transgenic plants, or parts thereof, of the present invention may be used directly as feed products or alternatively may be incorporated or mixed with feed products for consumption. Furthermore, the food or feed products may be processed or used as is. Exemplary feed products comprising the transgenic plants, or parts thereof, include, but are not limited to, grains, cereals, such as oats, e.g. black oats, barley, wheat, rye, sorghum, corn, vegetables, leguminous plants, especially soybeans, root vegetables and cabbage, or green forage, such as grass or hay.

As used herein the term "about" refers to ± 10 % . The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to". The term "consisting of means "including and limited to". The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure. As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof. Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween. As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts. It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements. Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. EXAMPLES Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion. Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

EXAMPLE 1

Differential Expression of miRNAs in Maize Plant under Optimal VersusAbiotic Stress Conditions Experimental Procedures Plant Material Corn seeds were obtained from Galil seeds (Israel). Corn variety GSO308 was used in all experiments. Plants were grown at 24 °C under a 16 hr light : 8 hr dark regime. Drought Induction Corn seeds were germinated and grown at 22 °C in soil under normal conditions for 3-4 weeks. Seedlings were then used for experimental assays of each of the following abiotic stresses: drought, salinity and heat shock. For drought induction, irrigation of the stress group was completely stopped for four or six days. Salt Induction For salinity induction, irrigation with regular water was substituted by irrigation with 300 mM NaCl solution in the stress group, for overall 2-3 irrigations in a period of four or six days. Heat Induction For induction of heat shock, the stress group plants were exposed to a high temperature (37°C) for one hour. For all stress analyses, tissue samples from both experimental groups are then used for RNA analysis, as described below. Total RNA Extraction Total RNA of leaf or root samples from four to eight biological repeats were extracted using the mirVana™ kit (Ambion, Austin, TX) by pooling 3-4 plants to one biological repeat. RNA samples from the two experimental groups of each assay were then loaded onto a microarray for small RNA expression comparison and subsequent identification of differential small RNAs, as described below. Microarray Design Custom microarrays were manufactured by Agilent Technologies by in situ synthesis. The first generation microarray consisted of a total of 13619 non-redundant DNA probes, the majority of which arose from deep sequencing data and included different small RNA molecules (i.e. miRNA, siRNA and predicted small RNA sequences), with each probe being printed once. An in-depth analysis of the first generation microarray, which included hybridization experiments as well as structure and orientation verifications on all its small RNAs, resulted in the formation of an improved, second generation, microarray. The second generation microarray consists of a total 4721 non-redundant DNA 45-nucleotide long probes for all known plant small RNAs, with 912 sequences (19.32%) from Sanger version 15 and the rest (3809), encompassing miRNAs (968=20.5%), siRNAs (1626=34.44%) and predicted small RNA sequences (1215=25.74%), from deep sequencing data accumulated by the inventors, with each probe being printed in triplicate. An additional microarray, consisting of 707 sequences from Sanger version 15 was also used in this invention. Results Wild type maize plants were allowed to grow at standard, optimal conditions or stress conditions for a period of time as specified above, at the end of which they were evaluated for stress tolerance. Three to four plants from each group were grouped as a biological repeat. Four to eight biological repeats were obtained for each group, and RNA was extracted from leaf or root tissue. The expression level of the maize small RNAs was analyzed by high throughput microarray to identify small RNAs that were differentially expressed between the experimental groups. Tables 1-5 below present sequences that were found to be differentially expressed in corn grown under drought conditions (lasting four or six days) compared to optimal growth conditions. To clarify, the sequence of an up-regulated miRNA is induced under stress conditions and the sequence of a down-regulated miRNA is repressed under stress conditions.

Table 1: Differentially Expressed Small RNAs in Plants Growing under Drought (4 days) versus Optimal Conditions.

Mir Name Mature Stem Loop/SEQ ID Direction Leaf 4 d Sequence/SEQ ID NO: NO: Predicted folded 24- 101 up 2.65 nts-long seq 52214 Predicted folded 24- 1 down 2.64 nts-long seq 52255 Predicted siRNA 55507 102 up 4.82 Predicted siRNA 55629 103 up 4.97 Predicted siRNA 55869 104 up 2.23 Predicted siRNA 55937 2 down 2.93 Predicted siRNA 55979 105 up 2.58

Predicted siRNA 56759 106 up 2.22 Predicted siRNA 57049 107 up 2.14 Predicted siRNA 57283 108 up 2.52 Predicted siRNA 58170 3 down 2.22 Predicted zma mir 4 down 2.16 47934 Predicted zma mir 109 up 2.04 48043 Predicted zma mir 5 down 7.44 48120 Predicted zma mir 110 up 3.19 48193 Predicted zma mir 6 down 3.58 48408 Predicted zma mir 7 down 2.69 48451 Predicted zma mir 8 down 3.4 48462 Predicted zma mir 111 up 2.2 485 14 Predicted zma mir 9 down 2.12 48520 Predicted zma mir 10 down 2.78 48669 Predicted zma mir 11 down 3.11 48682 Predicted zma mir 12 down 4.52 48841 Predicted zma mir 13 down 3.02 48966 Predicted zma mir 14 down 2.08 49156 Predicted zma mir 15 down 2.04 49199 Predicted zma mir 112 up 2.18 50109 Predicted zma mir 113 up 2.3 1 50425 tae-miR1 125 114 217 up 2.07

Table 2: Differentially Expressed Small RNAs in Plants Growing under Drought (6 days) versus Optimal Conditions.

Mir Name Mature Stem Loop/SEQ old Direction Fold Fold Sequence/SEQ ID ID NO: numbers Change Change NO: Leaf 6 Root 6 d d ath-miR164c 115 218 up 1.94 1.5 1

218 osa- 116 219 up 3.69 miR2907a 219 Predicted 117 up 3.94 folded 24- nts-long seq 52214 Predicted 16 down 2.95 folded 24- nts-long seq 52255

Predicted 118 up 2.09 folded 24- nts-long seq 52285 Predicted 119 up 2.99 folded 24- nts-long seq 52953 Predicted 120 up 4.24 folded 24- nts-long seq 53693 Predicted 121 up 9.27 siRNA 55507 Predicted 122 up 8.68 siRNA 55629 Predicted 123 up 2.93 siRNA 55775 Predicted 124 up 3.08 siRNA 55869 Predicted 17 down 2.82 siRNA 55937 Predicted 18 down 2.86 siRNA 56066 Predicted 125 up 2.69 siRNA 56759 Predicted 126 up 2.67 siRNA 57049 Predicted 127 up 3.91 siRNA 57283 Predicted 19 down 5.99 siRNA 58170 Predicted 128 up 2.73 siRNA 58574 Predicted 129 up 4.18 siRNA 60433 Predicted 20 down 2.47 zma mir 47934 Predicted 130 up 2.4 zma mir 48043 Predicted 2 1 down 9.3 zma mir 48120 Predicted 13 1 up 5.34 zma mir 48193 Predicted 22 down 3.23 zma mir 48408 Predicted 23 down 2.69 zma mir 4845 1 Predicted 24 down 5.49 zma mir 48462 Predicted 25 down 6.19 zma mir 48520 Predicted 26 down 2.98 zma mir 48653 Predicted 27 down 2.33 zma mir 48669 Predicted 28 down 2.86 zma mir 48682 Predicted 29 down 5.01 zma mir 48841 Predicted 30 down 2.54 zma mir 48966 Predicted 31 down 4.39 zma mir 49156 Predicted 32 down 2.8 zma mir 49199 sbi-miR164c 132 220 up 1.86

220 tae-miR1 125 133 222 221 up 2.58

Table 3: Differentially Expressed Small RNAs in Plants Growing under High Salt (4 days) versus Optimal Conditions Name Mir SEQ ID NO: Direction Fold Change Leaf 4 d folded 24-nts-long Predicted 33 down 2.34 seq 54187 siRNA 54673 Predicted 134 up 2.08

siRNA 54895 Predicted 135 up 2.17

siRNA 55242 Predicted 136 up 2.09

siRNA 55246 Predicted 137 up 2.64

siRNA 55344 Predicted 138 up 2.35 siRNA 55402 Predicted 139 up 2.46 siRNA 55909 Predicted 140 up 2.06

siRNA 56060 Predicted 141 up 2.3 1

siRNA 56305 Predicted 142 up 2.43 siRNA 563 14 Predicted 143 up 2.3 1

siRNA 56506 Predicted 144 up 2.3

siRNA 5665 1 Predicted 145 up 2.42

siRNA 57169 Predicted 146 up 2.25

siRNA 57197 Predicted 147 up 2.15

siRNA 58212 Predicted 148 up 2.66 siRNA 59035 Predicted 149 up 6.12

siRNA 59453 Predicted 150 up 2.73 zma mir 47990 Predicted 34 down 2.69

zma mir 48459 Predicted 45 (35) down 2.37 zma mir 48490 Predicted 15 1 up 3.12

zma mir 48753 Predicted 36 down 2.11 zma mir 48783 Predicted 152 up 2.35

zma mir 48824 Predicted 37 down 2.08 zma mir 48848 Predicted 38 down 2.06 zma mir 49575 Predicted 39 down 2.49 zma mir 498 17 Predicted 40 down 2.8 zma mir 49855 Predicted 4 1 down 2.69 zma mir 49862 Predicted 52 (42) down 2.16 zma mir 50145 Predicted 153 up 3.92

Table 4: Differentially Expressed Small RNAs in Plants Growing under High Salt (6 days) versus Optimal Conditions

Mir Name SEQ ID NO: Direction Fold Change Leaf 6 d Predicted folded 24-nts-long seq 43 down 2.2 54187 Predicted siRNA 54673 154 up 5.57 Predicted siRNA 54895 155 up 6.11 Predicted siRNA 55242 156 up 5.91 Predicted siRNA 55246 157 up 6.3

Predicted siRNA 55344 158 up 8.56 Predicted siRNA 55402 159 up 4.96 Predicted siRNA 55909 160 up 2.58

Predicted siRNA 56060 161 up 2.95 Predicted siRNA 56305 162 up 4.66 Predicted siRNA 563 14 163 up 5.97 Predicted siRNA 56506 164 up 5.98

Predicted siRNA 5665 1 165 up 5.5 Predicted siRNA 57169 166 up 5.52 Predicted siRNA 57197 167 up 3.98

Predicted siRNA 58212 168 up 3.29 Predicted siRNA 59035 169 up 8.47 Predicted siRNA 59453 170 up 2.12 Predicted zma mir 47990 44 down 4.22 Predicted zma mir 48459 45 (35) down 3.21 Predicted zma mir 48490 171 up 2.71 Predicted zma mir 48753 46 down 3.3 Predicted zma mir 48783 172 up 2.69 Predicted zma mir 48824 47 down 2.17 Predicted zma mir 48848 48 down 2.38 Predicted zma mir 49575 49 down 2.07 Predicted zma mir 498 17 50 down 3.26 Predicted zma mir 49855 5 1 down 3.01 Predicted zma mir 49862 52 (42) down 2.88 Predicted zma mir 50145 173 up 3.66

Table 5: Differentially Expressed Small RNAs in Plants Growing under Heat Shock (1 hour) versus Optimal Conditions Mir Name SEQ ID NO: Direction Fold Change Leaf 1 hour Predicted folded 24-nts-long seq 174 up 2.7 50957 Predicted folded 24-nts-long seq 175 up 3.56 5 1391 Predicted folded 24-nts-long seq 176 up 2.47 51709 Predicted folded 24-nts-long seq 177 up 2.46 52606 Predicted folded 24-nts-long seq 178 up 2.47 52682 Predicted folded 24-nts-long seq 53 down 2.25 52724 Predicted folded 24-nts-long seq 179 up 4.42 5385 1 Predicted folded 24-nts-long seq 54 down 4.5 1 53866 Predicted siRNA 54548 180 up 3.72

Predicted siRNA 54566 18 1 up 4.34

Predicted siRNA 54666 182 up 2.42

Predicted siRNA 54735 55 down 4.98

Predicted siRNA 55208 56 down 3.8

Predicted siRNA 55684 183 up 3.16

Predicted siRNA 55793 184 up 2.62

Predicted siRNA 55824 185 up 6.85

Predicted siRNA 55968 186 up 2.35

Predicted siRNA 56154 187 up 2.03

Predicted siRNA 56225 188 up 3.61

Predicted siRNA 56396 57 down 3.08

Predicted siRNA 56582 189 up 2.5 1 Predicted siRNA 56658 190 up 2.19

Predicted siRNA 56664 191 up 3.07 Predicted siRNA 56791 58 down 4.75

Predicted siRNA 56885 192 up 2.24

Predicted siRNA 57061 193 up 3.15

Predicted siRNA 57689 59 down 2.69 Predicted siRNA 58105 194 up 2.55

Predicted siRNA 58108 60 down 6.63 Predicted siRNA 58158 6 1 down 3.98 Predicted siRNA 58387 195 up 2.77

Predicted siRNA 58717 196 up 3.46

Predicted siRNA 58720 62 down 3.54 Predicted siRNA 58740 63 down 2.88 Predicted siRNA 59056 64 down 2.29 Predicted siRNA 5921 1 65 down 5.3 1 Predicted siRNA 59300 66 down 3.04 Predicted siRNA 59379 67 down 2.32 Predicted siRNA 59410 68 down 6.53 Predicted siRNA 59474 69 down 6.01 Predicted siRNA 59580 197 up 3.95

Predicted siRNA 59736 70 down 3.34 Predicted siRNA 59799 7 1 down 2.22 Predicted siRNA 59800 72 down 2 Predicted siRNA 598 17 198 up 7.86 Predicted siRNA 59820 73 down 3.79 Predicted siRNA 5985 1 74 down 9.21 Predicted siRNA 59918 75 down 9.26 Predicted siRNA 59935 76 down 2.06

Predicted siRNA 59937 77 down 2.61

Predicted siRNA 59987 199 up 12.68

Predicted siRNA 60036 200 up 2.16

Predicted siRNA 60421 78 down 6.25 Predicted siRNA 60533 79 down 6.03 Predicted siRNA 60635 201 up 3.01

Predicted siRNA 60718 202 up 2.18

Predicted siRNA 60742 203 up 2.07

Predicted siRNA 60833 80 down 2.45 Predicted siRNA 60993 204 up 2.37

Predicted siRNA 61212 8 1 down 2.14 Predicted siRNA 61236 82 down 2.27 Predicted zma mir 47966 205 up 3.04

Predicted zma mir 48327 83 down 2.04 Predicted zma mir 48479 206 up 3.92

Predicted zma mir 48482 207 up 2.91

Predicted zma mir 48489 84 down 2.98 Predicted zma mir 48790 208 up 2.04

Predicted zma mir 48905 209 up 3.72

Predicted zma mir 49248 85 down 4.94 Predicted zma mir 49259 210 up 3.77

Predicted zma mir 493 10 86 down 4.45 Predicted zma mir 49642 2 11 up 4.3 Predicted zma mir 497 18 212 up 3.57

Predicted zma mir 49952 87 down 2.41 Predicted zma mir 50085 213 up 2.43 Predicted zma mir 50120 88 down 2.92 Predicted zma mir 50166 89 down 2.9 Predicted zma mir 50256 90 down 6.25 Predicted zma mir 50289 9 1 down 2.01 Predicted zma mir 50388 92 down 2.43 Predicted zma mir 50449 214 up 2.25

Predicted zma mir 50453 93 down 7.88 Predicted zma mir 50480 94 down 2.21 Predicted zma mir 5048 1 95 down 2.3 Predicted zma mir 50483 96 down 2.23 Predicted zma mir 50486 215 up 2.34

Predicted zma mir 50522 216 up 2.73

Predicted zma mir 50570 97 down 2.07 Predicted zma mir 50682 98 down 2.21 Predicted zma mir 50695 99 down 2.02 Predicted zma mir 50701 100 down 3.38 EXAMPLE 2 Identification of Homologous and Orthologous Sequences of Differential Small RNAs Associated with Enhanced Abiotic Stress Tolerance The small RNA sequences of the invention that were either down- or up- regulated under abiotic stress conditions were examined for homologous and orthologous sequences using the miRBase database (www.mirbase /) and the Plant MicroRNA Database (PMRD, http://bioinformatics.cau.edu.cn/PMRD). The mature miRNA sequences that are homologous or orthologous to the miRNAs of the invention (listed in Tables 1-5 above) are found using miRNA public databases, having at least 75 % identity of the mature small RNA, and are summarized in Tables 6-8 below.

Table 6: Homologs of Small RNAs Listed in Tables 1-2 Above (Differen bdi- 273 2 1 467 0.95 miR164b bdi- 274 2 1 468 0.95 miR164c bdi- 275 2 1 469 0.95 miR164d bdi- 276 2 1 470 0.95 miR164e bdi- 277 2 1 471 0.86 miR164f bna- 278 2 1 472 0.95 miR164 bra- 279 2 1 473 0.95 miR164a cav- 280 2 1 474 0.95 miR164 csi-miR164 281 2 1 475/605 0.95 ctr-miR164 282 2 1 476 0.95 far- 283 2 1 477 0.9 miR164a far- 284 2 1 478 0.9 miR164b gar- 285 2 1 479 0.86 miR164 ghr- 286 2 1 480 0.95 miR164 gma- 287 2 1 481 0.95 miR164 ini-miR164 288 2 1 482 0.9 mtr- 289 2 1 483 0.95 miR164a mtr- 290 2 1 484 0.95 miR164b mtr- 291 2 1 485 0.95 miR164c mtr- 292 2 1 486 0.9 miR164d osa- 293 2 1 487 0.95 miR164a osa- 294 2 1 488 0.95 miR164b osa- 295 2 1 489 0.9 miR164c osa- 296 2 1 490 0.95 miR164d osa- 297 2 1 491 0.95 miR164e osa- 298 2 1 492 0.95 miR164f ppl- 299 2 1 493 0.95 miR164 ptc- 300 2 1 494 0.95 miR164a ptc- 301 2 1 495 0.95 miR164b ptc- 302 2 1 496 0.95 miR164c ptc- 303 2 1 497 0.95 miR164d ptc- 304 2 1 498 0.95 miR164e ptc- 305 2 1 499 0.9 miR164f rco- 306 2 1 500 0.95 miR164a rco- 307 2 1 501 0.95 miR164b rco- 308 2 1 502 0.95 miR164c rco- 309 2 1 503 0.9 miR164d sbi- 310 2 1 504 0.95 miR164 sbi- 311 2 1 505 0.95 miR164b sbi- 312 2 1 506 0.9 miR164c sbi- 313 2 1 507 0.95 miR164d sbi- 314 2 1 508 0.95 miR164e tae- 315 2 1 509 0.95 miR164 tae- 316 2 1 510 0.95 miR164b tcc- 317 2 1 511 0.95 miR164a tcc- 318 2 1 512 0.95 miR164b tcc- 319 2 1 5 13 0.9 miR164c vvi- 320 2 1 514 0.95 miR164a vvi- 321 2 1 5 15 0.9 miR164b vvi- 322 2 1 516 0.95 miR164c vvi- 323 2 1 517 0.95 miR164d zma- 324 2 1 5 18 0.95 miR164a zma- 325 2 1 519 0.95 miR164b zma- 326 2 1 520 0.95 miR164c zma- 327 2 1 521 0.95 miR164d zma- 4 11 2 1 522/606 0.90/0.95 miR164e miR164c mtr- 358 2 1 552 0.8 1 miR164d osa- 359 2 1 553 0.86 miR164a osa- 360 2 1 554 0.86 miR164b osa- 361 2 1 555 0.8 1 miR164c osa- 362 2 1 556 0.86 miR164d osa- 363 2 1 557 0.95 miR164e osa- 364 2 1 558 0.86 miR164f ppl- 365 2 1 559 0.86 miR164 ptc- 366 2 1 560 0.86 miR164a ptc- 367 2 1 561 0.86 miR164b ptc- 368 2 1 562 0.86 miR164c ptc- 369 2 1 563 0.86 miR164d ptc- 370 2 1 564 0.86 miR164e ptc- 371 2 1 565 0.8 1 miR164f rco- 372 2 1 566 0.86 miR164a rco- 373 2 1 567 0.86 miR164b rco- 374 2 1 568 0.86 miR164c rco- 375 2 1 569 0.8 1 miR164d sbi- 376 2 1 570 0.86 miR164 sbi- 377 2 1 571 0.86 miR164b sbi- 378 2 1 572 0.86 miR164d sbi- 379 2 1 573 0.86 miR164e tae- 380 2 1 574 0.86 miR164 tae- 38 1 2 1 575 0.86 miR164b tcc- 382 2 1 576 0.86 miR164a tcc- 383 2 1 577 0.86 miR164b tcc- 384 2 1 578 0.8 1 miR164c

Table 7: Homologs of Small RNAs Listed in Tables 3-4 Above (Differentially Expressed Under Salinity Stress)

Table 8: Homologs of Small RNAs Listed in Table 5 Above (Differentially Expressed Under Heat Shock Stress) Mir Mature Mir Homologs Sequence/SEQ Homolog Stem %Identity Name Sequence Length Names ID NO: Length Loop Sequence/ SEQ ID NO:

Predicted 85 2 1 zma- 639 2 1 640 0.9 zma mir miR398b* 49248 EXAMPLE 3 Verification of Expression of Small RNA Molecules Associated with Abiotic Stress Small RNAs that are potentially associated with improved abiotic or biotic stress tolerance are first identified by proprietary computational algorithms that analyze RNA expression profiles alongside publicly available gene and protein databases. A high throughput screening is performed on microarrays loaded with miRNAs that were found to be differential under multiple stress and optimal environmental conditions and in different plant tissues. Following identification of small RNA molecules potentially involved in maize abiotic stress tolerance using bioinformatics tools, the actual mRNA levels in an experiment are determined using reverse transcription assay followed by quantitative Real-Time PCR (qRT-PCR) analysis. RNA levels are compared between different tissues, developmental stages, growing conditions and/or genetic backgrounds incorporated in each experiment. A correlation analysis between mRNA levels in different experimental conditions/genetic backgrounds is applied and used as evidence for the role of the gene in the plant.

Experimental Procedures Root and leaf samples are freshly excised from maize plants grown as described above on Murashige-Skoog (Duchefa). Experimental plants are grown either under optimal irrigation conditions, salt levels or temperatures to be used as a control group, or under stressful conditions of prolonged water deprivation, high salt concentrations and a heat shock treatment at a temperature higher than 34°C to be used as stress- induced groups to assess the drought, salinity and heat shock tolerance, respectively, of control versus transgenic plants. Total RNA is extracted from the different tissues, using mirVana™ commercial kit (Ambion) following the protocol provided by the manufacturer. For measurement and verification of messenger RNA (mRNA) expression level of all genes, reverse transcription followed by quantitative real time PCR (qRT-PCR) is performed on total RNA extracted from each plant tissue (i.e., roots and leaves) from each experimental group as described above. To elaborate, reverse transcription is performed on 1 µg total RNA, using a miScript Reverse Transcriptase kit (Qiagen), following the protocol suggested by the manufacturer. Quantitative RT- PCR is performed on cDNA (0.1 ng/µΐ final concentration), using a miScript SYBR GREEN PCR (Qiagen) forward (based on the miR sequence itself) and reverse primers (supplied with the kit). All qRT-PCR reactions are performed in triplicates using an ABI7500 real-time PCR machine, following the recommended protocol for the machine. To normalize the expression level of miRNAs associated with enhanced NUE between the different tissues and growing conditions of the maize plants, normalizer miRNAs are selected and used for comparison. Normalizer miRNAs, which are miRNAs with unchanged expression level between tissues and growing conditions, are custom selected for each experiment. The normalization procedure consists of second- degree polynomial fitting to a reference data (which is the median vector of all the data - excluding outliers) as described by Rosenfeld et al (2008, Nat Biotechnol, 26(4):462- 469). A summary of primers for the differential small RNA molecules that will be used in the qRT-PCR validation and analysis is presented in Tables 9-11 below.

Table 9-Primersfor qRT-PCRAnalysis of small RNAs Differentially Expressed in Drought miR Name Primer Sequence/SEQ ID NO: Primer Tm length ath-miR164c 641 2 1 64 osa-miR2907a 642 20 67 Predicted folded 24-nts-long seq 643 24 66 52214 Predicted folded 24-nts-long seq 644 24 59 52255 Predicted folded 24-nts-long seq 645 24 64 52285 Predicted folded 24-nts-long seq 646 24 64 52953 Predicted folded 24-nts-long seq 647 24 62 53693 Predicted siRNA 55507 648 22 59 Predicted siRNA 55629 649 22 62 Predicted siRNA 55775 650 2 1 6 1 Predicted siRNA 55869 65 1 23 6 1 Predicted siRNA 55937 652 23 60 Predicted siRNA 55979 653 24 60 Predicted siRNA 56066 654 25 59 Predicted siRNA 56759 655 23 59 Predicted siRNA 57049 656 23 6 1 Predicted siRNA 57283 657 2 1 66 Predicted siRNA 58170 658 22 60 Predicted siRNA 58574 659 23 59 Predicted siRNA 60433 660 24 66 Predicted siRNA 60529 661 22 6 1 Predicted zma mir 47934 662 25 60 Predicted zma mir 48043 663 2 1 6 1 Predicted zma mir 481 0 664 22 6 1 Predicted zma mir 48193 665 26 60 Predicted zma mir 48408 666 2 1 58 Predicted zma mir 4845 1 667 26 60 Predicted zma mir 48462 668 26 59 Predicted zma mir 485 14 669 22 6 1 Predicted zma mir 48520 670 29 59 Predicted zma mir 48653 671 23 58 Predicted zma mir 48669 672 24 60 Predicted zma mir 48682 673 23 59 Predicted zma mir 48841 674 24 59 Predicted zma mir 48966 675 25 6 1 Predicted zma mir 49156 676 26 60 Predicted zma mir 49199 677 22 60 Predicted zma mir 50109 678 25 59 Predicted zma mir 50425 679 22 60 sbi-miR164c 680 2 1 58 tae-miR1 125 682 24 66

Table 10-Primersfor qRT-PCRAnalysis of small RNAs Differentially Expressed in Salt Stress miR Name SEQ ID Primer Tm NO: length Predicted folded 24-nts-long seq 683 24 65 54187 Predicted siRNA 54673 684 24 63 Predicted siRNA 54895 685 23 59 Predicted siRNA 55242 686 2 1 63 Predicted siRNA 55246 687 27 60 Predicted siRNA 55344 688 22 60 Predicted siRNA 55402 689 23 60 Predicted siRNA 55909 690 24 63 Predicted siRNA 56060 691 22 59 Predicted siRNA 56305 692 2 1 62 Predicted siRNA 563 14 693 23 59 Predicted siRNA 56506 694 26 59 Predicted siRNA 5665 1 695 22 64 Predicted siRNA 57169 696 24 64 Predicted siRNA 57197 697 25 59 Predicted siRNA 58212 698 18 60 Predicted siRNA 59035 699 22 6 1 Predicted siRNA 59453 700 18 60 Predicted zma mir 47990 701 26 59 Predicted zma mir 48459 702 23 6 1 Predicted zma mir 48490 703 25 59 Predicted zma mir 48753 704 24 59 Predicted zma mir 48783 705 24 60 Predicted zma mir 48824 706 22 60 Predicted zma mir 48848 707 23 60 Predicted zma mir 49575 708 2 1 59 Predicted zma mir 498 17 709 22 59 Predicted zma mir 49855 710 27 59 Predicted zma mir 49862 7 11 2 1 60 Predicted zma mir 50145 712 24 60

Table 11-Primersfor qRT-PCRAnalysis of small RNAs Differentially Expressed in Heat Stress miR Name SEQ ID Primer Tm NO: length Predicted folded 24-nts-long seq 713 24 59 50957 Predicted folded 24-nts-long seq 714 24 64 5 1391 Predicted folded 24-nts-long seq 715 24 64 51709 Predicted folded 24-nts-long seq 716 24 65 52606 Predicted folded 24-nts-long seq 717 24 65 52682 Predicted folded 24-nts-long seq 718 24 66 52724 Predicted folded 24-nts-long seq 719 26 59 5385 1 Predicted folded 24-nts-long seq 720 24 64 53866 Predicted siRNA 54548 721 24 60 Predicted siRNA 54566 722 22 66 Predicted siRNA 54666 723 22 62 Predicted siRNA 54735 724 24 63 Predicted siRNA 55208 725 26 59 Predicted siRNA 55684 726 22 60 Predicted siRNA 55793 727 25 59 Predicted siRNA 55824 728 23 59 Predicted siRNA 55968 729 24 6 1 Predicted siRNA 56154 730 24 6 1 Predicted siRNA 56225 731 24 6 1 Predicted siRNA 56396 732 24 60 Predicted siRNA 56582 733 2 1 6 1 Predicted siRNA 56658 734 24 67 Predicted siRNA 56664 735 2 1 62 Predicted siRNA 56791 736 26 59 Predicted siRNA 56885 737 24 59 Predicted siRNA 57061 738 22 62 Predicted siRNA 57689 739 20 6 1 Predicted siRNA 58105 740 24 64 Predicted siRNA 58108 741 20 6 1 Predicted siRNA 58158 742 2 1 64 Predicted siRNA 58387 743 27 60 Predicted siRNA 58717 744 24 6 1 Predicted siRNA 58720 745 20 60 Predicted siRNA 58740 746 24 59 Predicted siRNA 59056 747 23 59 Predicted siRNA 5921 1 748 2 1 60 Predicted siRNA 59300 749 20 64 Predicted siRNA 59379 750 20 59 Predicted siRNA 59410 75 1 22 60 Predicted siRNA 59474 752 19 6 1 Predicted siRNA 59580 753 24 64 Predicted siRNA 59736 754 19 6 1 Predicted siRNA 59799 755 20 64 Predicted siRNA 59800 756 20 63 Predicted siRNA 598 17 757 2 1 60 Predicted siRNA 59820 758 20 59 Predicted siRNA 5985 1 759 22 60 Predicted siRNA 59918 760 2 1 60 Predicted siRNA 59935 761 25 66 Predicted siRNA 59937 762 25 64 Predicted siRNA 59987 763 22 60 Predicted siRNA 60036 764 24 6 1 Predicted siRNA 60421 765 27 59 Predicted siRNA 60533 766 20 63 Predicted siRNA 60635 767 29 59 Predicted siRNA 60718 768 25 59 Predicted siRNA 60742 769 24 59 Predicted siRNA 60833 770 2 1 60 Predicted siRNA 60993 771 25 60 Predicted siRNA 61212 772 2 1 59 Predicted siRNA 61236 773 25 60 Predicted zma mir 47966 774 26 59 Predicted zma mir 48327 775 22 59 Predicted zma mir 48479 776 24 60 Predicted zma mir 48482 777 24 59 Predicted zma mir 48489 778 22 60 Predicted zma mir 48790 779 22 59 Predicted zma mir 48905 780 25 59 Predicted zma mir 49248 781 2 1 62 Predicted zma mir 49259 782 22 60 Predicted zma mir 493 10 783 2 1 63 Predicted zma mir 49642 784 22 66 Predicted zma mir 497 18 785 22 59 Predicted zma mir 49952 786 23 67 Predicted zma mir 50085 787 25 59 Predicted zma mir 50120 788 23 6 1 Predicted zma mir 50166 789 22 60 Predicted zma mir 50256 790 22 6 1 Predicted zma mir 50289 791 19 58 Predicted zma mir 50388 792 24 60 Predicted zma mir 50449 793 23 59 Predicted zma mir 50453 794 22 6 1 Predicted zma mir 50480 795 20 64 Predicted zma mir 5048 1 796 20 64 Predicted zma mir 50483 797 20 63 Predicted zma mir 50486 798 22 6 1 Predicted zma mir 50522 799 22 6 1 Predicted zma mir 50570 800 20 60 Predicted zma mir 50682 801 23 59 Predicted zma mir 50695 802 22 58 Predicted zma mir 50701 803 19 60 Alternative RT-PCR Validation Method of Selected microRNAs of the Invention A novel microRNA quantification method has been applied using stem-loop RT followed by PCR analysis (Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, Guegler KJ. 2005, Nucleic Acids Res 33(20):el79; Varkonyi-Gasic E, Wu R, Wood M, Walton EF, Hellens RP. 2007, Plant Methods 3:12) (see Figure 2). This highly accurate method allows the detection of less abundant miRNAs. In this method, stem-loop RT primers are used, which provide higher specificity and efficiency to the reverse transcription process. While the conventional method relies on polyadenylated (poly (A)) tail and thus becomes sensitive to methylation because of the susceptibility of the enzymes involved, in this novel method the reverse transcription step is transcriptspecific and insensitive to methylation. Reverse transcriptase reactions contained RNA samples including purified total RNA, 50 nM stem-loop RT primer (see Tables 12a-c, synthesized by Sigma), and using the Superscript II reverse transcriptase (Invitrogen). A mix of up to 12 stem-loop RT primers may be used in each reaction, and the forward primers are such that the last 6 nucleotides are replaced with a GC rich sequence. For the PCR step, each miRNA has a custom forward primer, while only miRNAs exhibiting technical difficulties using the stem loop universal reverse primer (5'- GTGCAGGGTCCGAGGT-3 ' -SEQ ID NO: 228) get custom reverse primer as well. Note, SL-RT stands for stem loop reverse transcription, SL-F are the forward primers, SL-R are the reverse primers.

Table 12a: Stem Loop Reverse Transcriptase Primers for RT-PCR Validation of Differential Mirs under Drought Stress

Primer Mir Name Primer Name SEQ ID NO: Length Pred zma 52255-SL- RT 804 51 Predicted folded 24-nts-long seq 52255 Pred zma 52255-SL-F 805 21 Pred siRNA 55629-SL- RT 806 50 Pred siRNA 55629-SL- Predicted siRNA 55629 F 807 20 Pred zma 55775-SL- RT 808 50

Predicted siRNA 55775 Pred zma 55775-SL-F 809 21 Pred zma 55869-SL- RT 810 50

Predicted siRNA 55869 Pred zma 55869-SL-F 811 2 1 Pred zma 55937-SL- RT 812 50

Predicted siRNA 55937 Pred zma 55937-SL-F 813 20 Pred zma 58170-SL- RT 814 50

Predicted siRNA 58170 Pred zma 58170-SL-F 815 19 Pred zma 47934-SL- RT 816 50

Predicted zma mir 47934 Pred zma 47934-SL-F 817 22 Pred zma 48043-SL- RT 818 50

Predicted zma mir 48043 Pred zma 48043-SL-F 819 2 1 Pred zma mir 48193- SL-RT 820 50 Pred zma mir 48193- SL-F 821 22

Predicted zma mir 48193 Pred zma 48193 -SL-R 822 24 Pred zma 48408-SL- RT 823 50

Predicted zma mir 48408 Pred zma 48408-SL-F 824 2 1

Table 12b: Stem Loop Reverse Transcriptase Primers for RT-PCR Validation of Differential Mirs under Salinity Stress Primer Mir Name Primer Name Primer Sequence/SEQ ID NO: Length Pred zma 54895- SL-RT 825 50 Predicted siRNA Pred zma 54895- 54895 SL-F 826 22 Pred zma 55344- SL-RT 827 50 Predicted siRNA Pred zma 55344- 55344 SL-F 828 20 Pred zma 56506- SL-RT 829 50 Predicted siRNA Pred zma 56506- 56506 SL-F 830 24 Pred zma 59035- SL-F 831 19 Predicted siRNA 59035 Pred 59035-SL-RT 832 50 Pred zma 47990- SL-RT 833 50 Predicted zma mir Pred zma 47990- 47990 SL-F 834 22 Pred zma 48459- SL-RT 835 5 1 Predicted zma mir Pred zma 48459- 48459 SL-F 836 18 Pred zma 49817- SL-RT 837 5 1 Predicted zma mir Pred zma 49817- 49817 SL-F 838 18 Pred zma 49855- SL-RT 839 50 Predicted zma mir Pred zma 49855- 49855 SL-F 840 2 1 Pred zma 49862- SL-F 841 18 Predicted zma mir Pred zma 49862- 49862 SL-RT 842 5 1 Pred zma 50145- SL-RT 843 50 Predicted zma mir Pred zma 50145- 50145 SL-F 844 20

Table 12c: Stem Loop Reverse Transcriptase Primers for RT-PCR Validation of Differential Mirs under Heat Shock Stress

Primer Sequence/SEQ Primer Mir Name Primer Name ID NO: Length Pred zma 53851- SL-RT 845 50 Predicted folded 24-nts-long seq Pred zma 53851- 53851 SL-F 846 24 Pred zma 53866- SL-RT 847 5 1 Predicted folded 24-nts-long seq Pred zma 53866- 53866 SL-F 848 23 Pred zma 54566- SL-RT 849 50 Pred zma 54566- Predicted siRNA 54566 SL-F 850 20 Pred zma 55824- SL-RT 851 50 Pred zma 55824- Predicted siRNA 55824 SL-F 852 20 Pred zma 58108- Predicted siRNA 58108 SL-RT 853 50 Pred zma 58108- SL-F 854 17 Pred zma 59817- SL-RT 855 50 Pred zma 59817- Predicted siRNA 59817 SL-F 856 19 Pred zma 59851- SL-RT 857 50 Pred zma 59851- Predicted siRNA 59851 SL-F 858 18 Pred zma 59918- SL-RT 859 50 Pred zma 59918- Predicted siRNA 59918 SL-F 860 20 Pred zma 59987- SL-RT 861 50 Pred zma 59987- SL-F 862 20 Pred zma 59987- Predicted siRNA 59987 SL-R 863 24 Pred zma 48479- SL-F 864 22 Pred zma 48479- Predicted zma mir 48479 SL-RT 865 50 Pred zma 49248- SL-RT 866 50 Pred zma 49248- Predicted zma mir 49248 SL-F 867 19 Pred zma 49642- SL-RT 868 50 Pred zma 49642- Predicted zma mir 49642 SL-F 869 18 Pred zma 50256- SL-RT 870 50 Pred zma 50256- Predicted zma mir 50256 SL-F 871 20 Pred zma 50453- SL-RT 872 50 Pred zma 50453- Predicted zma mir 50453 SL-F 873 20

EXAMPLE 4 Results of RT-PCR Validation of Selected miRNAs of the Invention An RT-PCR analysis was run on selected microRNAs of the invention, using the conventional and stem-loop RT primers as described in Tables 9-11 and 12a-c in Example 3 above. Total RNA was extracted from either leaf or root tissues of maize plants grown as described above, and was used as a template for RT-PCR analysis. Expression level and directionality of several up-regulated and down-regulated microRNAs that were found to be differential on the microarray analysis were verified. Results are summarized in Tables 13a-b below.

Table 13a: Summary of RT-PCR Verification Results on Selected miRNAs using Conventional Method

Table 13b: Summary of RT-PCR Verification Results on Selected miRNAs using Stem Loop RT (Alternative) Method

Fold- Trait miR Name p-Value change Predicted folded 24-nts-long Drought seq 52255 3.30E-02 3.12 (-) Predicted siRNA 55869 5.30E-02 2.00 (+) Predicted siRNA 55629 2.70E-02 1.43 (+) Salinity Predicted zma mir 50145 4.20E-02 1.75 (+) Predicted zma mir 49817 2.20E-03 3.28 (-) Predicted zma mir 47990 5.10E-02 3.64 (-) Predicted siRNA 54895 1.70E-04 3.98 (+) Predicted siRNA 55344 7.40E-06 3.31 (+) Predicted siRNA 56506 1.20E-03 2.17 (+) Predicted zma mir 48459 1.50E-03 4.81 (-) Heat Shock Predicted siRNA 59987 1.20E-04 5.40 (+) Predicted siRNA 54566 4.80E-02 1.52 (+) Predicted siRNA 59851 7.60E-05 10.30 (-) Predicted zma mir 50453 7.40E-05 7.24 (-) Predicted folded 24-nts-long seq 53866 6.50E-03 4.34 (-) EXAMPLE 5 Gene Cloning Strategiesfor miRNA and siRNA Molecules and Creation of Binary Vectorsfor Plant Expression The best validated miRNA sequences are cloned into pORE-El binary vectors

(Figure 1) for the generation of transgenic plants. The full-length precursor sequence comprising the hairpin sequence of each selected miRNA, is synthesized by Genscript (USA). The resulting clone is digested with appropriate restriction enzymes and inserted into the Multi Cloning Site (MCS) of a similarly digested binary vector through ligation using T4 DNA ligase enzyme (Promega, Madison, WI, USA). In order to clone siRNA sequences, which have different secondary structures than those of miRNA sequences, a method of artificial microRNA (amiRNA) is implemented, where a plant miRNA precursor is modified to express a small RNA sequence that is not related to the original miRNA produced by the precursor. In this method, the mature siRNA sequence replaces the mature sequence of a specific known miRNA (e.g., miR172a and miR319a) but uses its hairpin backbone for amiRNA expression (Schwab et al., 2006, Plant Cell 18(5): 1121-1133). Moreover, the miRNA* sequences are altered such that both structural and energetic features of the miRNA precursor are retained. Examples for such artificial miRNA constructs using either miR172a (Arabidopsis mature sequence AGAAUCUUGAUGAUGCUGCAU SEQ ID NO: 453, stem loop UGCUGUGGCAUCAUCAAGAUUCACAUCUGUUGAUGGACGGUGGUGAUUC ACUCUCCACAAAGUUCUCUAUGAAAAUGAGAAUCUUGAUGAUGCUGCAU CGGC SEQ ID NO: 454) or miR319a (Arabidopsis mature sequence UUGGACUGAAGGGAGCUCCCU SEQ ID NO: 455, stem loop AGAGAGAGCUUCCUUGAGUCCAUUCACAGGUCGUGAUAUGAUUCAAUUA GCUUCCGACUCAUUCAUCCAAAUACCGAGUCGCCAAAAUUCAAACUAGAC UCGUUAAAUGAAUGAAUGAUGCGGUAGACAAAUUGGAUCAUUGAUUCUC UUUGAUUGGACUGAAGGGAGCUCCCUCU SEQ ID NO: 456), as a backbone are presented in Figures 3 and 4, respectively. EXAMPLE 6 Generation of Transgenic Model Plants Expressing the Abiotic Stress Associated small RNAs Arabidoposis thaliana transformation is performed using the floral dip procedure following a slightly modified version of the published protocol (Clough and Bent, 1998, Plant J 16(6): 735-43; and Desfeux et al, 2000, Plant Physiol 123(3): 895-904).

Briefly, T O Plants are planted in small pots filled with soil. The pots are covered with aluminum foil and a plastic dome, kept at 4°C for 3-4 days, then uncovered and incubated in a growth chamber at 24°C under 16 hr light : 8 hr dark cycles. A week prior to transformation all individual flowering stems are removed to allow for growth of multiple flowering stems instead. A single colony of Agrobacterium (GV3101) carrying the binary vectors (pORE-El), harboring the miRNA hairpin sequences with additional flanking sequences both upstream and downstream of it, is cultured in LB medium supplemented with kanamycin (50 mg/L) and gentamycin (25 mg/L). Three days prior to transformation, each culture is incubated at 28°C for 48 hrs, shaking at 180 rpm. The starter culture is split the day before transformation into two cultures, which are allowed to grow further at 28°C for 24 hours at 180 rpm. Pellets containing the agrobacterium cells are obtained by centrifugation of the cultures at 5000 rpm for 15 minutes. The pellets are re-suspended in an infiltration medium (10 mM MgCl2, 5% sucrose, 0.044 µΜ BAP (Sigma) and 0.03% Tween 20) prepared with double-distilled water.

Transformation of T O plants is performed by inverting each plant into the agrobacterium suspension, keeping the flowering stem submerged for 5 minutes. Following inoculation, each plant is blotted dry for 5 minutes on both sides, and placed sideways on a fresh covered tray for 24 hours at 22°C. Transformed (transgenic) plants are then uncovered and transferred to a greenhouse for recovery and maturation. The transgenic T O plants are grown in the greenhouse for 3-5 weeks until the seeds are ready, which are then harvested from plants and kept at room temperature until sowing. EXAMPLE 7 Selection of Transgenic Arabidopsis Plants Expressing the Abiotic Stress Genes According to Expression Level Arabidopsis seeds are sown and Basta (Bayer) is sprayed for the first time on 1- 2 weeks old seedlings, at least twice every few days. Only resistant plants, which are heterozygous for the transgene, survive. PCR on the genomic gene sequence is performed on the surviving seedlings using primers pORE-F2 (fwd, 5'- TTTAGCGATGAACTTCACTC-3 ' , SEQ ID NO: 457) and a custom designed reverse primer based on each small RNA sequence.

