University of Castilla-La Mancha Faculty of Environmental Sciences and Biochemistry

UNIVERSIDAD DE CASTILLA-LA MANCHA

FACULTAD DE CIENCIAS AMBIENTALES Y BIOQUÍMICA

Departamento de Ciencias Ambientales Área de Fisiología Vegetal

Análisis funcional de genes cruciales para el desarrollo de sitios de alimentación inducidos por nematodos agalladores (Meloidogyne spp.) en arabidopsis

Fernando Evaristo Díaz Manzano

Doctorado en Ciencias Agrarias y Ambientales

Tesis Doctoral

Toledo, 2017 Fernando Evaristo Díaz Manzano UNIVERSITY OF CASTILLA-LA MANCHA

ENVIRONMENTAL SCIENCES AND BIOCHEMISTRY FACULTY

Department of Environmental Sciences Plant Physiology Area

Functional analysis of genes crucial for the development of feeding sites induced by root-knot nematodes (Meloidogyne spp.) in arabidopsis

Fernando Evaristo Díaz Manzano

PhD in Agricultural and Environmental Sciences

Doctoral Thesis

Toledo, 2017

UNIVERSITY OF CASTILLA-LA MANCHA FACULTY OF ENVIRONMENTAL SCIENCES AND BIOCHEMISTRY

Plant Physiology Area

Functional analysis of genes crucial for the development of feeding sites induced by root-knot nematodes (Meloidogyne spp.) in arabidopsis

AUTHOR: M.Sc. Fernando Evaristo Díaz Manzano

DIRECTOR: Dr. Carolina Escobar Lucas

CODIRECTOR: Dr. Carmen Fenoll Comes

Doctoral Thesis

Toledo, 2017

To all those who trusted, trust and will trust in me, Thank you, hugs, and kisses!

A todos aquellos que confiaron, confían y confiarán en mi persona, ¡gracias, besos y abrazos!

Humility, perseverance and honor...

When you observe normality, avoid it;

When you see frequency, elude it;

When you sense singularity, pursue it.

Humildad, perseverancia y honor…

Cuando observes normalidad, evítalo;

Cuando veas frecuencia, elúdelo;

Cuando intuyas singularidad, persíguelo.

INDEX OF CONTENTS

- 7 -

- 8 -

Index of contents

INDEX OF CONTENTS ...... - 7 - 1. - ACKNOWLEDGMENTS (AGRADECIMIENTOS) ...... - 15 -

1.1. - ENGLISH (INGLÉS) ...... - 17 - 1.2. - ESPAÑOL (SPANISH) ...... - 19 - 2. - ABSTRACT (RESUMEN) ...... - 21 -

2.1. - ENGLISH (INGLÉS) ...... - 23 - 2.2. - ESPAÑOL (SPANISH) ...... - 25 - 3. - INTRODUCTION ...... - 27 - 3.1. - PLANT PARASITIC NEMATODES ...... - 29 -

3.1.1. - ROOT KNOT NEMATODES, AN OVERVIEW ...... - 32 - 3.1.2. – THE CONTROL OF ROOT KNOT NEMATODES ...... - 36 - 3.2. – PLANT DEVELOPMENTAL PATHWAYS ALTERED BY NEMATODES WITHIN THEIR FEEDING SITES: MOLECULAR HALLMARKS OF GALLS AND GIANT CELLS ...... - 40 -

3.2.1. – PARALELLS BETWEEN LATERAL ROOT FORMATION AND RKNS FEEDING SITES ...... - 43 - 3.2.2. – GIANT CELLS, FLOWERING AND TUBER FORMATION: ARE THERE SIMILARITIES? ...... - 47 - 3.3. – GENE SILENCING IN GALLS AND GIANT CELLS ...... - 50 -

3.3.1. – SMALL RNAS IN GIANT CELLS ...... - 52 - 4. – OBJECTIVES (OBJETIVOS) ...... - 55 - 5. - METHODOLOGY ...... - 61 - 5.1. – MATERIAL AND METHODS USED IN THIS THESIS ...... - 63 -

5.1.1. – IN VITRO CULTURE OF ARABIDOPSIS ...... - 63 - 5.1.2. – PLANT MATERIAL ...... - 63 - 5.1.3. – HOMOZYGOUS LINES SELECTION IN SOIL ...... - 65 - 5.1.4. – LATE FLOWERING ASSAYS ...... - 65 -