EXAMPLE 8 Abiotic Stress Tolerance Assessments in Control and Transgenic Plants Transgenic plants with tolerance to abiotic stress in the form of extreme deficiency in water, high salt concentrations, or heat shock are expected to exhibit better overall survival and growth compared to control non-transgenic plants. Since different plants vary considerably in their tolerance to drought, salinity and heat shock stresses, the duration of drought effected, concentration of salt applied and duration of exposure to high temperature, respectively, can be tailored to the specific plant cultivar or variety (for guidelines specifically to appropriate salt concentrations see, Bernstein and Kafkafi, Root Growth Under Salinity Stress In: Plant Roots, The Hidden Half 3rd ed. Waisel Y, Eshel A and Kafkafi U. (editors) Marcel Dekker Inc., New York, 2002). Transgenic Arabidopsis plants are allowed to grow until seed production followed by an evaluation of their drought tolerance. Quantitative parameters of tolerance measured include, but are not limited to, the overall size and yield, average wet and dry weight, growth rate, leaf size, leaf coverage (overall leaf area), the weight of the seeds yielded, the average seed size and the number of seeds produced per plant. Under normal conditions, transgenic plants exhibit a phenotype equivalent or superior to that of the wild type plants. Following stress induction i.e., growth under stress, transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher measured parameters levels compared to wild-type plants, are identified as abiotic stress tolerant plants. Corn seeds were germinated and grown at 22 °C in soil under normal conditions for 3-4 weeks. Seedlings were then used for experimental assays of each of the following abiotic stresses: drought, salinity and heat shock. Generally, each stress assay includes an internal control group of plants that is continuously grown under optimal conditions. For drought induction, irrigation of the stress group was completely stopped for four or six days. For salinity induction, irrigation with regular water is substituted by irrigation with 300 mM NaCl solution in the stress group, for overall 2-3 irrigations in a period of four or six days. For induction of heat shock, the stress group plants are exposed to a high temperature (37°C) for one hour. For all stress analyses, tissue samples from both experimental groups are then used for RNA analysis, as described below. Soil-based Drought Tolerance Assay Screens are performed with transgenic plants over-expressing the differential small RNAs detailed above. Briefly, seeds from control Arabidopsis plants, or other transgenic plants over-expressing the small RNA molecule of the invention are germinated and transferred to pots. Drought stress is obtained after irrigation is ceased and the two plant types (transgenic and control plants) are compared when most control plants develop severe wilting, concurrently, rehydration of the plants is initiated at this point. Transgenic plants are ranked on two levels compared to controls: (1) tolerance to drought conditions, and (2) recovery (survival) following re-watering. To illustrate and elaborate on the above drought tolerance assays of any given wild type plant compared to a corresponding transgenic plant (in which a drought- associated miRNA has been over-expressed), two different approaches are taken as follows: Lethal drought stress - whereby wild type (used as a control) and transgenic plants (1-3 weeks old) are grown under prolonged extreme drought conditions (duration varies in accordance with plant species). Next, a recovery attempt is implemented during which plants are regularly irrigated and survival level is estimated in the two plant groups 1-2 days post irrigation initiation. While the control (wild type) plant is not expected to survive this extreme stress, the transgenic plant is expected to demonstrate some improved drought tolerance, usually within hours of re-hydration. Non-lethal drought stress - whereby wild type (used as a control) and transgenic plants (1-3 weeks old) are grown under regular short-term cycles of drought and re hydration steps, such that re-hydration is applied when general visible drought symptoms (e.g., evident decrease in turgor pressure of lower leaves) emerge in the experimental plants. This drought/irrigation alternating treatment continues until the flowering stage of the plants is reached, followed by an evaluation of dry matter weight. Both wild type and transgenic plants are expected to survive this non-lethal stress, however, measurable differences in drought tolerance are demonstrated by increased yield of the transgenic compared with the wild type plants. Drought Tolerance Assay Using Sorbitol Another assay designed to assess whether transgenic plants are more tolerant to drought or severe water deprivation, involves induction of an osmotic stress by the non- ionic osmolyte sorbitol (Mazel et al., 2004, Plant Physiol 134: 118-128). Control and transgenic plants are germinated and grown in plant-agar plates for 4 days, after which they are transferred to plates containing 500 mM sorbitol, to cause delayed growth. Following 7 days of stress treatment, control and transgenic plants are compared by measuring plant weight (wet and dry), yield, and by growth rates measured as time to flowering. Methods for Salinity Tolerance Assessment Osmotic stress assays, such as chloride and mannitol assays, are aimed to determine whether an osmotic stress phenotype is sodium chloride- specific or a result of a general osmotic stress. Plants which are tolerant to osmotic stress may also exhibit tolerance to drought and/or freezing. For salt and osmotic stress germination experiments, the medium is supplemented with 50, 100, or 200 mM NaCl or 100 mM, 200 mM NaCl, 400 mM mannitol. Methods for Heat Stress Tolerance Assessment Heat stress tolerance is achieved by exposing the plants to temperatures above 34 °C for a certain period, dependent on the plant and in accordance with the above- guidelines. Plant tolerance is examined after transferring the plants back to 22 °C for recovery and evaluation after 5 days relative to internal controls (non-transgenic plants) or plants not exposed to neither cold or heat stress. Methods for Cold Stress Tolerance Assessment To analyze cold stress, mature (25 day old) plants are transferred to 4 °C chambers for 1 or 2 weeks, with constitutive light. Next, plants are moved back to the greenhouse for 2 weeks to recover. Following the recovery period, chilling damages such as growth retardation are determined based on measurements of plant weight (wet and dry) and growth rates (e.g. time to flowering, plant size, yield, etc) taken on control and transgenic plants.

EXAMPLE 9 Evaluating Changes in Root Architecture in Transgenic Plants Many key traits in modern agriculture can be explained by changes in the root architecture of the plant. Root size and depth have been shown to logically correlate with drought tolerance and fertilizer use efficiency, since deeper and more branched root systems provide better coverage of the soil and can access water stored in deeper soil layers. To test whether the transgenic plants produce a modified root structure, plants can be grown in agar plates placed vertically. A digital picture of the plates is taken every few days and the maximal length and total area covered by the plant roots are assessed. From every construct created, several independent transformation events are checked in replicates. To assess significant differences between root features, statistical test, such as a Student's t-test, is employed in order to identify enhanced root features and to provide a statistical value to the findings.

EXAMPLE 10 Methodfor Generating Transgenic Maize Plants with Enhanced or Reduced small RNA Regulation of Target Genes Target prediction enables two contrasting strategies; an enhancement (positive) or a reduction (negative) of small RNA regulation. Both these strategies have been used in plants and have resulted in significant phenotype alterations. For complete in-vivo assessment of the phenotypic effects of the differential small RNAs of this invention, the inventors plan to implement both over-expression and down-regulation methods on the small RNA molecules found to associate with abiotic stress tolerance as listed in Tables 1-5. In the case of small RNAs that were up-regulated under abiotic stress conditions, an enhancement in abiotic stress tolerance can theoretically be achieved by maintaining their directionality, i.e. over-expressing them. Conversely, in the case of small RNAs that were down-regulated under abiotic stress conditions, enhancement in tolerance can be achieved by reduction of their regulation. Reduction of small RNA regulation of target genes can be accomplished in one of two approaches: Expressing a miRNA-Resistant Target In this method, silent mutations are introduced in the miRNA binding site of the target gene so that the DNA and resulting RNA sequences are changed to prevent miRNA binding, but the amino acid sequence of the protein is unchanged. For design of miRNA-resistant target sequences for the small RNA molecules of the invention, optimization of the nucleic acid sequence in accordance with the preferred codon usage for a particular plant species is required. Tables such as those provided on-line at the Codon Usage Database through the NCBI (National Center for Biotechnology Information) webpage (Hypertext Transfer Protocol://World Wide Web (dot) ncbi (dot) nlm (dot) nih (dot) gov/ Taxonomy/Utils/wprintgc (dot) cgi) were used. The Genbank database contains codon usage tables for a number of different species, with its Table 11 (The Bacterial, Archaeal and Plant Plastid Code) being the most relevant for plant species of this invention. Expressing a Target-mimic Sequence Plant miRNAs usually lead to cleavage of their targeted gene, with this cleavage typically occurring between bases 10 and 11 of the miRNA. This position is therefore especially sensitive to mismatches between the miRNA and the target. It was found that expressing a DNA sequence that could potentially be targeted by a miRNA, but contains three extra nucleotides (ATC), and thus creating a bulge in a key position (between the two nucleotides that are predicted to hybridize with bases 10-11 of the miRNA), can inhibit the regulation of that miRNA on its native targets (Franco-Zorilla et al, 2007, Nat Genet 39(8):1033-1037). This type of sequence is referred to as a "target-mimic". Inhibition of the miRNA regulation is presumed to occur through physically capturing the miRNA by the target-mimic sequence and titering-out the miRNA, thereby reducing its abundance. This method was used to reduce the amount and, consequentially, the regulation of miRNA 399 in Arabidopsis. Tables 14-16 below present miRNA-resistant target examples and Tables 17-19 below present target mimic examples for differential (downregulated) miRNAs under drought, salinity and heat-shock stress, respectively. Table 14: miRNA-Resistant Target Examples for miRNAs which were Downregulated under Drought Stress.

Table 15a: miRNA-Resistant Target Examples for miRNAs which were Downregulated under Salinity Stress.

Mir nam Original Nucleotide ORF nucleotide Mutated Nucleotide NCBI Mir e Sequence/SEQ ID NO: seq/SEQ ID NO: Sequence/SEQ ID NO: Binding Site Predi cted zma mir 4845 9 887 890 893 100 - 120 894 100 - 120 895 100 - 120 896 100 - 120 897 100 - 120 898 100 - 120 899 100 - 120 900 100 - 120 901 100 - 120 902 100 - 120 Predi cted zma mir 4882 4 888 891 903 414 - 434 904 414 - 434 905 414 - 434 906 414 - 434 907 414 - 434 908 414 - 434 909 414 - 434 Predi cted zma mir 4986 2 889 892 910 515 - 535 9 11 515 - 535 912 515 - 535 913 515 - 535

Table 15b miRNA-Resistant Target Examples for miRNAs which were Upregulated under Salinity Stress

ORF NCBI Original Nucleotide nucleotide Mir Mir Sequence/SEQ ID seq/SEQ Mutated Nucleotide Binding name NO: ID NO: Sequence/SEQ ID NO: Site Predicted siRNA 563 14 914 923 932 280 - 301 933 280 - 301 934 280 - 301 935 280 - 301 936 280 - 301 937 280 - 301 938 280 - 301 939 280 - 301 940 280 - 301 941 280 - 301 Predicted siRNA 58212 915 924 942 176 - 193 943 176 - 193 944 176 - 193 945 176 - 193 916 925 946 970 - 987 947 970 - 987 948 970 - 987 949 970 - 987 950 970 - 987 95 1 970 - 987 952 970 - 987 917 926 1294 - 953 13 11 1294 - 954 13 11 1294 - 955 13 11 1294 - 956 13 11 1294 - 957 13 11 1294 - 958 13 11 1294 - 959 13 11 1294 - 960 13 11 1294 - 961 13 11 1294 - 962 13 11 918 927 963 183 - 200 964 183 - 200 965 183 - 200 966 183 - 200 967 183 - 200 968 183 - 200 969 183 - 200 970 183 - 200 971 183 - 200 972 183 - 200 919 928 973 130 - 147 974 130 - 147 975 130 - 147 976 130 - 147 977 130 - 147 978 130 - 147 979 130 - 147 980 130 - 147 981 130 - 147 982 130 - 147 Predicted siRNA 59453 920 929 983 527 - 544 984 527 - 544 985 527 - 544 986 527 - 544 987 527 - 544 988 527 - 544 989 527 - 544 990 527 - 544 991 527 - 544 992 527 - 544 921 930 1165 - 993 1182 1165 - 994 1182 1165 - 995 1182 1165 - 996 1182 1165 - 997 1182 1165 - 998 1182 1165 - 999 1182 1165 - 1000 1182 1165 - 1001 1182 1165 - 1002 1182 922 931 1135 - 1003 1152 1135 - 1004 1152 1135 - 1005 1152 1135 - 1006 1152 1135 - 1007 1152 1135 - 1008 1152 1135 - 1009 1152 1135 - 1010 1152 1135 - 1011 1152 1135 - 1012 1152

Table 16a: miRNA-Resistant Target Examplesfor miRNAs which Downregulated during Heat Shock.

Mir Mir Homol Org Protein Original ORF Mutated NCBI name sequenc g anis Sequenc Nucleotide nucleotid Nucleotide Mir e/SEQ NCBI m e/SEQ Sequence/S e Sequence/SE Bindin ID NO: Accessi ID NO: EQ ID NO: seq/SEQ Q ID NO: g Site on ID NO: Predict 59 ACR33 Zea 1013 1084 1155 ed 787 may siRNA s 57689 1226 822 - 839 1227 822 - 839 1228 822 - 839 1229 822 - 839 1230 822 - 839 ACF83 Zea 1014 1085 1156 391 may s 1231 575 - 592 1232 575 - 592 1233 575 - 592 1234 575 - 592 1235 575 - 592 Predict 60 XP_002 Sorg 1015 1086 1157 ed 455452 hum siRNA bicol 58108 or 1236 617 - 634 1237 617 - 634 1238 617 - 634 1239 617 - 634 1240 617 - 634 NP_001 Zea 1016 1087 1158 132904 may s 1241 1540 - 1557 1242 1540 - 1557 1243 1540 - 1557 1244 1540 - 1557 1245 1540 - 1557 XP_002 Sorg 1017 1088 1159 451348 hum bicol or 1246 1564 - 1581 1247 1564 - 1581 1248 1564 - 1581 NP_001 Zea 1018 1089 1160 143089 may s 1249 1528 - 1545 1250 1528 - 1545 1251 1528 - 1545 1252 1528 - 1545 1253 1528 - 1545 Predict 6 1 ACL53 Zea 1019 1090 1161 ed 547 may siRNA s 58158 1254 1179 - 1199 1255 1179 - 1199 1256 1179 - 1199 1257 1179 - 1199 XP_002 Sorg 1020 1091 1162 460562 hum bicol or 1258 1382 - 1402 1259 1382 - 1402 1260 1382 - 1402 1261 1382 - 1402 1262 1382 - 1402 ACN31 Zea 1021 1092 1163 936 may s 1263 1393 - 1413 1264 1393 - 1413 1265 1393 - 1413 1266 1393 - 1413 NP_001 Zea 1022 1093 1164 183878 may s 1267 1180 - 1200 1268 1180 - 1200 1269 1180 - 1200 1270 1180 - 1200 Predict 64 NP_001 Zea 1023 1094 1165 ed 169291 may siRNA s 59056 1271 353 - 371 1272 353 - 371 1273 353 - 371 1274 353 - 371 XP_002 Sorg 1024 1095 1166 437665 hum bicol or 1275 264 - 282 1276 264 - 282 1277 264 - 282 1278 264 - 282 1279 264 - 282 ACL52 Zea 1025 1096 1167 777 may s 1280 30- Dec 1281 30- Dec 1282 30- Dec 1283 30- Dec 1284 30- Dec NP_001 Zea 1026 1097 1168 140626 may s 1285 328 - 346 1286 328 - 346 1287 328 - 346 1288 328 - 346 1289 328 - 346 NP_001 Zea 1027 1098 1169 143033 may s 1290 60 - 78 1291 60 - 78 1292 60 - 78 1293 60 - 78 1294 60 - 78 NP_001 Zea 1028 1099 1170 146570 may s 1295 1713 - 1731 1296 1713 - 1731 1297 1713 - 1731 1298 1713 - 1731 1299 1713 - 1731 Predict 66 XP_002 Sorg 1029 1100 1171 ed 453411 hum siRNA bicol 59300 or 1300 2064 - 2083 NP_001 Zea 1030 1101 1172 144625 may s 1301 237 - 256 1302 237 - 256 1303 237 - 256 1304 237 - 256 1305 237 - 256 ADX60 Zea 1031 1102 1173 172 may s 1306 1838 - 1857 Predict 67 XP_002 Sorg 1032 1103 1174 ed 464695 hum siRNA bicol 59379 or 1307 35 - 52 1308 35 - 52 1309 35 - 52 1310 35 - 52 Predict 69 XP_002 Sorg 1033 1104 1175 ed 466400 hum siRNA bicol 59474 or 1311 278 - 296 1312 278 - 296 1313 278 - 296 1314 278 - 296 NP_001 Zea 1034 1105 1176 151137 may s 1315 597 - 615 1316 597 - 615 1317 597 - 615 1318 597 - 615 1319 597 - 615 ACG50 Zea 1035 1106 1177 012 may s 1320 4 1 - 59 1321 4 1 - 59 1322 4 1 - 59 1323 4 1 - 59 XP_002 Sorg 1036 1107 1178 465546 hum bicol or 1324 387 - 405 1325 387 - 405 1326 387 - 405 1327 387 - 405 1328 387 - 405 NP_001 Zea 1037 1108 1179 149657 may s 1329 279 - 297 1330 279 - 297 1331 279 - 297 1332 279 - 297 Predict 70 ACF84 Zea 1038 1109 1180 ed 208 may siRNA s 59736 1333 491 - 509 1334 491 - 509 1335 491 - 509 1336 491 - 509 1337 491 - 509 NP_001 Zea 1039 1110 1181 183626 may s 1338 225 - 243 1339 225 - 243 1340 225 - 243 1341 225 - 243 1342 225 - 243 Predict 7 1 ACR34 Zea 1040 1111 1182 ed 837 may siRNA s 59799 1343 154 - 173 Predict 72 NP_001 Zea 1041 1112 1183 ed 132616 may siRNA s 59800 1344 343 - 362 1345 343 - 362 1346 343 - 362 1347 343 - 362 1348 343 - 362 Predict 75 XP_002 Sorg 1042 1113 1184 ed 458387 hum siRNA bicol 59918 or 1349 801 - 821 1350 801 - 821 1351 801 - 821 1352 801 - 821 1353 801 - 821 Predict 9 1 NP_001 Zea 1043 1114 1185 e zma 183850 may mir s 50289 1354 1414 - 1432 1355 1414 - 1432 1356 1414 - 1432 1357 1414 - 1432 1358 1414 - 1432 NP_001 Zea 1044 1115 1186 168893 may s 1359 1395 - 1413 Predict 94 NP_001 Zea 1045 1116 1187 ed zma 147862 may mir s 50480 1360 626 - 645 1361 626 - 645 1362 626 - 645 1363 626 - 645 1364 626 - 645 ACN27 Zea 1046 1117 1188 570 may s 1365 1304 - 1323 1366 1304 - 1323 1367 1304 - 1323 1368 1304 - 1323 NP_001 Zea 1047 1118 1189 151285 may s 1369 670 - 689 1370 670 - 689 1371 670 - 689 1372 670 - 689 1373 670 - 689 NP_001 Zea 1048 1119 1190 168251 may s 1374 458 - 477 1375 458 - 477 1376 458 - 477 1377 458 - 477 1378 458 - 477 ACN27 Zea 1049 1120 1191 595 may s 1379 858 - 877 1380 858 - 877 1381 858 - 877 1382 858 - 877 1383 858 - 877 NP_001 Zea 1050 1121 1192 159284 may s 1384 1743 - 1762 1385 1743 - 1762 1386 1743 - 1762 1387 1743 - 1762 1388 1743 - 1762 NP_001 Zea 1051 1122 1193 159342 may s 1389 1751 - 1770 1390 1751 - 1770 1391 1751 - 1770 1392 1751 - 1770 1393 1751 - 1770 NP_001 Zea 1052 1123 1194 146934 may s 1394 151 - 170 1395 151 - 170 1396 151 - 170 1397 151 - 170 XP_002 Sorg 1053 1124 1195 449308 hum bicol or 1398 409 - 428 1399 409 - 428 1400 409 - 428 1401 409 - 428 1402 409 - 428 NP_001 Zea 1054 1125 1196 144625 may s 1403 237 - 256 1404 237 - 256 1405 237 - 256 1406 237 - 256 1407 237 - 256 NP_001 Zea 1055 1126 1197 151654 may s 1408 118 - 137 1409 118 - 137 1410 118 - 137 1411 118 - 137 1412 118 - 137 Predict 95 NP_001 Zea 1056 1127 1198 e zma 140853 may mir s 50481 1413 506 - 525 1414 506 - 525 1415 506 - 525 1416 506 - 525 1417 506 - 525 ACN35 Zea 1057 1128 1199 719 may s 1418 669 - 688 1419 669 - 688 1420 669 - 688 1421 669 - 688 1422 669 - 688 NP_001 Zea 1058 1129 1200 130351 may s 1423 1174 - 1193 1424 1174 - 1193 1425 1174 - 1193 1426 1174 - 1193 1427 1174 - 1193 ACF84 Zea 1059 1130 1201 329 may s 1428 223 - 242 1429 223 - 242 1430 223 - 242 1431 223 - 242 1432 223 - 242 XP_002 Sorg 1060 1131 1202 463817 hum bicol or 1433 1298 - 1317 1434 1298 - 1317 1435 1298 - 1317 1436 1298 - 1317 XP_002 Sorg 1061 1132 1203 465627 hum bicol or 1437 1990 - 2009 1438 1990 - 2009 1439 1990 - 2009 1440 1990 - 2009 1441 1990 - 2009 NP_001 Zea 1062 1133 1204 105211 may s 1442 911 - 930 1443 911 - 930 1444 911 - 930 1445 911 - 930 1446 911 - 930 NP_001 Zea 1063 1134 1205 158910 may s 1447 491 - 510 1448 491 - 510 1449 491 - 510 1450 491 - 510 ACF84 Zea 1064 1135 1206 241 may s 1451 1477 - 1496 1452 1477 - 1496 1453 1477 - 1496 1454 1477 - 1496 NP_001 Zea 1065 1136 1207 132755 may s 1455 591 - 610 1456 591 - 610 1457 591 - 610 1458 591 - 610 1459 591 - 610 NP_001 Zea 1066 1137 1208 144625 may s 1460 237 - 256 1461 237 - 256 1462 237 - 256 1463 237 - 256 1464 237 - 256 XP_002 Sorg 1067 1138 1209 453372 hum bicol or 1465 26 - 45 1466 26 - 45 1467 26 - 45 1468 26 - 45 1469 26 - 45 Predict 96 XP_002 Sorg 1068 1139 1210 e zma 439337 hum mir bicol 50483 or 1470 592 - 611 ACF80 Zea 1069 1140 1211 701 may s 1471 897 - 916 1472 897 - 916 1473 897 - 916 1474 897 - 916 1475 897 - 916 XP_002 Sorg 1070 1141 1212 455492 hum bicol or 1476 342 - 361 1477 342 - 361 1478 342 - 361 1479 342 - 361 1480 342 - 361 NP_001 Zea 1071 1142 1213 142046 may s 1481 360 - 379 1482 360 - 379 1483 360 - 379 1484 360 - 379 XP_002 Sorg 1072 1143 1214 451328 hum bicol or 1485 1185 - 1204 1486 1185 - 1204 1487 1185 - 1204 1488 1185 - 1204 1489 1185 - 1204 NP_001 Zea 1073 1144 1215 142230 may s 1490 199 - 218 ACN26 Zea 1074 1145 1216 514 may s 1491 429 - 448 1492 429 - 448 1493 429 - 448 1494 429 - 448 1495 429 - 448 NP_001 Zea 1075 1146 1217 152292 may s 1496 230 - 249 1497 230 - 249 1498 230 - 249 1499 230 - 249 1500 230 - 249 ACF81 Zea 1076 1147 1218 426 may s 1501 690 - 709 1502 690 - 709 1503 690 - 709 1504 690 - 709 1505 690 - 709 NP_001 Zea 1077 1148 1219 141352 may s 1506 240 - 259 1507 240 - 259 1508 240 - 259 1509 240 - 259 1510 240 - 259 XP_002 Sorg 1078 1149 1220 437204 hum bicol or 1511 447 - 466 1512 447 - 466 1513 447 - 466 1514 447 - 466 1515 447 - 466 NP_001 Zea 1079 1150 1221 141965 may s 1516 993 - 1012 1517 993 - 1012 1518 993 - 1012 1519 993 - 1012 1520 993 - 1012 NP_001 Zea 1080 1151 1222 130136 may s 1521 750 - 769 1522 750 - 769 1523 750 - 769 1524 750 - 769 1525 750 - 769 XP_002 Sorg 1081 1152 1223 464517 hum bicol or 1526 345 - 364 1527 345 - 364 1528 345 - 364 1529 345 - 364 1530 345 - 364 NP_001 Zea 1082 1153 1224 147443 may s 1531 830 - 849 Predict 98 ACG38 Zea 1083 1154 1225 e zma 830 may mir s 50682 1532 561 - 580 1533 561 - 580 1534 561 - 580 1535 561 - 580

Table 16b miRNA-Resistant Target Examplesfor miRNAs which were Upregulated during Heat Shock

Mir name S Homol Organism Protei Origin ORF NCBI E g n al nucl Mutate Mir Q NCBI Seque Nucleo eotid d Bindi I Access nce/SE tide e Nucleo ng D ion Q ID Seque seq/ tide Site N NO: nce/SE SEQ Seque 0 Q ID ID nce/SE NO: NO: QID NO: Predicted folded 1 NP_00 Zea mays 1536 1563 1590 24-nts-long seq 7 11695 52606 7 56 1617 1561

1584 1618 1561

1584 1619 1561

1584 1620 1561

1584 Predicted siRNA 1 NP_00 Zea mays 1537 1564 1591 54566 8 11526 1 19 1621 837 - 858 1622 837 - 858 1623 837 - 858 1624 837 - 858 NP_00 Zea mays 1538 1565 1592 11303 42 1625 212 - 233 1626 212 - 233 1627 212 - 233 1628 212 - 233 1629 212 - 233 Predicted siRNA 1 ACN33 Zea mays 1539 1566 1593 54666 8 370 2 1630 207 - 228 1631 207 - 228 1632 207 - 228 1633 207 - 228 1634 207 - 228 ACR38 Zea mays 1540 1567 1594 139 1635 680 - 701 1636 680 - 701 1637 680 - 701 NP_00 Zea mays 1541 1568 1595 11415 27 1638 848 - 869 1639 848 - 869 1640 848 - 869 1641 848 - 869 1642 848 - 869 NP_00 Zea mays 1542 1569 1596 11308 41 1643 327 - 348 1644 327 - 348 1645 327 - 348 1646 327 - 348 1647 327 - 348 NP_00 Zea mays 1543 1570 1597 11837 78 1648 588 - 609 1649 588 - 609 1650 588 - 609 1651 588 - 609 1652 588 - 609 Predicted siRNA 1 NP_00 Zea mays 1544 1571 1598 55684 8 11501 3 52 1653 231 - 252 1654 231 - 252 1655 231 - 252 1656 231 - 252 1657 231 - 252 NP_00 Zea mays 1545 1572 1599 11461 49 1658 252 - 273 1659 252 - 273 1660 252 - 273 1661 252 - 273 1662 252 - 273 NP_00 Zea mays 1546 1573 1600 11415 27 1663 846 - 867 1664 846 - 867 1665 846 - 867 1666 846 - 867 1667 846 - 867 Predicted siRNA 1 NP_00 Zea mays 1547 1574 1601 56658 9 11051 0 85 1668 102 - 125 1669 102 - 125 1670 102 - 125 1671 102 - 125 1672 102 - 125 Predicted siRNA 1 NP_00 Zea mays 1548 1575 1602 56885 9 11478 2 62 1673 1287

1308 1674 1287

1308 1675 1287

1308 1676 1287

1308 1677 1287

1308 XP_002 Sorghum 1549 1576 1603 46789 bicolor 7 1678 188 - 209 1679 188 - 209 1680 188 - 209 1681 188 - 209 1682 188 - 209 NP_00 Oryza sativa 1550 1577 1604 10620 Japonica Group 56 1683 1145

1166 1684 1145

1166 1685 1145

1166 1686 1145

1166 1687 1145 Predicted siRNA 2 NP_00 Zea mays 1551 1578 1605 60742 0 11318 3 32 1688 542 - 563 1689 542 - 563 1690 542 - 563 1691 542 - 563 1692 542 - 563 Predicted siRNA NP_00 Zea mays 1552 1579 1606 60833 8 11457 0 63 1693 434 - 451 1694 434 - 451 1695 434 - 451 1696 434 - 451 1697 434 - 451 NP_00 Zea mays 1553 1580 1607 11493 87 1698 673 - 690 1699 673 - 690 1700 673 - 690 1701 673 - 690 1702 673 - 690 Predicted zma mir 2 XP_002 Sorghum 1554 1581 1608 48482 0 46504 bicolor 7 8 1703 380 - 401 1704 380 - 401 1705 380 - 401 1706 380 - 401 1707 380 - 401 Predicted zma mir 2 BAJ848 Hordeum 1555 1582 1609 49259 1 54 vulgare subsp. 0 vulgare 1708 456 - 477 1709 456 - 477 1710 456 - 477 1711 456 - 477 1712 456 - 477 Predicted zma mir 2 XP_002 Sorghum 1556 1583 1610 49642 1 44882 bicolor 1 7 1713 129 - 150 ACN25 Zea mays 1557 1584 1611 803 1714 1138

1159 1715 1138

1159 1716 1138

1159 1717 1138

1159 1718 1138

1159 AC072 Zea mays 1558 1585 1612 994 1719 174 - 195 1720 174 - 195 1721 174 - 195 1722 174 - 195 1723 174 - 195 Predicted zma mir 2 XP_002 Sorghum 1559 1586 1613 50085 1 45294 bicolor 3 3 1724 820 - 840 1725 820 - 840 1726 820 - 840 1727 820 - 840 1728 820 - 840 NP_00 Zea mays 1560 1587 1614 11503 20 1729 349 - 369 1730 349 - 369 XP_002 Sorghum 1561 1588 1615 43690 bicolor 3 1731 813 - 833 1732 813 - 833 1733 813 - 833 1734 813 - 833 1735 813 - 833 Predicted zma mir 2 ACN35 Zea mays 1562 1589 1616 50486 1 534 5 1736 352 - 373 1737 352 - 373 1738 352 - 373 1739 352 - 373

Table 17: Target Mimic Examples for miRNAs which were Downregulated under Drought Stress.

Mir Name Mir Sequence/SEQ ID Bulge in Target NO: Binding Sequence/SEQ ID NO: Predicted folded 24-nts-long seq 52255 1 1741

Predicted siRNA 55937 2 1742

Predicted siRNA 56066 18 1743

Predicted siRNA 58170 3 1744 Predicted zma mir 47934 4 1745 Predicted zma mir 48120 5 1746

Predicted zma mir 48408 6 1747

Predicted zma mir 48451 7 1748

Predicted zma mir 48462 8 1749

Predicted zma mir 48520 9 1750

Predicted zma mir 48653 26 1751

Predicted zma mir 48669 10 1752

Predicted zma mir 48682 11 1753

Predicted zma mir 48841 12 1754

Predicted zma mir 48966 13 1755

Predicted zma mir 49156 14 1756

Predicted zma mir 49199 15 1757

Table 18: Target Mimic Examples for miRNAs which were Downregulated during Salt Stress.

Mir Name Mir Sequence/SEQ ID Bulge in Target Binding NO: Sequence/SEQ ID NO: Predicted folded 24-nts-long seq 54187 33 1758 Predicted zma mir 47990 34 1759 Predicted zma mir 48459 35 1760 Predicted zma mir 48753 36 1761 Predicted zma mir 48824 37 1762 Predicted zma mir 48848 38 1763 Predicted zma mir 49575 39 1764 Predicted zma mir 49817 40 1765 Predicted zma mir 49855 41 1766 Predicted zma mir 49862 42 1767 Table 19: Target Mimic Examplesfor miRNAs which were Downregulated during Heat Shock

Mir Name Mir Sequence/SEQ ID NO: Bulge in Target Binding Sequence/SEQ ID NO: Predicted folded 24-nts-long seq 52724 53 1768 Predicted folded 24-nts-long seq 53866 54 1769

Predicted siRNA 54735 55 1770

Predicted siRNA 55208 56 1771 Predicted siRNA 56396 57 1772

Predicted siRNA 56791 58 1773

Predicted siRNA 57689 59 1774

Predicted siRNA 58108 60 1775

Predicted siRNA 58158 61 1776 Predicted siRNA 58720 62 1777

Predicted siRNA 58740 63 1778

Predicted siRNA 59056 64 1779

Predicted siRNA 59211 65 1780

Predicted siRNA 59300 66 1781 Predicted siRNA 59379 67 1782

Predicted siRNA 59410 68 1783

Predicted siRNA 59474 69 1784

Predicted siRNA 59736 70 1785 Predicted siRNA 59799 71 1786

Predicted siRNA 59800 72 1787

Predicted siRNA 59820 73 1788

Predicted siRNA 59851 74 1789

Predicted siRNA 59918 75 1790 Predicted siRNA 59935 76 1791

Predicted siRNA 59937 77 1792

Predicted siRNA 60421 78 1793

Predicted siRNA 60533 79 1794

Predicted siRNA 60833 80 1795 Predicted siRNA 61212 81 1796

Predicted siRNA 61236 82 1797 Predicted zma mir 48327 83 1798 Predicted zma mir 48489 84 1799 Predicted zma mir 49248 85 1800 Predicted zma mir 49310 86 1801 Predicted zma mir 49952 87 1802 Predicted zma mir 50120 88 1803 Predicted zma mir 50166 89 1804 Predicted zma mir 50256 90 1805 Predicted zma mir 50289 91 1806 Predicted zma mir 50388 92 1807 Predicted zma mir 50453 93 1808 Predicted zma mir 50480 94 1809 Predicted zma mir 50481 95 1810 Predicted zma mir 50483 96 1811 Predicted zma mir 50570 97 1812 Predicted zma mir 50682 98 1813 Predicted zma mir 50695 99 1814 Predicted zma mir 50701 100 1815

EXAMPLE 11 Target Gene Identification using Bioinformatic Tools

Homologous or orthologous genes to the genes of interest in maize and/or Arabidopsis are found through a proprietary tool that analyzes publicly available genomic as well as expression and gene annotation databases from multiple plant species. Homologous and orthologous protein and nucleotide sequences of target genes of the small RNA sequences of the invention, were found using BLAST having at least 70% identity on at least 60% of the entire master gene length, and are summarized in Table 6-8 below.

Table 20 - Targets of small RNAs listed in Tables 1 and 2 above

N Pr uc Mi Ho Nuc I ot leo r mo leot d ei tid Bi log ide G n G nd NC NC in BI BI n se se Mi g Ac GI t q q r Po ces nu i Org id id na siti sio mb t anis no no me on n er Annotation m : : ath 75 CA 600 Zea - 8- H5 980 may 18 20 mi 77 605 47 hypothetical protein [Zea mays] 1 s 16 15 8 7 c 0

7 Sor XP 9 _oo hypothetical protein SORBIDRAFT_08g006330 3 ghu 244 242 [Sorghum bicolor] >gil241942671 IgblEES 158 16. 11 2 m 197 083 hypothetical protein SORBIDRAFT_08g006330 9 bico 18 20 8 105 [Sorghum bicolor] 6 lor 17 16 0 Ory za 7 sati 0 va EA 1 Indi Z O 543 1 ca 083 625 hypothetical protein OsI_22867 [Oryza sativa Indica 1 Gro 18 6 48 Group] 7 up 18 0 Ory za 7 sati va NP Os06g0344900 [Oryza sativa Japonica Group] 0 3 Japo _oo >gil54291 113ldbjlBAD61787. 1 1 putative NAM 105 115 [Oryza sativa Japonica Group] 9 nica 757 467 >gil 1135956 18Idbj IB AF19492. 11Os06g0344900 1 Gro 18 20 8 957 [Oryza sativa Japonica Group] 1 up 19 17 67 AD 1- X6 323 Zea 69 012 388 may 18 20 1 9 648 NAC transcription factor [Zea mays] 1 s 20 18 AC 194 Zea F86 704 may 18 20 180 191 unknown [Zea mays] 1 s 2 1 19 0

9 NP 5 _oo 6 114 226 NAC domain-containing protein 21/22 [Zea mays] 3 Zea 823 507 >gil 1956 16832lgblACG30246. 11NAC domain- 6 may 18 20 1 Oil containing protein 21/22 [Zea mays] 4 s 22 20 0

8 Sor XP 5 _oo hypothetical protein SORBIDRAFT_07g005610 4 ghu 244 242 [Sorghum bicolor] >gil241940349lgblEES13494.1l 5 m 399 078 hypothetical protein SORBIDRAFT_07g005610 4 bico 18 20 9 460 [Sorghum bicolor] 5 lor 23 2 1 40 NP 9- _oo 293 hypothetical protein LOC100382594 [Zea mays] Zea 42 116 334 >gil223973065lgblACN30720. 1 1 unknown [Zea may 18 20 9 879 660 mays] 1 s 24 22 5 0

9 XP 4 Sor _oo hypothetical protein SORBIDRAFT_02g038 150 4 ghu 246 242 [Sorghum bicolor] >gil241926493lgblEER99637. 1l 5 m 311 050 hypothetical protein SORBIDRAFT_02g038 150 3 bico 18 20 6 743 [Sorghum bicolor] 2 lor 25 23 0 Ory za 8 sati Os07g0592200 [Oryza sativa Japonica Group] NP >gil29027762ldbj IBAC65898.i lputative CND41, va _oo chloroplast nucleoid DNA binding protein [Oryza 2 Japo 106 115 sativa Japonica Group] 6 nica 016 473 >gil11361 1697ldbj IB AF22075 .11Os07g0592200 1 Gro 18 20 1 124 [Oryza sativa Japonica Group] 5 up 26 24 0 Ory za 8 sati 5 va EE 2 Japo E6 543 6 nica 75 1 986 hypothetical protein OsJ_24961 [Oryza sativa Japonica 1 Gro 18 1 60 Group] 5 up 27 Ory 0 za sati 8 va EE 5 Indi C8 543 1 ca 237 625 hypothetical protein Osl_26705 [Oryza sativa Indica 0 Gro 18 1 48 Group] 3 up 28 Hor 0 deu m 8 vulg 0 are BA 6 subs KO 326 6 P - 325 511 5 vulg 18 20 1 103 predicted protein [Hordeum vulgare subsp. vulgare] 6 are 29 25 Hor 0 deu m 8 vulg 0 are BA 5 subs KO 326 0 P - 250 501 7 vulg 18 20 0 421 predicted protein [Hordeum vulgare subsp. vulgare] 1 are 30 26

8 0

7 NP 9 _oo 4 114 226 hypothetical protein LOCI 00275471 [Zea mays] 3 Zea 300 500 >gil 1956 12812lgblACG28236. 11hypothetical 0 may 18 20 8 337 protein [Zea mays] 4 s 39 35 Sor XP _oo hypothetical protein SORBIDRAFT_03g033 100 ghu 245 242 [Sorghum bicolor] >gil241930392lgblEES03537. 1l m 841 058 hypothetical protein SORBIDRAFT_03g033 100 bico 18 20 7 542 [Sorghum bicolor] 1 lor 40 36 0

8 NP 5 _oo 2 115 226 LOCI 00284789 [Zea mays] 5 Zea 115 529 >gill95644686lgblACG418 11.11phosphatase 1 may 18 20 6 416 phosphol [Zea mays] 8 s 4 1 37 0

8 4 AC 8 G2 195 9 Zea 508 606 2 may 18 20 1 501 phosphatase phosphol [Zea mays] 1 s 42 38 0

8 hypothetical protein LOC100191227 [Zea mays] 4 NP >gill94688368lgblACF78268. 11unknown [Zea _oo mays] >gill95606422lgblACG25041 .11phosphatase 5 113 212 phosphol [Zea mays] 3 Zea 013 275 >gil 195606828 IgblACG25244. 11phosphatase 2 may 18 20 3 705 phosphol [Zea mays] 4 s 43 39 Hor deu 0 m vulg 7 are 8 subs BA 326 7 P - J95 507 7 vulg 18 20 704 253 predicted protein [Hordeum vulgare subsp. vulgare] 7 are 44 40 0 Hor deu BA 326 7 m J88 525 8 vulg 18 20 9 11 728 predicted protein [Hordeum vulgare subsp. vulgare] 4 are 45 4 1

Osl0g0548600 [Oryza sativa Japonica Group] >gil75232354lsplQ7XCG7. 1IEXPB9_ORYSJ RecName: Full=Expansin-B9; AltName: Full=Beta- expansin-9; AltName: Full=OsEXPB9; AltName: Full=OsaEXPbl .6; Flags: Precursor >gil8 118437lgblAAF72990. 1IAF261277_1 beta- expansin [Oryza sativa] >gill3876539lgblAAK435 15. 1IAC020666_25 beta- expansin [Oryza sativa Japonica Group] >gil3 1433387lgblAAP54906. 1lBeta-expansin l a precursor, putative, expressed [Oryza sativa Japonica 0 Ory Group] >gil33338561 lgblAAQ13902. 1lpollen za allergen [Oryza sativa] 7 sati >gill 13639837ldbj IB AF27 142. 11Os10g0548600 NP [Oryza sativa Japonica Group] va _oo >gill25575604lgblEAZ16888. 11hypothetical protein 2 Japo 106 115 OsJ_32365 [Oryza sativa Japonica Group] 3 nica 530 483 >gil215704498ldbj IBAG93932.i lunnamed protein 4 Gro 18 20 5 269 product [Oryza sativa Japonica Group] 2 up 59 52 0 Ory za 7 sati 2 va EA 8 Indi Y7 543 6 ca 942 625 hypothetical protein OsI_34559 [Oryza sativa Indica 2 Gro 18 6 48 Group] 5 up 60 Pre die ted Sor siR 12 XP NA 89 _oo hypothetical protein SORBIDRAFT_07g028020 ghu 55 - 244 242 [Sorghum bicolor] >gi124 1942268 IgbEES 15413. 11 m 93 13 591 082 hypothetical protein SORBIDRAFT_07g028020 bico 18 20 7 10 8 298 [Sorghum bicolor] 1 lor 6 1 53 0

9 2 AA 6 Y8 683 4 Zea 965 039 9 may 18 20 7 4 1 beta 1,2-xylosyltransferase [Zea mays] 9 s 62 54 0

9 NP 1 _oo 4 110 162 Beta-l,2-xylosyltransferase [Zea mays] 8 Zea 584 464 >gil83715789lemblCAJ47425. 1IBeta-l,2- 9 may 18 20 5 153 xylosyltransferase [Zea mays] 4 s 63 55 0 Sac CA 559 char 11 1 569 8 um 18 20 448 67 beta-2-xylosyltransferase [Saccharum officinarum] 7 offi 64 56 0 cina 4 rum 0 6 0

8 3 Sor 1 ghu CA 837 7 m J47 157 2 bico 18 20 422 82 Beta-l,2-xylosyltransferase [Sorghum bicolor] 1 lor 65 57 0 Ory za 8 sati NP Os08g0503800 [Oryza sativa Japonica Group] 0 va _oo >gil42408140ldbj IBAD09279.il putative beta 1,2- 8 Japo 106 115 xylosyltransferase [Oryza sativa Japonica Group] 5 nica 217 477 >gilll3624146ldbjlBAF24091.1I Os08g0503800 1 Gro 18 20 7 161 [Oryza sativa Japonica Group] 1 up 66 58 Hor 0 deu m 7 vulg 7 are 5 subs BA 326 6 P - J90 495 2 vulg 18 20 540 835 predicted protein [Hordeum vulgare subsp. vulgare] 9 are 67 59 0

7 8 Hor 3 deu CA 837 3 m J47 157 6 vulg 18 20 421 80 Beta-l,2-xylosyltransferase [Hordeum vulgare] 6 are 68 60 12 25 AC G2 195 Zea 12 979 615 may 18 20 46 8 935 beta-2-xylosyltransferase [Zea mays] 1 s 69 6 1 Pre die ted siR XP Sor NA 33 _oo hypothetical protein SORBIDRAFT_01g044050 ghu 57 6- 246 242 [Sorghum bicolor] >gil241919554lgblEER92698.11 m 28 35 570 036 hypothetical protein SORBIDRAFT_01g044050 bico 18 20 3 6 0 610 [Sorghum bicolor] 1 lor 70 62 NP _oo 162 serine acetyltransferase2 [Zea mays] 0 Zea 110 463 >gil25991549lgblAAN76865.1IAF453838_l satase may 18 20 508 855 isoform II [Zea mays] 8 s 7 1 63 3 7 7 8 1 4 0 Ory za 7 sati 9 va EA 4 Indi Y8 543 2 ca 890 625 hypothetical protein Osl_10380 [Oryza sativa Indica 1 Gro 18 1 48 Group] 2 up 72 0 Ory Os03g0 196600 [Oryza sativa Japonica Group] za >gil 122224506lsplQ 10QH 1.1IS AT4_ORYS J 8 sati RecName: Full=Probable serine acetyltransferase 4; va NP AltName: Full=OsSERAT2;2 0 _oo >gill08706662lgblABF94457. 1l satase isoform II, 0 Japo 104 297 putative, expressed [Oryza sativa Japonica Group] 6 nica 926 600 >gil255674283ldbjlBAFl 1179.21 Os03g0196600 4 Gro 18 20 5 483 [Oryza sativa Japonica Group] 3 up 73 64 Hor 0 deu m 7 vulg 8 are 4 subs BA 326 5 P - J93 523 6 vulg 18 20 017 692 predicted protein [Hordeum vulgare subsp. vulgare] 6 are 74 65 0 Ory Os03g0 185000 [Oryza sativa Japonica Group] za >gil223635827lsplQ0DUI1 .2ISAT3_ORYSJ 7 sati RecName: Full=Probable serine acetyltransferase 3; va NP AltName: Full=OsSERAT2; 1 5 _oo >gill08706556lgblABF9435 1.1l satase isoform II, 2 Japo 104 297 putative [Oryza sativa Japonica Group] 4 nica 919 600 >gil255674260ldbjlBAFl 1107.21 Os03g0185000 1 Gro 18 20 3 437 [Oryza sativa Japonica Group] 2 up 75 66 Sor XP _oo hypothetical protein SORBIDRAFT_04g029800 ghu 245 242 [Sorghum bicolor] >gil241932475lgblEES05620. 1l m 264 062 hypothetical protein SORBIDRAFT_04g029800 bico 18 20 4 709 [Sorghum bicolor] 1 lor 76 67 0

9 7 AC 9 N2 223 5 Zea 767 947 9 may 18 20 6 184 unknown [Zea mays] 2 s 77 68 NP 226 pxl9-like protein [Zea mays] 0 Zea 18 20

114 690 mays] 8 s 185 6 4 8 3 5 4 Hor 0 deu m 8 vulg 6 are 8 subs BA 326 3 P - J86 506 5 vulg 19 20 407 177 predicted protein [Hordeum vulgare subsp. vulgare] 4 are 05 9 1 0

XP 7 _oo 8 Viti 228 225 PREDICTED: hypothetical protein [Vitis vinifera] 4 s 347 451 >gil296087299lemblCBI33673.3l unnamed protein 8 vini 19 20 9 992 product [Vitis vinifera] 1 fera 06 92 0

7 XP 7 Pop _oo 7 ulus 232 224 predicted protein [Populus trichocarpa] 2 trich 932 127 >gil222870779lgblEEF07910. 1lpredicted protein 1 ocar 19 20 5 629 [Populus trichocarpa] 5 pa 07 93 0

7 XP 6 Rici _oo 7 nus 25 1 255 Ran GTPase binding protein, putative [Ricinus 0 com 674 55 1 communis] >gil2235441 18lgblEEF45643. 1lRan 8 mun 19 20 5 397 GTPase binding protein, putative [Ricinus communis] 9 is 08 94 0

8 8 Pice AD 6 a E7 294 0 site 671 462 7 hens 19 20 1 323 unknown [Picea sitchensis] 6 is 09 95 0 Ara XP regulator of chromosome condensation family protein bido _oo [Arabidopsis lyrata subsp. lyrata] 7 psis 287 297 >gil2973 19589lgblEFH5001 1.11regulator of 6 lyrat 375 811 chromosome condensation family protein [Arabidopsis 4 a 19 20 2 736 lyrata subsp. lyrata] 5 subs 10 96

Pre die ted zm a NP mir _oo 48 63 114 226 protein phosphatase 2C [Zea mays] Zea 5 1 846 493 >gill95619560lgblACG3 1610. 11protein phosphatase may 19 2 1 4 84 6 425 2C [Zea mays] 1 s 40 17 OsOlgO164600 [Oryza sativa Japonica Group] >gil75 164086lsplQ942P9. 1IP2C01_ORYSJ RecName: Full=Probable protein phosphatase 2C 1; 0 Ory Short=OsPP2C0 1 >gil 15528748 Idbj IB AB64790. 11 za putative senescence-associated protein [Oryza sativa 7 sati Japonica Group] >gi 1 1327992ldbj IB AC005 81.11 va NP putative senescence-associated protein [Oryza sativa 8 _oo Japonica Group] >gil 11353 1634ldbj IB AF040 17. 11 7 Japo 104 115 OsOlgO164600 [Oryza sativa Japonica Group] 2 nica 210 434 >gill2556915 1lgblEAZ10666. 1lhypothetical protein 3 Gro 19 2 1 3 689 OsJ_00496 [Oryza sativa Japonica Group] 4 up 4 1 18 0 Ory za 7 sati 8 va EA 7 Indi Y7 543 2 ca 266 625 hypothetical protein Osl_00528 [Oryza sativa Indica 3 Gro 19 2 48 Group] 4 up 42 Hor 0 deu m 7 vulg 8 are 4 subs BA 326 1 P - J94 494 9 vulg 19 2 1 449 659 predicted protein [Hordeum vulgare subsp. vulgare] 5 are 43 19 Sor XP _oo hypothetical protein SORBIDRAFT_10g025330 ghu 54 243 242 [Sorghum bicolor] > ;gi124 19 16963 IgbIEER90107.11 m 874 096 hypothetical protein SORBIDRAFT_10g025330 bico 19 2 1 75 0 499 [Sorghum bicolor] 1 lor 44 20 0

9 5 AC 2 G2 195 4 Zea 927 614 7 may 19 2 1 0 879 amino acid permease [Zea mays] 9 s 45 2 1 NP hypothetical protein LOC100191967 [Zea mays] 0 _oo 212 >gill94690296lgblACF79232. 11unknown [Zea Zea 113 274 mays] >gill94707684lgblACF87926. 11unknown 9 may 19 2 1 086 856 [Zea mays] >gil224029673lgblACN33912. 1l 5 s 46 22 3 unknown [Zea mays] 2 4 7 9 0 Ory za 8 sati NP Os06g0644700 [Oryza sativa Japonica Group] 6 va _oo >gil51535520ldbj IB AD37439.il amino acid 7 Japo 105 115 transporter-like protein [Oryza sativa Japonica Group] 7 nica 818 469 >gil113596229ldbj IB AF20103.11Os06g0644700 6 Gro 19 2 1 9 179 [Oryza sativa Japonica Group] 9 up 47 23 0 Ory za 8 sati 7 va EA 3 Indi Z O 543 9 ca 185 625 hypothetical protein Osl_23880 [Oryza sativa Indica 6 Gro 19 9 48 Group] 7 up 48 Hor 0 deu m 8 vulg 4 are 5 subs BA 326 0 P - J85 495 4 vulg 19 2 1 749 305 predicted protein [Hordeum vulgare subsp. vulgare] 1 are 49 24 Hor 0 deu m 7 vulg 9 are 7 subs BA 326 5 P - J95 507 2 vulg 19 2 1 660 165 predicted protein [Hordeum vulgare subsp. vulgare] 1 are 50 25 0 Ory za 7 sati 4 va EE 3 Japo E6 543 8 nica 610 986 hypothetical protein OsJ_22140 [Oryza sativa Japonica 0 Gro 19 7 60 Group] 2 up 5 1 Pre die ted 16 NP zm 15 _oo a - 113 212 hypothetical protein LOC100191773 [Zea mays] Zea mir 16 067 275 >gill94689790lgblACF78979. 1 1 unknown [Zea may 19 2 1 48 36 0 146 mays] 1 s 52 26

2 6 0

9 1 2 AC 194 1 Zea F85 703 3 may 19 2 1 700 231 unknown [Zea mays] 4 s 60 33 Osl IgO 186200 [Oryza sativa Japonica Group] >gil62954909lgblAAY23278.11aldehyde dehydrogenase, putative [Oryza sativa Japonica Group] >gill08864076lgblABA91775.2l aldehyde dehydrogenase family protein, expressed [Oryza sativa Japonica Group] >gill l3644625ldbjlBAF27766. 1l Osl IgO 186200 [Oryza sativa Japonica Group] 0 Ory >gil215737694ldbj IBAG96824.i lunnamed protein za product [Oryza sativa Japonica Group] 8 sati >gil215737793ldbjlBAG96923. 11unnamed protein NP product [Oryza sativa Japonica Group] 0 va _oo >gil218 185391 lgblEEC678 18. 11hypothetical protein 3 Japo 106 115 OsI_35395 [Oryza sativa Indica Group] 3 nica 592 484 >gil222615645lgblEEE5 1777. 11hypothetical protein 4 Gro 19 2 1 1 5 18 OsJ_33226 [Oryza sativa Japonica Group] 7 up 6 1 34 0 Ory za 8 sati 0 va AA 3 Japo X9 458 3 nica 633 609 aldehyde dehydrogenase, putative [Oryza sativa 4 Gro 19 2 1 8 9 1 Japonica Group] 7 up 62 35 Hor 0 deu m 7 vulg 6 are BA 3 subs KO 326 5 P - 193 492 9 vulg 19 2 1 7 306 predicted protein [Hordeum vulgare subsp. vulgare] 8 are 63 36 Pre die ted zm Eula 19 mir 77 AD liop 50 - U3 315 sis 10 19 288 493 bina 19 2 1 9 97 9 433 embryonic flower 1 protein [Eulaliopsis binata] 1 ta 64 37 AB C6 850 0 Zea 915 625 may 19 2 1 4 76 EMF-like [Zea mays] 9 s 65 38 2 3 4 4 5 0

9 NP 3 _oo VEF family protein [Zea mays] 4 110 162 >gil29569 111lgblAAO84022.11VEF family protein 6 Zea 553 461 [Zea mays] >gil60687422lgblAAX35735.1l 0 may 19 2 1 0 707 embryonic flower 2 [Zea mays] 9 s 66 39 0 Den 8 droc 0 ala AB 5 mus B7 824 4 latif 721 699 2 loru 19 2 1 0 18 EMF2 [Dendrocalamus latiflorus] 3 s 67 40 0

7 9 AA 7 Triti X7 622 4 cum 823 756 4 aesti 19 2 1 2 60 embryonic flower 2 [Triticum aestivum] 8 vum 68 4 1 0 Ory za 7 sati NP 5 va _oo 7 Japo 106 115 Os09g0306800 [Oryza sativa Japonica Group] 5 nica 282 478 >gil255678755ldbjlBAF24739.2l Os09g0306800 7 Gro 19 2 1 5 459 [Oryza sativa Japonica Group] 6 up 69 42 0 Ory za 7 sati 5 va BA 7 Japo D3 510 5 nica 651 916 putative VEF family protein [Oryza sativa Japonica 7 Gro 19 0 94 Group] 6 up 70 0

7 Eula AD 5 liop U3 315 7 sis 289 493 5 bina 19 2 1 0 435 embryonic flower 2 protein [Eulaliopsis binata] 7 ta 7 1 43

[Oryza sativa Japonica Group] Hor deu 0 m vulg 8 are 3 subs BA 326 4 P - J95 502 7 vulg 19 2 1 234 341 predicted protein [Hordeum vulgare subsp. vulgare] 7 are 79 50 0 Ory za 8 sati 0 va CA 8 Japo D4 386 OSJNBa0019K04.6 [Oryza sativa Japonica Group] 9 nica 165 059 >gill25591348lgblEAZ3 1698. 11hypothetical protein 0 Gro 19 9 39 OsJ_15847 [Oryza sativa Japonica Group] 8 up 80 Os04g0573000 [Oryza sativa Japonica Group] >gil306756012lsplB8AT5 1.1ISPXM2_ORYSI RecName: Full=SPX domain-containing membrane protein OsI_ 17046 >gil306756288lsplQ0JAW2.2ISPXM2_ORYSJ 0 Ory RecName: Full=SPX domain-containing membrane za protein Os04g0573000 8 sati >gil215694614ldbjlBAG89805. 11unnamed protein NP product [Oryza sativa Japonica Group] 0 va _oo >gil218 195403lgblEEC77830. 1lhypothetical protein 8 Japo 105 115 OsI_ 17046 [Oryza sativa Indica Group] 9 nica 361 460 >gil255675707ldbjlBAF15525.2l Os04g0573000 0 Gro 19 2 1 1 021 [Oryza sativa Japonica Group] 8 up 8 1 5 1 0 Ory za 8 sati 0 va CA 6 Indi H6 116 0 ca 695 309 3 Gro 19 2 1 7 919 OSIGBa0147H17.5 [Oryza sativa Indica Group] 4 up 82 52 0

7 XP 8 Sor _oo hypothetical protein SORBIDRAFT_06g025950 4 ghu 244 242 [Sorghum bicolor] >gil241938 147lgblEES 11292. 11 4 m 696 074 hypothetical protein SORBIDRAFT_06g025950 8 bico 19 2 1 4 055 [Sorghum bicolor] 3 lor 83 53 0 XP _oo 7 Viti 228 225 PREDICTED: hypothetical protein [Vitis vinifera] 2 s 254 426 >gil297742609lemblCBI34758.3l unnamed protein 1 vini 19 2 1 0 756 product [Vitis vinifera] 2 fera 84 54

3 vulg are Hor 0 deu m 7 vulg 3 are 8 subs BA 326 3 P - J99 512 4 vulg 20 2 1 672 633 predicted protein [Hordeum vulgare subsp. vulgare] 2 are 00 70 0 Ory za Os09g0428900 [Oryza sativa Japonica Group] 7 sati >gil50726497ldbj IB AD34 105.11VirR/VirH-like NP protein [Oryza sativa Japonica Group] 2 va _oo >gill 1363 1466ldbj IB AF25 147. 11Os09g0428900 5 Japo 106 115 [Oryza sativa Japonica Group] 3 nica 323 479 >gil215704829ldbj IBAG94857.il unnamed protein 8 Gro 20 2 1 3 278 product [Oryza sativa Japonica Group] 9 up 0 1 7 1 0 Ory za 7 sati 2 va EE 5 Japo E6 543 3 nica 974 986 hypothetical protein OsJ_29445 [Oryza sativa Japonica 8 Gro 20 9 60 Group] 9 up 02 0 Ory za 7 sati 3 va EE 5 Indi C8 543 7 ca 461 625 hypothetical protein Osl_31450 [Oryza sativa Indica 5 Gro 20 4 48 Group] 1 up 03 AC N2 223 Zea 550 942 may 20 2 1 5 842 unknown [Zea mays] 1 s 04 72 0

9 NP 7 _oo 9 114 226 NAC domain protein NAC5 [Zea mays] 8 Zea 777 503 >gill95613638lgblACG28649.1l NAC domain 8 may 20 2 1 0 046 protein NAC5 [Zea mays] 5 s 05 73 XP 0 Sor _oo hypothetical protein SORBIDRAFT_04g023990 ghu 245 242 [Sorghum bicolor] >gil241932171lgblEES05316.1l 8 m 234 062 hypothetical protein SORBIDRAFT_04g023990 3 bico 20 2 1 0 101 [Sorghum bicolor] 0 lor 06 74 Table 21 - Targets of small RNAs listed in Tables 3 and 4 above

6 ubiquitin-conjugating enzyme E2 2 1 [Arabidopsis 2 thali thaliana] 9 ana >gil75330089lsplQ8LGF7. 1IPEX4_ARATH 9 RecName: Full=Protein PEROXIN-4; Short=AtPEX4; 3 AltName: Full=Probable ubiquitin-conjugating enzyme 6 E2 2 1; AltName: Full=Ubiquitin carrier protein 2 1 >gil21536556lgblAAM60888. 1lE2, ubiquitin- conjugating enzyme, putative [Arabidopsis thaliana] >gil66354452lgblAAY44861 .11ubiquitinating enzyme [Arabidopsis thaliana] >gil9896 1101 IgblABF59034. 11At5g25760 [Arabidopsis thaliana] >gil332006099lgblAED93482. 11putative ubiquitin- conjugating enzyme E2 2 1 [Arabidopsis thaliana] >gil332006100lgblAED93483. 11putative ubiquitin- conjugating enzyme E2 2 1 [Arabidopsis thaliana] hypothetical protein SORBIDRAFT_07g002770 XP [Sorghum bicolor] Sor _oo >gill 848 1702lgblAAL73524. 1IAF466200_3 ghu 244 242 tryptophan synthase beta-subunit [Sorghum bicolor] m 382 078 >gil241940170lgblEES 133 15. 11hypothetical protein bico 22 23 0 102 SORBIDRAFT_07g002770 [Sorghum bicolor] 1 lor 30 96 0

8 3 RecName: Full=Tryptophan synthase beta chain 2, 4 chloroplastic; AltName: Full=Orange pericarp 2; Flags: 0 Zea P43 Precursor >gill68574lgblAAA33491 .1l tryptophan 3 may 22 284 synthase beta-subunit [Zea mays] 4 s 3 1 0 Qry za 8 sati 4 va EA 8 Indi Z O 543 7 ca 55 1 625 hypothetical protein OsI_27728 [Oryza sativa Indica 3 Gro 22 2 48 Group] 9 up 32 0

8 0 RecName: Full=Tryptophan synthase beta chain 1; 2 AltName: Full=Orange pericarp 1 5 Zea P43 >gill68572lgblAAA33490. 1l tryptophan synthase 2 may 22 283 beta-subunit [Zea mays] 1 s 33 0

8 4 Qry AD 8 za Z O 325 7 glab 463 260 3 erri 22 23 7 807 hypothetical protein [Oryza glaberrima] 9 ma 34 97 XP 225 0 Viti _oo 461 s 22 23 228 049 PREDICTED: hypothetical protein [Vitis vinifera] 7 vini 35 98

6 2 2

NP _oo 1 114 226 LOCI 00282597 [Zea mays] 0 Zea 897 508 >gill95623744lgblACG33702. 1lalpha-N- 9 may 22 24 7 337 arabinofuranosidase A precursor [Zea mays] 8 s 50 13 0 Ory za 8 sati 9 va EE 0 Indi C6 543 2 ca 759 625 hypothetical protein OsI_34967 [Oryza sativa Indica 4 Gro 22 8 48 Group] 4 up 5 1 Osl lg013 1900 [Oryza sativa Japonica Group] >gill08863956lgblABA91355.2l Alpha-L- arabinofuranosidase C-terminus family protein, expressed [Oryza sativa Japonica Group] >gill08863957lgblABG22345. 1lAlpha-L- arabinofuranosidase C-terminus family protein, expressed [Oryza sativa Japonica Group] >gill08863958lgblABG22346. 1lAlpha-L- arabinofuranosidase C-terminus family protein, 0 Ory expressed [Oryza sativa Japonica Group] za >gill l3644364ldbjlBAF27505. 1IOsl lg013 1900 o8. sati NP [Oryza sativa Japonica Group] 9 va _oo >gil215694468ldbjlBAG8943 1.11unnamed protein 0 Japo 106 115 product [Oryza sativa Japonica Group] 2 nica 566 483 >gil222615454lgblEEE5 1586. 11hypothetical protein 4 Gro 22 24 0 996 OsJ_32826 [Oryza sativa Japonica Group] 4 up 52 14 0

8 7 Hor AA 3 deu K2 133 4 m 188 984 arabinoxylan arabinofuranohydrolase isoenzyme 7 vulg 22 24 0 13 AXAH-II [Hordeum vulgare] 6 are 53 15 Osl2g0 128700 [Oryza sativa Japonica Group] >gil77553575lgblABA9637 1.11Alpha-L- Ory arabinofuranosidase C-terminus family protein, za expressed [Oryza sativa Japonica Group] sati NP >gill08862132lgblABA96370.2l Alpha-L- 0 va _oo arabinofuranosidase C-terminus family protein, Japo 106 115 expressed [Oryza sativa Japonica Group] 8 nica 606 487 >gil113648569ldbj IB AF2908 1.11Os12g0128700 7 Gro 22 24 2 149 [Oryza sativa Japonica Group] 5 up 54 16 0 Ory EE za C6 543 8 sati 879 625 hypothetical protein OsI_37345 [Oryza sativa Indica 7 va 22 3 48 Group] 5 Indi 55

AC L5 219 Zea 434 887 may 22 24 6 942 unknown [Zea mays] 1 s 7 1 3 1 NP _oo 114 226 hypothetical protein LOCI 00277964 [Zea mays] Zea 486 528 >gill95648236lgblACG43586. 11hypothetical may 22 24 9 390 protein [Zea mays] 1 s 72 32 0

8 XP 2 Sor _oo hypothetical protein SORBIDRAFT_01g0 19820 0 ghu 246 242 [Sorghum bicolor] >gil241918361lgblEER9 1505.11 7 m 450 034 hypothetical protein SORBIDRAFT_01g0 19820 3 bico 22 24 7 224 [Sorghum bicolor] 8 lor 73 33 XP Sor _oo hypothetical protein SORBIDRAFT_06g002240 ghu 244 242 [Sorghum bicolor] >gil241937322lgblEES 10467. 11 m 613 072 hypothetical protein SORBIDRAFT_06g002240 bico 22 24 9 405 [Sorghum bicolor] 1 lor 74 34 0

9 3 AC 6 N3 224 5 Zea 436 030 0 may 22 24 6 580 unknown [Zea mays] 8 s 75 35 0

9 NP 2 _oo 4 114 226 amino acid permease [Zea mays] 1 Zea 778 500 >gill95613758lgblACG28709. 1lamino acid 6 may 22 24 5 959 permease [Zea mays] 2 s 76 36 0

7 XP 4 Sor _oo hypothetical protein SORBIDRAFT_04g000290 2 ghu 245 242 [Sorghum bicolor] >gil241932946lgblEES06091 .1l 5 m 311 063 hypothetical protein SORBIDRAFT_04g000290 0 bico 22 24 5 65 1 [Sorghum bicolor] 4 lor 77 37 0

7 XP 2 Sor _oo hypothetical protein SORBIDRAFT_10g019640 4 ghu 243 242 [Sorghum bicolor] >gil241916662lgblEER89806. 1l 8 m 843 095 hypothetical protein SORBIDRAFT_10g019640 6 bico 22 24 9 897 [Sorghum bicolor] 8 lor 78 38 NP 115 Os02g0101000 [Oryza sativa Japonica Group] 0 Ory _oo 443 >gil41053220ldbjlBAD08 18 1.11putative amino acid za 22 24 104 610 transport protein [Oryza sativa Japonica Group] 7 sati 79 39

4 7 9 putative chlorophyll a/b-binding protein type III precursor [Oryza sativa Japonica Group] >gil49388341 Idbj IB AD2545 1.11putative chlorophyll a/b-binding protein type III precursor [Oryza sativa Japonica Group] >gill25538483lgblEAY84878. 11hypothetical protein Osl_06243 [Oryza sativa Indica Group] >gill2558 1168lgblEAZ22099. 11hypothetical protein OsJ_05758 [Oryza sativa Japonica Group] >gil215678980ldbj IBAG96410. i lunnamed protein product [Oryza sativa Japonica Group] >gil215679371 ldbj IBAG965 11.i lunnamed protein product [Oryza sativa Japonica Group] >gil215686386ldbj IBAG87647. i lunnamed protein product [Oryza sativa Japonica Group] >gil215737482ldbj IBAG96612. i lunnamed protein product [Oryza sativa Japonica Group] >gil215737505ldbjlBAG96635. 11unnamed protein product [Oryza sativa Japonica Group] >gil2157375 12ldbj IBAG96642. i lunnamed protein product [Oryza sativa Japonica Group] >gil215737560ldbj IBAG96690. i lunnamed protein product [Oryza sativa Japonica Group] >gil215737570ldbj IBAG96700. i lunnamed protein product [Oryza sativa Japonica Group] >gil215737580ldbj IBAG96710. i lunnamed protein product [Oryza sativa Japonica Group] >gil215737621 ldbjlBAG9675 1.11unnamed protein product [Oryza sativa Japonica Group] >gil215737634ldbj IBAG96764. i lunnamed protein product [Oryza sativa Japonica Group] >gil215737653ldbjlBAG96783. 11unnamed protein product [Oryza sativa Japonica Group] >gil215737729ldbj IBAG96859. i lunnamed protein 0 Ory product [Oryza sativa Japonica Group] za >gil215737785ldbjlBAG96915. 11unnamed protein 8 sati product [Oryza sativa Japonica Group] 2 va BA >gil215765646ldbjlBAG87343. 11unnamed protein 7 Japo D2 493 product [Oryza sativa Japonica Group] 7 nica 528 88 1 >gil215767462ldbj IBAG99690. i lunnamed protein 1 Gro 22 24 4 36 product [Oryza sativa Japonica Group] 5 up 87 45 Ara 0 bido psis 8 lyrat XP hypothetical protein ARALYDRAFT_475 174 0 a _oo [Arabidopsis lyrata subsp. lyrata] 5 subs 288 297 >gil297333925lgblEFH64343. 11hypothetical 2 P 808 840 protein A ALYDR AFT_475 174 [Arabidopsis lyrata 4 lyrat 22 24 4 404 subsp. lyrata] 3 a 88 46 light-harvesting complex I chlorophyll a/b binding 0 Ara NP protein 3 [Arabidopsis thaliana] bido _17 306 >gil3341 8355 1lreflNP_001 185280. 11light- 8 psis 634 965 harvesting complex I chlorophyll a/b binding protein 3 0 thali 22 24 7 81 [Arabidopsis thaliana] 1 ana 89 47

9 9 Hor 0 deu m 7 vulg 0 are 6 subs BA 326 5 P - J96 5 17 7 vulg 23 24 500 015 predicted protein [Hordeum vulgare subsp. vulgare] 7 are 26 77 Ory za Predi sati cted va zma 78 EE Indi mir 7- C6 543 ca 4799 80 766 625 hypothetical protein Osl_35091 [Oryza sativa Indica Gro 23 0 8 7 48 Group] 1 up 27 Osl IgO 146700 [Oryza sativa Japonica Group] >gill08863991 lgblABA91466.2l expressed protein Ory [Oryza sativa Japonica Group] 0 za >gill 13644441 ldbj IB AF27582. i l Osl lg0146700 sati NP [Oryza sativa Japonica Group] 9 va _oo >gil2157041 19ldbj IBAG92959. i lunnamed protein 8 Japo 106 115 product [Oryza sativa Japonica Group] 7 nica 573 484 >gil2226155 14lgblEEE5 1646. 11hypothetical protein 4 Gro 23 24 7 150 OsJ_32953 [Oryza sativa Japonica Group] 1 up 28 78 0

8 XP 3 Sor _oo hypothetical protein SORBIDRAFT_08g001030 9 ghu 244 242 [Sorghum bicolor] >gil241942400lgblEES 15545. 11 9 m 170 082 hypothetical protein SORBIDRAFT_08g001030 2 bico 23 24 7 563 [Sorghum bicolor] 8 lor 29 79 0 Ory za 8 sati 9 va EA 0 Indi Y8 543 2 ca 223 625 hypothetical protein OsI_37441 [Oryza sativa Indica 8 Gro 23 6 48 Group] 8 up 30 0

8 NP 4 _oo putative splicing factor [Zea mays] 1 110 162 >gill34035227lgblABO47657. 1lputative splicing 7 Zea 598 458 factor [Zea mays] >gill34035229lgblABO47658. 1l 2 may 23 24 8 579 putative splicing factor [Zea mays] 7 s 3 1 80 0 AC G4 195 8 Zea 256 646 3 may 23 24 4 191 hypothetical protein [Zea mays] 8 s 32 8 1

4 0 Ory za RecName: Full=Putative laccase-1 1; AltName: 7 sati Full=Benzenediol:oxygen oxidoreductase 11; 1 va AltName: Full=Diphenol oxidase 11; AltName: 5 Japo Q0 Full=Urishiol oxidase 11 0 nica DH >gil22263 1843lgblEEE63975. 11hypothetical protein 2 Gro 23 L5 OsJ_18801 [Oryza sativa Japonica Group] 6 up 40 0

XP 7 Sor _oo hypothetical protein SORBIDRAFT_09g022460 1 ghu 244 242 [Sorghum bicolor] >gil241 94650 1IgblEES 19646. 11 8 m 121 090 hypothetical protein SORBIDRAFT_09g022460 4 bico 23 24 6 766 [Sorghum bicolor] 8 lor 4 1 89 Predi cted NP zma 49 _oo mir 3- 115 226 tubulin—tyrosine ligase-like protein 12 [Zea mays] Zea 4882 5 1 180 532 >gil 195649775 IgblACG44355 .11tubulin-tyrosine may 23 24 4 3 3 099 ligase-like protein 12 [Zea mays] 1 s 42 90 0 Ory za 8 sati NP Os03g0 179000 [Oryza sativa Japonica Group] 3 va _oo >gill08706494lgblABF94289. 11Tubulin-tyrosine 3 Japo 104 115 ligase family protein, expressed [Oryza sativa Japonica 7 nica 915 45 1 Group] >gill 13547626ldbjlBAFl 1069. 11 1 Gro 23 24 5 108 Os03g0 179000 [Oryza sativa Japonica Group] 6 up 43 9 1 0 Ory za 8 sati 3 va EE 3 Japo E5 543 7 nica 843 986 hypothetical protein OsJ_09642 [Oryza sativa Japonica 1 Gro 23 4 60 Group] 6 up 44 0

8 2 AC 1 N3 223 1 Zea 204 975 0 may 23 24 3 710 unknown [Zea mays] 1 s 45 92 Hor 0 deu m 8 vulg 1 are 1 subs BA 326 9 P - J96 5 12 2 vulg 23 24 002 041 predicted protein [Hordeum vulgare subsp. vulgare] 7 are 46 93 EE 543 hypothetical protein OsI_ 10249 [Oryza sativa Indica 0 Ory 23 C7 625 Group] za 47

Table 22 - Targets of small RNAs listed in Table 5 above

Mi N r Ho Nuc Pr uc Bi mo leot I ot leo nd log ide d ei tid in NC NC e n e g BI BI n se se Po Ac GI t q q Mir sit ces nu id id nam io sio mb t Orga n no e n n er Annotation nism o: Predi cted folde d 24- nts- long XP Cani seq _84 740 s 5139 867 13 1 PREDICTED: similar to Retrovirus-related Pol famil 25 39 1 7 6 1 polyprotein from transposon 297 [Canis familiaris] 1 iaris 00 70 0

7 AA 9 L6 182 putative gag-pol precursor [Zea mays] 2 675 544 >gil33 113975lgblAAP94597. 1lputative gag-pol 5 Zea 25 1 08 precursor [Zea mays] 7 mays 0 1 0

8 0 AA 6 L7 185 8 598 682 1 Zea 25 2 34 putative prpol [Zea mays] 1 mays 02 Predi 2 1 XP hypothetical protein SORBIDRAFT_01g03 1560 Sorg cted 5- _oo 242 [Sorghum bicolor] >gil241918922lgblEER92066. 1l hum folde 23 246 035 hypothetical protein SORBIDRAFT_01g03 1560 bicol 25 39 d 24- 8 506 346 [Sorghum bicolor] 1 or 03 7 1

349 [Sorghum bicolor] or 6 0

8 NP 8 _oo 2 114 226 hypothetical protein LOCI 00277804 [Zea mays] 8 475 493 >gil 195646528 IgblACG42732. 11hypothetical 3 Zea 25 40 4 369 protein [Zea mays] 4 mays 42 04 Os03g0853900 [Oryza sativa Japonica Group] >gil29126338lgblAAO66530. 1lputative p21 C- terminal-binding protein (alternative splicing products) [Oryza sativa Japonica Group] >gi 1108712161 IgblABF99956. 11expressed protein [Oryza sativa Japonica Group] >gill l3550404ldbj IB AF13847. i l Os03g0853900 0 Oryz [Oryza sativa Japonica Group] a >gill25546494lgblEAY92633. 11hypothetical 7 sativ NP protein OsI_14377 [Oryza sativa Indica Group] 2 a _oo >gill25588683lgblEAZ29347. 11hypothetical 2 Japo 105 115 protein OsJ_13413 [Oryza sativa Japonica Group] 0 nica 193 456 >gil215737372ldbjlBAG96301 .11unnamed protein 7 Grou 25 40 3 664 product [Oryza sativa Japonica Group] 1 P 43 05 0 Hord eum 7 vulga 2 re BA 2 subs KO 326 predicted protein [Hordeum vulgare subsp. vulgare] 0 P 206 492 >gil326505672ldbj IBAJ95507. i lpredicted protein 7 vulga 25 40 9 571 [Hordeum vulgare subsp. vulgare] 1 re 44 06 NP 4 _oo - 115 226 lactoylglutathione lyase [Zea mays] 6 261 506 >gill95658267lgblACG48601 .1l lactoylglutathione Zea 25 40 9 333 lyase [Zea mays] 1 mays 45 07 0

NP 7 _oo lactoylglutathione lyase [Zea mays] 7 114 226 >gill94700264lgblACF84216. 11unknown [Zea 0 957 500 mays] >gill95628 124lgblACG35892. 1l 2 Zea 25 40 1 125 lactoylglutathione lyase [Zea mays] 7 mays 46 08 0

7 XP 5 _oo hypothetical protein SORBIDRAFT_09g005270 2 Sorg 243 242 [Sorghum bicolor] >gil241944656lgblEES 17801 .11 2 hum 937 087 hypothetical protein SORBIDRAFT_09g005270 5 bicol 25 40 1 076 [Sorghum bicolor] 2 or 47 09 XP 23 _oo hypothetical protein SORBIDRAFT_01g01 1390 Sorg 246 242 [Sorghum bicolor] >gil241920490lgblEER93634. 11 hum Fe 663 038 hypothetical protein SORBIDRAFT_01g01 1390 bicol 25 40 b 6 482 [Sorghum bicolor] 1 or 48 10

5 9 3 0

8 9 AC 6 A2 168 9 185 25 1 8 Zea 26 2 061 serine threonine kinase 1 [Zea mays] 5 mays 03 0 Oryz a 8 sativ 1 a EE 5 Japo E6 543 3 nica 524 986 hypothetical protein OsJ_20418 [Oryza sativa 2 Grou 26 5 60 Japonica Group] 7 P 04 0 Hord eum 8 vulga 0 re BA 2 subs K0 326 7 P - 610 499 6 vulga 26 40 8 234 predicted protein [Hordeum vulgare subsp. vulgare] 4 re 05 53 0 Oryz a 7 sativ 6 a EA 2 Indie Y9 543 5 a 998 625 hypothetical protein OsI_21985 [Oryza sativa Indica 6 Grou 26 1 48 Group] 3 P 06 XP _oo hypothetical protein SORBIDRAFT_01g041990 Sorg 246 242 [Sorghum bicolor] >gil241922072lgblEER95216. 1l hum 821 041 hypothetical protein SORBIDRAFT_01g041990 bicol 26 40 8 646 [Sorghum bicolor] 1 or 07 54 0

9 NP 6 _oo 2 115 226 LOC100283999 [Zea mays] 0 036 490 >gill95638716lgblACG38826. 1lmaf-like protein 8 Zea 26 40 9 909 CV_0124 [Zea mays] 5 mays 08 55 0 Hord eum 9 vulga 1 re 4 subs BA 326 6 P - J91 505 9 vulga 26 40 214 949 predicted protein [Hordeum vulgare subsp. vulgare] 2 re 09 56 AB 108 Maf family protein, putative, expressed [Oryza sativa 0 Oryz 26 40

0

8 XP 0 _oo hypothetical protein SORBIDRAFT_10g025690 9 Sorg 243 242 [Sorghum bicolor] >gil241915592lgblEER88736. 1l 6 hum 736 093 hypothetical protein SORBIDRAFT_10g025690 7 bicol 26 40 9 757 [Sorghum bicolor] 2 or 26 7 1 0

7 XP 9 _oo hypothetical protein SORBIDRAFT_07g0163 10 8 Sorg 244 242 [Sorghum bicolor] >gil24 194 1761IgblEES 14906. 11 7 hum 541 081 hypothetical protein SORBIDRAFT_07g0163 10 5 bicol 26 40 1 284 [Sorghum bicolor] 2 or 27 72 0

7 NP hypothetical protein LOCI 00 19 1479 [Zea mays] 9 _oo >gill94688986lgblACF78577. 11unknown [Zea 4 113 212 mays] >gi 11956 14790lgb 1ACG29225 .11 0 038 275 transmembrane 9 superfamily protein member 2 7 Zea 26 40 3 585 precursor [Zea mays] 2 mays 28 73 0

7 XP 9 Ricin _oo Endosomal P24A protein precursor, putative [Ricinus 2 us 252 255 communis] >gil22353 1130lgblEEF32978. 11 5 com 938 576 Endosomal P24A protein precursor, putative [Ricinus 1 muni 26 40 2 994 communis] 2 s 29 74 AC R3 238 813 014 Zea 26 40 9 207 unknown [Zea mays] 1 mays 30 75 0

9 8 AC 7 G2 195 3 603 608 0 Zea 26 40 0 399 homeobox domain containing protein [Zea mays] 2 mays 31 76 0

8 XP 7 _oo hypothetical protein SORBIDRAFT_01g036670 3 Sorg 246 242 [Sorghum bicolor] >gil241919189lgblEER92333. 1l 0 hum 533 035 hypothetical protein SORBIDRAFT_01g036670 1 bicol 26 40 5 880 [Sorghum bicolor] 6 or 32 77 NP Os03g0325600 [Oryza sativa Japonica Group] 0 Oryz _oo >gi 1122247076lsp I 10M29 .11WOX6_OR YSJ a 104 115 RecName: Full=WUSCHEL-related homeobox 6; 7 sativ 998 452 AltName: Full=OsWOX6 0 a 26 40 5 768 >gill08707914lgblABF95709. 1lHomeobox 4 Japo 33 78 domain containing protein, expressed [Oryza sativa 7 nica Japonica Group] >gill l3548456ldbjlBAFl 1899. 11 6 Grou Os03g0325600 [Oryza sativa Japonica Group] 2 P 0 Oryz a 7 sativ 0 a RecName: Full=WUSCHEL-related homeobox 6; 4 Indie A2 AltName: Full=OsWOX6 7 a XG >gill25543698lgblEAY89837. 11hypothetical 6 Grou 26 77 protein OsI_l 1385 [Oryza sativa Indica Group] 2 P 34 hypothetical protein LOC100191945 [Zea mays] NP >gill94690250lgblACF79209. 11unknown [Zea _oo mays] >gil 195636434lgbl ACG37685 .11 113 212 hypothetical protein [Zea mays] 084 276 >gil 195640568 IgblACG39752. 11hypothetical Zea 26 40 1 171 protein [Zea mays] 1 mays 35 79 0

8 NP 9 _oo 1 114 226 hypothetical protein LOCI 002773 15 [Zea mays] 3 438 531 >gil 19564 1390lgblACG40 163.11hypothetical 0 Zea 26 40 7 256 protein [Zea mays] 4 mays 36 80 0 Oryz a 7 sativ 9 a EE 1 Japo E6 543 9 nica 774 986 hypothetical protein OsJ_2543 1 [Oryza sativa 2 Grou 26 0 60 Japonica Group] 5 P 37 0 Oryz a 7 sativ 8 a EA 5 Indie Z O 543 7 a 500 625 hypothetical protein Osl_27180 [Oryza sativa Indica 1 Grou 26 0 48 Group] 4 P 38 0 Oryz a 7 sativ 8 a BA 2 Japo C I 227 unknown protein [Oryza sativa Japonica Group] 6 nica 547 756 >gil505 10 136ldbj IB AD3 1101 .11unknown protein 0 Grou 26 40 4 14 [Oryza sativa Japonica Group] 9 P 39 8 1 0 Hord eum 7 vulga 4 re 2 subs BA 326 2 P J85 495 3 vulga 26 40 816 439 predicted protein [Hordeum vulgare subsp. vulgare] 6 re 40 82 0 Hord eum 7 vulga 4 re 2 subs BA 326 2 P J87 5 13 3 vulga 26 40 777 5 15 predicted protein [Hordeum vulgare subsp. vulgare] 6 re 4 1 83 XP 5 _oo hypothetical protein SORBIDRAFT_01g033670 Sorg - 246 242 [Sorghum bicolor] >gil24 19 19043 lgblEER92 187. 11 hum 8 5 18 035 hypothetical protein SORBIDRAFT_01g033670 bicol 26 40 9 588 [Sorghum bicolor] 1 or 42 84 8 AA - V6 557 1 421 410 Zea 26 40 4 72 stk [Zea mays] 1 mays 43 85 0 Oryz a 7 sativ 0 a EE 7 Indie C7 543 9 a 414 625 hypothetical protein Osl_09217 [Oryza sativa Indica 5 Grou 26 3 48 Group] 3 P 44 0 Oryz Os02g0787200 [Oryza sativa Japonica Group] a >gil47497167ldbjlBAD19215. 11putative serine 7 sativ NP threonine kinase [Oryza sativa Japonica Group] 0 a _oo >gil47497752ldbj IB AD19852. i lputative serine 6 Japo 104 115 threonine kinase [Oryza sativa Japonica Group] 6 nica 834 449 >gill 1353787 1Idbj IB AF10254. 11Os02g0787200 4 Grou 26 40 0 120 [Oryza sativa Japonica Group] 9 P 45 86 NP 9 _oo 114 226 lectin-like receptor kinase 7 [Zea mays] 1 783 528 >gill95614030lgblACG28845. 1l lectin-like Zea 26 40 5 692 receptor kinase 7 [Zea mays] 1 mays 46 87 0

8 XP 6 _oo hypothetical protein SORBIDRAFT_01g003030 0 Sorg 246 242 [Sorghum bicolor] > ;gi124 19 17475 IgbIEER906 19. 11 7 hum 362 032 hypothetical protein SORBIDRAFT_01g003030 0 bicol 26 40 1 452 [Sorghum bicolor] 4 or 47 88 XP 6 _oo hypothetical protein SORBIDRAFT_01g034030 Sorg - 246 242 [Sorghum bicolor] >gil241921640lgblEER94784. 1l hum 9 778 040 hypothetical protein SORBIDRAFT_01g034030 bicol 26 40 6 782 [Sorghum bicolor] 1 or 48 89 0 NP _oo 9 114 226 hypothetical protein LOCI 00273224 [Zea mays] 0 113 530 >gill94702834lgblACF85501 .11unknown [Zea 3 Zea 26 40 8 821 mays] 3 mays 49 90

1 7 4 0 Oryz a 7 sativ 1 a EA 7 Indie Z O 543 9 a 196 625 hypothetical protein Osl_24000 [Oryza sativa Indica 4 Grou 26 8 48 Group] 9 P 66 putative microtubule-associated protein [Oryza sativa 0 Oryz Japonica Group] >gil52077384ldbj IBAD46424. i l a putative microtubule-associated protein [Oryza sativa 7 sativ Japonica Group] >gill25598 116lgblEAZ37896. 1l 1 a BA hypothetical protein OsJ_22246 [Oryza sativa 7 Japo D4 471 Japonica Group] >gil215695 188ldbjlBAG90379.1l 9 nica 584 697 unnamed protein product [Oryza sativa Japonica 4 Grou 26 4 1 8 81 Group] 9 P 67 04 NP _oo 118 308 hypothetical protein LOCI 00502371 [Zea mays] 377 081 >gill8092335lgblAAL59227. 1IAF448416_5 serine Zea 26 4 1 8 574 threonine kinase [Zea mays] 1 mays 68 05 XP _oo hypothetical protein SORBIDRAFT_10g003930 Sorg 243 242 [Sorghum bicolor] >gil241916084lgblEER89228.11 hum 786 094 hypothetical protein SORBIDRAFT_10g003930 bicol 26 4 1 1 741 [Sorghum bicolor] 1 or 69 06 0

8 9 AC 1 N3 223 0 161 974 0 Zea 26 4 1 6 856 unknown [Zea mays] 8 mays 70 07 0

8 NP 9 _oo hypothetical protein LOC100382365 [Zea mays] 9 116 293 >gil223944685lgblACN26426. 11unknown [Zea 1 858 337 mays] >gil223949323lgblACN28745.11unknown 8 Zea 26 4 1 1 218 [Zea mays] 3 mays 7 1 08 0 Oryz a 8 sativ 2 a EE 5 Japo E6 543 6 nica 512 986 hypothetical protein OsJ_20187 [Oryza sativa 1 Grou 26 1 60 Japonica Group] 3 P 72 0 Hord BA 326 predicted protein [Hordeum vulgare subsp. vulgare] eum J90 494 >gil326494274ldbj IBAJ90406. i lpredicted protein 8 vulga 26 4 1 380 221 [Hordeum vulgare subsp. vulgare] 0 re 73 09

805 336 7 glom 0 8 erata 6 7 4 4 0 Oryz a 7 sativ 8 a BA 9 Japo G9 329 6 nica 091 784 unnamed protein product [Oryza sativa Japonica 2 Grou 26 4 1 9 77 Group] 5 P 82 18 0 Hord eum 7 vulga papain-like cysteine proteinase [Hordeum vulgare 4 re CA subsp. vulgare] >gil3264885 19ldbjlBAJ93928. 1l 3 subs Q0 194 predicted protein [Hordeum vulgare subsp. vulgare] 5 P - Oi l 352 >gil326508 126ldbj IB AJ99330. i lpredicted protein 1 vulga 26 4 1 2 767 [Hordeum vulgare subsp. vulgare] 6 re 83 19 Hord 0 eum vulga cathepsin B [Hordeum vulgare subsp. vulgare] 7 re CA >gil326494236ldbj IBAJ90387. i lpredicted protein 4 subs C8 406 [Hordeum vulgare subsp. vulgare] 9 P - 372 432 >gil326499864ldbj IBAJ90767. i lpredicted protein 2 vulga 26 4 1 0 49 [Hordeum vulgare subsp. vulgare] 8 re 84 20 0 Hord eum 7 vulga predicted protein [Hordeum vulgare subsp. vulgare] 3 re >gil326508404ldbj IBAJ99469. i lpredicted protein 7 subs BA 326 [Hordeum vulgare subsp. vulgare] 7 P - J90 490 >gil3265 14912ldbj IB AJ998 17. i lpredicted protein 5 vulga 26 4 1 118 901 [Hordeum vulgare subsp. vulgare] 2 re 85 2 1 0

7 CA 3 Tritic A4 4 um 681 216 8 aesti 26 4 1 0 92 cathepsin B [Triticum aestivum] 7 vum 86 22 0

7 1 CA 7 Tritic A4 5 um 681 216 7 aesti 26 4 1 1 98 cathepsin B [Triticum aestivum] 9 vum 87 23 NP _oo 226 hypothetical protein LOCI 002797 18 [Zea mays] 114 505 >gil219885973lgblACL53361 .11unknown [Zea Zea 26 4 1 614 901 mays] 1 mays 88 24 9 0

8 XP 0 _oo hypothetical protein SORBIDRAFT_02g041560 2 Sorg 246 242 [Sorghum bicolor] >gil241926687lgblEER9983 1.11 4 hum 33 1 05 1 hypothetical protein SORBIDRAFT_02g041560 1 bicol 26 4 1 0 13 1 [Sorghum bicolor] 9 or 89 25 NP _oo 114 226 hypothetical protein LOCI 00276723 [Zea mays] 391 500 >gill95629462lgblACG36372. 11hypothetical Zea 26 4 1 5 557 protein [Zea mays] 1 mays 90 26 0

9 XP 4 _oo hypothetical protein SORBIDRAFT_03g037170 8 Sorg 245 242 [Sorghum bicolor] >gil241930613lgblEES03758. 1l 1 hum 863 058 hypothetical protein SORBIDRAFT_03g037170 7 bicol 26 4 1 8 984 [Sorghum bicolor] 1 or 9 1 27 0

8 NP 3 _oo 8 114 226 hypothetical protein LOCI 00277579 [Zea mays] 4 457 528 >gill95643964lgblACG41450. 11hypothetical 1 Zea 26 4 1 0 574 protein [Zea mays] 5 mays 92 28 0 Oryz a 8 sativ 4 a EA 4 Indie Y7 543 5 a 615 625 hypothetical protein Osl_04089 [Oryza sativa Indica 1 Grou 26 6 48 Group] 2 P 93 Os01g0800300 [Oryza sativa Japonica Group] >gill9570984ldbj IB AB8641 1.11unknown protein [Oryza sativa Japonica Group] >gil20804736ldbj IBAB92422. i lunknown protein [Oryza sativa Japonica Group] >gil 113534063 Idbj IB AF06446. 11OsO 1g0800300 [Oryza sativa Japonica Group] >gil215704187ldbj IBAG93027. i lunnamed protein 0 Oryz product [Oryza sativa Japonica Group] a >gil2157048 15ldbjlBAG94843. 11unnamed protein 8 sativ NP product [Oryza sativa Japonica Group] 4 a _oo >gil2157048 19ldbj IBAG94847. i lunnamed protein 4 Japo 104 115 product [Oryza sativa Japonica Group] 5 nica 453 440 >gil215741020ldbjlBAG975 15. 11unnamed protein 1 Grou 26 4 1 2 504 product [Oryza sativa Japonica Group] 2 P 94 29 BA 0 Hord KO 326 eum 682 5 13 7 vulga 26 4 1 2 163 predicted protein [Hordeum vulgare subsp. vulgare] 8 re 95 30

57 117 350 mays] 5 019 7 NP 52 _oo 6- 110 162 putative growth-regulating factor 3 [Zea mays] 54 602 461 >gill46008369lgblABQ01216. 11putative growth- Zea 27 4 1 7 2 199 regulating factor 3 [Zea mays] 1 mays 10 43 0