- 9 -

- 10 -

Index of contents

5.1.5. – ASSESING LR FOUNDER CELL NUMBER IN INFECTED VERSUS UN-INFECTED PLANTS ...... - 66 - 5.1.6. – MAINTENANCE AND AMPLIFICATION OF NEMATODES ... - 67 - 5.1.7. – IN VITRO INOCULATION WITH NEMATODES ...... - 68 - 5.1.8. – ANALYSIS OF REPRODUCTION PARAMETERS IN SOIL ... - 68 - 5.1.9. – NEMATODE PERFORMANCE IN POTATO MIR172 OVEREXPRESSOR LINES ...... - 69 - 5.1.10. – GUS ANALYSIS AND GFP EXPRESSION ...... - 70 - 5.1.11. – GCS & GALL TRANSCRIPTOMES IN SILICO ANALYSIS ... - 70 - 5.1.12. – IN SILICO ANALYSIS OF PLANT AUXIN CIS-ELEMENTS .. - 71 - 5.1.13. – PHARMACOLOGICAL TREATMENTS...... - 71 - 5.1.14. – PLANT RNA ISOLATION AND QPCR ANALYSIS ...... - 72 - 5.1.15. – PLANT IN SITU HYBRIDIZATION ...... - 72 - 5.1.16. – BLASTN ANALYSIS IN CROPS ...... - 73 - 5.1.17. – DATA PROCESSING ...... - 73 - 6. - RESULTS AND DISCUSSION ...... - 75 - 6.1.- LONG-TERM IN VITRO SYSTEM FOR MAINTENANCE AND AMPLIFICATION OF RNKS IN CUCUMIS SATIVUS ROOTS ...... - 77 - 6.2.- PHENOTYPING NEMATODE FEEDING SITES: THREE‐DIMENSIONAL RECONSTRUCTION AND VOLUMETRIC MEASUREMENTS OF GIANT CELLS INDUCED BY ROOT‐KNOT NEMATODES IN ARABIDOPSIS ...... - 88 - 6.3.- A RELIABLE PROTOCOL FOR IN SITU MICRORNAS DETECTION IN FEEDING SITES INDUCED BY ROOT-KNOT NEMATODES .... - 108 - 6.4. A COMPARATIVE STUDY OF LATERAL ROOT FORMATION AND THE DEVELOPMENT OF GALLS/GCS THROUGH AUXIN REGULATED PATHWAYS GOVERNING LATERAL ROOT INITIATION...... - 117 - 6.5. - THE GENE REGULATORY MODULE MIRNA172/TOE1/FT IS ACTIVE IN THE FEEDING SITES INDUCED BY MELOIDOGYNE JAVANICA IN ARABIDOPSIS AND HAS A ROLE DURING THE GALL AND GIANT CELLS DEVELOPMENT ...... - 147 - 7. - GENERAL DISCUSSION...... - 173 - 8. - GENERAL CONCLUSIONS (CONCLUSIONES GENERALES) .. - 183 - - 11 -

- 12 -

Index of contents

9. - SUPPLEMENTAL DATA ...... - 193 - 10. - BOOK CHAPTERS ALREADY PUBLISHED ...... - 207 - 10.1. - DEVELOPMENTAL PATHWAYS MEDIATED BY HORMONES IN NEMATODE FEEDING SITES...... - 209 - 10.2. - A STANDARDIZED METHOD TO ASSESS INFECTION RATES OF ROOT-KNOT AND CYST NEMATODES IN ARABIDOPSIS THALIANA MUTANTS WITH ALTERATIONS IN ROOT DEVELOPMENT RELATED TO AUXIN AND CYTOKININ SIGNALLING ...... - 227 - 11. - BIBLIOGRAPHY ...... - 237 -

- 13 -

- 14 -

1. - ACKNOWLEDGMENTS (AGRADECIMIENTOS)

- 15 -

Egg mass of Meloidogyne javanica in cucumber root

- 16 -

Acknowledgments

1.1. - ENGLISH (INGLÉS) Thanks to Prof. Dr. Carolina Escobar, for teaching me within this wonderful world of plant-nematode interaction, I still remember the question that changed my fate the first day that I went to her office to ask if she wanted to lead my degree project: do you know what are nematodes? Carolina thank you very much for supporting me, encouraging me, helping me, talking to me, giving me advices, in brief, for sharing unforgettable moments that they have taught me how as extraordinary is the time on your side. It was not easy the way, but now we look at the fruit of patience, poise, humility and perseverance. Thanks for instilling me these values.