AC 9 G4 195 8 241 645 2 Zea 27 4 1 0 883 atGRF5 [Zea mays] 5 mays 11 44 XP 0 _oo hypothetical protein SORBIDRAFT_04g034800 Sorg 245 242 [Sorghum bicolor] >gil241934482lgblEES07627. 1l 8 hum 465 066 hypothetical protein SORBIDRAFT_04g034800 0 bicol 27 4 1 1 723 [Sorghum bicolor] 5 or 12 45 Oryz a sativ NP Os02g0776900 [Oryza sativa Japonica Group] 0 a _oo >gil5 103983 l ltpgIDAA05205. i lTPA_exp: growth- Japo 104 115 regulating factor 1 [Oryza sativa (japonica cultivar- 7 nica 828 449 group)] >gill l3537819ldbjlBAF10202. 1l 2 Grou 27 4 1 8 016 Os02g0776900 [Oryza sativa Japonica Group] 5 P 13 46 0

AA 7 Oryz F l 657 growth-regulating factor 1 [Oryza sativa] 2 a 756 314 >gill25541338lgblEAY87733. 11hypothetical 7 sativ 27 4 1 7 8 protein Osl_09149 [Oryza sativa Indica Group] 5 a 14 47 0 NP _oo 7 110 162 putative growth-regulating factor 9 [Zea mays] 1 602 461 >gill46008476lgblABQ01222. 11putative growth- 2 Zea 27 4 1 7 967 regulating factor 9 [Zea mays] 5 mays 15 48 XP 25 _oo hypothetical protein SORBIDRAFT_01g033670 Sorg 7- 246 242 [Sorghum bicolor] >gil24 19 19043 lgblEER92 187. 11 hum 27 5 18 035 hypothetical protein SORBIDRAFT_01g033670 bicol 27 4 1 8 9 588 [Sorghum bicolor] 1 or 16 49 Predi cted NP siRN 24 _oo A 7- 110 162 sigma factor protein [Zea mays] 5665 27 5 18 463 >gil20159761 lgblAAM12034. 1l sigma factor Zea 27 4 1 8 0 5 524 protein [Zea mays] 1 mays 17 50 0

9 AC 2 N3 223 4 202 975 2 Zea 27 4 1 8 680 unknown [Zea mays] 9 mays 18 5 1 6 0

7 XP 2 _oo hypothetical protein SORBIDRAFT_09g030350 7 Sorg 244 242 [Sorghum bicolor] >gil241945647lgblEES 18792. 1l 1 hum 036 089 hypothetical protein SORBIDRAFT_09g030350 1 bicol 27 4 1 2 058 [Sorghum bicolor] 3 or 19 52 Predi cted NP siRN 17 _oo A 0- 114 226 LOCI 0028 1472 [Zea mays] 5688 19 786 497 >gill95614188lgblACG28924. 1ltransparent testa Zea 27 4 1 5 1 2 613 12 protein [Zea mays] 1 mays 20 53 0 Hord eum 7 vulga 7 re 8 subs BA 326 predicted protein [Hordeum vulgare subsp. vulgare] 4 P - J87 511 >gil326521392ldbj IB AJ96899. i lpredicted protein 6 vulga 27 4 1 592 155 [Hordeum vulgare subsp. vulgare] 8 re 2 1 54 XP 48 _oo hypothetical protein SORBIDRAFT_01g036050 Sorg 3- 246 242 [Sorghum bicolor] >gil24 192175 1lgblEER94895.11 hum 50 789 041 hypothetical protein SORBIDRAFT_01g036050 bicol 27 4 1 4 7 004 [Sorghum bicolor] 1 or 22 55 0

9 NP 4 _oo hypothetical protein LOCI 00279541 [Zea mays] 5 114 226 >gil2198853 17lgblACL53033. 11unknown [Zea 3 601 508 mays] >gil223944401 lgblACN26284. 11unknown 4 Zea 27 4 1 0 499 [Zea mays] 2 mays 23 56 0 Oryz RecName: Full=Putative potassium transporter 8; a AltName: Full=OsHAK8 8 sativ >gill08708033lgblABF95828. 11Potassium 8 a transporter 2, putative, expressed [Oryza sativa 0 Japo Q8 Japonica Group] >gill2558618 1lgblEAZ26845. 1l 7 nica VX hypothetical protein OsJ_ 10761 [Oryza sativa 4 Grou 27 B5 Japonica Group] 5 P 24 0 Oryz a 8 sativ 7 a EA 9 Indie Y8 543 5 a 992 625 hypothetical protein OsI_l 1472 [Oryza sativa Indica 0 Grou 27 4 48 Group] 3 P 25 NP Os07g0679000 [Oryza sativa Japonica Group] 0 Oryz _oo >gil75232649lsplQ7XIV8. 1IHAK9_ORYSJ a 106 115 RecName: Full=Probable potassium transporter 9; 8 sativ 063 474 AltName: Full=OsHAK9 0 a 27 4 1 7 076 >gill8250702lemblCAD20999. 1lputative potasium 7 Japo 26 57 transporter [Oryza sativa Japonica Group] 4 nica >gil33 146437ldbj IBAC79545. i lputative potassium 5 Grou transporter [Oryza sativa Japonica Group] 3 P >gil 1136 12 173Idbj IB AF2255 1.11Os07g0679000 [Oryza sativa Japonica Group] >gill25559610lgblEAZ05 146. 11hypothetical protein Osl_27340 [Oryza sativa Indica Group] 0

8 0 Phra BA 4 gmit E9 912 9 es 316 047 6 austr 27 4 1 0 11 potassium transporter [Phragmites australis] 9 alis 27 58 0

8 0 Phra BA 3 gmit E9 912 7 es 3 15 047 2 austr 27 4 1 9 09 potassium transporter [Phragmites australis] 7 alis 28 59 0

8 0 Phra BA 7 gmit E9 912 4 es 3 15 047 5 austr 27 4 1 8 07 potassium transporter [Phragmites australis] 3 alis 29 60 0 Oryz a 7 sativ 8 a EA 1 Japo Z4 543 3 nica 109 986 hypothetical protein OsJ_25584 [Oryza sativa 6 Grou 27 2 60 Japonica Group] 6 P 30 0 Hord eum 7 vulga 6 re 2 subs BA 326 predicted protein [Hordeum vulgare subsp. vulgare] 7 P - J87 5 13 >gil326525935ldbj IB AJ93 144. i lpredicted protein 3 vulga 27 4 1 873 707 [Hordeum vulgare subsp. vulgare] 3 re 31 6 1 XP _oo hypothetical protein SORBIDRAFT_10g024660 Sorg 243 242 [Sorghum bicolor] >gil24 19 16924lgblEER90068 .11 hum 870 096 hypothetical protein SORBIDRAFT_10g024660 bicol 27 4 1 1 421 [Sorghum bicolor] 1 or 32 62 NP 0 _oo 114 226 potassium transporter 10 [Zea mays] 9 747 504 >gil 1956 11632lgblACG27646. 11potassium 3 Zea 27 4 1 2 5 15 transporter 10 [Zea mays] 7 mays 33 63 8 0 5 0 Hord eum 8 vulga 3 re BA 1 subs K0 326 7 P 349 5 15 0 vulga 27 4 1 5 163 predicted protein [Hordeum vulgare subsp. vulgare] 7 re 34 64 0 Oryz a 8 sativ 2 a CA 0 Japo D2 182 7 nica 100 507 putative potasium transporter [Oryza sativa Japonica 3 Grou 27 4 1 0 03 Group] 2 P 35 65 Os06g0625900 [Oryza sativa Japonica Group] >gil62900352lsplQ67VS5. 1IHAK10_ORYSJ 0 Oryz RecName: Full=Potassium transporter 10; AltName: a Full=OsHAK10 >gill8250690lemblCAD20993. 1l 8 sativ NP putative potasium transporter [Oryza sativa Japonica 2 a _oo Group] >gil5 1535727ldbjlBAD37744. 1lputative 8 Japo 105 115 potassium transporter KUP3p [Oryza sativa Japonica 0 nica 811 469 Group] >gil 113596 156ldbj IB AF20030. 11 4 Grou 27 4 1 6 033 Os06g0625900 [Oryza sativa Japonica Group] 9 P 36 66 CA N7 123 0 Vitis 589 699 vinif 27 5 834 hypothetical protein VITISV_038658 [Vitis vinifera] 7 era 37 XP _oo hypothetical protein SORBIDRAFT_02g042930 Sorg 246 242 [Sorghum bicolor] >gil241926764lgblEER99908. 11 hum 338 05 1 hypothetical protein SORBIDRAFT_02g042930 bicol 27 4 1 7 285 [Sorghum bicolor] 1 or 38 67 0

9 NP hypothetical protein LOC100273533 [Zea mays] 3 _oo >gill94704534lgblACF8635 1.11unknown [Zea 4 114 226 mays] >gil223945057lgblACN26612. 11unknown 3 142 503 [Zea mays] >gil223948037lgblACN28 102. 1l 4 Zea 27 4 1 3 931 unknown [Zea mays] 3 mays 39 68 Oryz a sativ a AB protein kinase family protein, putative, expressed Japo A9 108 [Oryza sativa Japonica Group] nica 586 862 >gil215769321 ldbj IB AH01550. i lunnamed protein Grou 27 9 058 product [Oryza sativa Japonica Group] 1 P 40 EE 0 Oryz E5 543 a 281 986 hypothetical protein OsJ_35327 [Oryza sativa 9 sativ 27 8 60 Japonica Group] 5 a 4 1

4 4 1 0

7 XP 1 _oo hypothetical protein SORBIDRAFT_05g003840 6 Sorg 244 242 [Sorghum bicolor] >gil24193488 1lgblEES08026. 1l 6 hum 903 067 hypothetical protein SORBIDRAFT_05g003840 9 bicol 27 4 1 8 522 [Sorghum bicolor] 8 or 49 75 Oryz a sativ a 1 EE Japo - E6 543 nica 4 887 986 hypothetical protein OsJ_27688 [Oryza sativa Grou 27 6 60 Japonica Group] 1 P 50 0 Oryz a 9 sativ 9 a EE 7 Indie C8 543 4 a 375 625 hypothetical protein OsI_29621 [Oryza sativa Indica 3 Grou 27 3 48 Group] 6 P 51 XP 3 _oo hypothetical protein SORBIDRAFT_09g021 160 Sorg - 244 242 [Sorghum bicolor] >gil241946426lgblEES 19571 .1l hum 5 114 090 hypothetical protein SORBIDRAFT_09g021 160 bicol 27 4 1 1 616 [Sorghum bicolor] 1 or 52 76 0

9 NP 0 _oo 6 110 162 potassium channel protein ZMK2 [Zea mays] 9 5 12 461 >gil583078 1lemblCAB54856. 11potassium channel 2 Zea 27 4 1 0 887 protein ZMK2 [Zea mays] 1 mays 53 77 0

8 NP 9 _oo 6 114 226 potassium channel AKT2/3 [Zea mays] 1 779 503 >gill95613792lgblACG28726. 1lpotassium channel 8 Zea 27 4 1 6 366 AKT2/3 [Zea mays] 1 mays 54 78 0

8 XP 7 _oo hypothetical protein SORBIDRAFT_09g021210 2 Sorg 244 242 [Sorghum bicolor] >gil241946430lgblEES 19575. 11 3 hum 114 090 hypothetical protein SORBIDRAFT_09g021210 1 bicol 27 4 1 5 624 [Sorghum bicolor] 5 or 55 79 XP 242 hypothetical protein SORBIDRAFT_09g021 190 0 Sorg 27 4 1 _oo 090 [Sorghum bicolor] >gil241946428lgblEES 19573. 11 hum 56 80 244 620 hypothetical protein SORBIDRAFT_09g021 190 8 bicol 114 [Sorghum bicolor] 7 or 3 4 7 0 2 0 Oryz a 7 sativ RecName: Full=Potassium channel AKT2 9 a >gil46391 141 lgblAAS90668. 11putative potassium 1 Japo Q7 channel protein [Oryza sativa Japonica Group] 1 nica 5H >gil22263 1670lgblEEE63802. 11hypothetical 6 Grou 27 P9 protein OsJ_18626 [Oryza sativa Japonica Group] 9 P 57 0 Oryz a 7 sativ 9 a EA 1 Indie Y9 543 1 a 8 13 625 hypothetical protein Osl_20054 [Oryza sativa Indica 6 Grou 27 9 48 Group] 9 P 58 0

7 AB inwardly rectifying potassium channel AKT2 4 Hord E9 931 [Hordeum vulgare] 8 eum 981 387 >gil326499398ldbj IB AJ86010. i lpredicted protein 2 vulga 27 4 1 1 32 [Hordeum vulgare subsp. vulgare] 1 re 59 8 1 0 Hord eum 7 vulga 4 re 7 subs BA 326 0 P - J86 507 1 vulga 27 4 1 681 875 predicted protein [Hordeum vulgare subsp. vulgare] 7 re 60 82 0 Hord eum 7 vulga 4 re 7 subs BA 326 0 P - J96 523 1 vulga 27 4 1 949 876 predicted protein [Hordeum vulgare subsp. vulgare] 7 re 6 1 83 Oryz Os08g0480000 [Oryza sativa Japonica Group] a >gil42408579ldbj IBAD09756. i lputative ripening sativ 13 NP regulated protein [Oryza sativa Japonica Group] a 74 _oo >gil 113624025 Idbj IB AF23970. 11Os08g0480000 Japo 106 115 [Oryza sativa Japonica Group] nica 13 205 476 >gil215695384ldbjlBAG90575. 11unnamed protein Grou 27 4 1 95 6 919 product [Oryza sativa Japonica Group] 1 P 62 84 Predi 2 1 AC 237 cted 3- R3 908 Zea 27 4 1 siRN 23 378 822 cytochrome P450 monooxygenase [Zea mays] 1 mays 63 85

J90 494 >gil326527807ldbj IBAJ88976. i lpredicted protein eum 70 9 1 421 303 [Hordeum vulgare subsp. vulgare] 9 vulga 2 re 5 subs 5 P - 3 vulga 2 re Chain R, Localization Of The Large Subunit 0 Ribosomal Proteins Into A 5.5 A Cryo-Em Map Of Triticum Aestivum Translating 80s Ribosome 9 >gil3 15 113257lpdbl3IZRIR Chain R, Localization 2 Of The Large Subunit Ribosomal Proteins Into A 5.5 0 Tritic 3IZ A Cryo-Em Map Of Triticum Aestivum Translating 2 um 5_ 80s Ribosome >gil57471708lgblAAW50985. 1l 1 aesti 27 R ribosomal protein L I 8 [Triticum aestivum] 3 vum 7 1 0

XP 9 _oo hypothetical protein SORBIDRAFT_02g042750 3 Sorg 246 242 [Sorghum bicolor] >gil241924578lgblEER97722. 11 6 hum 120 046 hypothetical protein SORBIDRAFT_02g042750 1 bicol 27 4 1 1 909 [Sorghum bicolor] 7 or 72 92 0

9 XP 4 _oo hypothetical protein SORBIDRAFT_01g035860 1 Sorg 246 242 [Sorghum bicolor] >gil241919156lgblEER92300. 1l 4 hum 530 035 hypothetical protein SORBIDRAFT_01g035860 8 bicol 27 4 1 2 814 [Sorghum bicolor] 9 or 73 93 0

NP hypothetical protein LOCI 00 192878 [Zea mays] 9 _oo >gill95606022lgblACG24841 .1l 60S ribosomal 3 113 212 protein L I 8 [Zea mays] 6 153 721 >gi 11956202 12lgblACG3 1936. 1160S ribosomal 1 Zea 27 4 1 8 317 protein L I 8 [Zea mays] 7 mays 74 94 Os03g0341 100 [Oryza sativa Japonica Group] >gill08708066lgblABF95861 .1l 60S ribosomal 0 Oryz protein L I 8, putative, expressed [Oryza sativa a Japonica Group] >gill l3548540ldbjlBAF1 1983. 1l 9 sativ NP Os03g0341 100 [Oryza sativa Japonica Group] 0 a _oo >gil218 192805 lgblEEC75232. 11hypothetical 9 Japo 105 115 protein OsI_l 1506 [Oryza sativa Indica Group] 5 nica 006 452 >gil222624903lgblEEE59035. 11hypothetical 7 Grou 27 4 1 9 936 protein OsJ_10788 [Oryza sativa Japonica Group] 4 P 75 95 Os07g0674700 [Oryza sativa Japonica Group] >gil34393858ldbj IBAC83538. i lputative cytoplasmic ribosomal protein L I 8 [Oryza sativa Japonica Group] >gil505098 11Idbj IB AD3 1974. 11 0 Oryz putative cytoplasmic ribosomal protein L I 8 [Oryza a sativa Japonica Group] 8 sativ NP >gi 11136 12 153Idbj IB AF225 31.11Os07g0674700 9 a _oo [Oryza sativa Japonica Group] 8 Japo 106 115 >gill25559582lgblEAZ05 118. 11hypothetical 9 nica 061 474 protein OsI_273 11 [Oryza sativa Indica Group] 3 Grou 27 4 1 7 036 >gil215694724ldbjlBAG89915. 11unnamed protein 6 P 76 96

3 0 Hord eum 7 vulga 6 re 2 subs BA 326 9 P - J93 526 6 vulga 28 42 188 022 predicted protein [Hordeum vulgare subsp. vulgare] 3 re 07 22 0

7 6 Dasy AE serine/threonine protein kinase Stpk-V [Dasypyrum 0 pyru F3 333 villosum] >gil333384997lgblAEF30547. 11 4 m 054 384 serine/threonine protein kinase Stpk-V [Dasypyrum 9 villos 28 42 6 994 villosum] 4 um 08 23 0

7 6 AE 0 Tritic F3 333 4 um 054 384 serine/threonine protein kinase Stpk-A [Triticum 9 aesti 28 42 8 998 aestivum] 4 vum 09 24 Os02g0165 100 [Oryza sativa Japonica Group] >gil49388058ldbj IB AD25 172. i lputative receptor 0 Oryz protein kinase PERK [Oryza sativa Japonica Group] a >gil49388415ldbjlBAD25548. 11putative receptor 7 sativ NP protein kinase PERK [Oryza sativa Japonica Group] 4 a _oo >gil113535526ldbj IB AF07909. 11Os02g0 165 100 5 Japo 104 115 [Oryza sativa Japonica Group] 6 nica 599 444 >gil215694876ldbj IBAG90067.i lunnamed protein 7 Grou 28 42 5 430 product [Oryza sativa Japonica Group] 9 P 10 25 Oryz 0 a sativ 7 a EE 4 Japo E5 543 3 nica 637 986 hypothetical protein OsJ_05508 [Oryza sativa 2 Grou 28 1 60 Japonica Group] 1 P 11 Oryz a sativ a EE Japo E5 543 nica 613 986 hypothetical protein OsJ_05018 [Oryza sativa Grou 28 8 60 Japonica Group] 1 P 12 Os02g0 104700 [Oryza sativa Japonica Group] 0 Oryz >gil75 131025lsplQ6YPG5.1INOS_ORYSJ a NP RecName: Full=Putative nitric oxide synthase 9 sativ _oo >gil40363768ldbjlBAD06278. 11putative GTPase 8 a 104 115 [Oryza sativa Japonica Group] 8 Japo 561 443 >gil41052546ldbjlBAD07538. 11putative GTPase 2 nica 28 42 4 668 [Oryza sativa Japonica Group] 9 Grou 13 26

0 9 0

NP 9 _oo 3 114 226 hypothetical protein LOCI 00276574 [Zea mays] 8 380 505 >gill95627382lgblACG35521 .11hypothetical 8 Zea 28 42 2 329 protein [Zea mays] 3 mays 53 59 0 Oryz a 7 sativ 0 a BA 2 Japo D2 487 hydrolase-like protein [Oryza sativa Japonica Group] 1 nica 341 167 >gil50726197ldbj IB AD33716. i lhydrolase-like 2 Grou 28 42 5 14 protein [Oryza sativa Japonica Group] 8 P 54 60 0 Hord eum 7 vulga 4 re 4 subs BA 326 6 P - J92 516 8 vulga 28 42 435 559 predicted protein [Hordeum vulgare subsp. vulgare] 1 re 55 6 1 0 Oryz a 7 sativ 4 a EE hypothetical protein Osl_3 1065 [Oryza sativa Indica 2 Indie C8 543 Group] >gil222641433lgblEEE69565. 11 0 a 444 625 hypothetical protein OsJ_29077 [Oryza sativa 2 Grou 28 6 48 Japonica Group] 1 P 56 XP 57 _oo hypothetical protein SORBIDRAFT_03g041220 Sorg 7- 245 242 [Sorghum bicolor] >gil241928688lgblEES01833. 1l hum 59 671 055 hypothetical protein SORBIDRAFT_03g041220 bicol 28 42 7 3 134 [Sorghum bicolor] 1 or 57 62 0

7 NP 9 _oo 0 114 226 POT family protein [Zea mays] 3 759 506 >gill95612430lgblACG28045. 1lPOT family 5 Zea 28 42 9 121 protein [Zea mays] 3 mays 58 63 Predi cted 10 siRN 81 AC A R3 238 5874 11 793 013 Zea 28 42 0 00 9 807 unknown [Zea mays] 1 mays 59 64 NP 0 _oo 115 226 LOCI 00284401 [Zea mays] 9 076 495 >gi119564 1698 Igb1ACG403 17. 11ubiquitinating 9 Zea 28 42 8 128 enzyme [Zea mays] 6 mays 60 65

0 9 1 0

dihydrolipoyllysine-residue succinyltransferase 8 NP component of 2-oxoglutarate dehydrogenase complex 8 _oo [Zea mays] >gill95606476lgblACG25068. 1l 1 114 226 dihydrolipoyllysine-residue succinyltransferase 8 701 509 component of 2-oxoglutarate dehydrogenase complex 1 Zea 28 42 4 379 [Zea mays] 8 mays 68 7 1 0

8 2 AC 7 R3 238 2 867 015 7 Zea 28 42 2 273 unknown [Zea mays] 3 mays 69 72 0 Hord eum 8 vulga 1 re 3 subs BA 326 6 P - J96 5 12 3 vulga 28 42 018 073 predicted protein [Hordeum vulgare subsp. vulgare] 6 re 70 73 0 Oryz a 7 sativ 3 a BA 4 Japo D2 487 0 nica 299 163 putative 2-oxoglutarate dehydrogenase E2 subunit 9 Grou 28 42 2 67 [Oryza sativa Japonica Group] 1 P 7 1 74 Oryz Os01g0925300 [Oryza sativa Japonica Group] a >gil57899394ldbjlBAD88041 .11putative zisp sativ NP [Oryza sativa Japonica Group] a _oo >gil57900122ldbj IB AD88 184. i lputative zisp Japo 104 115 [Oryza sativa Japonica Group] nica 525 441 >gill l3534786ldbj IB AF07169. i lOs01g0925300 Grou 28 42 t 5 950 [Oryza sativa Japonica Group] 1 P 72 75 0 Oryz a 9 sativ 6 a EA 1 Japo Z l 543 2 nica 468 986 hypothetical protein OsJ_04607 [Oryza sativa 5 Grou 28 3 60 Japonica Group] 9 P 73 0 Oryz a BA 9 sativ B8 201 4 a 965 607 9 Japo 28 42 8 11 P0482D04.5 [Oryza sativa Japonica Group] 1 nica 74 76

846 [Sorghum bicolor] 0 or 2 1 9 0 3 4 AC N3 223 0 066 972 Zea 28 42 4 952 unknown [Zea mays] 1 mays 90 89 dihydrolipoyllysine-residue succinyltransferase NP component of 2-oxoglutarate dehydrogenase complex 2 _oo [Zea mays] >gill95640766lgblACG3985 1.1l - 115 226 dihydrolipoyllysine-residue succinyltransferase 4 063 532 component of 2-oxoglutarate dehydrogenase complex Zea 28 42 6 023 [Zea mays] 1 mays 9 1 90 XP 3 _oo hypothetical protein SORBIDRAFT_06g033040 Sorg - 244 242 [Sorghum bicolor] >gil241938512lgblEES l 1657. 11 hum 5 732 074 hypothetical protein SORBIDRAFT_06g033040 bicol 28 42 9 785 [Sorghum bicolor] 1 or 92 9 1 0

9 1 AC 2 N2 223 5 658 944 4 Zea 28 42 1 994 unknown [Zea mays] 8 mays 93 92 0

9 XP 0 _oo hypothetical protein SORBIDRAFT_06g020130 1 Sorg 244 242 [Sorghum bicolor] >gil241939227lgblEES 12372. 11 1 hum 804 076 hypothetical protein SORBIDRAFT_06g020130 4 bicol 28 42 4 215 [Sorghum bicolor] 1 or 94 93 0

9 1 AD 2 T9 315 5 220 259 N-acetylglucosaminyl-phosphatidylinositol de-N- 4 Zea 28 42 2 985 acetylase-like protein [Zea mays] 8 mays 95 94 0 Hord eum 8 vulga 0 re 2 subs BA 326 2 P J97 488 8 vulga 28 42 962 700 predicted protein [Hordeum vulgare subsp. vulgare] 1 re 96 95 0 Oryz EE a C7 543 7 sativ 825 625 hypothetical protein OsI_17935 [Oryza sativa Indica 8 a 28 8 48 Group] 7 Indie 97 putat ve potass um e ux system am y prote n ea ea T9 259 mays] mays 14 219 985 9 2 9 0 3 0 8 0

8 XP 8 _oo hypothetical protein SORBIDRAFT_06g0333 10 1 Sorg 244 242 [Sorghum bicolor] >gil241939977lgblEES 13 122. 11 9 hum 879 077 hypothetical protein SORBIDRAFT_06g0333 10 3 bicol 29 43 4 715 [Sorghum bicolor] 8 or 15 11 0 Oryz Os04g0682800 [Oryza sativa Japonica Group] a >gil38345563lemblCAE03437.2l 8 sativ NP OSJNBa0032F06.20 [Oryza sativa Japonica Group] 0 a _oo >gil113565870ldbj IB AF16213.11Os04g0682800 7 Japo 105 115 [Oryza sativa Japonica Group] 0 nica 429 461 >gil215768459ldbjlBAH00688. 11unnamed protein 4 Grou 29 43 9 397 product [Oryza sativa Japonica Group] 8 P 16 12 0 Hord eum 7 vulga 6 re 9 subs BA 326 1 P J87 5 13 6 vulga 29 43 826 613 predicted protein [Hordeum vulgare subsp. vulgare] 3 re 17 13 0 Hord eum 7 vulga 6 re 8 subs BA 326 2 P J89 487 8 vulga 29 43 683 397 predicted protein [Hordeum vulgare subsp. vulgare] 2 re 18 14 XP _oo hypothetical protein SORBIDRAFT_10g009750 Sorg 243 242 [Sorghum bicolor] >gil241915059lgblEER88203. 1l hum 683 092 hypothetical protein SORBIDRAFT_10g009750 bicol 29 43 6 691 [Sorghum bicolor] 1 or 19 15 NP _oo 114 226 hypothetical protein LOCI 00275501 [Zea mays] 303 529 >gil1956 13282lgblACG2847 1.11hypothetical Zea 29 43 3 719 protein [Zea mays] 1 mays 20 16 NP _oo 114 226 hypothetical protein LOCI 00275 344 [Zea mays] 291 498 >gil1956 11342lgblACG2750 1.11hypothetical Zea 29 43 2 003 protein [Zea mays] 1 mays 2 1 17 XP 242 hypothetical protein SORBIDRAFT_04g034580 0 Sorg _oo 063 [Sorghum bicolor] >gil241932729lgblEES05874. 1l hum 29 43 245 217 hypothetical protein SORBIDRAFT_04g034580 9 bicol 22 18

5 P 0 Oryz a 8 sativ 1 a EE 5 Indie C8 543 1 a 466 625 hypothetical protein OsI_3 1569 [Oryza sativa Indica 7 Grou 29 7 48 Group] 5 P 30 Predi cted XP siRN 44 _oo hypothetical protein SORBIDRAFT_04g032980 Sorg A 3- 245 242 [Sorghum bicolor] >gil241934372lgblEES075 17. 1l hum 5921 46 454 066 hypothetical protein SORBIDRAFT_04g032980 bicol 29 43 1 2 1 503 [Sorghum bicolor] 1 or 31 24 0

9 5 AC 1 R3 238 6 602 009 6 Zea 29 43 0 969 unknown [Zea mays] 7 mays 32 25 0

9 NP 4 _oo 8 114 226 cell division cycle protein 23 [Zea mays] 3 712 494 >gill95607482lgblACG25571 .1lcell division cycle 3 Zea 29 43 6 332 protein 23 [Zea mays] 3 mays 33 26 0 Oryz a 8 sativ 7 a EE 8 Indie C7 543 3 a 372 625 hypothetical protein Osl_08332 [Oryza sativa Indica 3 Grou 29 3 48 Group] 3 P 34 0 Oryz Os02g0656300 [Oryza sativa Japonica Group] a >gil49388560ldbj IBAD25679. i lputative cell 8 sativ NP division cycle protein 23 [Oryza sativa Japonica 7 a _oo Group] >gill l3537155ldbjlBAF09538. 1l 6 Japo 104 115 Os02g0656300 [Oryza sativa Japonica Group] 6 nica 762 447 >gil222623375lgblEEE57507. 11hypothetical 6 Grou 29 43 4 688 protein OsJ_07790 [Oryza sativa Japonica Group] 7 P 35 27 0 CA Oryz C3 141 8 a 907 401 anaphase-promoting complex subunit 8-like protein 7 sativ 29 43 0 12 [Oryza sativa] 5 a 36 28 0 Hord BA eum KO 326 8 vulga 365 517 8 re 29 43 7 476 predicted protein [Hordeum vulgare subsp. vulgare] 5 subs 37 29

_oo 469 >gil75 112500lsplQ5Z8 Y4. 1IUSP_ORYSJ a 59 48 105 765 RecName: Full=UDP-sugar pyrophosphorylase 8 sativ 848 >gil53792734ldbjlBAD53770. 1IUDP-N- 4 a 2 acetylglucosamine pyrophosphorylase-like [Oryza 9 Japo sativa Japonica Group] 8 nica >gil 113596522ldbj IB AF20396. 11Os06g070 1200 4 Grou [Oryza sativa Japonica Group] P >gil215686708ldbjlBAG88961 .11unnamed protein product [Oryza sativa Japonica Group] 0

NP 8 _oo 4 115 226 LOCI 00285949 [Zea mays] 9 231 501 >gil 195654965 IgblACG46950. 11UDP-sugar 8 Zea 29 43 0 637 pyrophospharylase [Zea mays] 4 mays 60 49 Oryz 0 a sativ 8 a EE 4 Indie C8 543 9 a 126 625 hypothetical protein OsI_24356 [Oryza sativa Indica 8 Grou 29 2 48 Group] 4 P 6 1 0 Oryz a 8 sativ 3 a EE 3 Japo E6 543 8 nica 630 986 hypothetical protein OsJ_22533 [Oryza sativa 6 Grou 29 2 60 Japonica Group] 6 P 62 0

RecName: Full=UDP-sugar pyrophospharylase; 7 AltName: Full=UDP-galactose/glucose 2 Q O pyrophosphorylase; Short=UGGPase 5 Cucu GZ >gil88954061 lgblABD59006. 11UDP- 2 mis 29 S3 galactose/glucose pyrophosphorylase [Cucumis melo] 4 melo 63 Arab idops 0 is lyrat XP hypothetical protein ARALYDR AFT_495 327 7 a _oo [Arabidopsis lyrata subsp. lyrata] 1 subs 286 297 >gil2973 10017lgblEFH40441 .11hypothetical 8 P 418 792 protein ARALYDRAFT_495327 [Arabidopsis lyrata 8 lyrat 29 43 2 594 subsp. lyrata] 5 a 64 50 UDP-sugar pyrophosphorylase [Arabidopsis thaliana] >gil75 168956lsplQ9C51 1.1IUSP_ARATH 0 RecName: Full=UDP-sugar pyrophosphorylase; Short=AtUSP 7 >gill3430648lgblAAK25946. 1IAF360236_l 2 Arab NP unknown protein [Arabidopsis thaliana] 2 idops _56 145 >gill4532822lgblAAK64093. 11unknown protein 0 is 877 359 [Arabidopsis thaliana] 4 thalia 29 43 5 167 >gil8418 1457lgblABC55066. 1l nonspecific UDP- 5 na 65 5 1

1 5 0 Oryz a 7 sativ 9 a AA 5 Japo X9 455 2 nica 624 929 hypothetical protein LOC_Osl lg25920 [Oryza sativa 0 Grou 29 7 79 Japonica Group] 7 P 81 0 Oryz a 7 sativ 8 a EE 6 Indie C8 543 4 a 370 625 hypothetical protein OsI_29522 [Oryza sativa Indica 9 Grou 29 3 48 Group] 2 P 82 Predi cted NP siRN _oo A 50 114 226 UBA and UBX domain-containing protein [Zea mays] 5937 973 509 >gill95629900lgblACG36591 .1lUBA and UBX Zea 29 43 9 67 3 895 domain-containing protein [Zea mays] 1 mays 83 67 0

9 XP 2 _oo hypothetical protein SORBIDRAFT_06gO19230 6 Sorg 244 242 [Sorghum bicolor] >gil241937813lgblEES 10958. 1l 2 hum 663 073 hypothetical protein SORBIDRAFT_06gO19230 8 bicol 29 43 0 387 [Sorghum bicolor] 2 or 84 68 0

8 0 AC 7 N3 223 6 113 973 9 Zea 29 43 1 886 unknown [Zea mays] 2 mays 85 69 0

9 NP 1 _oo 0 114 226 LOCI 00282371 [Zea mays] 2 875 496 >gill95621900lgblACG32780. 1lUBA and UBX 5 Zea 29 43 5 278 domain-containing protein [Zea mays] 6 mays 86 70 0 Oryz a 7 sativ NP 5 a _oo 3 Japo 105 115 Os04g0464500 [Oryza sativa Japonica Group] 2 nica 301 458 >gill l3564589ldbj IB AF14932. i lOs04g0464500 0 Grou 29 43 8 835 [Oryza sativa Japonica Group] 5 P 87 7 1 CA 324 OSJNBa0060P14. 10 [Oryza sativa Japonica Group] 0 Oryz 29 43

925 349 9 9 8 9 0 7 1 0

9 NP 8 _oo 6 113 212 hypothetical protein LOC100191986 [Zea mays] 3 088 275 >gill95622040lgblACG32850. 11serine/threonine- 3 Zea 29 43 2 449 protein kinase SAPK8 [Zea mays] 9 mays 97 8 1 0

9 7 AC 8 L5 219 1 268 884 4 Zea 29 43 9 628 unknown [Zea mays] 2 mays 98 82 0 Hord eum 9 vulga 4 re BA 5 subs K0 326 3 P - 549 487 5 vulga 29 43 5 645 predicted protein [Hordeum vulgare subsp. vulgare] 5 re 99 83 Os03g0764800 [Oryza sativa Japonica Group] >gil7 1153747lsplQ7Y0B9. 1IS APK8_ORYSJ RecName: Full=Serine/threonine-protein kinase SAPK8; AltName: Full=Osmotic stress/abscisic acid- activated protein kinase 8 >gil3 1415944lgblAAP50965. 11putative serine- threonine protein kinase [Oryza sativa Japonica 0 Oryz Group] >gil469 17344ldbj IB AD18004. 11 a serine/threonine protein kinase SAPK8 [Oryza sativa 9 sativ NP Japonica Group] >gill0871 1239lgblABF99034. 1l 3 a _oo Serine/threonine-protein kinase SAPK9, putative, 4 Japo 105 115 expressed [Oryza sativa Japonica Group] 4 nica 137 455 >gil113549842ldbj IB AF1 3285.11Os03g0764800 2 Grou 30 43 1 540 [Oryza sativa Japonica Group] 6 P 00 84 0

8 3 CA 6 N6 147 0 Vitis 274 788 6 vinif 30 5 087 hypothetical protein VITISV_025025 [Vitis vinifera] 6 era 0 1 XP 0 _oo 228 225 PREDICTED: hypothetical protein [Vitis vinifera] 8 Vitis 495 428 >gil297741336lemblCBI32467.3l unnamed protein 3 vinif 30 43 9 694 product [Vitis vinifera] 6 era 02 85

465 sativa Japonica Group] 9 a 7 >gil 113578208 Idbj IB AF1 657 1.11Os05g0 149400 4 Japo [Oryza sativa Japonica Group] 3 nica >gi 1 1568642 1Idbj IBAG87706. i lunnamed protein 0 Grou product [Oryza sativa Japonica Group] 4 P >gil218 196096lgblEEC78523. 11hypothetical protein OsI_ 18467 [Oryza sativa Indica Group] NP _oo 115 226 LOCI 00284770 [Zea mays] 113 502 >gill95644530lgblACG41733. 1l anthranilate N - Zea 30 43 7 371 benzoyltransferase protein 1 [Zea mays] 1 mays 11 94 0

8 XP 9 _oo hypothetical protein SORBIDRAFT_02g025010 6 Sorg 246 242 [Sorghum bicolor] >gil241925776lgblEER98920. 1l 0 hum 239 049 hypothetical protein SORBIDRAFT_02g025010 7 bicol 30 43 9 309 [Sorghum bicolor] 4 or 12 95 0 Hord eum 8 vulga 4 re BA 0 subs K0 326 predicted protein [Hordeum vulgare subsp. vulgare] 6 P 672 504 >gil32653 1672ldbj IB AJ97840. i lpredicted protein 4 vulga 30 43 5 867 [Hordeum vulgare subsp. vulgare] 7 re 13 96 Oryz 0 a sativ 8 a EA 2 Indie Z O 543 6 a 913 625 hypothetical protein Osl_3 1408 [Oryza sativa Indica 7 Grou 30 8 48 Group] 9 P 14 Oryz Os09g0422000 [Oryza sativa Japonica Group] 0 a >gil50726 120ldbj IB AD3364 1.11putative sativ NP hydroxycinnamoyl transferase [Oryza sativa Japonica 8 a _oo Group] >gil 11363 1439ldbj IB AF25 120. 11 2 Japo 106 115 Os09g0422000 [Oryza sativa Japonica Group] 4 nica 320 479 >gil215678844ldbjlBAG9528 1.11unnamed protein 4 Grou 30 43 6 224 product [Oryza sativa Japonica Group] 8 P 15 97 0

7 NP 6 _oo 6 114 226 anthranilate N-benzoyltransferase protein 1 [Zea 7 746 494 mays] >gill9561 1590lgblACG27625. 1l anthranilate 4 Zea 30 43 4 126 N-benzoyltransferase protein 1 [Zea mays] 4 mays 16 98 0 AC F8 194 7 743 706 6 Zea 30 43 5 701 unknown [Zea mays] 4 mays 17 99

0

8 XP 5 _oo hypothetical protein SORBIDRAFT_03g034670 9 Sorg 245 242 [Sorghum bicolor] >gil241930466lgblEES0361 1.11 2 hum 849 058 hypothetical protein SORBIDRAFT_03g034670 0 bicol 30 44 1 690 [Sorghum bicolor] 6 or 26 08 WRKY transcription factor-like [Oryza sativa 0 Oryz Japonica Group] >gil46394280ltpglDAA05078. i l a TPA_inf: WRKY transcription factor 13 [Oryza sativa 7 sativ (japonica cultivar-group)] 0 a BA >gil58042735lgblAAW63711.11WRKY1 3 [Oryza 7 Japo B5 209 sativa Japonica Group] 5 nica 605 752 >gil215695 180ldbjlBAG90371.11unnamed protein 8 Grou 30 44 5 81 product [Oryza sativa Japonica Group] 1 P 27 09 0 Oryz a 7 sativ 0 a EA hypothetical protein Osl_03741 [Oryza sativa Indica 3 Indie Y7 543 Group] >gill32566305lgblABO34049. 1ldefense- 9 a 582 625 responsive protein WRKY 13 [Oryza sativa Indica 7 Grou 30 7 48 Group] 1 P 28 0 Oryz a 7 sativ 0 a EA 3 Japo Zl 543 9 nica 354 986 hypothetical protein OsJ_03461 [Oryza sativa 7 Grou 30 5 60 Japonica Group] 1 P 29 XP _oo hypothetical protein SORBIDRAFT_01g040900 Sorg 246 242 [Sorghum bicolor] >gil241919400lgblEER92544. 1l hum 554 036 hypothetical protein SORBIDRAFT_01g040900 bicol 30 44 6 302 [Sorghum bicolor] 1 or 30 10 0

9 NP 1 _oo 6 114 226 phosphomevalonate kinase [Zea mays] 0 934 504 >gill95626562lgblACG35 111.11 1 Zea 30 44 5 079 phosphomevalonate kinase [Zea mays] 6 mays 31 11 0

9 1 AC 6 N3 223 0 168 975 1 Zea 30 44 9 002 unknown [Zea mays] 6 mays 32 12 AC 0 G3 195 500 626 9 Zea 30 44 8 355 phosphomevalonate kinase [Zea mays] 1 mays 33 13

Tritic 110 um 127 aesti 30 7A histone H4 vum 72

Tritic RecName: Full=Histone H4 variant TH091 um >gill70747lgblAAA34292. 1lhistone H4 [Triticum aesti 30 aestivum] vum 73

AC G3 195 145 619 Zea 30 44 5 249 histone H4 [Zea mays] mays 74 50 histone H4 [Arabidopsis thaliana] >gill523 1283lreflNP_190179. I Ihistone H4 [Arabidopsis thaliana] >gill52323 18lreflNP_190941 .I Ihistone H4 [Arabidopsis thaliana] >gill8390794lreflNP_563793. I Ihistone H4 [Arabidopsis thaliana] >gill83908 15lreflNP_563797. 1lhistone H4 [Arabidopsis thaliana] >gill8424269lreflNP_56891 1.11histone H4 [Arabidopsis thaliana] >gill8424305lreflNP_568918. I Ihistone H4 [Arabidopsis thaliana] >gil30680368lreflNP_850939. I Ihistone H4 [Arabidopsis thaliana] >gil30692704lreflNP_850660. I Ihistone H4 [Arabidopsis thaliana] >gil115447965 IrefINP_00 1047762. 11 Os02g0684500 [Oryza sativa Japonica Group] >gil115450365 IrefINP_00 1048783 .11 Os03g01 19900 [Oryza sativa Japonica Group] >gil115460 128IrefINP_00 1053664. 11 Os04g0583600 [Oryza sativa Japonica Group] >gill l5464339lreflNP_001055769. 1l Os05g0462700 [Oryza sativa Japonica Group] >gill l5464373lreflNP_001055786. 1l Os05g0466600 [Oryza sativa Japonica Group] >gil115479303 IrefINP_00 1063245 .11 Os09g0433600 [Oryza sativa Japonica Group] >gil115480569lref INP_00 1063878 .11 Os09g0553 100 [Oryza sativa Japonica Group] >gill 15483 172lreflNP_001065 179. I I Osl0g0539500 [Oryza sativa Japonica Group] Arab NP >gil2127223 14lreflNP_001 13 1585. I Ihistone H4 idops _18 425 [Zea mays] >gil297597921lreflNP_001044729.2l is 044 694 Os01g0835900 [Oryza sativa Japonica Group] thalia 30 44 1 20 >gil297725773 IrefINP_00 1175250. 11 na 75 5 1 Os07g0549900 [Oryza sativa Japonica Group] >gil167998046lref IXP_00 175 1729. 11histone H4 [Physcomitrella patens subsp. patens] >gill68027663lreflXP_001766349. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill6803 1388lreflXP_001768203. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill6803438 1lreflXP_001769691 .I Ihistone H4 [Physcomitrella patens subsp. patens] >gill68037263lreflXP_001771 124. 1lhistone H4 [Physcomitrella patens subsp. patens] >gill68042214lreflXP_001773584. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill68046645lreflXP_001775783. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill68054207lreflXP_001779524. 11predicted protein [Physcomitrella patens subsp. patens] >gill68055941 lreflXP_00177998 1.i lhistone H4 [Physcomitrella patens subsp. patens] >gill68056875lreflXP_001780443. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill68063722lreflXP_001783818. I Ihistone H4 [Physcomitrella patens subsp. patens] >gil224097150lreflXP_0023 10853. I Ihistone H4 [Populus trichocarpa] >gil224097156lreflXP_0023 10855. I Ihistone H4 [Populus trichocarpa] >gil224097164lreflXP_0023 10859. 1lhistone H4 [Populus trichocarpa] >gil224098 168lreflXP_0023 11129. 11histone H4 [Populus trichocarpa] >gil2241 12905 lreflXP_0023 16326. 11histone H4 [Populus trichocarpa] >gil224126063lreflXP_002329652. I Ihistone H4 [Populus trichocarpa] >gil224133734lreflXP_002327667. 1lhistone H4 [Populus trichocarpa] >gil224133742lreflXP_002327669. 1lhistone H4 [Populus trichocarpa] >gil22414225 1lreflXP_002324472. 11histone H4 [Populus trichocarpa] >gil224142255lreflXP_002324474. I Ihistone H4 [Populus trichocarpa] >gil224143736lreflXP_002325056. I Ihistone H4 [Populus trichocarpa] >gil224167386lreflXP_002339024. I Ihistone H4 [Populus trichocarpa] >gil2254350 16lrefIXP_002284 158 .11 PREDICTED: hypothetical protein isoform 1 [Vitis vinifera] >gil225435 124lreflXP_002284569. 11 PREDICTED: hypothetical protein isoform 2 [Vitis vinifera] >gil225435 126lreflXP_002284564. 11 PREDICTED: hypothetical protein isoform 1 [Vitis vinifera] >gil225440304lreflXP_002262845. 11 PREDICTED: hypothetical protein isoform 1 [Vitis vinifera] >gil22544877 1IrefIXP_00228 1801 .11 PREDICTED: hypothetical protein isoform 2 [Vitis vinifera] >gil225448773lreflXP_00228 1789. 11 PREDICTED: hypothetical protein isoform 1 [Vitis vinifera] >gil225449567lreflXP_002283894. 11 PREDICTED: hypothetical protein [Vitis vinifera] >gil225449569lreflXP_002283901 .11 PREDICTED: hypothetical protein isoform 1 [Vitis vinifera] >gil225449573lreflXP_002283912. 1l PREDICTED: hypothetical protein isoform 1 [Vitis vinifera] >gil242035235lreflXP_002465012. 11 hypothetical protein SORBIDRAFT_01g030460 [Sorghum bicolor] >gil242042459lreflXP_002468624. 11hypothetical protein SORBIDRAFT_01g049250 [Sorghum bicolor] >gil242044758lreflXP_002460250. 11hypothetical protein SORBIDRAFT_02g025440 [Sorghum bicolor] >gil242050 118IrefIXP_002462803 .11hypothetical protein SORBIDRAFT_02g032240 [Sorghum bicolor] >gil24205 1969lreflXP_002455 130. 11hypothetical protein SORBIDRAFT_03g004840 [Sorghum bicolor] >gil24205 1971IrefIXP_002455 13 1.11hypothetical protein SORBIDRAFT_03g004870 [Sorghum bicolor] >gil242054901 lreflXP_002456596. 11hypothetical protein SORBIDRAFT_03g039090 [Sorghum bicolor] >gil24205628 1lreflXP_002457286. 11hypothetical protein SORBIDRAFT_03g004890 [Sorghum bicolor] >gil242062908lreflXP_002452743. 11hypothetical protein SORBIDRAFT_04g03 1620 [Sorghum bicolor] >gil242076918lreflXP_002448395. IIhypothetical protein SORBIDRAFT_06g026490 [Sorghum bicolor] >gil242088 199lreflXP_002439932. 11hypothetical protein SORBIDRAFT_09g022920 [Sorghum bicolor] >gil255537239lreflXP_002509686. 1lhistone h4, putative [Ricinus communis] >gil255555809lreflXP_0025 18940. IIhistone h4, putative [Ricinus communis] >gil255568 195lreflXP_002525073. IIhistone h4, putative [Ricinus communis] >gil25558 1703lreflXP_00253 1654. IIhistone h4, putative [Ricinus communis] >gil25558 1707lreflXP_00253 1656. IIhistone h4, putative [Ricinus communis] >gil255584136lreflXP_002532808. IIhistone h4, putative [Ricinus communis] >gil297793525lreflXP_002864647. 11hypothetical protein ARALYDR AFT_496 101 [Arabidopsis lyrata subsp. lyrata] >gil2978 15748lreflXP_002875757. 1l hypothetical protein ARALYDRAFT_48497 1 [Arabidopsis lyrata subsp. lyrata] >gil2978 19196lrefIXP_00287748 1.11hypothetical protein ARALYDRAFT_4850 10 [Arabidopsis lyrata subsp. lyrata] >gil2978201 10lreflXP_002877938. 1l hypothetical protein ARALYDRAFT_485763 [Arabidopsis lyrata subsp. lyrata] >gil297826247lreflXP_00288 1006. 11hypothetical protein ARALYDRAFT_48 1787 [Arabidopsis lyrata subsp. lyrata] >gil28202123lsplP59259.2IH4_ARATH RecName: Full=Histone H4 >gil5 1315699lsplQ6LAF3 .3IH4_FLATR RecName: Full=Histone H4 >gil5 13 15702lsplQ6PMI5.3IH4_CHEMJ RecName: Full=Histone H4 >gil5 13 1571 1lsplQ6WZ83.3IH4_EUCGL RecName: Full=Histone H4 >gil5 13 15719lsplQ76H85.3IH4_SILLA RecName: Full=Histone H4 >gil5 13 173 13lsplP62788.2IH4_PEA RecName: Full=Histone H4 >gil5 13 17325lsplP62787.2IH4_MAIZE RecName: Full=Histone H4 >gil5 13 17341 lsplP62887.2IH4_LOLTE RecName: Full=Histone H4 >gil78 100002lsplP62785.2IH41_WHEAT RecName: Full=Histone H4 variant TH01 1 >gil302425021 lsplP0CG89. 1IH4_SOYBN RecName: Full=Histone H4 >gil8439886lgblAAF75072. 1IAC007583_8 Identical to histone H4 from Arabidopsis thaliana gilS06904 >gil8439903lgblAAF75089. 1IAC007583_25 Identical to histone H4 from Arabidopsis thaliana gilS06904 >gill l762277lgblAAG40410. 1IAF325058_l AT5g59690 [Arabidopsis thaliana] >gil 120393 18IgblAAG46 106. 11AC073 166_4 histone H4 [Oryza sativa Japonica Group] >gill224803 1lgblAAG50107. 1IAF334729_l putative histone H4 protein [Arabidopsis thaliana] >gil21795lemblCAA24924. 1l unnamed protein product [Triticum aestivum] >gill66740lgblAAA328 10. 1l histone H4 [Arabidopsis thaliana] >gil 166742lgblAAA328 11.11 histone H4 [Arabidopsis thaliana] >gill68499lgblAAA33474. 1l histone H4 (H4C13) [Zea mays] >gill68501 lgblAAA33475. 1l histone H4 [Zea mays] >gill68503lgblAAA33476. 1l histone H4 [Zea mays] >gil498898lgblAAA86948. 1l histone H4 homolog [Pisum sativum] >gill806285lemblCAB01914. 1l histone H4 homologue [Sesbania rostrata] >gil3927823lgblAAC79580. I Ihistone H4 [Arabidopsis thaliana] >gi 160099 15Idbj IB AA85 120. i lhistone H4-like protein [Solanum melongena] >gil652261 1lemblCAB62023. 11histone H4-like protein [Arabidopsis thaliana] >gil7339494lemblCAB828 17. 1l Histone H4-like protein [Arabidopsis thaliana] >gil7629993lemblCAB88335. I Ihistone H4-like protein [Arabidopsis thaliana] >gil9757918ldbjlB AB08365. i lhistone H4 [Arabidopsis thaliana] >gil9758835ldbjlB AB09507. i lhistone H4 [Arabidopsis thaliana] >gill3277212lemblCAC3441 1.I Ihistone H4 [Flaveria trinervia] >gill6209693lgblAAL14404. 1l AT5g59690/mthl2_90 [Arabidopsis thaliana] >gill7065282lgblAAL32795. I Ihistone H4-like protein [Arabidopsis thaliana] >gill7380766lgblAAL36213. I Iputative histone H4 protein [Arabidopsis thaliana] >gil20160804ldbjlBAB89744. 1lhistone H4 [Oryza sativa Japonica Group] >gil20198 175lgblAAM15445. I Ihistone H4 [Arabidopsis thaliana] >gil20260010lgblAAM13352. 1lhistone H4-like protein [Arabidopsis thaliana] >gil20466418lgblAAM20526. 1lhistone H4-like protein [Arabidopsis thaliana] >gil21537385lgblAAM61726. I Ihistone H4-like protein [Arabidopsis thaliana] >gil21553628lgblAAM62721 .I Ihistone H4-like protein [Arabidopsis thaliana] >gil21554094lgblAAM63 175. I Ihistone H4-like protein [Arabidopsis thaliana] >gil21555353lgblAAM63839. I Ihistone H4-like protein [Arabidopsis thaliana] >gil215923 13lgblAAM64264. 1lhistone H4-like protein [Arabidopsis thaliana] >gil21592673lgblAAM64622. I Ihistone H4-like protein [Arabidopsis thaliana] >gil21592795lgblAAM64744. I Ihistone H4-like protein [Arabidopsis thaliana] >gi 12 1700843 IgbIAAM70545 .11 AT5g59690/mthl2_90 [Arabidopsis thaliana] >gil22136354lgblAAM91255. I Ihistone H4-like protein [Arabidopsis thaliana] >gil22165 124lgblAAM93740. I Ihistone H4 [Oryza sativa Japonica Group] >gil23296862lgblAAN13 189. 1lputative histone H4 protein [Arabidopsis thaliana] >gil27452909lgblAAO15293. 1l Unknown protein [Oryza sativa Japonica Group] >gil28208264ldbj IBAC56852. i lhistone H4 [Silene latifolia] >gil28393088lgblAAO41978. I Iputative histone H4 protein [Arabidopsis thaliana] >gil28466803 IgblAAO440 10.11At 1g07820 [Arabidopsis thaliana] >gil28564804ldbj IBAC57734. i lhistone H4 [Oryza sativa Japonica Group] >gil288273 18lgblAAO50503. I Iputative histone H4 protein [Arabidopsis thaliana] >gil30575604lgblAAP33088. I Ihistone H4 [Eucalyptus globulus] >gil3 1433309lgblAAP54838. 1l Histone H4, putative, expressed [Oryza sativa Japonica Group] >gil383468 10lemblCAD41 377.21 OSJNBa0088A01 .17 [Oryza sativa Japonica Group] >gil41052706ldbjlBAD07563. I Ihistone H4 [Oryza sativa Japonica Group] >gil468 11262lgblAAT01924. I Ihistone H4 [Chelidonium majus] >gil47900360lgblAAT39190. 1lputative histone H4 [Oryza sativa Japonica Group] >gil49328063lgblAAT58763. I Ihistone H4 [Oryza sativa Japonica Group] >gil49328086lgblAAT58785. I Ihistone H4 [Oryza sativa Japonica Group] >gil5025 1938ldbjlBAD27874. 1lhistone H4 [Oryza sativa Japonica Group] >gil5072603 1ldbj IBAD33556. i lhistone H4 [Oryza sativa Japonica Group] >gil5 1969168ldbjlBAD43276. 1lhistone H4 [Arabidopsis thaliana] >gil5 1969828ldbjlBAD43606. 1lhistone H4 [Arabidopsis thaliana] >gil5 1970436ldbjlBAD43910. 1lhistone H4 [Arabidopsis thaliana] >gil537493 11lgblAAU90170. I Ihistone H4 [Oryza sativa Japonica Group] >gil56798269ldbj IBAD82897. i lhistone H4 [Fragaria x ananassa] >gil62642127lgblAAX92702. I Ihistone 4 [Picea abies] >gil87138 105lgblABD28289. 1lhistone H4- like protein [Glycine max] >gil88010997lgblABD38885. 1l At3g45930 [Arabidopsis thaliana] >gil92885 100lgblABE87620. 1l Histone core [Medicago truncatula] >gill08705887lgblABF93682. 1l Histone H4, putative, expressed [Oryza sativa Japonica Group] >gill l0738359ldbjlBAF01 106. 1l Histone H4 - like protein [Arabidopsis thaliana] >gill l0742734ldbjlBAF00179. 1lhistone H4 [Arabidopsis thaliana] >gill l3537293ldbj IB AF09676. i l Os02g0684500 [Oryza sativa Japonica Group] >gil 113547254ldbj IB AF1 0697. 11Os03g0 119900 [Oryza sativa Japonica Group] >gill l3565235ldbjlBAF15578. 1IOs04g0583600 [Oryza sativa Japonica Group] >gill l3579320ldbjlBAF17683. 1IOs05g0462700 [Oryza sativa Japonica Group] >gill l3579337ldbj IB AF17700. i l Os05g0466600 [Oryza sativa Japonica Group] >gill l363 1478ldbj IB AF25 159. i l Os09g0433600 [Oryza sativa Japonica Group] >gill 136321 1l ldbj IBAF25792. i l Os09g0553 100 [Oryza sativa Japonica Group] >gil 113639788 Idbj IB AF27093 .11Os10g0539500 [Oryza sativa Japonica Group] >gill l6778467lgblABK20879. I Iunknown [Picea sitchensis] >gil 116782704lgbl ABK226 19. 11 unknown [Picea sitchensis] >gill l6788052lgblABK24738. I Iunknown [Picea sitchensis] >gill 16793524lgblABK26777. 1l unknown [Picea sitchensis] >gill l8482735lgblABK93286. 1lunknown [Populus trichocarpa] >gill l8484754lgblABK94246. 1lunknown [Populus trichocarpa] >gill l8485565lgblABK94634. 1lunknown [Populus trichocarpa] >gill24360937lgblABN08909. 1l Histone core [Medicago truncatula] >gi 1 25528296lgblEAY764 10.11hypothetical protein Osl_04340 [Oryza sativa Indica Group] >gill25532798lgblEA Y79363. i lhypothetical protein OsI_34491 [Oryza sativa Indica Group] >gill25540704lgblEAY87099. 11hypothetical protein Osl_08497 [Oryza sativa Indica Group] >gill25542165lgblEAY88304. 1lhypothetical protein Osl_09762 [Oryza sativa Indica Group] >gill25549476lgblEAY95298. IIhypothetical protein OsI_17 123 [Oryza sativa Indica Group] >gi 1125552628 lgblEAY98337. 1hypothetical protein Osl_20247 [Oryza sativa Indica Group] >gill25552649lgblEA Y98358. i lhypothetical protein Osl_20269 [Oryza sativa Indica Group] >gill25558734lgblE AZ04270. i lhypothetical protein OsI_26413 [Oryza sativa Indica Group] >gill25563829lgblE AZ09209. i lhypothetical protein OsI_3 1484 [Oryza sativa Indica Group] >gill25564638lgblEAZ10018. I Ihypothetical protein OsI_32321 [Oryza sativa Indica Group] >gill25572554lgblEAZ14069. IIhypothetical protein OsJ_03994 [Oryza sativa Japonica Group] >gill25575549lgblEAZ16833. Ihypothetical protein OsJ_32304 [Oryza sativa Japonica Group] >gill25583277lgblEAZ24208. I Ihypothetical protein OsJ_07955 [Oryza sativa Japonica Group] >gill25584717lgblEAZ2538 1.11hypothetical protein OsJ_09199 [Oryza sativa Japonica Group] >gil 12559 141 3IgbIE AZ3 1763. 11hypothetical protein OsJ_15915 [Oryza sativa Japonica Group] >gill25600645lgblEAZ40221 .I Ihypothetical protein OsJ_24666 [Oryza sativa Japonica Group] >gill25606566lgblEAZ45602. IIhypothetical protein OsJ_30268 [Oryza sativa Japonica Group] >gill46403794lgblABQ32303. Iputative histone H4-like protein [Artemisia annua] >gi 147800359lemblC AN64268 .11hypothetical protein VITISV_036365 [Vitis vinifera] >gill47826823lemblCAN59705. I Ihypothetical protein VITISV_0 10247 [Vitis vinifera] >gill47826824lemblCAN59706. I Ihypothetical protein VITISV_0 10248 [Vitis vinifera] >gill47839844lemblCAN68239. IIhypothetical protein VITISV_006985 [Vitis vinifera] >gill47842470lemblCAN63 143. 1 hypothetical protein VITISV_034577 [Vitis vinifera] >gill47855 175lemblCAN79580. 1lhypothetical protein VITISV_002271 [Vitis vinifera] >gi 147855 176lemblCAN7958 1.11hypothetical protein VITISV_002272 [Vitis vinifera] >gil1478554 13lembICAN796 12. 11hypothetical protein VITISV_035467 [Vitis vinifera] >gil 147858 185lemblCAN79680. 11hypothetical protein VITISV_034640 [Vitis vinifera] >gill47859377lemblCAN83554. 1lhypothetical protein VITISV_030356 [Vitis vinifera] >gill58828217lgblABW8 1095. 1lH4hisl8 [Cleome spinosa] >gill62664647lgblEDQ5 1358. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill62668 119lgblEDQ54733. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill62668586lgblEDQ55 190. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill62669106lgblEDQ55700. 1lpredicted protein [Physcomitrella patens subsp. patens] >gill62672790lgblEDQ59322. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill62675 123lgblEDQ61622. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill62677657lgblEDQ64125. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill62679040lgblEDQ65492. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill62680641 lgblEDQ67076. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill62682563lgblEDQ6898 1.11histone H4 [Physcomitrella patens subsp. patens] >gill62696827lgblEDQ83 164. I Ihistone H4 [Physcomitrella patens subsp. patens] >gill94691936lgblACF80052. 1lunknown [Zea mays] >gill94693488lgblACF80828. I Iunknown [Zea mays] >gill94696282lgblACF82225. 1l unknown [Zea mays] >gill94696408lgblACF82288. I Iunknown [Zea mays] >gill94698290lgblACF83229. I Iunknown [Zea mays] >gill94698982lgblACF83575. 1l unknown [Zea mays] >gill94699362lgblACF83765. I Iunknown [Zea mays] >gill94700348lgblACF84258. I Iunknown [Zea mays] >gill94704392lgblACF86280. 1l unknown [Zea mays] >gill94706260lgblACF87214. I Iunknown [Zea mays] >gill94708346lgblACF88257. I Iunknown [Zea mays] >gill95605566lgblACG24613. 1l histone H4 [Zea mays] >gill95605632lgblACG24646. I Ihistone H4 [Zea mays] >gill95605640lgblACG24650. I Ihistone H4 [Zea mays] >gill95605982lgblACG24821 .1l histone H4 [Zea mays] >gill95606488lgblACG25074. I Ihistone H4 [Zea mays] >gill95606652lgblACG25 156. I Ihistone H4 [Zea mays] >gill95607014lgblACG25337. 1l histone H4 [Zea mays] >gill95607340lgblACG25500. I Ihistone H4 [Zea mays] >gill95617184lgblACG30422. 1lhistone H4 [Zea mays] >gill95617244lgblACG30452. 1l histone H4 [Zea mays] >gill95617708lgblACG30684. I Ihistone H4 [Zea mays] >gill95617830lgblACG30745. I Ihistone H4 [Zea mays] >gill95617840lgblACG30750. 1l histone H4 [Zea mays] >gill95617842lgblACG3075 1.11histone H4 [Zea mays] >gill95617880lgblACG30770. I Ihistone H4 [Zea mays] >gill95618008lgblACG30834. 1l histone H4 [Zea mays] >gill95618012lgblACG30836. 1lhistone H4 [Zea mays] >gill95618076lgblACG30868. I Ihistone H4 [Zea mays] >gi 11956 18078lgblACG30869. 11 histone H4 [Zea mays] >gill95618086lgblACG30873. I Ihistone H4 [Zea mays] >gill95618 174lgblACG30917. 1lhistone H4 [Zea mays] >gill95618332lgblACG30996. 1l histone H4 [Zea mays] >gill95618430lgblACG3 1045. I Ihistone H4 [Zea mays] >gill95618454lgblACG3 1057. 1lhistone H4 [Zea mays] >gi 11956 18798lgblACG3 1229. 11 histone H4 [Zea mays] >gill95618800lgblACG3 1230. 1lhistone H4 [Zea mays] >gill95618808lgblACG3 1234. 1lhistone H4 [Zea mays] >gi 11956 18940lgblACG3 1300. 11 histone H4 [Zea mays] >gill95618970lgblACG3 13 15. I Ihistone H4 [Zea mays] >gill95620178lgblACG3 1919. 1lhistone H4 [Zea mays] >gill95621558lgblACG32609. 1l histone H4 [Zea mays] >gill95623 194lgblACG33427. I Ihistone H4 [Zea mays] >gill95625 166lgblACG34413. I Ihistone H4 [Zea mays] >gill95626072lgblACG34866. 1l histone H4 [Zea mays] >gill95628242lgblACG3595 1.11histone H4 [Zea mays] >gill95628292lgblACG35976. I Ihistone H4 [Zea mays] >gill95628370lgblACG36015. 1l histone H4 [Zea mays] >gill95629326lgblACG36304. I Ihistone H4 [Zea mays] >gill95630263lgblACG36622. I Ihistone H4 [Zea mays] >gill95635063lgblACG37000. 1l histone H4 [Zea mays] >gill95635563lgblACG37250. I Ihistone H4 [Zea mays] >gill95636274lgblACG37605. I Ihistone H4 [Zea mays] >gill95636714lgblACG37825. 1l histone H4 [Zea mays] >gill95638688lgblACG388 12. I Ihistone H4 [Zea mays] >gill95639506lgblACG39221 .I Ihistone H4 [Zea mays] >gill95658023lgblACG48479. 1l histone H4 [Zea mays] >gill95658045lgblACG48490. I Ihistone H4 [Zea mays] >gill95658083lgblACG48509. I Ihistone H4 [Zea mays] >gill95658353lgblACG48644. 1l histone H4 [Zea mays] >gill9565845 1lgblACG48693. I Ihistone H4 [Zea mays] >gill95659307lgblACG49121 .I Ihistone H4 [Zea mays] >gil215740727ldbjlBAG97383. 1l unnamed protein product [Oryza sativa Japonica Group] >gil215765078ldbjlBAG86775. I Iunnamed protein product [Oryza sativa Japonica Group] >gil215765094ldbjlBAG86791 .I Iunnamed protein product [Oryza sativa Japonica Group] >gil215765 174ldbjlBAG86871 .I Iunnamed protein product [Oryza sativa Japonica Group] >gil215765 195ldbj IBAG86892. i lunnamed protein product [Oryza sativa Japonica Group] >gil215767370ldbjlBAG99598. I Iunnamed protein product [Oryza sativa Japonica Group] >gil215767525ldbjlBAG99753. I Iunnamed protein product [Oryza sativa Japonica Group] >gil222423594ldbj IB AH 19766. 11AT 1G07820 [Arabidopsis thaliana] >gil22263 1868lgblEEE64000. 11hypothetical protein OsJ_18829 [Oryza sativa Japonica Group] >gil222641632lgblEEE69764. 11hypothetical protein OsJ_29473 [Oryza sativa Japonica Group] >gil222836752lgblEEE75 145. 1lhistone H4 [Populus trichocarpa] >gil222836754lgblEEE75 147. I Ihistone H4 [Populus trichocarpa] >gil222850949lgblEEE88496. I Ihistone H4 [Populus trichocarpa] >gil222853756lgblEEE91303. I Ihistone H4 [Populus trichocarpa] >gil222853758lgblEEE91305. I Ihistone H4 [Populus trichocarpa] >gil222853762lgblEEE9 1309. I Ihistone H4 [Populus trichocarpa] >gil222865366lgblEEF02497. I Ihistone H4 [Populus trichocarpa] >gil222865906lgblEEF03037. I Ihistone H4 [Populus trichocarpa] >gil222865908lgblEEF03039. I Ihistone H4 [Populus trichocarpa] >gil222866490lgblEEF03621 .I Ihistone H4 [Populus trichocarpa] >gil222870533lgblEEF07664. I Ihistone H4 [Populus trichocarpa] >gil222874224lgblEEF1 1355. I Ihistone H4 [Populus trichocarpa] >gil223527428lgblEEF29565. I Ihistone h4, putative [Ricinus communis] >gil223528712lgblEEF30724. 1lhistone h4, putative [Ricinus communis] >gil223528714lgblEEF30726. I Ihistone h4, putative [Ricinus communis] >gil223535654lgblEEF37320. I Ihistone h4, putative [Ricinus communis] >gil223541927lgblEEF43473. I Ihistone h4, putative [Ricinus communis] >gil223549585lgblEEF5 1073. I Ihistone h4, putative [Ricinus communis] >gil224032847lgblACN35499. I Iunknown [Zea mays] >gil224285053lgblACN40254. I Iunknown [Picea sitchensis] >gil23801 1888lgblACR36979. l l unknown [Zea mays] >gi 123 80 1 31OlgblACR37 190. 11unknown [Zea mays] >gil238014142lgblACR38 106. I Iunknown [Zea mays] >gil238014264lgblACR38 167. 1l unknown [Zea mays] >gil238014334lgblACR38202. I Iunknown [Zea mays] >gil238014894lgblACR38482. I Iunknown [Zea mays] >gil241918866lgblEER92010. 1l hypothetical protein SORBIDRAFT_01g030460 [Sorghum bicolor] >gil241922478lgblEER95622. 11 hypothetical protein SORBIDRAFT_01g049250 [Sorghum bicolor] >gil241923627lgblEER96771 .1l hypothetical protein SORBIDRAFT_02g025440 [Sorghum bicolor] >gil241926180lgblEER99324. 1l hypothetical protein SORBIDRAFT_02g032240 [Sorghum bicolor] >gil241927105lgblEES00250. 1l hypothetical protein SORBIDRAFT_03g004840 [Sorghum bicolor] >gil241927106lgblEES0025 1.1l hypothetical protein SORBIDRAFT_03g004870 [Sorghum bicolor] >gil241928571 lgblEES01716. 1l hypothetical protein SORBIDRAFT_03g039090 [Sorghum bicolor] >gil241929261 lgblEES02406. 11 hypothetical protein SORBIDRAFT_03g004890 [Sorghum bicolor] >gil241932574lgblEES05719. 1l hypothetical protein SORBIDRAFT_04g03 1620 [Sorghum bicolor] >gil241939578lgblEES 12723. I I hypothetical protein SORBIDRAFT_06g026490 [Sorghum bicolor] >gil241945217lgblEES 18362. 1l hypothetical protein SORBIDRAFT_09g022920 [Sorghum bicolor] >gil255625991 lgblACU13340. 1l unknown [Glycine max] >gil255673853ldbjlBAF06643.2l Os01g0835900 [Oryza sativa Japonica Group] >gil25567787 1Idbj IB AH93978 .11Os07g0549900 [Oryza sativa Japonica Group] >gil2973 10482lgblEFH40906. 11hypothetical protein ARALYDR AFT_496 101 [Arabidopsis lyrata subsp. lyrata] >gil297321595lgblEFH52016. 1l hypothetical protein ARALYDRAFT_48497 1 [Arabidopsis lyrata subsp. lyrata] >gil2973233 19lgblEFH53740. I Ihypothetical protein ARALYDRAFT_4850 10 [Arabidopsis lyrata subsp. lyrata] >gil297323776lgblEFH54197. 1l hypothetical protein ARALYDRAFT_485763 [Arabidopsis lyrata subsp. lyrata] >gil297326845lgblEFH57265. 11hypothetical protein ARALYDRAFT_48 1787 [Arabidopsis lyrata subsp. lyrata] >gil326488 189ldbj IB AJ89933 .11 predicted protein [Hordeum vulgare subsp. vulgare] >gil326489645ldbjlBAK01803. I Ipredicted protein [Hordeum vulgare subsp. vulgare] >gil326490127ldbj IB AJ94137. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil326497283ldbj IB AK02226. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil32649858 1ldbj IB AJ98718. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil326500352ldbjlBAK06265. I Ipredicted protein [Hordeum vulgare subsp. vulgare] >gil326503956ldbj IBAK02764. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil326505870ldbj IB AJ91 174. 11predicted protein [Hordeum vulgare subsp. vulgare] >gil326505922ldbj IB AJ91200. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil326506492ldbj IBAJ86564. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil326506520ldbj IB AJ86578. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil326522106ldbjlBAK0418 1.11predicted protein [Hordeum vulgare subsp. vulgare] >gil326523419ldbj IB AJ88750. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil3265248 14ldbjlBAK04343. 11predicted protein [Hordeum vulgare subsp. vulgare] >gil326529405ldbj IB AK04649. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil326530001 ldbj IB AK08280. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil326532258ldbjlBAK05058. 11predicted protein [Hordeum vulgare subsp. vulgare] >gil326532458ldbjlBAK05 158. 11predicted protein [Hordeum vulgare subsp. vulgare] >gil326533346ldbj IB AJ93645. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil330253071 lgblAEC08 165. 1lhistone H4 [Arabidopsis thaliana] >gil3303 18553lgblAEC10949. 1lhistone H4 [Camellia sinensis] >gil332009837lgblAED97220. 11histone H4 [Arabidopsis thaliana] >gil332009877lgblAED97260. 11histone H4 [Arabidopsis thaliana] >gil332190037lgblAEE28 158. 11histone H4 [Arabidopsis thaliana] >gil332190066lgblAEE28 187. 1lhistone H4 [Arabidopsis thaliana] >gil332190067lgblAEE28 188. 11histone H4 [Arabidopsis thaliana] >gil332644570lgblAEE7809 1.11histone H4 [Arabidopsis thaliana] >gil332644625lgblAEE78 146. 11histone H4 [Arabidopsis thaliana] >gil332645612lgblAEE79133. 11histone H4 [Arabidopsis thaliana] >gil225838lprflll3 14298A histone H4 0

9 Hyac AA 6 inthu T O 470 8 s 872 270 7 orien 30 44 5 19 histone H4 [Hyacinthus orientalis] 5 talis 76 52 0

9 AD 6 Malu L3 302 C3HL domain class transcription factor [Malus x 8 s X 664 398 domestica] >gil302398719lgblADL36654. 1l C3HL 7 dome 30 44 9 708 domain class transcription factor [Malus x domestica] 5 stica 77 53 Os01g0840100 [Oryza sativa Japonica Group] Oryz NP >gill5623835ldbj IB AB67894. 11putative HSP70 a _oo [Oryza sativa Japonica Group] sativ 104 297 >gil21 104622ldbj IB AB93214. i lputative HSP70 a 475 597 [Oryza sativa Japonica Group] Japo 30 44 7 935 >gi 111353428 8Idbj IB AF0667 1.11OsO 1g0840 100 1 nica 78 54 [Oryza sativa Japonica Group] Grou >gill25572585lgblEAZ14100. 11hypothetical P protein OsJ_04024 [Oryza sativa Japonica Group] >gil215769289ldbjlBAH015 18. 11unnamed protein product [Oryza sativa Japonica Group] >gil306416013lgblADM8688 1.1l70kDa heat shock protein [Oryza sativa Japonica Group] >gil3 13575779lgblADR66969. 1l70 kDa heat shock protein [Oryza sativa Japonica Group] Arab 0 idops is 9 lyrat XP hypothetical protein ARALYDRAFT_897465 4 a _oo [Arabidopsis lyrata subsp. lyrata] 4 subs 288 297 >gil297330752lgblEFH61 171 .11hypothetical 4 P - 491 834 protein ARALYDRAFT_897465 [Arabidopsis lyrata 4 lyrat 30 44 2 059 subsp. lyrata] 4 a 79 55 NP 0 _oo - 114 226 hypothetical protein LOC100277884 [Zea mays] 2 480 501 >gil195647306lgblACG43 121 .11hypothetical Zea 30 44 8 057 protein [Zea mays] 1 mays 80 56 XP 5 _oo hypothetical protein SORBIDRAFT_01g003720 Sorg - 246 242 [Sorghum bicolor] >gil241920072lgblEER93216. 1l hum 7 621 037 hypothetical protein SORBIDRAFT_01g003720 bicol 30 44 8 646 [Sorghum bicolor] 1 or 81 57 0

9 NP 5 _oo 2 114 226 hypothetical protein LOCI 002776 18 [Zea mays] 4 460 501 >gi119564445 8IgbIACG41697.11hypothetical 8 Zea 30 44 2 987 protein [Zea mays] 9 mays 82 58 0 Oryz a 8 sativ OSJNBa0035I04.2 [Oryza sativa Japonica Group] 3 a CA >gil38605918lemblCAE05953.3l 4 Japo E O 616 OSJNBb0088C09. 12 [Oryza sativa Japonica Group] 8 nica 541 566 >gill l6309409lemblCAH66485. 1l 4 Grou 30 44 4 46 OSIGBa0076I14.6 [Oryza sativa Indica Group] 2 P 83 59 0 Oryz a 8 sativ 3 a EE 7 Indie C7 543 1 a 727 625 hypothetical protein Osl_15905 [Oryza sativa Indica 0 Grou 30 5 48 Group] 4 P 84 NP 0 Oryz _oo a 105 297 Os04g0423700 [Oryza sativa Japonica Group] 8 sativ 279 602 >gil255675459ldbjlBAF14712.2l Os04g0423700 3 a 30 44 8 722 [Oryza sativa Japonica Group] 4 Japo 85 60

5 2 9 4 1 0 Hord eum 7 vulga 3 re BA 8 subs KO 326 2 P - 159 489 3 vulga 30 44 3 218 predicted protein [Hordeum vulgare subsp. vulgare] 5 re 94 67 0 Hord eum 7 vulga 3 re 8 subs BA 326 2 P - J99 503 3 vulga 30 44 202 153 predicted protein [Hordeum vulgare subsp. vulgare] 5 re 95 68 0 Oryz a 7 sativ NP Os05g0363 100 [Oryza sativa Japonica Group] 2 a _oo >gil54287660lgblAAV3 1404. 11putative 0 Japo 105 115 phospholipase [Oryza sativa Japonica Group] 5 nica 531 463 >gill 13578868ldbjlBAF1723 1.11Os05g0363 100 8 Grou 30 44 7 434 [Oryza sativa Japonica Group] 8 P 96 69 0 Oryz a 7 sativ 2 a EE 0 Japo E6 543 5 nica 343 986 hypothetical protein OsJ_18244 [Oryza sativa 8 Grou 30 1 60 Japonica Group] 8 P 97 XP 25 _oo hypothetical protein SORBIDRAFT_03g0 12970 Sorg 5- 245 242 [Sorghum bicolor] >gil241927523lgblEES00668. 1l hum 27 554 052 hypothetical protein SORBIDRAFT_03g0 12970 bicol 30 44 4 8 804 [Sorghum bicolor] 1 or 98 70 XP 66 _oo hypothetical protein SORBIDRAFT_07gO 19500 Sorg 0- 244 242 [Sorghum bicolor] >gil241940635lgblEES 13780. 1l hum 67 428 079 hypothetical protein SORBIDRAFT_07gO 19500 bicol 30 44 9 5 032 [Sorghum bicolor] 1 or 99 7 1 0

7 NP 9 _oo 5 114 226 F-box domain containing protein [Zea mays] 1 916 533 >gill95625 194lgblACG34427. 1lF-box domain 5 Zea 31 44 4 573 containing protein [Zea mays] 4 mays 00 72 Predi 34 NP 239 hypothetical protein LOCI 00 194090 [Zea mays] cted 4- _oo 047 >gill94703996lgblACF86082. 11unknown [Zea Zea 31 44 siRN 36 113 681 mays] >gil238908725lgblACF8 1540.21 unknown 1 mays 0 1 73

0 Oryz a 7 sativ NP 0 a _oo 3 Japo 105 115 Os04g0658600 [Oryza sativa Japonica Group] 0 nica 412 461 >gill l3565700ldbjlBAF16043. 1IOs04g0658600 4 Grou 31 44 9 057 [Oryza sativa Japonica Group] 1 P 23 94 Oryz 0 a sativ 7 a CA 0 Indie H6 116 4 a 779 310 OSIGBa0132E09-OSIGBa0108L24.7 [Oryza sativa 8 Grou 31 44 3 844 Indica Group] 3 P 24 95 0 Oryz a 7 sativ 0 a EA 3 Indie Y9 543 0 a 588 625 hypothetical protein OsI_17752 [Oryza sativa Indica 4 Grou 31 9 48 Group] 1 P 25 NP 1 _oo - 114 226 nitrate-induced NOI protein [Zea mays] 3 839 531 >gil1956 18920lgblACG3 1290. 11nitrate-induced Zea 31 44 1 629 NOI protein [Zea mays] 1 mays 26 96 0

8 XP 5 _oo hypothetical protein SORBIDRAFT_06g028920 8 Sorg 244 242 [Sorghum bicolor] >gil241939735lgblEES 12880. 11 6 hum 855 077 hypothetical protein SORBIDRAFT_06g028920 9 bicol 31 44 2 231 [Sorghum bicolor] 6 or 27 97 Os04g0620600 [Oryza sativa Japonica Group] >gil38344338lemblCAE02154.2l 0 Oryz OSJNBa0058K23.20 [Oryza sativa Japonica Group] a >gill l3565479ldbj IB AF15822. i lOs04g0620600 7 sativ NP [Oryza sativa Japonica Group] 1 a _oo >gill 16309950lemblCAH6698 1.11H07 14H04.8 7 Japo 105 115 [Oryza sativa Indica Group] 3 nica 390 460 >gil215768265ldbj IB AH00494. i lunnamed protein 9 Grou 31 44 8 615 product [Oryza sativa Japonica Group] 1 P 28 98 8 AC - F8 194 0 453 700 Zea 31 44 3 7 905 unknown [Zea mays] 1 mays 29 99 0 Hord eum 7 vulga AA 1 re M l 201 similar to H. sapiens NNP-1 / Nop52 AP001752 0 subs 344 529 (Score = 92; E= 9e-18) [Hordeum vulgare subsp. 9 P 31 45 1 72 vulgare] 0 vulga 30 00 9 re XP _oo hypothetical protein SORBIDRAFT_08g020610 Sorg 244 242 [Sorghum bicolor] >gil241944190lgblEES 17335. 11 hum 349 086 hypothetical protein SORBIDRAFT_08g020610 bicol 31 45 7 143 [Sorghum bicolor] 1 or 31 0 1 0

9 NP 8 _oo 1 110 239 H+-translocating pyrophosphatase [Zea mays] 2 606 985 >gill l7622272lgblABK5 1382. 1IH+-translocating 2 Zea 31 45 7 666 pyrophosphatase [Zea mays] 7 mays 32 02 0 Oryz a 9 sativ 4 a EE 6 Indie C7 543 1 a 334 625 hypothetical protein Osl_07556 [Oryza sativa Indica 8 Grou 31 8 48 Group] 3 P 33 Os02g0537900 [Oryza sativa Japonica Group] >gil5025 1984ldbjlBAD27918. 11putative vacuolar- type H+-translocating inorganic pyrophosphatase [Oryza sativa Japonica Group] Oryz >gil50252660ldbj IBAD28829. i lputative vacuolar- 0 a type H+-translocating inorganic pyrophosphatase sativ NP [Oryza sativa Japonica Group] 9 a _oo >gill l3536582ldbjlBAF08965. 1IOs02g0537900 4 Japo 104 115 [Oryza sativa Japonica Group] 3 nica 705 446 >gil222623005lgblEEE57 137. 11hypothetical 6 Grou 31 45 1 542 protein OsJ_07039 [Oryza sativa Japonica Group] 8 P 34 03 0 Hord eum 9 vulga 1 re 8 subs BA 326 6 P - J95 500 4 vulga 31 45 133 933 predicted protein [Hordeum vulgare subsp. vulgare] 8 re 35 04 0 RecName: Full=Pyrophosphate-energized membrane proton pump 3; AltName: Full=AVPl-like protein 2; 8 AltName: Full=Pyrophosphate-energized inorganic 6 Arab pyrophosphatase 3; Short=H(+)-PPase 3 2 idops Q9 >gil9954727lgblAAG09080. 1IAC026237_1 3 is FW Putative vacuolar-type H+-translocating inorganic 2 thalia 31 R2 pyrophosphatase [Arabidopsis thaliana] 8 na 36 0

8 Pyrophosphate-energized membrane proton pump 3 6 Arab NP [Arabidopsis thaliana] 2 idops _17 334 >gil332191375lgblAEE29496. 1lPyrophosphate- 3 is 312 182 energized membrane proton pump 3 [Arabidopsis 2 thalia 31 45 2 630 thaliana] 8 na 37 05 0

XP 8 _oo 7 226 225 PREDICTED: hypothetical protein [Vitis vinifera] 2 Vitis 581 443 >gil297735766lemblCBI18453.3l unnamed protein 3 vinif 31 45 1 360 product [Vitis vinifera] 4 era 38 06 Arab 0 idops is 8 lyrat XP 6 a _oo vacuolar H+-pyrophosphatase 2 [Arabidopsis lyrata 2 subs 288 297 subsp. lyrata] >gil297333603lgblEFH64021 .1l 3 P 776 839 vacuolar H+-pyrophosphatase 2 [Arabidopsis lyrata 2 lyrat 31 45 2 760 subsp. lyrata] 8 a 39 07 pyrophosphate-energized membrane proton pump 2 [Arabidopsis thaliana] >gill86496309lreflNP_001 117619. 11 pyrophosphate-energized membrane proton pump 2 [Arabidopsis thaliana] >gil83287950lsplQ56ZN6.2IAVP2_ARATH RecName: Full=Pyrophosphate-energized membrane proton pump 2; AltName: Full=AVPl-like protein 1; AltName: Full=Pyrophosphate-energized inorganic pyrophosphatase 2; Short=H(+)-PPase 2; AltName: Full=Vacuolar proton pyrophosphatase 2 >gil7024455ldbjlBAA9215 1.11vacuolar- pyrophosphatase like protein [Arabidopsis thaliana] >gill54508 10lgblAAK96676. 1l Similar to vacuolar H+-pyrophosphatase [Arabidopsis thaliana] >gil34098827lgblAAQ56796. 1l Atlg78920 0 [Arabidopsis thaliana] >gil332198056lgblAEE36177. 11pyrophosphate- 8 Arab NP energized membrane proton pump 2 [Arabidopsis 5 idops _56 145 thaliana] >gil332198057lgblAEE36178. 1l 6 is 5 19 337 pyrophosphate-energized membrane proton pump 2 0 thalia 31 45 5 727 [Arabidopsis thaliana] 7 na 40 08 Predi cted NP siRN _oo A 35 116 293 hypothetical protein LOC10038 1282 [Zea mays] 6053 765 33 1 >gill94708280lgblACF88224. 11unknown [Zea Zea 31 45 3 54 2 418 mays] 1 mays 4 1 09 0 Oryz a 7 sativ NP 9 a _oo 3 Japo 106 115 Os07g0656900 [Oryza sativa Japonica Group] 4 nica 050 473 >gil11361 2044ldbj IB AF22422. 11Os07g0656900 5 Grou 31 45 8 818 [Oryza sativa Japonica Group] 1 P 42 10 0 Oryz EE a E6 543 7 sativ 773 986 hypothetical protein OsJ_25423 [Oryza sativa 9 a 31 4 60 Japonica Group] 3 Japo 43

6 0 Oryz a 8 sativ 5 a AA 4 Japo 0 3 210 0 nica 231 709 putative oligopeptide transporter protein [Oryza sativa 8 Grou 31 45 3 19 Japonica Group] 3 P 51 17 0

8 0 Arab 1 idops 0 2 RecName: Full=01igopeptide transporter 3; 8 is 348 Short=AtOPT3 >gil25083021 lgblAAN72034. 11 7 thalia 31 2 isp4 like protein [Arabidopsis thaliana] 4 na 52 0

8 0 Arab AA 0 idops K9 154 5 is 678 510 3 thalia 31 45 1 19 Unknown protein [Arabidopsis thaliana] 5 na 53 18 Arab 0 idops is 8 lyrat XP hypothetical protein ARALYDRAFT_355 122 0 a _oo [Arabidopsis lyrata subsp. lyrata] 1 subs 286 297 >gil2973 13975lgblEFH44398. 11hypothetical 8 P 813 800 protein ARALYDRAFT_355 122 [Arabidopsis lyrata 7 lyrat 31 45 9 509 subsp. lyrata] 4 a 54 19

AC R3 238 506 008 Zea 31 45 5 059 unknown [Zea mays] 1 mays 55 20 AC N2 223 900 949 Zea 31 45 8 848 unknown [Zea mays] 1 mays 56 2 1 0

9 NP 9 _oo 6 114 226 serine carboxypeptidase 1 [Zea mays] 1 790 502 >gill95614482lgblACG29071 .11serine 8 Zea 31 45 4 317 carboxypeptidase 1 precursor [Zea mays] 3 mays 57 22 0 XP _oo hypothetical protein SORBIDRAFT_02g041610 9 Sorg 246 242 [Sorghum bicolor] >gil241926688lgblEER99832. 1l 0 hum 33 1 05 1 hypothetical protein SORBIDRAFT_02g041610 2 bicol 31 45 1 133 [Sorghum bicolor] 6 or 58 23 7 2 0

8 7 AC 7 N2 223 8 641 944 6 Zea 31 45 4 660 unknown [Zea mays] 3 mays 59 24 0

8 NP 7 _oo 4 114 226 LOCI 0028 1439 [Zea mays] 0 782 509 >gill95613988lgblACG28824. 1l serine 4 Zea 31 45 9 933 carboxypeptidase 1 precursor [Zea mays] 6 mays 60 25 0 Oryz a 7 sativ 3 a BA 6 Japo CI 505 6 nica 613 101 putative serine carboxypeptidase II-3 precursor [Oryza 4 Grou 31 45 1 31 sativa Japonica Group] 1 P 6 1 26 0 Hord eum 7 vulga 3 re 2 subs BA 326 8 P J94 490 2 vulga 31 45 105 062 predicted protein [Hordeum vulgare subsp. vulgare] 4 re 62 27 RecName: Full=Serine carboxypeptidase II-3; AltName: Full=CP-MII.3; Contains: RecName: 0 Hord Full=Serine carboxypeptidase II-3 chain A; Contains: eum RecName: Full=Serine carboxypeptidase II-3 chain B; 7 vulga Flags: Precursor >gil474392lemblCAA55478. 1l 3 re serine carboxylase II-3 [Hordeum vulgare subsp. 0 subs P5 vulgare] >gil619350lgblAAB3 1589. 11CP- 9 P 271 MII.3=serine carboxypeptidase [Hordeum 1 vulga 31 1 vulgare=barley, cv. Alexis, aleurone, Peptide, 516 aa] 6 re 63 Os01g0834500 [Oryza sativa Japonica Group] >gil 1154562 15IrefINP_00 105 1708 .11 Os03g08 18400 [Oryza sativa Japonica Group] >gil29772055 1lreflNP_001 172637. 11 Os01g08 34601 [Oryza sativa Japonica Group] >gil3 13 103637lpdbl3IZ6IL Chain L, Localization Of The Small Subunit Ribosomal Proteins Into A 5.5 Oryz A Cryo-Em Map Of Triticum Aestivum Translating a Predi 80s Ribosome >gil20805266ldbj IBAB92932. i l sativ cted NP putative 40s ribosomal protein S23 [Oryza sativa a siRN 16 _oo Japonica Group] >gi 120805267Idbj IB AB92933. i l Japo A 1- 104 115 putative 40s ribosomal protein S23 [Oryza sativa nica 6071 18 472 440 Japonica Group] >gil21671347ldbjlBAC02683. 1l Grou 31 45 8 2 0 880 putative 40s ribosomal protein S23 [Oryza sativa 1 P 64 28 Japonica Group] >gi 1 167 1348 Idbj IB AC02684. 11 putative 40s ribosomal protein S23 [Oryza sativa Japonica Group] >gil28876025lgblAAO60034. 1l 40S ribosomal protein S23 [Oryza sativa Japonica Group] >gil291241 15lgblAA065856. 1l40S ribosomal protein S23 [Oryza sativa Japonica Group] >gill 087 1177 1IgblABF99566. 1140S ribosomal protein S23, putative, expressed [Oryza sativa Japonica Group] >gill 1353425 1Idbj IB AF06634. 11 Os01g0834500 [Oryza sativa Japonica Group] >gil 113550 179ldbj IB AF1 3622. 11Os03g08 18400 [Oryza sativa Japonica Group] >gill25528286lgblEAY76400. I Ihypothetical protein Osl_04329 [Oryza sativa Indica Group] >gil 1255462 16lgblEAY92355 .11hypothetical protein Osl_14082 [Oryza sativa Indica Group] >gil215697420ldbj IBAG91414. i lunnamed protein product [Oryza sativa Japonica Group] >gil215734943ldbjlBAG95665. I Iunnamed protein product [Oryza sativa Japonica Group] >gil255673847ldbj IB AH91367. i l Os01g0834601 [Oryza sativa Japonica Group] >gil326501 134ldbj IB AJ98798. i lpredicted protein [Hordeum vulgare subsp. vulgare] >gil326506086ldbj IB AJ91282. i lpredicted protein [Hordeum vulgare subsp. vulgare] hypothetical protein LOCI 00 192600 [Zea mays] >gil242032479lreflXP_002463634. 11hypothetical protein SORBIDRAFT_01g003410 [Sorghum bicolor] >gil242059153lreflXP_002458722. 1lhypothetical protein SORBIDRAFT_03g039010 [Sorghum bicolor] >gil242090801 lreflXP_002441233. 11hypothetical protein SORBIDRAFT_09g022840 [Sorghum bicolor] >gill94691088lgblACF79628. I Iunknown [Zea mays] >gill94697612lgblACF82890. I Iunknown [Zea mays] >gill94702740lgblACF85454. 1l unknown [Zea mays] >gill95606082lgblACG24871 .1l40S ribosomal protein S23 [Zea mays] >gi 119561 8728 IgbIACG3 1194. 1140S ribosomal protein S23 [Zea mays] >gil 1956 19636lgbl ACG3 1648 .1140S ribosomal protein S23 [Zea mays] >gi 1195625 318IgblACG34489. 1140S ribosomal protein S23 [Zea mays] >gi 1195628702lgbl ACG36 18 1.1140S ribosomal protein S23 [Zea mays] >gill95657679lgblACG48307. 1l40S ribosomal protein S23 [Zea mays] >gil238012290lgblACR37180. 1lunknown [Zea mays] >gil241917488lgblEER90632. 1l hypothetical NP protein SORBIDRAFT_01g003410 [Sorghum bicolor] _00 >gil241930697lgblEES03842. I Ihypothetical 113 212 protein SORBIDRAFT_03g039010 [Sorghum bicolor] 128 722 >gil2419465 18lgblEES 19663. 11hypothetical Zea 31 45 7 729 protein SORBIDRAFT_09g022840 [Sorghum bicolor] mays 65 29 AC 195 Zea 31 45 G3 622 40S ribosomal protein S23 [Zea mays] mays 66 30

5 6 2 12 XP 93 _oo hypothetical protein SORBIDRAFT_04g006610 Sorg 245 242 [Sorghum bicolor] >gil24193 1553lgblEES04698. 1l hum 13 172 060 hypothetical protein SORBIDRAFT_04g006610 bicol 31 45 14 2 865 [Sorghum bicolor] 1 or 74 38 Predi cted NP hypothetical protein LOCI 00279270 [Zea mays] siRN 43 _oo >gil219884277lgblACL525 13. 11unknown [Zea A 7- 114 226 mays] >gil219884335lgblACL52542. 1l unknown 6083 45 576 491 [Zea mays] >gil224028501lgblACN33326. 1l Zea 31 45 3 4 3 569 unknown [Zea mays] 1 mays 75 39 0 Oryz a 8 sativ NP Os05g0132100 [Oryza sativa Japonica Group] 2 a _oo >gill l3578 107ldbj IB AF16470. i l Os05g0132100 8 Japo 105 115 [Oryza sativa Japonica Group] 3 nica 455 461 >gil222630090lgblEEE62222. 11hypothetical 5 Grou 31 45 6 912 protein OsJ_ 17009 [Oryza sativa Japonica Group] 8 P 76 40 0 Oryz a 8 sativ 1 a EE 0 Indie C7 543 4 a 846 625 hypothetical protein OsI_18335 [Oryza sativa Indica 4 Grou 31 6 48 Group] 8 P 77 0 Oryz a 7 sativ 5 a BA 3 Japo G9 329 7 nica 731 908 unnamed protein product [Oryza sativa Japonica 3 Grou 31 45 5 27 Group] 1 P 78 4 1 16 XP 60 _oo hypothetical protein SORBIDRAFT_03g036030 Sorg 245 242 [Sorghum bicolor] >gil241928399lgblEES01544. 1l hum 16 642 054 hypothetical protein SORBIDRAFT_03g036030 bicol 31 45 77 4 556 [Sorghum bicolor] 1 or 79 42 0

9 NP 8 _oo hypothetical protein LOCI 00274376 [Zea mays] 7 114 226 >gill94702286lgblACF85227. 11unknown [Zea 9 220 496 mays] >gill94707600lgblACF87884. 11unknown 0 Zea 31 45 8 106 [Zea mays] 3 mays 80 43 Os01g0772800 [Oryza sativa Japonica Group] 0 Oryz NP >gi 120 1609 17Idbj IB AB89854. i lputative signal a _oo recognition particle 54kD protein [Oryza sativa 9 sativ 104 115 Japonica Group] >gil21743252ldbjlBAC03250. 1l 4 a 439 440 putative signal recognition particle 54kD protein 7 Japo 31 45 5 230 [Oryza sativa Japonica Group] 5 nica 81 44 >gil32879776ldbj IBAC79360.i l signal recognition 8 Grou particle 54kDa subunit [Oryza sativa Japonica Group] 1 P >gill l3533926ldbj IB AF06309. i lOs01g0772800 [Oryza sativa Japonica Group] >gil215767979ldbjlBAH00208. 11unnamed protein product [Oryza sativa Japonica Group] >gil22261933 1lgblEEE55463. 11hypothetical protein OsJ_03626 [Oryza sativa Japonica Group] 0 Oryz a 9 sativ 4 a EE 5 Indie C7 543 5 a 155 625 hypothetical protein Osl_03915 [Oryza sativa Indica 6 Grou 31 9 48 Group] 5 P 82 0

9 XP 0 Ricin _oo signal recognition particle 54 kD protein, putative 5 us 25 1 255 [Ricinus communis] 2 com 766 553 >gil223543295lgblEEF44827. 1l signal recognition 4 muni 31 45 3 240 particle 54 kD protein, putative [Ricinus communis] 2 s 83 45 0

8 XP 8 Popu _oo 7 lus 229 224 predicted protein [Populus trichocarpa] 0 trich 979 059 >gil222847057lgblEEE84604. 11predicted protein 9 ocarp 31 45 9 269 [Populus trichocarpa] 7 a 84 46 0

8 XP 8 _oo 7 226 225 0 Vitis 415 442 9 vinif 31 45 9 909 PREDICTED: hypothetical protein [Vitis vinifera] 7 era 85 47 0

8 XP 9 Popu _oo 3 lus 232 224 predicted protein [Populus trichocarpa] 1 trich 296 139 >gil222867598lgblEEF04729. 11predicted protein 4 ocarp 31 45 8 05 1 [Populus trichocarpa] 5 a 86 48 0

8 8 Popu AB 5 lus K9 118 0 trich 581 487 8 ocarp 31 45 9 995 unknown [Populus trichocarpa] 1 a 87 49 XP 242 hypothetical protein SORBIDRAFT_01g017160 1 Sorg 31 45

7 subs 0 P 4 vulga 4 re 0 Hord eum 7 vulga 2 re 3 subs BA 326 6 P J93 488 0 vulga 31 45 808 278 predicted protein [Hordeum vulgare subsp. vulgare] 8 re 96 57 XP _oo hypothetical protein SORBIDRAFT_06g032450 Sorg 244 242 [Sorghum bicolor] >gil241939925lgblEES 13070. 1l hum 874 077 hypothetical protein SORBIDRAFT_06g032450 bicol 31 45 2 6 11 [Sorghum bicolor] 1 or 97 58 unknown [Zea mays] >gill94707726lgblACF87947. 11unknown [Zea 0 mays] >gill9561 1472lgblACG27566. 1llysine- specific histone demethylase 1 [Zea mays] 9 >gil1956 16900lgblACG30280. 11lysine-specific 6 AC histone demethylase 1 [Zea mays] 9 F7 238 >gil223950041 lgblACN29104. 1lunknown [Zea 1 874 908 mays] >gil22403 1369lgblACN34760. 11unknown 9 Zea 31 45 9 545 [Zea mays] 9 mays 98 59 Os04g0671200 [Oryza sativa Japonica Group] >gil32488409lemblCAE02834. 11 OSJNBa0043A12.39 [Oryza sativa Japonica Group] >gil90265248lemblCAH67701 .11H0624F09.9 0 Oryz [Oryza sativa Indica Group] a >gil113565789ldbj IB AF16132. 11Os04g067 1200 9 sativ NP [Oryza sativa Japonica Group] 0 a _oo >gill25550177lgblEAY95999. 11hypothetical 5 Japo 105 115 protein Osl_17870 [Oryza sativa Indica Group] 5 nica 421 461 >gill25592017lgblEAZ32367. 11hypothetical 4 Grou 31 45 8 235 protein OsJ_16578 [Oryza sativa Japonica Group] 4 P 99 60 0 XP _oo hypothetical protein SORBIDRAFT_06g032460 7 Sorg 244 242 [Sorghum bicolor] >gil241939927lgblEES 13072. 1l 5 hum 874 077 hypothetical protein SORBIDRAFT_06g032460 7 bicol 32 45 4 615 [Sorghum bicolor] 7 or 00 6 1 Os04g0671300 [Oryza sativa Japonica Group] >gil90265249lemblCAH67702. 11H0624F09. 10 [Oryza sativa Indica Group] >gil113565790ldbj IB AF16133.11Os04g067 1300 Oryz [Oryza sativa Japonica Group] 0 a >gil215704120ldbj IBAG92960.i lunnamed protein sativ NP product [Oryza sativa Japonica Group] 7 a _oo >gil21819580 1lgblEEC78228.11hypothetical 5 Japo 105 115 protein OsI_17871 [Oryza sativa Indica Group] 1 nica 421 461 >gil222629752lgblEEE61884. 1lhypothetical 5 Grou 32 45 9 237 protein OsJ_ 16579 [Oryza sativa Japonica Group] 4 P 0 1 62 CA 706 0 Oryz E O 639 a 32 45 359 36 OSJNBb0004A17. 1 [Oryza sativa Japonica Group] 7 sativ 02 63

XP 1 _oo hypothetical protein SORBIDRAFT_06gO 17770 Sorg - 244 242 [Sorghum bicolor] >gil24 1939091 IgblEES 12236. 11 hum 3 790 075 hypothetical protein SORBIDRAFT_06gO 17770 bicol 32 45 8 943 [Sorghum bicolor] 1 or 18 78 0

9 NP 1 _oo 6 110 162 barley mlo defense gene homolog3 [Zea mays] 6 552 461 >gill 3784979lgblAAK38339. 11seven 6 Zea 32 45 7 261 transmembrane protein Mlo3 [Zea mays] 7 mays 19 79 0 Oryz a 7 sativ 0 a EA 2 Indie Y9 543 3 a 427 625 hypothetical protein OsI_ 16042 [Oryza sativa Indica 8 Grou 32 3 48 Group] 1 P 20 0 Oryz a 7 sativ OSJNBa0027P08.3 [Oryza sativa Japonica Group] 0 a CA >gil21742880lemblCAD41046. 1l 2 Japo D4 324 OSJNBa0058G03.6 [Oryza sativa Japonica Group] 3 nica 097 829 >gill255905 10lgblEAZ30860. 11hypothetical 8 Grou 32 45 4 17 protein OsJ_14932 [Oryza sativa Japonica Group] 1 P 2 1 80 XP 6 _oo hypothetical protein SORBIDRAFT_08g004520 Sorg - 244 242 [Sorghum bicolor] >gil241943588lgblEES 16733. 11 hum 7 289 084 hypothetical protein SORBIDRAFT_08g004520 bicol 32 45 5 939 [Sorghum bicolor] 1 or 22 8 1 0

7 6 AC 9 N3 224 2 636 034 3 Zea 32 45 8 584 unknown [Zea mays] 1 mays 23 82 0

7 NP 6 _oo 4 115 226 bile acid sodium symporter/ transporter [Zea mays] 2 235 496 >gill95655405lgblACG47170. 1lbile acid sodium 6 Zea 32 45 1 368 symporter/ transporter [Zea mays] 8 mays 24 83 0 Oryz a 7 sativ AB 2 a A9 108 2 Japo 655 862 Sodium Bile acid symporter family protein, expressed 0 nica 32 45 6 058 [Oryza sativa Japonica Group] 8 Grou 25 84 4 P Oryz a sativ NP a _oo Japo 104 115 Os02g0820000 [Oryza sativa Japonica Group] nica 853 449 >gill l3538070ldbjlBAF10453. 1IOs02g0820000 Grou 32 45 9 732 [Oryza sativa Japonica Group] 1 P 26 85 protein phosphatase [Oryza sativa] >gil48716362ldbj IB AD22973. i lprotein phosphatase [Oryza sativa Japonica Group] >gil48716497ldbj IB AD23 102. i lprotein 0 phosphatase [Oryza sativa Japonica Group] >gil215767785ldbj IB AH00014. i lunnamed protein 9 product [Oryza sativa Japonica Group] 2 AA >gil2 18 191 835lgblEEC74262. 11hypothetical 1 Oryz K6 144 protein Osl_09476 [Oryza sativa Indica Group] 2 a 428 953 >gil222623927lgblEEE58059. 11hypothetical 8 sativ 32 45 3 45 protein OsJ_08899 [Oryza sativa Japonica Group] 3 a 27 86 0 serine/threonine-protein phosphatase PP1 [Zea mays] >gill30709lsplP22198. 1IPPl_MAIZE RecName: 8 NP Full=Serine/threonine-protein phosphatase PP1 6 _oo >gill68723lgblAAA33545. 11protein phosphatase-1 8 110 162 [Zea mays] >gil223944929lgblACN26548. 1l 8 534 462 unknown [Zea mays] >gil445586lprflll909338A 0 Zea 32 45 1 901 protein phosphatase 1 5 mays 28 87 0

7 XP 8 Ricin _oo serine/threonine protein phosphatase, putative [Ricinus 4 us 252 255 communis] >gil223538772lgblEEF40372. 11 2 com 196 561 serine/threonine protein phosphatase, putative [Ricinus 5 muni 32 45 8 918 communis] 7 s 29 88 0

7 XP 8 _oo 1 226 225 3 Vitis 555 453 4 vinif 32 45 2 025 PREDICTED: hypothetical protein [Vitis vinifera] 1 era 30 89 0

7 8 CA 1 N7 147 3 Vitis 148 842 4 vinif 32 9 159 hypothetical protein VITISV_005340 [Vitis vinifera] 1 era 31 0 AC U2 255 7 Glyci 461 648 9 ne 32 45 0 313 unknown [Glycine max] 0 max 32 90

2 0

NP 9 _oo 8 114 226 seed specific protein Bnl5D17A [Zea mays] 7 847 528 >gill95619590lgblACG3 1625. 1l seed specific 2 Zea 32 45 1 520 protein Bnl5D17A [Zea mays] 2 mays 4 1 99 0

8 XP 1 _oo hypothetical protein SORBIDRAFT_09g025710 7 Sorg 244 242 [Sorghum bicolor] >gi 124 1946673 IgblEES 198 18. 11 8 hum 138 091 hypothetical protein SORBIDRAFT_09g025710 9 bicol 32 46 8 110 [Sorghum bicolor] 1 or 42 00 NP 4 _oo - 110 162 SET domain protein SDG1 17 [Zea mays] 5 520 459 >gi 12826 1315IgblAA032935 .11SET domain Zea 32 46 6 735 protein SDG1 17 [Zea mays] 1 mays 43 0 1 Osl0g04 10600 [Oryza sativa Japonica Group] >gill585 13707lsplA3C4N5.2IPP2A4_ORYSJ RecName: Full=Serine/threonine-protein phosphatase PP2A-4 catalytic subunit >gil78708615lgblABB47590. 1l Serine/threonine protein phosphatase PP2A-4 catalytic subunit, Oryz putative, expressed [Oryza sativa Japonica Group] a >gil 113639 187ldbj IB AF26492. 11Os10g04 10600 sativ NP [Oryza sativa Japonica Group] a 5 _oo >gil215704585ldbjlBAG94218. 11unnamed protein Japo - 106 115 product [Oryza sativa Japonica Group] nica 7 457 481 >gil2226128 11lgblEEE50943. 11hypothetical Grou 32 46 8 969 protein OsJ_3 1490 [Oryza sativa Japonica Group] 1 P 44 02 Hord eum vulga predicted protein [Hordeum vulgare subsp. vulgare] re 6 >gil326500666ldbj IBAJ94999. i lpredicted protein subs - BA 326 [Hordeum vulgare subsp. vulgare] P 7 J85 493 >gil3265 13058ldbj IB AK03436. i lpredicted protein vulga 32 46 175 427 [Hordeum vulgare subsp. vulgare] 1 re 45 03 0

BA 8 F3 114 3 113 213 7 Vicia 32 46 2 457 catalytic subunit of protein phosphatase 1 [Vicia faba] 5 faba 46 04 Os03g0268000 [Oryza sativa Japonica Group] >gill08935873lsplP48489.2IPPl_ORYSJ Oryz RecName: Full=Serine/threonine-protein phosphatase 0 a PP1 >gil 108707369lgblABF95 164. 11 sativ NP Serine/threonine protein phosphatase PP1, putative, 8 a _oo expressed [Oryza sativa Japonica Group] 0 Japo 104 115 >gill08707370lgblABF95 165. 1l Serine/threonine 6 nica 966 452 protein phosphatase PP1, putative, expressed [Oryza 2 Grou 32 46 9 136 sativa Japonica Group] 5 P 47 05 >gil 10870737 1IgblABF95 166. 11Serine/threonine protein phosphatase PPl, putative, expressed [Oryza sativa Japonica Group] >gill l3548 140ldbjlBAF1 1583. 1IOs03g0268000 [Oryza sativa Japonica Group] >gil215706450ldbj IBAG93306. i lunnamed protein product [Oryza sativa Japonica Group] Predi cted 23 NP siRN 33 _oo A 110 162 starch synthase IIb-2 precursor [Zea mays] 6121 23 601 459 >gill45202746lgblABP35814. 1l starch synthase Zea 32 46 2 53 4 693 IIb-2 precursor [Zea mays] 1 mays 48 06 0

8 8 AC 0 Sorg C8 186 6 hum 684 695 8 bicol 32 46 5 419 starch synthase lib precursor [Sorghum bicolor] 2 or 49 07 0

8 AC 7 N3 223 6 177 975 4 Zea 32 46 9 182 unknown [Zea mays] 2 mays 50 08 0

8 NP 7 _oo 2 110 162 starch synthase homologl [Zea mays] 1 488 463 >gil265503 1lgblAAD13342. 1l starch synthase 5 Zea 32 46 0 587 isoform zSTSII-2 [Zea mays] 9 mays 5 1 09 RecName: Full=Soluble starch synthase 2-2, chloroplastic/amyloplastic; AltName: Full=Soluble starch synthase II-2; Flags: Precursor >gil262345641 lgblACY56184. 1l soluble starch synthase II-2 [Oryza sativa Japonica Group] >gil262345643lgblACY56185. 1l soluble starch synthase II-2 [Oryza sativa Japonica Group] >gil262345645lgblACY56186. 1l soluble starch 0 Oryz synthase II-2 [Oryza sativa Japonica Group] a >gil262345647lgblACY56187. 1l soluble starch 7 sativ synthase II-2 [Oryza sativa Japonica Group] 6 a >gil262345649lgblACY56188. 1l soluble starch 4 Japo Q6 synthase II-2 [Oryza sativa Japonica Group] 2 nica Z2 >gil26234565 1lgblACY56189. 1l soluble starch 0 Grou 32 T8 synthase II-2 [Oryza sativa Japonica Group] 5 P 52 hypothetical protein Osl_08916 [Oryza sativa Indica 0 Oryz Group] >gil262345653lgblACY56190. 1l soluble a EE starch synthase II-2 [Oryza sativa Indica Group] 7 sativ C7 543 >gil262345655lgblACY56191 .1l soluble starch 6 a 399 625 synthase II-2 [Oryza sativa Indica Group] 2 Indie 32 9 48 >gil262345657lgblACY56192. 1l soluble starch 7 a 53 synthase II-2 [Oryza sativa Indica Group] 8 Grou >gil262345659lgblACY56193. 1l soluble starch 4 P synthase II-2 [Oryza sativa Indica Group] >gil262345661 lgblACY56194. 1l soluble starch synthase II-2 [Oryza sativa Indica Group] >gil262345665lgblACY56196. 1l soluble starch synthase II-2 [Oryza sativa Indica Group] >gil262345667lgblACY56197. 1l soluble starch synthase II-2 [Oryza sativa Indica Group] Oryz a sativ NP a _oo 0 Japo 104 115 Os02g0744700 [Oryza sativa Japonica Group] nica 810 448 >gil 113537635 Idbj IB AF100 18.11Os02g0744700 7 Grou 32 46 4 648 [Oryza sativa Japonica Group] 5 P 54 10 0 Oryz a 7 sativ 6 a AC 1 Indie Y5 262 3 a 619 345 soluble starch synthase II-2 [Oryza sativa Indica 6 Grou 32 46 5 662 Group] 4 P 55 11 0

7 6 AA 1 Oryz K8 150 3 a 172 284 6 sativ 32 46 9 66 soluble starch synthase II-2 [Oryza sativa] 4 a 56 12 25 XP 30 _oo hypothetical protein SORBIDRAFT_04g028060 Sorg 245 242 [Sorghum bicolor] >gil241932387lgblEES05532. 1l hum 25 255 062 hypothetical protein SORBIDRAFT_04g028060 bicol 32 46 50 6 533 [Sorghum bicolor] 1 or 57 13 Hord eum Predi vulga cted re zma 85 subs mir 4- BA 326 P 4832 87 J91 5 11 vulga 32 46 7 4 900 5 10 predicted protein [Hordeum vulgare subsp. vulgare] 1 re 58 14 0 Oryz a 8 sativ putative protein kinase PK12 [Oryza sativa Japonica 5 a BA Group] >gil215694659ldbjlBAG89850. 1lunnamed 4 Japo D5 141 protein product [Oryza sativa Japonica Group] 4 nica 269 644 >gil2226 1877 1lgblEEE54903 .11hypothetical 1 Grou 32 46 5 03 protein OsJ_02427 [Oryza sativa Japonica Group] 5 P 59 15 AC 195 0 G3 626 Zea 32 46 532 991 serine/threonine-protein kinase AFC3 [Zea mays] 8 mays 60 16 6 4 4 8 6 9 0

8 4 AC 4 R3 238 8 436 006 6 Zea 32 46 4 657 unknown [Zea mays] 9 mays 6 1 17 0

8 3 AC 7 N2 223 7 899 949 0 Zea 32 46 4 820 unknown [Zea mays] 9 mays 62 18 0 Oryz a 8 sativ NP 3 a _oo 7 Japo 104 115 Os01g0590900 [Oryza sativa Japonica Group] 7 nica 345 438 >gill l3532983ldbj IB AF05366. i lOs01g0590900 0 Grou 32 46 2 077 [Oryza sativa Japonica Group] 9 P 63 19 0 Hord eum 7 vulga 6 re 8 subs BA 326 4 P - J98 501 9 vulga 32 46 839 215 predicted protein [Hordeum vulgare subsp. vulgare] 6 re 64 20 0

7 XP 0 _oo hypothetical protein SORBIDRAFT_03g026540 8 Sorg 245 242 [Sorghum bicolor] >gil241927842lgblEES00987. 1l 8 hum 586 053 hypothetical protein SORBIDRAFT_03g026540 3 bicol 32 46 7 442 [Sorghum bicolor] 1 or 65 2 1 0

XP 7 Popu _oo 1 lus 230 224 predicted protein [Populus trichocarpa] 5 trich 862 089 >gil222854601 lgblEEE92148. 11predicted protein 9 ocarp 32 46 5 073 [Populus trichocarpa] 9 a 66 22 XP _oo hypothetical protein SORBIDRAFT_03g036130 Sorg 245 242 [Sorghum bicolor] >gil241928404lgblEES01549. 1l hum 642 054 hypothetical protein SORBIDRAFT_03g036130 bicol 32 46 9 566 [Sorghum bicolor] 1 or 67 23

106 989 RecName: Full=Actin-depolymerizing factor 10; 8 sativ 508 Short=ADF-10; Short=OsADF10 9 a 8 >gil78708922lgblABB47897. 11Actin- 5 Japo depolymerizing factor, putative, expressed [Oryza 4 nica sativa Japonica Group] 2 Grou >gil 113639697ldbj IB AF27002. 11Os10g052 1100 5 P [Oryza sativa Japonica Group] >gil215693794ldbjlBAG88993. 11unnamed protein product [Oryza sativa Japonica Group] >gil215768406ldbjlBAH00635. 11unnamed protein product [Oryza sativa Japonica Group] >gil222613 147lgblEEE5 1279. 11hypothetical protein OsJ_32187 [Oryza sativa Japonica Group] 0 Oryz a 8 sativ 4 a RecName: Full=Putative actin-depolymerizing factor 3 Japo Q0 8; Short=ADF-8; Short=OsADF8 1 nica D7 >gil343943 10ldbj IBAC84792. i lputative actin 3 Grou 33 44 depolymerizing factor [Oryza sativa Japonica Group] 7 P 11 0 Oryz a 8 sativ 1 a EE 6 Japo E5 543 9 nica 813 986 hypothetical protein OsJ_09029 [Oryza sativa 9 Grou 33 0 60 Japonica Group] 3 P 12 Predi cted XP zma 89 _oo hypothetical protein SORBIDRAFT_01g034550 Sorg mir 3- 246 242 [Sorghum bicolor] >gil241919080lgblEER92224. 1l hum 4924 9 1 522 035 hypothetical protein SORBIDRAFT_01g034550 bicol 33 46 8 3 6 662 [Sorghum bicolor] 1 or 13 6 1 proline-rich family protein, putative, expressed [Oryza sativa Japonica Group] Oryz >gill08708320lgblABF961 15. 11proline-rich family a protein, putative, expressed [Oryza sativa Japonica 0 sativ Group] >gil218 192888lgblEEC753 15. 1l a AB hypothetical protein OsI_l 1686 [Oryza sativa Indica 8 Japo F9 108 Group] >gil222624967lgblEEE59099. 11 5 nica 6 11 705 hypothetical protein OsJ_10953 [Oryza sativa 8 Grou 33 46 4 663 Japonica Group] 3 P 14 62 Os07g0642800 [Oryza sativa Japonica Group] >gi 13 3146645 Idbj IBAC79975. i lunknown protein [Oryza sativa Japonica Group] >gil50509935ldbj IB AD30256. i lunknown protein 0 Oryz [Oryza sativa Japonica Group] a >gil 11361 1974ldbj IB AF22352. 11Os07g0642800 7 sativ NP [Oryza sativa Japonica Group] 2 a _oo >gi 112560 1263 IgbIE AZ408 39.11hypothetical 2 Japo 106 115 protein OsJ_25318 [Oryza sativa Japonica Group] 6 nica 043 473 >gil215707132ldbj IBAG93592. i lunnamed protein 7 Grou 33 46 8 678 product [Oryza sativa Japonica Group] 2 P 15 63 NP 219 hypothetical protein LOCI 002 1698 1 [Zea mays] 0 Zea 33 46 _oo 362 >gill94697292lgblACF82730. 11unknown [Zea mays 16 64 113 356 mays] >gil223944185lgblACN26176. 1lunknown 7 683 [Zea mays] 1 2 4 5 7 5 0 Oryz a 7 sativ 2 a EA 0 Indie Z O 543 6 a 488 625 hypothetical protein Osl_27067 [Oryza sativa Indica 4 Grou 33 5 48 Group] 8 P 17 0

7 XP 2 _oo hypothetical protein SORBIDRAFT_02g040980 0 Sorg 246 242 [Sorghum bicolor] >gil241924490lgblEER97634. 11 6 hum 111 046 hypothetical protein SORBIDRAFT_02g040980 4 bicol 33 46 3 733 [Sorghum bicolor] 8 or 18 65 0 Hord eum 7 vulga 1 re BA 8 subs KO 326 6 P - 709 5 15 2 vulga 33 46 8 703 predicted protein [Hordeum vulgare subsp. vulgare] 3 re 19 66 YP _oo Coix 320 260 ribosomal protein S3 [Coix lacryma-jobi] lacry 822 677 >gil209361395lgblACI433 10. 1lribosomal protein ma- 33 46 5 373 S3 [Coix lacryma-jobi] 1 jobi 20 67 ribosomal protein S3 [Indocalamus longiauritus] >gil340034064lreflYP_004733616. 11ribosomal protein S3 [Phyllostachys edulis] >gil340034235lreflYP_004733798. 11ribosomal protein S3 [Acidosasa purpurea] >gil340034403lreflYP_004734016. 11ribosomal protein S3 [Phyllostachys nigra var. henonis] >gil340034574lreflYP_004734223. 11ribosomal protein S3 [Ferrocalamus rimosivaginus] >gil307133924lgblADN32929. 11ribosomal protein S3 [Phyllostachys nigra var. henonis] >gil309321655lgblADO65 180. 1lribosomal protein 0 S3 [Acidosasa purpurea] >gil309321739lgblADO65263. 11ribosomal protein 9 Indo YP S3 [Ferrocalamus rimosivaginus] 5 cala _oo >gil309321823lgblADO65346. 1lribosomal protein 9 mus 473 339 S3 [Indocalamus longiauritus] 8 longi 328 906 >gil309321906lgblADO65428. 11ribosomal protein 2 aurit 33 46 2 432 S3 [Phyllostachys edulis] 1 us 2 1 68 AE 337 0 Pueli 170 730 a 33 46 820 95 1 ribosomal protein S3 [Puelia olyriformis] 9 olyrif 22 69

_oo 093 >gil222852841 lgblEEE90388. 1lamino acid lus 29 76 230 574 transporter [Populus trichocarpa] 8 trich 993 2 ocarp 8 7 a 3 2 4 0

8 2 3 CB 270 5 Vitis 121 232 2 vinif 33 46 593 045 unnamed protein product [Vitis vinifera] 9 era 30 77 0

8 XP 2 _oo 1 227 225 6 Vitis 476 438 3 vinif 33 46 2 399 PREDICTED: hypothetical protein [Vitis vinifera] 2 era 31 78 0

8 1 CA 9 N6 147 7 Vitis 078 773 3 vinif 33 46 9 95 1 hypothetical protein VITISV_000645 [Vitis vinifera] 4 era 32 79 0

7 XP 4 Ricin _oo GABA-specific permease, putative [Ricinus 1 us 252 255 communis] >gil223540533lgblEEF42100. 1l 9 com 031 558 GABA-specific permease, putative [Ricinus 3 muni 33 46 4 577 communis] 5 s 33 80 0

7 XP 5 _oo 3 228 225 3 Vitis 460 459 2 vinif 33 46 3 654 PREDICTED: hypothetical protein [Vitis vinifera] 1 era 34 8 1 XP _oo hypothetical protein SORBIDRAFT_03g043360 Sorg 245 242 [Sorghum bicolor] >gil241928793lgblEES01938. 1l hum 681 055 hypothetical protein SORBIDRAFT_03g043360 bicol 33 46 8 344 [Sorghum bicolor] 1 or 35 82 NP hypothetical protein LOCI 00277624 [Zea mays] 0 _oo >gil195644550lgblACG4 1743.11hypothetical 114 226 protein [Zea mays] 8 460 505 >gil224033445lgblACN35798. 11unknown [Zea 9 Zea 33 46 8 097 mays] 9 mays 36 83 2 4 4 Os08g05 13300 [Oryza sativa Japonica Group] >gil42408809ldbj IB AD10070. i lunknown protein [Oryza sativa Japonica Group] >gill l3624194ldbj IB AF24139. i l Os08g05 13300 0 Oryz [Oryza sativa Japonica Group] a >gil 125562 163lgblEAZ076 11.11hypothetical 7 sativ NP protein OsI_29862 [Oryza sativa Indica Group] 4 a _oo >gill25603995lgblEAZ43320. 11hypothetical 3 Japo 106 115 protein OsJ_27916 [Oryza sativa Japonica Group] 0 nica 222 477 >gil21569713 1ldbj IBAG91 125. i lunnamed protein 7 Grou 33 46 5 257 product [Oryza sativa Japonica Group] 3 P 37 84 Hord 0 eum vulga 7 re 0 subs BA 326 5 P J93 528 2 vulga 33 46 470 576 predicted protein [Hordeum vulgare subsp. vulgare] 9 re 38 85 XP 5 _oo hypothetical protein SORBIDRAFT_02g039350 Sorg - 246 242 [Sorghum bicolor] >gil241924399lgblEER97543. 1l hum 7 102 046 hypothetical protein SORBIDRAFT_02g039350 bicol 33 46 2 301 [Sorghum bicolor] 1 or 39 86 NP 6 _oo - 114 226 receptor-like protein kinase [Zea mays] 8 759 502 >gil 1956 12392lgblACG28026. 11receptor-like Zea 33 46 3 838 protein kinase [Zea mays] 1 mays 40 87 OslOgOlOlOOO [Oryza sativa Japonica Group] >gill 848 1964lgblAAL73562. 1IAC079632_6 Putative receptor-like protein kinase [Oryza sativa Japonica Group] >gill9920204lgblAAM08636. 1IAC108883_9 Putative receptor-like protein kinase [Oryza sativa 0 Oryz Japonica Group] >gil3 1429736lgblAAP5 1745. 1l a Protein kinase domain containing protein, expressed 7 sativ NP [Oryza sativa Japonica Group] 3 a _oo >gil 113638622ldbj IB AF25927. 11Os1OgO 10 1000 6 Japo 106 115 [Oryza sativa Japonica Group] 1 nica 401 480 >gill25573756lgblEAZ15040. 11hypothetical 9 Grou 33 46 3 839 protein OsJ_30450 [Oryza sativa Japonica Group] 6 P 4 1 88 Hord 0 eum vulga 7 re 1 subs BA 326 4 P J93 528 1 vulga 33 46 355 346 predicted protein [Hordeum vulgare subsp. vulgare] 1 re 42 89 0 Hord BA 326 eum J85 495 7 vulga 33 46 838 483 predicted protein [Hordeum vulgare subsp. vulgare] 1 re 43 90 2 subs 8 P 8 vulga 3 re Predi cted NP zma 73 _oo hypothetical protein LOC100194336 [Zea mays] mir 2- 113 239 >gill94695554lgblACF8 1861 .11unknown [Zea 4964 75 284 046 mays] >gil219885465lgblACL53 107. 1lunknown Zea 33 46 2 3 4 576 [Zea mays] 1 mays 44 9 1 0

NP hypothetical protein LOCI 00272620 [Zea mays] 8 _oo >gill94690356lgblACF79262. 11unknown [Zea 5 114 226 mays] >gill94699966lgblACF84067. 11unknown 3 055 493 [Zea mays] >gil219887213lgblACL5398 1.1l 4 Zea 33 46 5 194 unknown [Zea mays] 8 mays 45 92 0

8 XP 2 _oo hypothetical protein SORBIDRAFT_02g027300 7 Sorg 246 242 [Sorghum bicolor] >gil241923757lgblEER96901 .1l 8 hum 038 045 hypothetical protein SORBIDRAFT_02g027300 3 bicol 33 46 0 017 [Sorghum bicolor] 9 or 46 93 0 Oryz a 7 sativ 5 a EE 0 Japo E6 543 9 nica 988 986 hypothetical protein OsJ_29706 [Oryza sativa 1 Grou 33 5 60 Japonica Group] 6 P 47 Os09g0470500 [Oryza sativa Japonica Group] >gil75 125073 lsplQ6K498.1IHOX4_ORYSJ RecName: Full=Homeobox-leucine zipper protein HOX4; AltName: Full=HD-ZIP protein HOX4; AltName: Full=Homeodomain transcription factor HOX4; AltName: Full=OsHox4 >gil753 15 199lsplQ9XH37. 1IHOX4_ORYSI RecName: Full=Homeobox-leucine zipper protein HOX4; AltName: Full=HD-ZIP protein HOX4; AltName: Full=Homeodomain transcription factor HOX4; AltName: Full=OsHox4 >gil5006853lgblAAD37697. 1IAF145728_l 0 Oryz homeodomain leucine zipper protein [Oryza sativa a Indica Group] >gil47848413ldbjlBAD22271 .1l 7 sativ NP homeodomain leucine zipper protein [Oryza sativa 5 a _oo Japonica Group] >gill l363 1669ldbjlBAF25350. 1l 4 Japo 106 115 Os09g0470500 [Oryza sativa Japonica Group] 5 nica 343 479 >gil21 8202304lgblEEC8473 1.11hypothetical 7 Grou 33 46 6 684 protein OsI_3 1718 [Oryza sativa Indica Group] 9 P 48 94 predicted protein [Hordeum vulgare subsp. vulgare] 0 Hord >gil326502458ldbj IB AJ95292. i lpredicted protein eum BA 326 [Hordeum vulgare subsp. vulgare] 7 vulga J85 493 >gil326509779ldbj IB AJ87105. i lpredicted protein 4 re 33 46 282 641 [Hordeum vulgare subsp. vulgare] 3 subs 49 95 5 P 9 vulga re XP 2 _oo hypothetical protein SORBIDRAFT_0283s002010 Sorg - 248 253 [Sorghum bicolor] >gil241947303lgblEES20448. 1l hum 4 904 761 hypothetical protein SORBIDRAFT_0283s002010 bicol 33 46 2 062 [Sorghum bicolor] 1 or 50 96 0

8 7 AC 8 G3 195 1 538 627 leucine -rich repeat receptor protein kinase EXS 1 Zea 33 46 2 103 precursor [Zea mays] 6 mays 51 97 0

8 5 AC 8 G3 195 7 030 616 leucine -rich repeat receptor protein kinase EXS 2 Zea 33 46 2 943 precursor [Zea mays] 6 mays 52 98 Os04g0540900 [Oryza sativa Japonica Group] >gil38344983lemblCAE02789.2l OSJNBaOOl 1L07. 13 [Oryza sativa Japonica Group] >gill l3565014ldbj IB AF15357. i lOs04g0540900 [Oryza sativa Japonica Group] >gill l63 10384lemblCAH67395. 1IH01 15B09.7 0 Oryz [Oryza sativa Indica Group] a >gil125549 190lgblEAY950 12.11hypothetical 7 sativ NP protein Osl_16820 [Oryza sativa Indica Group] 7 a _oo >gill25591 143lgblEAZ3 1493. 11hypothetical 8 Japo 105 115 protein OsJ_15629 [Oryza sativa Japonica Group] 3 nica 344 459 >gil215694759ldbj IBAG89950. i lunnamed protein 9 Grou 33 46 3 685 product [Oryza sativa Japonica Group] 3 P 53 99 0 Hord eum 7 vulga 3 re 1 subs BA 326 predicted protein [Hordeum vulgare subsp. vulgare] 3 P J85 493 >gil3265 16176ldbjlBAJ88 111.11predicted protein 0 vulga 33 47 198 473 [Hordeum vulgare subsp. vulgare] 2 re 54 00 XP 2 _oo hypothetical protein SORBIDRAFT_06g033930 Sorg - 244 242 [Sorghum bicolor] >gil24 194001 OlgblEES 13 155. 11 hum 5 882 077 hypothetical protein SORBIDRAFT_06g033930 bicol 33 47 7 781 [Sorghum bicolor] 1 or 55 0 1 0

NP 9 _oo 7 116 293 hypothetical protein LOC100383569 [Zea mays] 2 968 332 >gil224030901 lgblACN34526. 11unknown [Zea 4 Zea 33 47 8 5 18 mays] 7 mays 56 02 7 0 Oryz Os08g0326600 [Oryza sativa Japonica Group] a >gil24414065ldbj IBAC223 14. i lputative GMP 9 sativ NP synthetase [Oryza sativa Japonica Group] 0 a _oo >gil 11362352 1Idbj IB AF23466. 11Os08g0326600 2 Japo 106 115 [Oryza sativa Japonica Group] 7 nica 155 475 >gil215694477ldbj IBAG89422. i lunnamed protein 5 Grou 33 47 2 9 11 product [Oryza sativa Japonica Group] 2 P 57 03 0 Hord eum 8 vulga 8 re BA 0 subs K0 326 7 P 053 524 3 vulga 33 47 6 304 predicted protein [Hordeum vulgare subsp. vulgare] 4 re 58 04 0

7 XP 4 _oo 6 227 225 7 Vitis 459 426 8 vinif 33 47 0 433 PREDICTED: hypothetical protein [Vitis vinifera] 9 era 59 05 0

XP 7 Popu _oo 3 lus 230 224 predicted protein [Populus trichocarpa] 9 trich 450 074 >gil222841932lgblEEE79479. 11predicted protein 4 ocarp 33 47 0 940 [Populus trichocarpa] 5 a 60 06 Arab 0 idops is 7 lyrat XP hypothetical protein A ALYD AFT_8 93078 3 a _oo [Arabidopsis lyrata subsp. lyrata] 3 subs 288 297 >gil297332235lgblEFH62653. 11hypothetical 9 P 639 837 protein ARAL YDR AFT_8 93078 [Arabidopsis lyrata 4 lyrat 33 47 4 024 subsp. lyrata] 5 a 6 1 07 GMP-synthase-C and glutamine amidotransferase domain-containing protein [Arabidopsis thaliana] 0 >gil 12324937lgbl AAG524 16. 11AC0 11622_4 GMP synthase; 61700-64653 [Arabidopsis thaliana] 7 >gil5638 1989lgblAAV85713. 1l Atlg63660 3 Arab NP [Arabidopsis thaliana] 3 idops _17 425 >gil332196006lgblAEE34127. 11GMP-synthase-C 9 is 655 629 and glutamine amidotransferase domain-containing 4 thalia 33 47 3 14 protein [Arabidopsis thaliana] 5 na 62 08 0

7 Arab AA 3 idops 0 4 283 2 is 205 932 1 thalia 33 47 3 48 putative GMP synthase [Arabidopsis thaliana] 1 na 63 09 XP _oo hypothetical protein SORBIDRAFT_01g0 18490 Sorg 246 242 [Sorghum bicolor] >gil24192088 1lgblEER94025. 11 hum 702 039 hypothetical protein SORBIDRAFT_01g0 18490 bicol 33 47 7 264 [Sorghum bicolor] 1 or 64 10 0

8 NP 5 _oo 7 114 226 LOC100283021 [Zea mays] 7 939 532 >gill95626940lgblACG35300. 1l secretory protein 7 Zea 33 47 5 849 [Zea mays] 8 mays 65 11 0 Hord eum 8 vulga PR17c precursor [Hordeum vulgare subsp. vulgare] 0 re AB >gill57093714lgblABV22583. 1lPR17c precursor 8 subs V2 157 [Hordeum vulgare subsp. vulgare] 8 P - 258 093 >gill57093720lgblABV22586. 1lPR17c precursor 8 vulga 33 47 2 7 11 [Hordeum vulgare subsp. vulgare] 9 re 66 12 0

8 hypothetical protein [Hordeum vulgare] 0 CA >gil326494904ldbj IBAJ85547. i lpredicted protein 8 Hord A7 226 [Hordeum vulgare subsp. vulgare] 8 eum 459 666 >gil3265 14206ldbj IB AJ92253. i lpredicted protein 8 vulga 33 47 4 5 [Hordeum vulgare subsp. vulgare] 9 re 67 13 0

7 XP 3 _oo hypothetical protein SORBIDRAFT_01g0 18480 3 Sorg 246 242 [Sorghum bicolor] >gil241920880lgblEER94024. 11 3 hum 702 039 hypothetical protein SORBIDRAFT_01g0 18480 3 bicol 33 47 6 262 [Sorghum bicolor] 3 or 68 14 0

7 9 AA 1 Tritic D4 566 1 um 613 900 1 aesti 33 47 3 7 secretory protein [Triticum aestivum] 1 vum 69 15 0 Oryz a 7 sativ 0 a EE 2 Indie C6 543 2 a 722 625 hypothetical protein OsI_34133 [Oryza sativa Indica 2 Grou 33 1 48 Group] 2 P 70 AC N2 223 580 943 Zea 33 47 3 438 unknown [Zea mays] 1 mays 7 1 16 pre cte prote n or eum vu gare su sp. vu gare vu ga

0

8 XP 3 _oo hypothetical protein SORBIDRAFT_02g030320 1 Sorg 246 242 [Sorghum bicolor] >gil24 1926068 lgblEER992 12. 11 9 hum 269 049 hypothetical protein SORBIDRAFT_02g030320 3 bicol 33 47 1 893 [Sorghum bicolor] 3 or 87 30 Os09g0522200 [Oryza sativa Japonica Group] >gil75253216lsplQ64MAl .1IDRE1 A_ORYSJ RecName: Full=Dehydration-responsive element- binding protein 1A; Short=Protein DREB IA; AltName: Full= Protein C-repeat-binding factor 3; 0 Oryz Short=rCBF3 a >gil22594969lgblAAN02486. 1IAF300970_1 DRE- 7 sativ NP binding protein 1A [Oryza sativa] 3 a _oo >gil52075594ldbjlBAD46704. 1IDRE-binding 9 Japo 106 115 protein 1A [Oryza sativa Japonica Group] 4 nica 371 480 >gil 11363 1945 Idbj IB AF25626. 11Os09g0522200 9 Grou 33 47 2 236 [Oryza sativa Japonica Group] 6 P 88 3 1 RecName: Full=Dehydration-responsive element- 0 binding protein 1A; Short=Protein DREB IA; AltName: Full= Protein C-repeat-binding factor 3; 7 Short=rCBF3 >gil33321848lgblAAQ06658. 1l 3 apetala2 domain-containing CBFl-like protein [Oryza 5 Oryz A2 sativa] >gil 125564420lgblEAZ09800. 11 2 a Z3 hypothetical protein Osl_32087 [Oryza sativa Indica 9 sativ 33 89 Group] 4 a 89 0

7 3 AA 5 Oryz Q2 336 2 a 398 376 9 sativ 33 47 3 97 transcription factor RCBF3 [Oryza sativa] 4 a 90 32 0

7 0 Oryz AB 5 a G7 110 8 brach 345 430 8 yanth 33 0 645 DREB l b [Oryza brachyantha] 2 a 9 1 0

7 XP hypothetical protein SORBIDRAFT_02g030330 1 _oo [Sorghum bicolor] >gil60593391 lgblAAX28960. 1l 4 Sorg 246 242 SbCBF6 [Sorghum bicolor] 2 hum 269 049 >gi 124 1926069 IgbIEER992 13. 11hypothetical 8 bicol 33 47 2 895 protein SORBIDRAFT_02g030330 [Sorghum bicolor] 6 or 92 33 XP _oo hypothetical protein SORBIDRAFT_02g040610 Sorg 246 242 [Sorghum bicolor] >gil241926629lgblEER99773. 11 hum 325 05 1 hypothetical protein SORBIDRAFT_02g040610 bicol 33 47 2 015 [Sorghum bicolor] 1 or 93 34

8 8 1 4 9 7 0 Oryz Osl2g0 194900 [Oryza sativa Japonica Group] a >gill08862289lgblABA96080.2l amino acid 8 sativ NP permease I, putative, expressed [Oryza sativa Japonica 8 a _oo Group] >gill 13648860ldbj IBAF29372. i l 1 Japo 106 115 Osl2g0 194900 [Oryza sativa Japonica Group] 4 nica 635 487 >gill25536049lgblEAY82537. 11hypothetical 9 Grou 34 47 3 731 protein Osl_37760 [Oryza sativa Indica Group] 7 P 23 57 Oryz a sativ a 1 EE Indie - C7 543 a 3 414 625 hypothetical protein Osl_09216 [Oryza sativa Indica Grou 34 2 48 Group] 1 P 24 0

8 NP 4 _oo 8 115 226 serine esterase family protein [Zea mays] 7 205 502 >gill95652153lgblACG45544. 1l serine esterase 6 Zea 34 47 1 027 family protein [Zea mays] 5 mays 25 58 0

7 1 AC 2 F8 194 9 020 692 6 Zea 34 47 4 239 unknown [Zea mays] 3 mays 26 59 0

7 XP 2 _oo hypothetical protein SORBIDRAFT_04g035350 8 Sorg 245 242 [Sorghum bicolor] >gil241932774lgblEES05919. 1l 3 hum 294 063 hypothetical protein SORBIDRAFT_04g035350 9 bicol 34 47 3 307 [Sorghum bicolor] 5 or 27 60 XP 0 _oo hypothetical protein SORBIDRAFT_02g032420 Sorg - 246 242 [Sorghum bicolor] >gil241926192lgblEER99336. 1l hum 2 281 050 hypothetical protein SORBIDRAFT_02g032420 bicol 34 47 5 141 [Sorghum bicolor] 1 or 28 6 1 0 Oryz a 9 sativ EE hypothetical protein OsI_32346 [Oryza sativa Indica 6 a C8 543 Group] >gil22264207 1lgblEEE70203. 11 4 Indie 503 625 hypothetical protein OsJ_30293 [Oryza sativa 0 a 34 7 48 Japonica Group] 7 Grou 29 2 P 0

9 NP 7 _oo hypothetical protein LOCI 00274280 [Zea mays] 6 114 226 >gill94704262lgblACF86215. 11unknown [Zea 0 2 11 502 mays] >gill94707182lgblACF87675. 11unknown 4 Zea 34 47 6 757 [Zea mays] 8 mays 30 62 0 Hord eum 9 vulga predicted protein [Hordeum vulgare subsp. vulgare] 5 re >gil326508052ldbj IBAJ86769. i lpredicted protein 2 subs BA 326 [Hordeum vulgare subsp. vulgare] 0 P - J85 495 >gil326524422ldbj IBAK00594. i lpredicted protein 9 vulga 34 47 748 303 [Hordeum vulgare subsp. vulgare] 6 re 31 63 0

8 2 AC 0 Ul 255 3 Glyci 364 626 5 ne 34 47 9 608 unknown [Glycine max] 9 max 32 64 0

8 2 AC 0 Ul 255 3 Glyci 490 629 5 ne 34 47 8 126 unknown [Glycine max] 9 max 33 65 0

7 XP 9 _oo 0 228 225 4 Vitis 486 451 1 vinif 34 47 6 010 PREDICTED: hypothetical protein [Vitis vinifera] 9 era 34 66 0

8 7 AC 4 G4 195 2 747 656 5 Zea 34 47 5 014 hypothetical protein [Zea mays] 1 mays 35 67 0

7 XP 8 Ricin _oo microsomal signal peptidase 23 kD subunit, putative 4 us 25 1 255 [Ricinus communis] 4 com 235 542 >gil2235483 13lgblEEF49804. 1lmicrosomal signal 3 muni 34 47 2 577 peptidase 23 kD subunit, putative [Ricinus communis] 1 s 36 68 XP 94 _oo hypothetical protein SORBIDRAFT_04g035350 Sorg 6- 245 242 [Sorghum bicolor] >gil241932774lgblEES05919. 1l hum 96 294 063 hypothetical protein SORBIDRAFT_04g035350 bicol 34 47 6 3 307 [Sorghum bicolor] 1 or 37 69 AC F8 194 0 810 708 Zea 34 47 3 037 unknown [Zea mays] 9 mays 38 70 0 Oryz Os02g0787100 [Oryza sativa Japonica Group] a >gil47497 166ldbj IB AD192 14. 11hypothetical 7 sativ NP protein [Oryza sativa Japonica Group] 5 a _oo >gil4749775 1ldbjlBAD1985 1.11hypothetical 7 Japo 104 115 protein [Oryza sativa Japonica Group] 8 nica 833 449 >gill l3537870ldbjlBAF10253. 1IOs02g0787100 9 Grou 34 47 9 118 [Oryza sativa Japonica Group] 5 P 39 7 1 Hord eum vulga re subs BA 326 0 P J88 522 vulga 34 47 501 910 predicted protein [Hordeum vulgare subsp. vulgare] 7 re 40 72 NP 23 _oo signal peptidase complex subunit 3 [Zea mays] 1- 115 226 >gill94695862lgblACF82015. 11unknown [Zea 25 032 502 mays] >gill95638350lgblACG38643. 1l signal Zea 34 47 1 0 818 peptidase complex subunit 3 [Zea mays] 1 mays 4 1 73 0

8 6 AC 2 G4 195 2 747 656 7 Zea 34 47 5 014 hypothetical protein [Zea mays] 5 mays 42 74 0

7 Cucu 7 mis AA 8 melo 0 4 307 4 subs 575 135 signal peptidase protein-like protein [Cucumis melo 4 P 34 47 4 766 subsp. melo] 3 melo 43 75 10 XP 0 1 _oo hypothetical protein SORBIDRAFT_10g010840 Sorg 243 242 [Sorghum bicolor] >gil241915 126lgblEER88270. 1l hum 10 690 092 hypothetical protein SORBIDRAFT_10g010840 bicol 34 47 2 1 3 825 [Sorghum bicolor] 1 or 44 76 0 NP hypothetical protein LOC 100191511 [Zea mays] _oo >gill94689060lgblACF78614. 11unknown [Zea 9 113 212 mays] >gil223942719lgblACN25443. 11unknown 5 041 274 [Zea mays] >gil224029573lgblACN33862. 1l 4 Zea 34 47 5 954 unknown [Zea mays] 1 mays 45 77

2 AC - N2 223 4 757 946 Zea 34 48 0 972 unknown [Zea mays] 1 mays 89 14 0 Oryz a 7 sativ 6 a EE 4 Indie C7 543 3 a 622 625 hypothetical protein OsI_1363 1 [Oryza sativa Indica 6 Grou 34 4 48 Group] 8 P 90 XP 8 _oo hypothetical protein SORBIDRAFT_01g029660 Sorg - 246 242 [Sorghum bicolor] >gil241921382lgblEER94526. 1l hum 0 752 040 hypothetical protein SORBIDRAFT_01g029660 bicol 34 48 8 266 [Sorghum bicolor] 1 or 9 1 15 0

8 NP 9 _oo 3 114 226 proline oxidase [Zea mays] 7 757 531 >gill95612286lgblACG27973. 11proline oxidase 8 Zea 34 48 7 032 [Zea mays] 8 mays 92 16 0

8 NP 3 _oo 3 114 226 proline oxidase [Zea mays] 6 766 505 >gill95612896lgblACG28278. 11proline oxidase 6 Zea 34 48 0 5 15 [Zea mays] 7 mays 93 17 0 Hord eum 7 vulga 8 re BA 7 subs KO 326 5 P 289 505 7 vulga 34 48 2 009 predicted protein [Hordeum vulgare subsp. vulgare] 5 re 94 18 0 Oryz a 7 sativ 4 a EA 9 Indie Y7 543 4 a 944 625 hypothetical protein OsI_34579 [Oryza sativa Indica 9 Grou 34 9 48 Group] 9 P 95 0 Oryz Osl0g0550900 [Oryza sativa Japonica Group] a >gil7870899 1lgblABB47966. 11Proline 7 sativ NP dehydrogenase family protein, expressed [Oryza sativa 4 a _oo Japonica Group] >gill l3639853ldbjlBAF27158. 1l 9 Japo 106 115 Osl0g0550900 [Oryza sativa Japonica Group] 4 nica 532 483 >gil215768044ldbjlBAH00273. 11unnamed protein 9 Grou 34 48 1 301 product [Oryza sativa Japonica Group] 9 P 96 19 0 Oryz a 7 sativ 3 a AA 1 Japo Gl 201 4 nica 346 435 putative proline oxidase [Oryza sativa Japonica 6 Grou 34 48 7 86 Group] 3 P 97 20 7 AA - V6 557 9 420 410 Zea 34 48 9 54 unknown [Zea mays] 1 mays 98 2 1 NP 8 _oo - 115 226 plastid-specific 30S ribosomal protein 1 [Zea mays] 0 128 528 >gill95645526lgblACG4223 1.11plastid-specific Zea 34 48 5 965 30S ribosomal protein 1 [Zea mays] 1 mays 99 22 0

7 XP 7 _oo hypothetical protein SORBIDRAFT_01g000590 9 Sorg 246 242 [Sorghum bicolor] >gil24 1919919lgblEER93063.11 9 hum 606 037 hypothetical protein SORBIDRAFT_01g000590 3 bicol 35 48 5 340 [Sorghum bicolor] 5 or 00 23 WRKY1 1 - superfamily of TFs having WRKY and NP zinc finger domains [Zea mays] _oo >gill94700780lgblACF84474. 11unknown [Zea 9 114 226 mays] >gi11956 12626lgb1ACG28 143. 11WRKY 11 - 762 499 superfamily of TFs having WRKY and zinc finger Zea 35 48 8 3 377 domains [Zea mays] 1 mays 0 1 24 0

8 XP 9 _oo hypothetical protein SORBIDRAFT_03g028530 2 Sorg 245 242 [Sorghum bicolor] >gil241927962lgblEES01 107. 11 0 hum 598 053 hypothetical protein SORBIDRAFT_03g028530 4 bicol 35 48 7 682 [Sorghum bicolor] 5 or 02 25 XP 4 _oo hypothetical protein SORBIDRAFT_06g020170 Sorg - 244 242 [Sorghum bicolor] >gil241937853lgblEES 10998. 11 hum 6 667 073 hypothetical protein SORBIDRAFT_06g020170 bicol 35 48 0 467 [Sorghum bicolor] 1 or 03 26 0

9 NP 0 _oo 5 115 226 eukaryotic translation initiation factor 4B [Zea mays] 8 134 528 >gill95646008lgblACG42472. 11eukaryotic 3 Zea 35 48 9 885 translation initiation factor 4B [Zea mays] 8 mays 04 27 0 Oryz BA a H O 116 7 sativ 155 012 unnamed protein product [Oryza sativa Japonica 8 a 35 48 3 715 Group] 5 Japo 05 28

7 >gil219888 143lgblACL54446. 11unknown [Zea 4 mays] >gil224030309lgblACN34230.11unknown 1 [Zea mays] 4 9 Os01g0585 100 [Oryza sativa Japonica Group] >gill4588680ldbj IB AB61845. i lunknown protein 0 Oryz [Oryza sativa Japonica Group] a >gil21644683ldbj IBAC01240.i lunknown protein 8 sativ NP [Oryza sativa Japonica Group] 6 a _oo >gill l3532954ldbj IB AF05337. i lOs01g0585 100 7 Japo 104 115 [Oryza sativa Japonica Group] 0 nica 342 437 >gil215697604ldbjlBAG91598. 11unnamed protein 2 Grou 35 48 3 959 product [Oryza sativa Japonica Group] 1 P 22 42 0 Oryz a 8 sativ 6 a EA 7 Japo Zl 543 0 nica 248 986 hypothetical protein OsJ_02378 [Oryza sativa 2 Grou 35 1 60 Japonica Group] 1 P 23 0 Oryz a 8 sativ 6 a EA 4 Indie Y7 543 3 a 470 625 hypothetical protein Osl_02596 [Oryza sativa Indica 6 Grou 35 3 48 Group] 2 P 24 0 Hord eum 8 vulga 5 re 6 subs BA 326 3 P - J96 517 8 vulga 35 48 508 031 predicted protein [Hordeum vulgare subsp. vulgare] 3 re 25 43 0

7 XP 1 _oo 2 228 225 7 Vitis 057 444 6 vinif 35 48 9 823 PREDICTED: hypothetical protein [Vitis vinifera] 6 era 26 44 0

7 1 AC 2 U2 255 7 Glyci 284 644 6 ne 35 48 1 677 unknown [Glycine max] 6 max 27 45 XP 0 Ricin _oo 255 conserved hypothetical protein [Ricinus communis] us 25 1 546 >gil223546542lgblEEF48040. 11conserved 7 com 35 48 408 052 hypothetical protein [Ricinus communis] 1 muni 28 46

0 5 NP _oo 0 115 226 protein binding protein [Zea mays] 252 508 >gil 195657 115IgblACG48025 .11protein binding 7 Zea 35 48 5 021 protein [Zea mays] 9 mays 38 55 NP 24 _oo 1- 114 226 hypothetical protein LOCI 00277643 [Zea mays] 26 462 498 >gil 195644788 IgblACG4 1862. 11hypothetical Zea 35 48 0 5 917 protein [Zea mays] 1 mays 39 56 0

7 4 AC 7 R3 238 9 680 Oi l 6 Zea 35 48 6 541 unknown [Zea mays] 7 mays 40 57 NP 13 _oo 5- 115 226 anthocyanin regulatory C 1 protein [Zea mays] 15 165 533 >gi 11956484 18Igb1ACG43677 .11anthocyanin Zea 35 48 4 4 332 regulatory C 1 protein [Zea mays] 1 mays 4 1 58 NP 31 _oo 7- 114 226 RING-H2 finger protein ATL2K [Zea mays] 33 802 530 >gi 11956 15316lgblACG2948 8.11RING-H2 finger Zea 35 48 6 6 490 protein ATL2K [Zea mays] 1 mays 42 59 0

8 XP 6 _oo hypothetical protein SORBIDRAFT_03g034930 3 Sorg 245 242 [Sorghum bicolor] >gil241928347lgblEES01492. 1l 0 hum 637 054 hypothetical protein SORBIDRAFT_03g034930 7 bicol 35 48 2 452 [Sorghum bicolor] 1 or 43 60 0

7 NP 9 _oo 2 114 226 RING-H2 finger protein ATL2K [Zea mays] 5 830 499 >gill95617376lgblACG305 18. 1l RING-H2 finger 3 Zea 35 48 8 733 protein ATL2K [Zea mays] 1 mays 44 6 1 0

8 0 AC 9 N3 224 1 350 028 2 Zea 35 48 8 864 unknown [Zea mays] 9 mays 45 62 Predi 22 EE Oryz cted C6 543 a zma M 835 625 hypothetical protein OsI_36482 [Oryza sativa Indica sativ 35 mir ar 2 48 Group] 1 a 46

0 Hord eum 8 vulga 2 re 7 subs BA 326 predicted protein [Hordeum vulgare subsp. vulgare] 1 P J96 5 14 >gil326528265ldbj IB AJ933 14. i lpredicted protein 7 vulga 35 48 159 343 [Hordeum vulgare subsp. vulgare] 3 re 6 1 75 0

8 XP 2 _oo hypothetical protein SORBIDRAFT_10g026600 2 Sorg 243 242 [Sorghum bicolor] >gil241917036lgblEER90180. 1l 1 hum 88 1 096 hypothetical protein SORBIDRAFT_10g026600 7 bicol 35 48 3 645 [Sorghum bicolor] 8 or 62 76 NP 6 _oo - 115 226 LOCI 00284495 [Zea mays] 8 086 5 10 >gill95642440lgblACG40688. 11helix-loop-helix Zea 35 48 2 390 DNA-binding domain containing protein [Zea mays] 1 mays 63 77 0

8 XP 4 _oo hypothetical protein SORBIDRAFT_03g042860 6 Sorg 245 242 [Sorghum bicolor] >gil241928767lgblEES01912. 1l 7 hum 679 055 hypothetical protein SORBIDRAFT_03g042860 9 bicol 35 48 2 292 [Sorghum bicolor] 7 or 64 78 NP 9 _oo - 114 226 hypothetical protein LOC100276839 [Zea mays] 1 401 499 >gill95635535lgblACG37236. 11hypothetical Zea 35 48 8 443 protein [Zea mays] 1 mays 65 79 0

XP 8 _oo hypothetical protein SORBIDRAFT_10g029660 4 Sorg 243 242 [Sorghum bicolor] >gi124 1917219IgbIEER90363.11 0 hum 899 097 hypothetical protein SORBIDRAFT_10g029660 5 bicol 35 48 6 Oi l [Sorghum bicolor] 8 or 66 80 NP 3 _oo - 110 162 WUS 1 protein [Zea mays] 4 596 460 >gil116811056lemblCAJ84 136. 11WUS 1 protein Zea 35 48 0 273 [Zea mays] 1 mays 67 8 1 0

7 XP 0 _oo hypothetical protein SORBIDRAFT_06g03 1880 5 Sorg 244 242 [Sorghum bicolor] >gil241939890lgblEES 13035. 1l 1 hum 870 077 hypothetical protein SORBIDRAFT_06g03 1880 2 bicol 35 48 7 541 [Sorghum bicolor] 8 or 68 82 3 AC 194 - F8 697 Zea 35 48 5 294 723 unknown [Zea mays] 1 mays 69 83

0

NP 8 _oo hypothetical protein LOCI 00277696 [Zea mays] 2 114 226 >gill94708364lgblACF88266. 11unknown [Zea 2 467 506 mays] >gill95645476lgblACG42206. 1l 4 Zea 35 48 0 299 hypothetical protein [Zea mays] 3 mays 78 9 1 XP _oo hypothetical protein SORBIDRAFT_02g0263 10 0 Sorg 246 242 [Sorghum bicolor] >gil241923689lgblEER96833. 1l hum 031 044 hypothetical protein SORBIDRAFT_02g0263 10 7 bicol 35 48 2 88 1 [Sorghum bicolor] 5 or 79 92 NP 2 _oo - 115 226 transferase, transferring glycosyl groups [Zea mays] 3 059 507 >gill95640434lgblACG39685. 11transferase, Zea 35 48 5 979 transferring glycosyl groups [Zea mays] 1 mays 80 93 Oryz a sativ a 3 EE Japo - E5 543 nica 5 767 986 hypothetical protein OsJ_08 115 [Oryza sativa Grou 35 1 60 Japonica Group] 1 P 81 AC 6 N3 223 186 975 Zea 35 48 5 3 350 unknown [Zea mays] 1 mays 82 94 0

9 9 AC 0 G4 195 1 415 649 6 Zea 35 48 1 366 choline-phosphate cytidylyltransferase B [Zea mays] 4 mays 83 95 0

XP 9 _oo hypothetical protein SORBIDRAFT_07g004150 5 Sorg 244 242 [Sorghum bicolor] >gil241941454lgblEES 14599. 11 0 hum 5 10 080 hypothetical protein SORBIDRAFT_07g004150 8 bicol 35 48 4 670 [Sorghum bicolor] 2 or 84 96 Os08g0161800 [Oryza sativa Japonica Group] >gil37806270ldbj IB AC99786. 11putative CTP:phosphorylcholine cytidylyltransferase [Oryza 0 Oryz sativa Japonica Group] a >gil 11362302 1Idbj IB AF22966. 11Os08g0 16 1800 8 sativ NP [Oryza sativa Japonica Group] 3 a _oo >gil215765435ldbj IBAG87132. i lunnamed protein 6 Japo 106 115 product [Oryza sativa Japonica Group] 0 nica 105 474 >gil21 82005 13lgblEEC82940. 11hypothetical 6 Grou 35 48 2 910 protein OsI_279 13 [Oryza sativa Indica Group] 6 P 85 97 EE 543 0 Oryz E6 986 hypothetical protein OsJ_26135 [Oryza sativa a 35 808 60 Japonica Group] 8 sativ 86

2 9 1 0 4 5 0

9 9 AC 1 G3 195 0 344 623 4 Zea 35 49 9 237 fructokinase-2 [Zea mays] 5 mays 95 06 0

9 AC 8 G3 195 8 903 639 0 Zea 35 49 1 125 fructokinase-2 [Zea mays] 6 mays 96 07 Os08g01 13 100 [Oryza sativa Japonica Group] >gill2223459 1lsplQ0J8G4. 1ISCRK2_ORYSJ RecName: Full=Fructokinase-2; AltName: Full=Fructokinase II; AltName: Full=OsFKII >gill585 13662lsplA2YQL4.2ISCRK2_ORYSI RecName: Full=Fructokinase-2; AltName: Full=Fructokinase II; AltName: Full=OsFKII >gill6566704lgblAAL26573. 1IAF429947_l putative fructokinase II [Oryza sativa] >gil32352126ldbj IBAC78556. i lfructokinase [Oryza sativa Japonica Group] >gil42408363ldbjlBAD095 15. 11putative fructokinase [Oryza sativa Japonica Group] >gil113622806ldbj IB AF2275 1.11Os08g0 113100 0 Oryz [Oryza sativa Japonica Group] a >gil12560 1970lgblEAZ4 1295 .11hypothetical 9 sativ NP protein OsJ_25803 [Oryza sativa Japonica Group] 0 a _oo >gil215687214ldbj IBAG91779. i lunnamed protein 1 Japo 106 115 product [Oryza sativa Japonica Group] 4 nica 083 474 >gil2157088 13ldbj IBAG94082. i lunnamed protein 9 Grou 35 49 7 480 product [Oryza sativa Japonica Group] 3 P 97 08 0 Oryz a 9 sativ 0 a EA 1 Indie Z O 543 4 a 537 625 hypothetical protein OsI_27579 [Oryza sativa Indica 9 Grou 35 5 48 Group] 3 P 98 0 Hord eum 8 vulga 6 re BA 2 subs KO 326 6 P 694 5 13 8 vulga 35 49 9 417 predicted protein [Hordeum vulgare subsp. vulgare] 7 re 99 09 XP _oo hypothetical protein SORBIDRAFT_01g020150 Sorg 246 242 [Sorghum bicolor] >gil241920987lgblEER9413 1.11 hum 713 039 hypothetical protein SORBIDRAFT_01g020150 bicol 36 49 3 476 [Sorghum bicolor] 1 or 00 10 0

9 5 AC 8 N2 223 8 913 950 7 Zea 36 49 6 104 unknown [Zea mays] 4 mays 0 1 11 Osl0g0457600 [Oryza sativa Japonica Group] >gill4140293lgblAAK54299. 1IAC034258_17 putative thiolase [Oryza sativa Japonica Group] >gil3 1432470lgblAAP54100. 113-ketoacyl-CoA thiolase 2, peroxisomal precursor, putative, expressed 0 Oryz [Oryza sativa Japonica Group] a >gil 113639373 Idbj IB AF26678 .11Os10g0457600 9 sativ NP [Oryza sativa Japonica Group] 0 a _oo >gill25575033lgblEAZ163 17. 11hypothetical 4 Japo 106 115 protein OsJ_3 1778 [Oryza sativa Japonica Group] 7 nica 476 482 >gil215704141 ldbjlBAG9298 1.11unnamed protein 6 Grou 36 49 4 341 product [Oryza sativa Japonica Group] 2 P 02 12 0 Oryz a 9 sativ 0 a EE 4 Indie C6 543 7 a 709 625 hypothetical protein OsI_33888 [Oryza sativa Indica 6 Grou 36 5 48 Group] 2 P 03 0

7 XP 7 _oo 2 228 225 PREDICTED: hypothetical protein isoform 1 [Vitis 7 Vitis 565 433 vinifera] >gil297741919lemblCBI33354.3l 2 vinif 36 49 3 423 unnamed protein product [Vitis vinifera] 7 era 04 13 0

7 7 CA 2 N8 147 7 Vitis 158 866 2 vinif 36 5 528 hypothetical protein VITIS V_023 191 [Vitis vinifera] 7 era 05 0

7 NP 6 _oo 6 113 212 hypothetical protein LOCI 00 192501 [Zea mays] 2 119 723 >gill94690834lgblACF79501 .11unknown [Zea 3 Zea 36 49 3 031 mays] 4 mays 06 14 0

7 6 AC 4 G3 195 0 694 634 34ietoacyl-CoA thiolase 2, peroxisomal precursor 6 Zea 36 49 9 960 [Zea mays] 9 mays 07 15 0

7 XP 6 Popu _oo 8 lus 229 224 predicted protein [Populus trichocarpa] 3 trich 928 057 >gil222846542lgblEEE84089. 11predicted protein 9 ocarp 36 49 4 613 [Populus trichocarpa] 8 a 08 16 0

7 6 AC 4 Peru V7 257 0 nia x 003 815 6 hybri 36 49 3 408 34ietoacyl CoA thiolase 2 [Petunia x hybrida] 9 da 09 17 XP 3 _oo hypothetical protein SORBIDRAFT_10g024430 Sorg - 243 242 [Sorghum bicolor] >gil241915520lgblEER88664. 1l hum 5 729 093 hypothetical protein SORBIDRAFT_10g024430 bicol 36 49 7 613 [Sorghum bicolor] 1 or 10 18 0 AC R3 238 8 681 Oi l 7 Zea 36 49 7 563 unknown [Zea mays] 5 mays 11 19 0

8 NP 7 _oo 1 114 226 LOCI 00280864 [Zea mays] 7 725 507 >gill95609146lgblACG26403. 1lbZIP transcription 1 Zea 36 49 6 503 factor protein [Zea mays] 1 mays 12 20 XP 4 _oo hypothetical protein SORBIDRAFT_10g027790 Sorg - 243 242 [Sorghum bicolor] >gil241915696lgblEER88840. 1l hum 6 747 093 hypothetical protein SORBIDRAFT_10g027790 bicol 36 49 3 965 [Sorghum bicolor] 1 or 13 2 1 Os06g0685700 [Oryza sativa Japonica Group] >gil75253259lsplQ653H7. 1IARFR_ORYSJ RecName: Full=Auxin response factor 18; AltName: 0 Oryz Full=OsARF10 >gil52076670ldbj IBAD45570. i l a putative auxin response factor 10 [Oryza sativa 8 sativ NP Japonica Group] >gil52077007ldbj IBAD46040. i l 5 a _oo putative auxin response factor 10 [Oryza sativa 8 Japo 105 115 Japonica Group] >gil113596439ldbj IB AF203 13. 11 9 nica 839 469 Os06g0685700 [Oryza sativa Japonica Group] 5 Grou 36 49 9 599 >gil215713413ldbj IBAG94550.i lunnamed protein 6 P 14 22 product [Oryza sativa Japonica Group] 0

8 5 BA 7 Oryz B8 193 5 a 591 520 4 sativ 36 49 9 50 auxin response factor 10 [Oryza sativa] 6 a 15 23 0 Oryz a 7 sativ 2 a EE 2 Indie C8 543 1 a 120 625 hypothetical protein OsI_24228 [Oryza sativa Indica 4 Grou 36 2 48 Group] 4 P 16 Oryz 0 a sativ 7 a EE 7 Japo E6 543 2 nica 624 986 hypothetical protein OsJ_22412 [Oryza sativa 9 Grou 36 0 60 Japonica Group] 2 P 17 Phra BA gmit Dl 448 plastidic glutamine synthetase [Phragmites australis] es 205 859 >gil44885918ldbjlBAD12058. 11plastidic glutamine austr 36 49 7 15 synthetase [Phragmites australis] 1 alis 18 24 Os04g0659100 [Oryza sativa Japonica Group] >gil121343lsplP14655 .1IGLNA2_ORYSJ RecName: Full=Glutamine synthetase, chloroplastic; AltName: Full=Glutamate—ammonia ligase; AltName: Full=OsGS2; Short=GS2; Flags: Precursor >gil20370lemblCAA32462. 1lunnamed protein product [Oryza sativa] >gil38345 192lemblCAE02885.2l OSJNBa0015K02.2 [Oryza sativa Japonica Group] >gil38346409lemblCAE54574. 11 OSJNBaOOl 1F23. 15 [Oryza sativa Japonica Group] >gill l3565704ldbj IB AF16047. i lOs04g0659100 [Oryza sativa Japonica Group] Oryz >gi1116310855 lembIC AH67797 .11 0 a OSIGBa0132E09-OSIGBa0108L24. 11 [Oryza sativa sativ NP Indica Group] >gil218 195744lgblEEC78 171 .1l 9 a _oo hypothetical protein OsI_17756 [Oryza sativa Indica 3 Japo 105 115 Group] >gil222629702lgblEEE61 834. 11 0 nica 413 461 hypothetical protein OsJ_ 16481 [Oryza sativa 0 Grou 36 49 3 065 Japonica Group] 7 P 19 25 0

9 Phra BA 1 gmit Dl 448 3 es 205 859 7 austr 36 49 9 19 plastidic glutamine synthetase [Phragmites australis] 5 alis 20 26 3 plastid glutamine synthetase isoform GS2c [Triticum aestivum] >gil73672739lgblAAZ80474. 1lGS2 [Triticum aestivum] >gil25 183298 1lgblACT22493. 11plastid glutamine 0 synthetase 2 [Triticum aestivum] >gil25 1832984lgblACT22495. 11plastid glutamine 8 synthetase 2 [Triticum aestivum] 6 AA >gil25 1832990lgblACT22498. 11plastid glutamine 4 Tritic Z3 713 synthetase 2 [Triticum aestivum] 8 um 006 626 >gil3348555 19lgblAEH16638. 11glutamine 0 aesti 36 49 2 39 synthetase [Triticum aestivum] 2 vum 2 1 27 0 Hord eum 8 vulga 6 re 4 subs BA 326 8 P - J91 509 0 vulga 36 49 545 256 predicted protein [Hordeum vulgare subsp. vulgare] 2 re 22 28 0

8 6 AC 2 Tritic T2 25 1 plastid glutamine synthetase 2 [Triticum aestivum] 4 um 249 832 >gil25 1832988lgblACT22497. 1lplastid glutamine 7 aesti 36 49 6 985 synthetase 2 [Triticum aestivum] 1 vum 23 29 0

8 6 AC 2 Tritic T2 25 1 4 um 250 832 7 aesti 36 49 0 991 plastid glutamine synthetase 2 [Triticum aestivum] 1 vum 24 30 0 Hord eum 8 vulga 6 re CA 2 subs A3 4 P - 413 189 unnamed protein product [Hordeum vulgare subsp. 7 vulga 36 49 1 85 vulgare] 1 re 25 3 1 Hord 0 eum vulga 8 re 6 subs BA 326 0 P - J95 505 1 vulga 36 49 492 641 predicted protein [Hordeum vulgare subsp. vulgare] 4 re 26 32 0 Oryz AA a L8 193 9 sativ 718 872 putative precursor chloroplastic glutamine synthetase 0 a 36 3 6 1 [Oryza sativa Japonica Group] 2 Japo 27

1 0 3 4 0

9 7 AC 7 F7 194 0 904 689 1 Zea 36 49 8 927 unknown [Zea mays] 1 mays 35 40 0

9 AC 5 G2 195 hypothetical protein [Zea mays] 9 942 615 >gill95649199lgblACG44067. 1lhypothetical 7 Zea 36 49 5 189 protein [Zea mays] 7 mays 36 4 1 0

8 NP 9 _oo 0 114 226 hypothetical protein LOCI 00277059 [Zea mays] 8 419 501 >gill95638304lgblACG38620. 11hypothetical 0 Zea 36 49 9 971 protein [Zea mays] 5 mays 37 42 0 Oryz a 7 sativ 8 a EE 7 Indie C7 543 3 a 973 625 hypothetical protein Osl_21063 [Oryza sativa Indica 5 Grou 36 0 48 Group] 6 P 38 0

8 XP 2 _oo hypothetical protein SORBIDRAFT_09g029060 7 Sorg 244 242 [Sorghum bicolor] >gil241946827lgblEES 19972. 11 5 hum 154 091 hypothetical protein SORBIDRAFT_09g029060 8 bicol 36 49 2 418 [Sorghum bicolor] 6 or 39 43 0 Oryz Os05g0571400 [Oryza sativa Japonica Group] a >gil52353529lgblAAU44095. 11unknown protein 7 sativ NP [Oryza sativa Japonica Group] 4 a _oo >gill 13579925ldbj IB AF1 8288. 11Os05g057 1400 7 Japo 105 115 [Oryza sativa Japonica Group] 1 nica 637 465 >gil215692864ldbj IBAG88284.i lunnamed protein 2 Grou 36 49 4 548 product [Oryza sativa Japonica Group] 6 P 40 44 0 Hord eum BA 7 vulga KO 326 predicted protein [Hordeum vulgare subsp. vulgare] 2 re 183 489 >gil3265 13576ldbj IBAJ87807. i lpredicted protein 9 subs 36 49 7 712 [Hordeum vulgare subsp. vulgare] 8 P - 4 1 45

0

9 NP 3 _oo 5 115 226 rab geranylgeranyl transferase like protein [Zea mays] 0 150 492 >gil195647272lgblACG43 104. 11rab 6 Zea 36 49 3 640 geranylgeranyl transferase like protein [Zea mays] 5 mays 66 68 0 Hord eum 7 vulga 6 re 7 subs BA 326 6 P J96 514 7 vulga 36 49 308 641 predicted protein [Hordeum vulgare subsp. vulgare] 7 re 67 69 0 Hord eum 7 vulga 6 re 6 subs BA 326 2 P J94 496 3 vulga 36 49 589 253 predicted protein [Hordeum vulgare subsp. vulgare] 4 re 68 70 0 Oryz a 7 sativ 7 a EE 4 Indie C8 543 8 a 117 625 hypothetical protein OsI_24155 [Oryza sativa Indica 9 Grou 36 6 48 Group] 2 P 69 Os06g0677500 [Oryza sativa Japonica Group] >gil52076622ldbjlBAD45523. 11putative Rab geranylgeranyl transferase, a subunit [Oryza sativa 0 Oryz Japonica Group] >gil52076908ldbjlBAD45920. i l a putative Rab geranylgeranyl transferase, a subunit 7 sativ NP [Oryza sativa Japonica Group] 7 a _oo >gill 13596397ldbj IB AF2027 1.11Os06g0677500 2 Japo 105 115 [Oryza sativa Japonica Group] 0 nica 835 469 >gill25598230lgblEAZ38010. 11hypothetical 0 Grou 36 49 7 5 15 protein OsJ_22355 [Oryza sativa Japonica Group] 6 P 70 7 1 XP _oo hypothetical protein SORBIDRAFT_01g006780 Sorg 246 242 [Sorghum bicolor] >gil241920236lgblEER93380. 1l hum 638 037 hypothetical protein SORBIDRAFT_01g006780 bicol 36 49 2 974 [Sorghum bicolor] 1 or 7 1 72 0

8 NP 9 _oo 8 114 226 lectin-like receptor kinase 7 [Zea mays] 9 799 508 >gil1956 15004lgblACG29332. 11lectin-like 7 Zea 36 49 0 033 receptor kinase 7 [Zea mays] 5 mays 72 73 BA 326 0 Hord 36 49 J98 498 predicted protein [Hordeum vulgare subsp. vulgare] eum 73 74

5 5 AC F8 194 432 700 Zea 36 49 9 489 unknown [Zea mays] 1 mays 81 79 0

9 NP 8 _oo 3 114 226 hypothetical protein LOCI 0027568 1 [Zea mays] 5 318 491 >gil 1956 15484lgblACG29572. 11hypothetical 0 Zea 36 49 1 793 protein [Zea mays] 5 mays 82 80 0

7 XP 7 _oo hypothetical protein SORBIDRAFT_09g010410 5 Sorg 243 242 [Sorghum bicolor] >gil2419448 17lgblEES 17962. 11 2 hum 953 087 hypothetical protein SORBIDRAFT_09g010410 5 bicol 36 49 2 398 [Sorghum bicolor] 8 or 83 8 1 XP _oo hypothetical protein SORBIDRAFT_01g006730 Sorg 246 242 [Sorghum bicolor] >gil24191767 1lgblEER908 15. 11 hum 38 1 032 hypothetical protein SORBIDRAFT_01g006730 bicol 36 49 7 844 [Sorghum bicolor] 1 or 84 82 0

9 AC 6 F8 238 7 283 908 8 Zea 36 49 8 755 unknown [Zea mays] 9 mays 85 83 0

9 6 AC 5 G4 195 5 425 649 9 Zea 36 49 6 576 hypothetical protein [Zea mays] 6 mays 86 84 0

9 NP 3 _oo hypothetical protein LOCI 002736 12 [Zea mays] 3 114 226 >gill94704836lgblACF86502. 11unknown [Zea 4 150 490 mays] >gill94707468lgblACF878 18. 11unknown 8 Zea 36 49 0 864 [Zea mays] 6 mays 87 85 0 Oryz a 8 sativ EA 4 a Y9 543 8 Indie 200 625 hypothetical protein OsI_13693 [Oryza sativa Indica 6 a 36 4 48 Group] 2 Grou 88 4 P 0 Oryz a 8 sativ 4 a EA 8 Japo Z2 543 6 nica 873 986 hypothetical protein OsJ_ 12756 [Oryza sativa 2 Grou 36 6 60 Japonica Group] 4 P 89 Oryz Os03g0773000 [Oryza sativa Japonica Group] 0 a >gil3 1745235lgblAAP68895. 11unknown protein sativ NP [Oryza sativa Japonica Group] 8 a _oo >gi 11087 11308 Igb1ABF99 103.11expressed protein 4 Japo 105 115 [Oryza sativa Japonica Group] 6 nica 141 455 >gill l3549885ldbjlBAF13328. 1IOs03g0773000 3 Grou 36 49 4 626 [Oryza sativa Japonica Group] 3 P 90 86 0 Oryz a 7 sativ 6 a AA 8 Japo P6 282 3 nica 889 694 4 Grou 36 49 4 88 unknown protein [Oryza sativa Japonica Group] 9 P 9 1 87 0 Hord eum 7 vulga 2 re 9 subs BA 326 3 P - J89 527 5 vulga 36 49 Oi l 918 predicted protein [Hordeum vulgare subsp. vulgare] 8 re 92 88 Os07g0133500 [Oryza sativa Japonica Group] >gil32352156ldbj IB AC7857 1.11hypothetical protein [Oryza sativa Japonica Group] >gil34393412ldbj IBAC82946. i lunknown protein [Oryza sativa Japonica Group] >gil50509299ldbj IBAD30606. i lunknown protein 0 Oryz [Oryza sativa Japonica Group] a >gil 1136 10373 Idbj IB AF2075 1.11Os07g0 133500 7 sativ NP [Oryza sativa Japonica Group] 2 a _oo >gill25599028lgblEAZ38604. 11hypothetical 2 Japo 105 115 protein OsJ_22992 [Oryza sativa Japonica Group] 4 nica 883 470 >gil215741 158ldbj IBAG97653. i lunnamed protein 7 Grou 36 49 7 476 product [Oryza sativa Japonica Group] 7 P 93 89 XP _oo hypothetical protein SORBIDRAFT_01g03 1090 Sorg 246 242 [Sorghum bicolor] >gil241918896lgblEER92040. 1l hum 504 035 hypothetical protein SORBIDRAFT_01g03 1090 bicol 36 49 2 294 [Sorghum bicolor] 1 or 94 90 0

AC 9 G2 195 3 918 614 4 Zea 36 49 7 713 subtilisin-like protease precursor [Zea mays] 2 mays 95 9 1 1 1 0 Oryz a 8 sativ 7 a EA 8 Indie Y7 543 9 a 926 625 hypothetical protein OsI_34383 [Oryza sativa Indica 4 Grou 36 8 48 Group] 7 P 96 Osl0g05 24600 [Oryza sativa Japonica Group] >gil20146761 lgblAAM12497. 1IAC074232_24 putative serine protease [Oryza sativa Japonica Group] >gil273 11277lgblAAO00703. 11putative serine protease [Oryza sativa Japonica Group] >gil3 1433 153lgblAAP54706. 11Subtilisin N- terminal Region family protein, expressed [Oryza 0 Oryz sativa Japonica Group] a >gil 1136397 18Idbj IB AF27023 .11Os10g0524600 8 sativ NP [Oryza sativa Japonica Group] 7 a _oo >gill25575456lgblEAZ16740. 11hypothetical 6 Japo 106 115 protein OsJ_32216 [Oryza sativa Japonica Group] 3 nica 5 10 483 >gil215697336ldbj IBAG91330. i lunnamed protein 1 Grou 36 49 9 031 product [Oryza sativa Japonica Group] 6 P 97 92 Os03g01 19300 [Oryza sativa Japonica Group] 0 Oryz >gil27452907lgblAAO15291 .1l Putative serine a protease [Oryza sativa Japonica Group] 7 sativ NP >gill08705882lgblABF93677. 1l Subtilisin N- 4 a _oo terminal Region family protein, expressed [Oryza 4 Japo 104 115 sativa Japonica Group] 7 nica 877 450 >gil 113547249ldbj IB AF1 0692. 11Os03g0 119300 3 Grou 36 49 8 354 [Oryza sativa Japonica Group] 7 P 98 93 0

7 XP 3 _oo hypothetical protein SORBIDRAFT_01g049280 1 Sorg 246 242 [Sorghum bicolor] >gil241919830lgblEER92974. 1l 5 hum 597 037 hypothetical protein SORBIDRAFT_01g049280 7 bicol 36 49 6 162 [Sorghum bicolor] 9 or 99 94 0 Hord eum 7 vulga predicted protein [Hordeum vulgare subsp. vulgare] 2 re BA >gil326496769ldbj IB AJ9841 1.11predicted protein 8 subs KO 326 [Hordeum vulgare subsp. vulgare] 9 P 559 490 >gil326497201 ldbjlBAK02185. 11predicted protein 4 vulga 37 49 9 998 [Hordeum vulgare subsp. vulgare] 7 re 00 95 0

7 1 AC 5 N3 223 7 079 973 8 Zea 37 49 2 208 unknown [Zea mays] 9 mays 0 1 96 NP 226 xylem serine proteinase 1 [Zea mays] 0 Zea 37 49

P vulga re 0

9 NP 2 _oo hypothetical protein LOC100191580 [Zea mays] 9 113 212 >gill94689252lgblACF78710. 1lunknown [Zea 6 048 275 mays] >gil223972733lgblACN30554. 11unknown 8 Zea 37 50 2 084 [Zea mays] 8 mays 10 04 Os06g0 128200 [Oryza sativa Japonica Group] >gil75 115092lsplQ658I5. 1ILMBDl_ORYSJ RecName: Full=LIMR family protein Os06g0 128200 >gil5207561 1ldbjlBAD44782. 1lLMBR1 integral membrane family protein-like [Oryza sativa Japonica Group] >gil55296214ldbj IB AD67932. 11LMBR1 integral membrane family protein-like [Oryza sativa Japonica Group] >gil 1135947 1Oldbj IB AF1 8584. 11 0 Oryz Os06g0 128200 [Oryza sativa Japonica Group] a >gil215697147ldbj IBAG91 141 .i lunnamed protein 9 sativ NP product [Oryza sativa Japonica Group] 0 a _oo >gil21 8197487lgblEEC799 14. 11hypothetical 4 Japo 105 115 protein OsI_21464 [Oryza sativa Indica Group] 2 nica 667 466 >gil222634886lgblEEE65018. 11hypothetical 9 Grou 37 50 0 141 protein OsJ_ 19972 [Oryza sativa Japonica Group] 7 P 11 05 Arab 0 idops is 8 lyrat XP LMBR1 integral membrane family protein 0 a _oo [Arabidopsis lyrata subsp. lyrata] 2 subs 287 297 >gil2973 18849lgblEFH4927 1.11LMBR1 integral 7 P 301 810 membrane family protein [Arabidopsis lyrata subsp. 3 lyrat 37 50 2 256 lyrata] 4 a 12 06 0

8 XP 0 Ricin _oo 2 us 252 255 conserved hypothetical protein [Ricinus communis] 7 com 809 574 >gil223532484lgblEEF34274. 11conserved 3 muni 37 50 5 362 hypothetical protein [Ricinus communis] 4 s 13 07 Arab 0 idops is 8 lyrat XP hypothetical protein ARAL YDRAFT_478 196 0 a _oo [Arabidopsis lyrata subsp. lyrata] 6 subs 288 297 >gil297328430lgblEFH58849. 11hypothetical 6 P 259 829 protein ARALYDRAFT_478 196 [Arabidopsis lyrata 4 lyrat 37 50 0 415 subsp. lyrata] 1 a 14 08 LMBRl -like membrane protein [Arabidopsis thaliana] 0 Arab NP >gil75 181394lsplQ9M028 .1ILMBD2_ ARATH idops _19 306 RecName: Full=LIMR family protein At5g01460 8 is 576 792 >gil7320724lemblCAB8 1929. 11putative protein 0 thalia 37 50 6 70 [Arabidopsis thaliana] 0 na 15 09

Osl0g0485500 [Oryza sativa Japonica Group] 2 Grou >gil 1255324 13lgblEAY78978 .11hypothetical 2 P protein Osl_34084 [Oryza sativa Indica Group] XP hypothetical protein SORBIDRAFT_03g01 1880 _oo [Sorghum bicolor] >gil229609765lgblACQ83498. 1l Sorg 245 242 CBL-interacting protein kinase 2 1 [Sorghum bicolor] hum 549 052 >gi 124 1927467 IgbIEES006 12. 11hypothetical bicol 37 50 2 692 protein SORBIDRAFT_03g01 1880 [Sorghum bicolor] 1 or 62 5 1 0

9 NP 3 _oo 3 110 162 putative protein kinase [Zea mays] 0 596 461 >gill20400397lgblABM21449. 11putative protein 4 Zea 37 50 7 846 kinase [Zea mays] 5 mays 63 52 0

9 2 AC 2 G3 195 2 5 13 626 CBL-interacting serine/threonine-protein kinase 1 4 Zea 37 50 0 599 [Zea mays] 6 mays 64 53 Os01g0292200 [Oryza sativa Japonica Group] >gil75334984lsplQ9LGV5. 1ICIPKl_ORYSJ RecName: Full=CBL-interacting protein kinase 1; AltName: Full=OsCIPK01 >gil8468028ldbjlBAA96628. 11putative CBL- interacting protein kinase 1 [Oryza sativa Japonica Group] >gil 113532323 Idbj IB AF04706. 11 0 Oryz Os01g0292200 [Oryza sativa Japonica Group] a >gil 189099603 IgblACD76973 .11CBL-interacting 8 sativ NP protein kinase 1 [Oryza sativa Japonica Group] 6 a _oo >gil215686723ldbjlBAG89573. 11unnamed protein 6 Japo 104 115 product [Oryza sativa Japonica Group] 0 nica 279 436 >gil222618247lgblEEE54379. 1lhypothetical 9 Grou 37 50 2 067 protein OsJ_01395 [Oryza sativa Japonica Group] 1 P 65 54 Os05g0 136200 [Oryza sativa Japonica Group] >gil75326492lsplQ75L42. 1ICIPKH_ORYSJ RecName: Full=CBL-interacting protein kinase 17; AltName: Full=OsCIPK17 >gil4648579 1Igb1AAS984 16. 11unknown protein [Oryza sativa Japonica Group] >gil5 1038254lgblAAT94057. 11unknown protein Oryz [Oryza sativa Japonica Group] 0 a >gil 113578 129ldbj IB AF1 6492. 11Os05g0 136200 sativ NP [Oryza sativa Japonica Group] 7 a _oo >gill89099617lgblACD76980. 1l CBL-interacting 4 Japo 105 115 protein kinase 17 [Oryza sativa Japonica Group] 5 nica 457 461 >gil2226301 13lgblEEE62245. 11hypothetical 1 Grou 37 50 8 956 protein OsJ_17032 [Oryza sativa Japonica Group] 4 P 66 55 0 Oryz EE a C7 543 7 sativ 847 625 hypothetical protein OsI_18365 [Oryza sativa Indica 4 a 37 6 48 Group] 5 Indie 67

5 5 RuBisCO activase small isoform precursor [Oryza sativa] >gil62733 169lgblAAX95286. 1lRuBisCO 0 activase small isoform precursor [Oryza sativa Japonica Group] >gil77552726lgblABA95523. i l 8 Ribulose bisphosphate carboxylase/oxygenase 3 BA activase, chloroplast precursor, putative, expressed 4 Oryz A9 891 [Oryza sativa Japonica Group] 0 a 758 836 >gi 1 156943 16ldbj IBAG89309.i lunnamed protein 9 sativ 37 50 4 0 product [Oryza sativa Japonica Group] 1 a 75 63 0 Oryz a 8 sativ 3 a AB 4 Japo G2 108 Ribulose bisphosphate carboxylase/oxygenase 0 nica 261 863 activase, chloroplast precursor, putative, expressed 9 Grou 37 4 896 [Oryza sativa Japonica Group] 1 P 76 RecName: Full=Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic; Short=RA; Short=RuBisCO activase; Flags: Precursor >gil8918359ldbj IB AA97583. i lRuBisCO activase large isoform precursor [Oryza sativa (japonica cultivar-group)] >gil32352158ldbjlBAC78572. 1l ribulose-bisphosphate carboxylase activase large Oryz isoform precursor protein [Oryza sativa Japonica a Group] >gil77552725lgblABA95522. 1lRibulose 0 sativ bisphosphate carboxylase/oxygenase activase, a chloroplast precursor, putative, expressed [Oryza 8 (japo sativa Japonica Group] 3 nica >gill25578 108lgblEAZ19330. 11hypothetical 4 culti P9 protein OsJ_34880 [Oryza sativa Japonica Group] 0 var- 343 >gil218186228 lgblEEC68655.11hypothetical 9 grou 37 1 protein Osl_37096 [Oryza sativa Indica Group] 1 P) 77 0 Oryz a 8 sativ 3 a AA 4 Japo C2 337 0 nica 813 779 ribulose-l,5-bisphosphate carboxylase/oxygenase 9 Grou 37 50 4 2 activase [Oryza sativa Japonica Group] 1 P 78 64 0

8 1 AA 8 Tritic F7 796 1 um 127 027 ribulose bisphosphate carboxylase activase B 8 aesti 37 50 2 6 [Triticum aestivum] 2 vum 79 65 0 Desc AA 8 hamp P8 324 1 sia 392 810 Rubisco activase beta form precursor [Deschampsia 5 antar 37 50 8 62 antarctica] 9 ctica 80 66

_oo 443 vinif 88 73 227 601 7 era 897 6 9 7 9 5 6 0

7 7 AC 3 Ul 255 4 Glyci 809 635 8 ne 37 50 2 479 unknown [Glycine max] 1 max 89 74 Arab 0 idops is 7 lyrat XP 4 a _oo DNAJ heat shock family protein [Arabidopsis lyrata 5 subs 288 297 subsp. lyrata] >gil297332127lgblEFH62546. 1l 8 P - 628 836 DNAJ heat shock family protein [Arabidopsis lyrata 5 lyrat 37 50 7 809 subsp. lyrata] 6 a 90 75 0

7 XP 5 Ricin _oo 6 us 250 255 Protein SIS 1, putative [Ricinus communis] 9 com 943 536 >gil223549329lgblEEF508 17. 1lProtein SIS 1, 0 muni 37 50 0 726 putative [Ricinus communis] 6 s 9 1 76 XP _oo hypothetical protein SORBIDRAFT_03g0 10370 Sorg 245 242 [Sorghum bicolor] >gil241929590lgblEES02735. 1l hum 761 056 hypothetical protein SORBIDRAFT_03g0 10370 bicol 37 50 5 938 [Sorghum bicolor] 1 or 92 77 0

9 4 AC 3 G4 195 4 842 657 7 Zea 37 50 3 910 hypothetical protein [Zea mays] 8 mays 93 78 0

9 NP 4 _oo 3 114 226 hypothetical protein LOC100278893 [Zea mays] 4 549 503 >gil19565708 1lgblACG48008. 11hypothetical 7 Zea 37 50 4 300 protein [Zea mays] 8 mays 94 79 EA 0 Oryz Zl 543 a 134 986 hypothetical protein OsJ_01214 [Oryza sativa 7 sativ 37 7 60 Japonica Group] 4 a 95

0 8 5 1 9 0

NP 8 _oo 7 115 226 ethylene-responsive transcription factor 2 [Zea mays] 0 205 498 >gil 195652 15 1IgblACG45543 .11ethylene- 3 Zea 38 50 0 033 responsive transcription factor 2 [Zea mays] 7 mays 10 94 0 Thin 7 opyr AB 7 um Q5 148 0 inter 268 009 3 medi 38 50 6 083 ethylene-responsive factor [Thinopyrum intermedium] 7 um 11 95 0

7 6 AB 6 Tritic Q5 148 6 um 268 009 pathogen-inducible transcription factor ERF3 6 aesti 38 50 7 101 [Triticum aestivum] 7 vum 12 96 Os04g0546800 [Oryza sativa Japonica Group] >gil70663974lemblCAD41472.3l 0 Oryz OSJNBa0079A21 .16 [Oryza sativa Japonica Group] a >gill l3565045ldbjlBAF15388. 1IOs04g0546800 7 sativ NP [Oryza sativa Japonica Group] 4 a _oo >gil 11750 1525 IgblABK34954. 11development 0 Japo 105 297 related ERF protein [Oryza sativa Japonica Group] 7 nica 347 603 >gil215769250ldbj IB AH01479. i lunnamed protein 4 Grou 38 50 4 127 product [Oryza sativa Japonica Group] 1 P 13 97 0 Oryz a 7 sativ 4 a CA 0 Indie H6 116 7 a 726 310 4 Grou 38 50 3 240 OSIGBa0101C23. 15 [Oryza sativa Indica Group] 1 P 14 98 0 Oryz a 7 sativ 4 a EA 0 Indie Y9 543 7 a 505 625 hypothetical protein OsI_16873 [Oryza sativa Indica 4 Grou 38 8 48 Group] 1 P 15 0 Hord eum BA 7 vulga KO 326 3 re 576 491 7 subs 38 50 6 332 predicted protein [Hordeum vulgare subsp. vulgare] 0 P - 16 99 3 vulga 7 re XP _oo hypothetical protein SORBIDRAFT_09g006240 Sorg 244 242 [Sorghum bicolor] >gil24 1946053 IgblEES 19198. 11 hum 076 089 hypothetical protein SORBIDRAFT_09g006240 bicol 38 5 1 8 870 [Sorghum bicolor] 1 or 17 00 0

9 NP 1 _oo 8 115 226 prenylated rab acceptor family protein [Zea mays] 3 020 531 >gill95637576lgblACG38256. 1lprenylated rab 6 Zea 38 5 1 9 775 acceptor family protein [Zea mays] 7 mays 18 0 1 0 Hord eum 7 vulga 1 re 4 subs BA 326 2 P - J94 490 8 vulga 38 5 1 157 166 predicted protein [Hordeum vulgare subsp. vulgare] 6 re 19 02 0 Oryz a 7 sativ 3 a AA 9 Japo T4 377 7 nica 430 191 9 Grou 38 5 1 9 65 hypothetical protein [Oryza sativa Japonica Group] 6 P 20 03 XP _oo hypothetical protein SORBIDRAFT_09g024710 Sorg 244 242 [Sorghum bicolor] >gil241946624lgblEES 19769. 11 hum 133 091 hypothetical protein SORBIDRAFT_09g024710 bicol 38 5 1 9 012 [Sorghum bicolor] 1 or 2 1 04 Os05g0500900 [Oryza sativa Japonica Group] >gil75 113903lsplQ60EJ6. 1IGH34_ORYSJ RecName: Full=Probable indole- 3-acetic acid-amido synthetase GH3.4; AltName: Full= Auxin-responsive GH3-like protein 4; Short=OsGH3-4 >gil53749366lgblAAU90225. 11putative auxin- Oryz responsive protein GH3 [Oryza sativa Japonica 0 a Group] >gil 1135795 18Idbj IB AF1 788 1.11 sativ NP Os05g0500900 [Oryza sativa Japonica Group] 7 a _oo >gill25552879lgblEAY98588. 11hypothetical 9 Japo 105 115 protein Osl_20501 [Oryza sativa Indica Group] 2 nica 596 464 >gil222632129lgblEEE64261 .11hypothetical 8 Grou 38 5 1 7 734 protein OsJ_ 19094 [Oryza sativa Japonica Group] 9 P 22 05 0

7 XP 7 _oo hypothetical protein SORBIDRAFT_03g036680 2 Sorg 245 242 [Sorghum bicolor] >gil241928433lgblEES01578. 1l 7 hum 645 054 hypothetical protein SORBIDRAFT_03g036680 9 bicol 38 5 1 8 624 [Sorghum bicolor] 8 or 23 06 Os01g0785400 [Oryza sativa Japonica Group] >gil75272534lsplQ8LQM5 .1IGH3 l_ORYSJ RecName: Full=Probable indole- 3-acetic acid-amido synthetase GH3. 1; AltName: Full=Auxin-responsive GH3-like protein 1; Short=OsGH3-l >gil20804910ldbj IB AB92590. i lputative auxin- 0 Oryz regulated protein GH3 [Oryza sativa Japonica Group] a >gill l3533998ldbjlBAF0638 1.1IOs01g0785400 7 sativ NP [Oryza sativa Japonica Group] 6 a _oo >gill25572267lgblE AZ13782. i lhypothetical 9 Japo 104 115 protein OsJ_03707 [Oryza sativa Japonica Group] 7 nica 446 440 >gil215693284ldbj IBAG88666. i lunnamed protein 0 Grou 38 5 1 7 374 product [Oryza sativa Japonica Group] 6 P 24 07 0

7 3 AC 4 L5 219 1 252 884 5 Zea 38 5 1 9 308 unknown [Zea mays] 8 mays 25 08 NP 8 _oo hypothetical protein LOC100191701 [Zea mays] - 113 212 >gill94689604lgblACF78886. 11unknown [Zea 0 060 274 mays] >gil219886741 lgblACL53745. 1lunknown Zea 38 5 1 2 530 [Zea mays] 1 mays 26 09 0

8 XP 6 _oo hypothetical protein SORBIDRAFT_03g009790 8 Sorg 245 242 [Sorghum bicolor] >gil241929556lgblEES02701 .1l 9 hum 758 056 hypothetical protein SORBIDRAFT_03g009790 0 bicol 38 5 1 1 870 [Sorghum bicolor] 8 or 27 10 0 Hord eum 7 vulga 4 re BA 1 subs KO 326 1 P 776 522 7 vulga 38 5 1 8 6 11 predicted protein [Hordeum vulgare subsp. vulgare] 6 re 28 11 0 Oryz a 7 sativ 1 a BA 2 Japo A8 592 putative pectinesterase [Oryza sativa Japonica Group] 6 nica 461 260 >gil60 16850ldbj IB AA85 193. 11putative 0 Grou 38 5 1 8 3 pectinesterase [Oryza sativa Japonica Group] 5 P 29 12 XP 5 _oo hypothetical protein SORBIDRAFT_03g039330 Sorg - 245 242 [Sorghum bicolor] >gil241930712lgblEES03857. 1l hum 7 873 059 hypothetical protein SORBIDRAFT_03g039330 bicol 38 5 1 7 182 [Sorghum bicolor] 1 or 30 13 NP 226 osmotin-like protein [Zea mays] 0 Zea 38 51 _oo 508 >gil226958466lref INP_00 1152945 .11 mays 31 14 114 543 LOC100284104 [Zea mays] 9 709 >gil195607 196lgblACG25428 .11osmotin-like 6 8 protein precursor [Zea mays] 4 >gill95639504lgblACG39220. 11osmotin-like 1 protein precursor [Zea mays] 4 3 0 Oryz a 8 sativ 8 a 8 Indie AD 297 4 a 143 498 4 Grou 38 5 1 217 988 osmotin-like protein [Oryza sativa Indica Group] 6 P 32 15 Os01g0839900 [Oryza sativa Japonica Group] >gill5623832ldbj IB AB6789 1.11putative thaumatin-like cytokinin-binding protein [Oryza sativa Japonica Group] >gil211046 19ldbj IB AB932 11.11 putative thaumatin-like cytokinin-binding protein [Oryza sativa Japonica Group] >gill l3534287ldbj IB AF06670. i lOs01g0839900 Oryz [Oryza sativa Japonica Group] 0 a >gill25528326lgblEAY76440. 11hypothetical sativ NP protein Osl_04374 [Oryza sativa Indica Group] 8 a _oo >gill25572584lgblEAZ14099. 11hypothetical 7 Japo 104 115 protein OsJ_04023 [Oryza sativa Japonica Group] 2 nica 475 440 >gil21576583 1ldbjlBAG87528.11unnamed protein 5 Grou 38 5 1 6 952 product [Oryza sativa Japonica Group] 1 P 33 16 0 Oryz a 8 sativ 6 a 8 Indie AD 297 5 a 143 498 2 Grou 38 5 1 216 986 osmotin-like protein [Oryza sativa Indica Group] 6 P 34 17 0 Hord eum 8 vulga 0 re BA 8 subs K0 326 7 P - 063 524 6 vulga 38 5 1 5 503 predicted protein [Hordeum vulgare subsp. vulgare] 5 re 35 18 AC N2 223 65 1 944 Zea 38 5 1 4 860 unknown [Zea mays] 1 mays 36 19 0

9 NP 9 _oo 7 115 226 triacylglycerol lipase [Zea mays] 5 124 533 >gil195645276lgblACG42 106. 11triacylglycerol 1 Zea 38 5 1 2 364 lipase [Zea mays] 2 mays 37 20 XP 242 hypothetical protein SORBIDRAFT_09g029230 0 Sorg 38 51

447 Group] >gil 113639085 Idbj IB AF26390. 11 5 a 6 Osl0g0377400 [Oryza sativa Japonica Group] 3 Japo >gil215767227ldbjlBAG99455. 11unnamed protein 9 nica product [Oryza sativa Japonica Group] 1 Grou >gil218 184417lgblEEC66844. 11hypothetical 7 P protein OsI_333 17 [Oryza sativa Indica Group] >gil222612729lgblEEE50861 .11hypothetical protein OsJ_3 1310 [Oryza sativa Japonica Group] 0

9 XP 1 _oo hypothetical protein SORBIDRAFT_01g044550 7 Sorg 246 242 [Sorghum bicolor] >gil24 19 1958 1lgblEER92725 .11 0 hum 572 036 hypothetical protein SORBIDRAFT_01g044550 5 bicol 38 5 1 7 664 [Sorghum bicolor] 1 or 80 6 1 0

ras-related protein Rabl ID [Zea mays] 9 NP >gil226958362lreflNP_001 152898. 11hypothetical 1 _oo protein LOCI 00272235 [Zea mays] 7 115 226 >gill94696242lgblACF82205. 11unknown [Zea 0 106 529 mays] >gill95644068lgblACG41502. 11ras-related 5 Zea 38 5 1 8 762 protein Rabl ID [Zea mays] 1 mays 81 62 0

9 NP 1 _oo ras-related protein Rabl ID [Zea mays] 2 115 226 >gill94708702lgblACF88435. 11unknown [Zea 4 156 503 mays] >gill95647718lgblACG43327. 1lras-related 4 Zea 38 5 1 0 740 protein Rabl ID [Zea mays] 2 mays 82 63 0 Hord eum 9 vulga 2 re 1 subs BA 326 6 P - J93 528 5 vulga 38 5 1 377 454 predicted protein [Hordeum vulgare subsp. vulgare] 9 re 83 64 0 Oryz a 8 sativ 8 a AA 9 Japo M O 172 4 nica 854 985 Putative Ras-related protein Rab [Oryza sativa 0 Grou 38 5 1 3 74 Japonica Group] 1 P 84 65 0

8 XP 4 Popu _oo 3 lus 231 224 predicted protein [Populus trichocarpa] 3 trich 055 096 >gil222853455lgblEEE91002. 1lpredicted protein 1 ocarp 38 5 1 2 150 [Populus trichocarpa] 8 a 85 66 XP 225 PREDICTED: hypothetical protein [Vitis vinifera] 0 Vitis 38 5 1

246 129 hypothetical protein SORBIDRAFT_02g037770 bicol 093 [Sorghum bicolor] or 6 0

8 NP 7 _oo 3 114 226 hypothetical protein LOCI 00279098 [Zea mays] 8 561 507 >gill95658887lgblACG4891 1.11hypothetical 4 Zea 39 5 1 5 742 protein [Zea mays] 6 mays 04 85 0

8 NP 3 _oo 0 114 226 hypothetical protein LOCI 00278263 [Zea mays] 7 506 495 >gill95650593lgblACG44764. 11hypothetical 6 Zea 39 5 1 7 966 protein [Zea mays] 9 mays 05 86 XP _oo hypothetical protein SORBIDRAFT_04g026900 Sorg 245 242 [Sorghum bicolor] >gil241932326lgblEES05471 .1l hum 249 062 hypothetical protein SORBIDRAFT_04g026900 bicol 39 5 1 5 4 11 [Sorghum bicolor] 1 or 06 87 0

8 9 AC 8 F8 194 9 806 707 4 Zea 39 5 1 9 969 unknown [Zea mays] 7 mays 07 88 0

9 NP 0 _oo 7 115 226 lysosomal protective protein [Zea mays] 3 224 533 >gil 195654245 IgblACG46590. 11lysosomal 6 Zea 39 5 1 5 273 protective protein precursor [Zea mays] 8 mays 08 89 Os02g0634700 [Oryza sativa Japonica Group] >gil49387538ldbj IB AD25094. i lputative carboxypeptidase D [Oryza sativa Japonica Group] >gil49388 186ldbj IB AD253 12. 11putative carboxypeptidase D [Oryza sativa Japonica Group] >gil 113537045 Idbj IB AF09428 .11Os02g0634700 0 Oryz [Oryza sativa Japonica Group] a >gil215737473ldbjlBAG96603. 11unnamed protein 8 sativ NP product [Oryza sativa Japonica Group] 2 a _oo >gi 1 1574 1081Idbj IBAG97576. i lunnamed protein 5 Japo 104 115 product [Oryza sativa Japonica Group] 2 nica 75 1 447 >gil222623302lgblEEE57434. 11hypothetical 6 Grou 39 5 1 4 468 protein OsJ_07638 [Oryza sativa Japonica Group] 3 P 09 90 EE 0 Oryz C7 543 a 365 625 hypothetical protein Osl_08 191 [Oryza sativa Indica 8 sativ 39 9 48 Group] 2 a 10

2 Os02g0757700 [Oryza sativa Japonica Group] >gil46805687ldbjlBAD17088. 11F-box protein-like Oryz [Oryza sativa Japonica Group] 0 a >gill l3537703ldbj IB AF10086. i lOs02g0757700 sativ NP [Oryza sativa Japonica Group] 7 a _oo >gill25541 199lgblEAY87594.11hypothetical 9 Japo 104 115 protein Osl_09005 [Oryza sativa Indica Group] 4 nica 817 448 >gill2558375 1lgblEAZ24682. 11hypothetical 0 Grou 39 52 2 784 protein OsJ_08452 [Oryza sativa Japonica Group] 3 P 26 02 0

8 NP 4 _oo hypothetical protein LOCI 00273637 [Zea mays] 7 114 226 >gill94696402lgblACF82285. 11unknown [Zea 7 152 506 mays] >gill94704930lgblACF86549. 11unknown 6 Zea 39 52 5 077 [Zea mays] 1 mays 27 03 0

8 4 AC 4 F7 194 7 974 691 7 Zea 39 52 4 319 unknown [Zea mays] 6 mays 28 04 0

8 4 AC 4 G3 195 7 170 619 7 Zea 39 52 3 745 ubiquitin-protein ligase [Zea mays] 6 mays 29 05 Os06g02 19700 [Oryza sativa Japonica Group] >gil5 1535368ldbj IB AD37239. i lF-box protein-like [Oryza sativa Japonica Group] >gil113595204ldbj IB AF19078.11Os06g02 19700 0 Oryz [Oryza sativa Japonica Group] a >gill25554574lgblE AZ00180. i lhypothetical 7 sativ NP protein OsI_22185 [Oryza sativa Indica Group] 2 a _oo >gil1255965 15lgblEAZ36295.11hypothetical 8 Japo 105 115 protein OsJ_20616 [Oryza sativa Japonica Group] 3 nica 716 467 >gil215697729ldbjlBAG91723. 11unnamed protein 5 Grou 39 52 4 129 product [Oryza sativa Japonica Group] 8 P 30 06 0 Hord eum 7 vulga 0 re 1 subs BA 326 4 P J92 514 9 vulga 39 52 240 179 predicted protein [Hordeum vulgare subsp. vulgare] 3 re 31 07 AA Sorg R3 397 hum 091 772 propi 39 6 92 phytochrome B [Sorghum propinquum] 1 nquu 32 m Sorg 0 hum bicol 9 or 9 subs AA 8 p. X R3 397 3 drum 091 772 phytochrome B [Sorghum bicolor subsp. x 0 mon 39 5 90 drummondii] 1 dii 33 hypothetical protein SORBIDRAFT_01g037340 [Sorghum bicolor] >gil39777261 lgblAAR30900. 11 phytochrome B [Sorghum bicolor] >gil39777263lgblAAR30901 .11phytochrome B [Sorghum bicolor] >gil39777265lgblAAR30902. 1l phytochrome B [Sorghum bicolor] >gil39777269lgblAAR30904. 11phytochrome B [Sorghum bicolor] >gil39777275lgblAAR30907. 1l phytochrome B [Sorghum bicolor subsp. verticilliflorum] >gil39777277lgblAAR30908. 1l phytochrome B [Sorghum bicolor subsp. verticilliflorum] >gil39777279lgblAAR30909. 11 phytochrome B [Sorghum bicolor subsp. verticilliflorum] >gil3977728 1lgblAAR309 10. 11 phytochrome B [Sorghum bicolor subsp. verticilliflorum] >gil39777283lgblAAR3091 1.11 phytochrome B [Sorghum bicolor subsp. 0 verticilliflorum] >gil39777285lgblAAR30912. 1l phytochrome B [Sorghum bicolor subsp. 9 XP verticilliflorum] >gil39777287lgblAAR30913. 1l 9 _oo phytochrome B [Sorghum bicolor subsp. 8 Sorg 246 242 verticilliflorum] >gil241921827lgblEER9497 1.11 3 hum 797 041 hypothetical protein SORBIDRAFT_01g037340 0 bicol 39 52 3 156 [Sorghum bicolor] 1 or 34 08 Sorg 0 hum bicol 9 or 9 subs AA 7 P - R3 397 4 verti 091 772 phytochrome B [Sorghum bicolor subsp. 5 cillifl 39 4 88 verticilliflorum] 1 orum 35 0

9 9 AA 7 Sorg R3 397 4 hum 090 772 5 bicol 39 3 66 phytochrome B [Sorghum bicolor] 1 or 36 0

AA 9 Sorg R3 397 phytochrome B [Sorghum bicolor] 9 hum 090 772 >gil39777273lgblAAR30906. 11phytochrome B 6 bicol 39 5 70 [Sorghum bicolor] 6 or 37

495 [Sorghum bicolor] 6 or 2 5 3 9 6 Predi cted zma 33 AC mir 6- G3 195 5068 35 883 638 Zea 39 52 2 5 0 723 nucleotide binding protein [Zea mays] 1 mays 54 23 0

9 NP 2 _oo 5 115 226 nucleotide binding protein [Zea mays] 4 023 495 >gill95637698lgblACG383 17. 1lnucleotide binding 6 Zea 39 52 3 198 protein [Zea mays] 6 mays 55 24 XP 13 _oo hypothetical protein SORBIDRAFT_04g004160 Sorg 8- 245 242 [Sorghum bicolor] >gil241933 173lgblEES063 18. 1l hum 15 334 064 hypothetical protein SORBIDRAFT_04g004160 bicol 39 52 7 2 105 [Sorghum bicolor] 1 or 56 25 0 Oryz a 8 sativ 3 a EE 8 Japo E5 543 9 nica 634 986 hypothetical protein OsJ_05464 [Oryza sativa 9 Grou 39 9 60 Japonica Group] 6 P 57 0 Oryz a 7 sativ 7 a BA 4 Japo D2 453 7 nica 804 820 putative Helicase SKI2W [Oryza sativa Japonica 4 Grou 39 6 08 Group] 2 P 58 XP 55 _oo hypothetical protein SORBIDRAFT_01g0075 10 Sorg 4- 246 242 [Sorghum bicolor] >gil241920274lgblEER934 18. 11 hum 57 642 038 hypothetical protein SORBIDRAFT_01g0075 10 bicol 39 52 3 0 050 [Sorghum bicolor] 1 or 59 26 Predi cted XP zma _oo hypothetical protein SORBIDRAFT_10g003610 Sorg mir 24 243 242 [Sorghum bicolor] >gil241916068lgblEER892 12. 11 hum 5070 784 094 hypothetical protein SORBIDRAFT_10g003610 bicol 39 52 1 42 5 709 [Sorghum bicolor] 1 or 60 27 LOC100283133 [Zea mays] 0 NP >gill95621266lgblACG32463. 1ltrafficking protein _oo particle complex subunit 4 [Zea mays] 9 114 226 >gill95627666lgblACG35663. 1ltrafficking protein 8 950 500 particle complex subunit 4 [Zea mays] 6 Zea 39 52 7 789 >gil223974417lgblACN3 1396. 1lunknown [Zea 0 mays 6 1 28

9 product [Vitis vinifera] 6 1 5 4 0

8 XP 3 Popu _oo 9 lus 231 224 predicted protein [Populus trichocarpa] 1 trich 400 105 >gil222850409lgblEEE87956. 11predicted protein 6 ocarp 39 52 1 980 [Populus trichocarpa] 1 a 69 36

Target sequences according to the teachings of the invention can be overexpressed or silenced as described herein. Methods of generating transgenic plants are described in Example 6, selection according to expression level is described in Example 7, selection according to tolerance to abiotic stress is described in Examples 8 and 9, above. Generally, target genes of upregulated miRNAs are contemplated to be downregulated; conversely target genes of downregulated miRNAs are contemplated to be upregulated according to the present teachings.

Table 23 - Abbreviations of Plant Species Common Name Organism Name Abbreviation Peanut Arachis hypogaea ahy Arabidopsis lyrata Arabidopsis lyrata aly Rocky Mountain Columbine Aquilegia coerulea aqc Tausch's goatgrass Aegilops taushii ata Arabidopsis thaliana Arabidopsis thaliana ath Grass Brachypodium distachyon bdi Brassica napus canola ("liftit") Brassica napus bna Brassica oleracea wild cabbage Brassica oleracea bol Brassica rapa yellow mustard Brassica rapa bra Clementine Citrus Clementine ccl Orange Citrus sinensis csi Trifoliate orange Citrus trifoliata ctr Glycine max Glycine max gma Wild soybean Glycine soja gso Barley Hordeum vulgare hvu Lotus japonicus Lotus japonicus Ija Medicago truncatula - Barrel Clover ("tiltan") Medicago truncatula mtr Oryza sativa Oryza sativa osa European spruce Picea abies pab Physcomitrella patens (moss) Physcomitrella patens ppt Pinus taeda - Loblolly Pine Pinus taeda pta Populus trichocarpa - black cotton wood Populus trichocarpa ptc Castor bean ("kikayon") Ricinus communis rco Sorghum bicolor Dura Sorghum bicolor sbi tomato microtom Solanum lycopersicum sly Selaginella moellendorffii Selaginella moellendorffii smo Sugarcane Saccharum spp ssp Triticum aestivum Triticum aestivum tae cacao tree and cocoa tree Theobroma cacao tec Vitis vinifera Grapes Vitis vinifera vvi corn Zea mays zma

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. WHAT IS CLAIMED IS:

1. A method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide having a nucleic acid sequence at least 90 % identical to SEQ ID NOs: 103, 101-102, 104-216, 223-227, 264-416, wherein said nucleic acid sequence is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant.

2. A transgenic plant exogenously expressing a polynucleotide having a nucleic acid sequence at least 90 % identical to SEQ ID NOs: 1-216, 223-227, 264-416, 615-626 or 639, wherein said nucleic acid sequence is capable of regulating abiotic stress tolerance of the plant.

3. The transgenic plant of claim 2, wherein said polynucleotide has a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-216, 223- 227, 264-416, 615-626 or 639.

4. The method of claim 1 or the transgenic plant of claim 2, wherein said exogenous polynucleotide encodes a precursor of said nucleic acid sequence.

5. The method of claim 1, wherein said precursor is at least 60 % identical to SEQ ID NO: 217-222, 417-421 or 458-614.

6. The method of claim 1 or the transgenic plant of claim 2, wherein said exogenous polynucleotide encodes a miRNA or a precursor thereof.

7. The method of claim 1 or the transgenic plant of claim 2, wherein said exogenous polynucleotide encodes a siRNA. 8. The method of claim 1 or the transgenic plant of claim 2, wherein said exogenous polynucleotide is selected from the group consisting of SEQ ID NO: 103, 101-102, 104-216, 217-222, 223-227, 264-416, 417-421 or 458-614.

9. An isolated polynucleotide having a nucleic acid sequence at least 90 % identical to SEQ ID NO: 16-113, 117-216, wherein said nucleic acid sequence is capable of regulating abiotic stress tolerance of a plant.

10. The isolated polynucleotide of claim 9, wherein said nucleic acid sequence us as set forth in SEQ ID NO: 16-113, 117-216.

11. The isolated polynucleotide of claim 9, wherein said polynucleotide encodes a precursor of said nucleic acid sequence.

12. The isolated polynucleotide of claim 9, wherein said polynucleotide encodes a miRNA or a precursor thereof.

13. The isolated polynucleotide of claim 9, wherein said polynucleotide encodes a siRNA.

14. A nucleic acid construct comprising the isolated polynucleotide of claim 9-13 under the regulation of a cis-acting regulatory element.

15. The nucleic acid construct of claim 14, wherein said cis-acting regulatory element comprises a promoter.

16. The nucleic acid construct of claim 15, wherein said promoter comprises a tissue-specific promoter.

17. The nucleic acid construct of claim 16, wherein said tissue- specific promoter comprises a root specific promoter. 18. A method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide which downregulates an activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence at least 90 % identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-100, 615- 626 and 639, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant.

19. A transgenic plant exogenously expressing a polynucleotide which downregulates an activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence at least 90 % identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-100, 615-626 and 639.

20. An isolated polynucleotide which downregulates an activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-100, 615-626 and 639, 627-638 and 640.

21. The method of claim 18, the transgenic plant of claim 19 or the isolated polynucleotide of claim 20, wherein said polynucleotide encodes a miRNA-Resistant Target as set forth in Tables 14-16.

22. The method, the transgenic plant or the isolated polynucleotide of claim 21, wherein said polynucleotide encoding miRNA-Resistant Target is as set forth in SEQ ID NO: 877-886, 893-913, 1226-1535.

23. The method of claim 18, the transgenic plant of claim 19 or the isolated polynucleotide of claim 20, wherein said isolated polynucleotide encodes a target mimic as set forth in Tables 17-19. 24. The method, the transgenic plant or the isolated polynucleotide of claim 21, wherein said polynucleotide encoding said target mimic is as set forth in SEQ ID NO:1741-1815.

25. A nucleic acid construct comprising the isolated polynucleotide of claim 20 under the regulation of a cis-acting regulatory element.

26. The nucleic acid construct of claim 25, wherein said cis-acting regulatory element comprises a promoter.

27. The nucleic acid construct of claim 26, wherein said promoter comprises a tissue-specific promoter.

28. The nucleic acid construct of claim 27, wherein said tissue-specific promoter comprises a root specific promoter.

29. The method of claim 1 or 18, further comprising growing the plant under abiotic stress.

30. The method of claim 29, wherein said abiotic stress is selected from the group consisting of salinity, drought, water deprivation, flood, etiolation, low temperature, high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, low nitrogen, atmospheric pollution and UV irradiation.

31. The method of claim 1 or 18, or the plant of claim 2 or 19, being a monocotyledon.

32. The method of claim 1 or 18, or the plant of claim 2 or 19, being a dicotyledon.

33. A method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide encoding a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1861-1869, 1892-1915, 1921-1924, 1931- 1939, 1952-1963, 2010-2014, 2327-2355, 2763-3040, 3044-3163, 3175-3269, 3313- 3323, 3458-3944 or 3950-3969, wherein said polypeptide is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant.

34. A transgenic plant exogenously expressing a polynucleotide encoding a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1816-2014, 2183-2355, 2500-3969, wherein said polypeptide is capable of regulating nitrogen use efficiency of the plant.

35. A nucleic acid construct comprising a polynucleotide encoding a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1816-2014, 2183-2355, 2500-3969, wherein said polypeptide is capable of regulating abiotic stress tolerance of a plant, and wherein said polynucleotide is under a transcriptional control of a cis-acting regulatory element.

36. The method of claim 33 or the transgenic plant of claim 34 or the nucleic acid construct of claim 35, wherein said polynucleotide is selected from the group consisting of SEQ ID NO: 2053-2061, 2080-2101, 2106-2109, 2111-2116, 2126-2136, 2178-2182, 2478-2499, 4185-4418, 4422-4527, 4539-4624, 4661-4670, 4787-5213 and 5219-5238.

37. The method of claim 33 or the transgenic plant of claim 34 or the nucleic acid construct of claim 35, wherein said polypeptide is selected from the group consisting of SEQ ID NO: 1861-1869, 1892-1915, 1921-1924, 1931-1939, 1952-1963, 2010-2014, 2327-2355, 2763-3040, 3044-3163, 3175-3269, 3313-3323, 3458-3944 and 3950-3969.

38. The nucleic acid construct of claim 35, wherein said cis-acting regulatory element comprises a promoter. 39. The nucleic acid construct of claim 38, wherein said promoter comprises a tissue-specific promoter.

40. The nucleic acid construct of claim 39, wherein said tissue-specific promoter comprises a root specific promoter.

41. The method of claim 33, further comprising growing the plant under water deprivation conditions.

42. The method of claim 33, further comprising growing the plant under salinity stress.

43. The method of claim 33, further comprising growing the plant under high temperature stress.

44. The method of claim 33, further comprising growing the plant under abiotic stress.

45. The method of claim 44, wherein said abiotic stress is selected from the group consisting of salinity, drought, water deprivation, flood, etiolation, low temperature, high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, atmospheric pollution and UV irradiation.

46. The method of claim 33, or the plant of claim 34, being a monocotyledon.

47. The method of claim 33, or the plant of claim 34, being a dicotyledon.

48. A method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide which downregulates an activity or expression of a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1816-1860, 1870-1891, 1916-1920, 1925-1930, 1940-1951, 1964-2009, 2183-2326, 2500-2762, 3041-3043, 3164-3174, 3270-3312, 3324-3457, 3945-3949, wherein said polypeptide is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant.

49. A transgenic plant exogenously expressing a polynucleotide which downregulates an activity or expression of a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1816-1860, 1870-1891, 1916-1920, 1925- 1930, 1940-1951, 1964-2009, 2183-2326, 2500-2762, 3041-3043, 3164-3174, 3270- 3312, 3324-3457, 3945-3979, wherein said polypeptide is capable of regulating abiotic stress tolerance of the plant.

50. A nucleic acid construct comprising a polynucleotide which downregulates an activity or expression of a polypeptide having an amino acid sequence at least 80 % homologous to SEQ ID NOs: 1816-1860, 1870-1891, 1916-1920, 1925- 1930, 1940-1951, 1964-2009, 2183-2326, 2500-2762, 3041-3043, 3164-3174, 3270- 3312, 3324-3457, 3945-3949, wherein said polypeptide is capable of regulating abiotic stress tolerance of a plant, said nucleic acid sequence being under the regulation of a cis-acting regulatory element.

51. The method of claim 48, the transgenic plant of claim 49 or the nucleic acid construct of claim 50, wherein said polynucleotide acts by a mechanism selected from the group consisting of sense suppression, antisense suppresion, ribozyme inhibition, gene disruption.

52. The nucleic acid construct of claim 50, wherein said cis-acting regulatory element comprises a promoter.

53. The nucleic acid construct of claim 52, wherein said promoter comprises a tissue-specific promoter. 54. The nucleic acid construct of claim 53, wherein said tissue-specific promoter comprises a root specific promoter.

55. The method of claim 48, further comprising growing the plant under water deprivation conditions.

56. The method of claim 48, further comprising growing the plant under salinity stress.

57. The method of claim 48, further comprising growing the plant under high temperature stress.

58. The method of claim 48, further comprising growing the plant under abiotic stress.

59. The method of claim 58, wherein said abiotic stress is selected from the group consisting of salinity, drought, water deprivation, flood, etiolation, low temperature, high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency, nutrient excess, atmospheric pollution and UV irradiation.

A . CLASSIFICATION O F SUBJECT MATTER IPC (2013.01) C12N 15/1 13, C12N 15/82, A01H 5/00

According to International Patent Classification ( PC) or to both national classification and IPC B . FIELDS SEARCHED Minimum documentation searched (classification system followed by classification symbols) IPC (2013.01) C12N 15/1 13, C12N 15/82, A01H 5/00

Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched

Electronic data base consulted during the international search (name of data base and, where practicable, search terms used) Databases consulted: BLAST, CAPLUS, BIOSIS, EMBASE, MEDLINE, REGISTRY, USGENE, DGENE, Google Scholar Search terms used: siRNA 55629

C . DOCUMENTS CONSIDERED TO BE RELEVANT

Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to c im No.

A W O 2009141824 A2 EMMANUEL, EYAL, ; DIBER, ALEX, ; GOLD, EVGENLA, ; NEVO, 1-17,29-32 INBAR, ; VINOCUR, BASIA JUDITH, ; AYAL, SHARON, ; RONEN, GIL, ; HERSCHKOVITZ, YOAV, ; GANG, MICHAEL, ; DIMET, DOTAN, ; IDAN, ANAT. 26 Nov 2009 (2009/1 1/26) claims 1-4, 19, 20, 24, 25, 31-34; description page 10 (lines 17-22), page 13 (lines 12-14), page 38 (line 15) - page 40 (line 17) and page 42 (lines 10-12), example 8 (especially table 29).

A Sunkar et al. "Small RNAs as big players in plant abiotic stress responses and nutrient 1-17,29-32 deprivation". Trends in Plant Science 2007, June 18, Vol.12, no. 7, pages 301-309. 18 Jul 2007 (2007/07/18) Whole document (especially table 1)

A W O 201 1132127 A l BASF PLANT SCIENCE COMPANY GMBH, BASF (CHINA) 1-17,29-32 COMPANY LIMITED 27 Oct 201 1 (201 1/10/27) Claims 1, 4

Further documents are listed in the continuation of Box C . X See patent family annex.

* Special categories of cited documents: te document published after the international filing date or priority "A" document defining the genera! state of the art which is ot considered date and not in conflict with the application but cited to understand to be of particular relevance the principle or theory underlying the invention "E" earlier application or patent but published on or after the χ » document of particular relevance; the claimed invention cannot be international tiling date considered novel or cannot be considered to involve an inventive "L" document which may throw doubts o priority ciaim(s) r which is when the document is taken alone cited to establis he publication date o another citation or other .ocumen ,t ,· . . , · . · .· ,h Y c:r particular relevance: the claimed invention cannot be special reason as s r ·d, , · ,ve . . *pecified') consi ered to invol an inventive step when t e document is "O" document referring to an oral disclosure, use, exhibition or other combined with one or more other such documents, such combination means being obvious to a person skilled in the art " " document published prior to the international fi !in date but later ,ocument. ,ber ,he .en t ,.amiiy « t & d mem orc t same at l than se priorit date claimed Date o f the actual completion of ihe international search Date of mailing of the international search report

13 Jan 2013 13 Jan 2013

Name and mailing address of the ESA: Authorized officer Israel Patent Office MAZEL Alexander The Technology Park, Bldg.5, Malcha, Jerusalem, 9695 1, Israel [email protected] Facsimile No. 972-2-5651616 Telephone No. 972-2-565 1716 Form PCT/ISA/21 0 (second sheet) (July 2009) Box No. M Observations where unity of i ve tion is Jacking (Continuation of item 3 of first sheet)

T is International Searching Authority found multiple inventions in this international application, as follows: See extra sheet.

As all required additional search fees were timely paid by the applicant, this international search report covers all searchable claims.

As all searchable claims could be searched without effort justifying additional fees, this Authority did not invite payment of additional fees.

As only some of the required additional search fees were timely paid by the applicant, this international search report covers only those claims for which fees were paid, specifically claims Nos.:

No required additional search Sees were timely paid by the applicant. Consequently, this international search report restricted to the invention first mentioned in the claims; it is covered by claims Nos.: 1-17,29-32

Remark on Protest The additional search fees were accompanied by the applicant's protest and, where applicable, the payment of a protest fee. The additional search fees were accompanied by the applicant's protest but the applicable protest fee was not paid within the time limit specified in the invitation. No protest accompanied the payment of additional search fees.

Form PCT/ESA/2 0 (continuation of first sheet (2)) (July 2009) Patent document cited search Publication date Patent family member(s) Publication Date report

WO 201 1132127 A l 27 Oct 201 1 AU 201 1243980 A l 0 1 Nov 2012

CA 2793559 A l 27 Oct 201 1

EP 2385 129 A l 09 Nov 201 1

WO 201 1132127 A l 27 Oct 201 1

WO 2009141824 A2 26 Nov 2009 AR 071871 A l 2 1 Jul 2010

AU 2009250806 A l 26 Nov 2009

CA 2724545 A l 26 Nov 2009

EP 2279258 A2 02 Feb 201 1

EP 2279258 A4 08 Jun 201 1

US 201 1097771 A l 28 Apr 201 1

WO 2009141824 A2 26 Nov 2009

WO 2009141824 A3 22 Apr 2010

Form PCT/ISA/210 (patent family annex) (July 2009) No. Observations where a i of Invention s lacking (Continnatton of item 3 of first sheet): ' This International Searching Authority found multiple iiwentions in this international application, as follows: Invention 1 Invention 1relates inter alia to a method of Claim/s 1-17,29-32 improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant an exogenous polynucleotide having a nucleic acid sequence at least 90% identical to SEQ ID NO: 103, wherein said nucleic acid sequence is capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant. Invention 1 also relates to transgenic plants expressing said polynucleotide, to nucleic acid constructs comprising said polynucleotide and to said isolated polynucleotide itself. Invention 2 Inventions 2-3806 relate inter alia to Claim/s 1-59 -a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant exogenous polynucleotides listed in claim s 1 (besides SEQ ID NO: 103), 5, 8 wherein said nucleic acid sequences are capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant.;

- a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant exogenous polynucleotides which downregulate an activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence at least 90% identical to nucleic acid sequences listed in claim s 18, 22, 24 thereby improving abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant.;

-a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant exogenous polynucleotides encoding polypeptides having amino acid at least 80% homologous to sequences listed in claims 33 said polynucleotides can be selected, inter alia, from sequences listed in claim 36, wherein said polypeptides are capable of regulating abiotic stress tolerance of the plant, thereby improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of the plant.;

- a method of improving abiotic stress tolerance, nitrogen use efficiency, biomass, vigor or yield of a plant, the method comprising expressing within the plant exogenous polynucleotides which downregulate an activity or expression of polypeptides having amino acid at least 80% homologous to sequences listed in claim 48;

-to transgenic plants exogenously expressing polynucleotide having a nucleic acid sequences as set forth in claim 2, 8, 19, 22, 24, 34, 36, 49; -to isolated polynucleotides having a nucleic acid sequences listed in claims 9, and to nucleic acid

Form PCT/ISA 2 0 (extra sheet) (July 2009) constructs comprising said isolated polynucleotides;

-to isolated polynucleotides which downregulate activity or expression of a gene encoding an RNAi molecule having a nucleic acid sequence having a nucleic acid sequences listed in claims 20, 22, 24, and to nucleic acid constructs comprising isolated polynucleotides of claim 20;

-to nucleic acid constructs comprising polynucleotide encoding polypeptides having an amino acid sequences listed in claims 35 or 37 wherein said polynucleotide can be, inter alia, of sequences listed in claim 36.

-to nucleic acid constructs comprising polynucleotides which downregulates an activity or expression of polypeptides having an amino acid sequences at least 80% homologous to sequences listed in claim 50.

Form PCT/ SA 2 0 (extra sheet) (July 2009)