Thanks to Prof. Dr. Carmen Fenoll for funding me after my FPU predoctoral grant ending and for her supervision of all my publications where her experience and wisdom has made to improve their contents thereof. Also, thanks to co-research group members Prof. Dr. Montaña Mena and Prof. Dr. Mar Martín and all our external collaborators. Thanks to my host director, Dr. Janice de Almeida-Engler, for endorsing me as a scientist in my early days, back in 2009, collaborating in several of my publications and for opening my mind to new thoughts. In addition, to Dr. Gilbert Engler for teaching me the wonderful world of microscopy with details of difficult understanding but with amazing visualization results. Finally, many thanks to Paulo, Mohammed and Natalia for supporting me in the solitude of the foreigner.

Thanks to my village, Mascaraque, for showing me the true quality of life. I am especially grateful to my parents who gave me this wonderful life, and they made me grow in a delightful atmosphere of love and prosperity within the simplicity and humility that I am today. Thanks mom for giving me all your livelihood and love until the last breath. Surely, you are proud of that I have got today.

- 17 -

Acknowledgments

To my father, for teaching me within the agriculture world, my first steps in agronomy. I still remember when we went every afternoon after elementary school to feed the lambs and sheeps at "Corchuelo". Thanks to my girlfriend for putting up with me, trying to understand what I do, explaining to her friends what I work in, filling me with happiness the days of grief and be as patient as science is. Thanks to my brothers, their peeks and support have always helped me to continue this hard and long highway. I would also like to thank to my “big family”, my career mates and my home friends for making me smile, for sharing other moments that perfectly complement scientist life.

Thanks to the great human team at the 0.8 laboratory of Plant Physiology in Toledo: Ana Rapp, Marta, Javi, Alberto, Alfonso, Rocío, Ana Claudia, Virginia and Jonatan, I wish you the best in your life future and thanks for bringing me happiness in our daily routine, without your inputs, it would not be the same. I really appreciate you. Thanks to our old labmates Alejandra, Mary, Maleni, María Sánchez, Loli, Cristina, Maria Peñuelas, Juan and Joaquín for their contributions and works.

Thanks to my elementary and high school teachers, particularly Mr. José Fernández Serrano, Ms. Ana Sanz Casero and Ms. Mayte Muñoz Sáez for teaching me education as a passion, effort and enrichment as a human being.

Thanks to my undergraduate students that I have directed their final project during my Thesis years: Silvia, Ana Celia, Ana Belén, Ana Cristina, José and Sonsoles. Finally, thanks to the labkeepers, María, Montse and Teresa, for their perseverance and sympathy that brighten and sweeten the loneliness of the corridors.

- 18 -

Agradecimientos

1.2. - ESPAÑOL (SPANISH) Gracias a la Dra. Carolina Escobar, por haberme mostrado este maravilloso mundo de la interacción planta-nematodo, todavía recuerdo la pregunta que cambió mi destino el primer día que fui a su despacho para preguntarle si quería dirigir mi proyecto de Licenciatura: ¿Sabes qué son los nematodos? Carolina, muchas gracias por apoyarme, animarme, ayudarme, hablarme, darme consejos; en resumen, por compartir momentos inolvidables que me han enseñado lo extraordinario que es el tiempo a tu lado. No fue fácil el camino, pero ahora miramos el fruto de la paciencia, el equilibrio, la humildad y la perseverancia. Gracias por inculcarme estos valores.

Gracias a la Dra. Carmen Fenoll por financiarme después de mi contrato predoctoral FPU y por la supervisión de todas mis publicaciones donde su experiencia y sabiduría han hecho mejorar su impacto científico. También, gracias a los miembros del grupo de investigación, la Dra. Montaña Mena y la Dra. Mar Martín, así como a todos nuestros colaboradores externos. Gracias a mi directora de estancia, la Dra. Janice de Almeida-Engler, por haberme apoyado como científico en mis primeros años allá por 2009, colaborando en varias de mis publicaciones y dándome ideas que no tenía. Además, al Dr. Gilbert Engler, por enseñarme el maravilloso mundo de la microscopía confocal con detalles de difícil comprensión pero con sorprendentes resultados de visualización. Finalmente, muchas gracias a Paulo, Mohammed y Natalia por apoyarme en la soledad del extranjero y darme risas y aliento en momentos difíciles.

Gracias a mi pueblo, Mascaraque, por enseñarme la verdadera calidad de vida. Gracias especialmente a mis padres, que me dieron esta maravillosa vida y me hicieron crecer en una deliciosa atmósfera de amor y prosperidad, dentro de la sencillez y humildad que soy hoy. Gracias mamá por darme todo tu sustento y amor hasta el último aliento. Seguramente, estarás orgullosa de lo que hoy consigo. - 19 -

Agradecimientos

A mi padre, por enseñarme el mundo de la agricultura, mis primeros pasos. Todavía recuerdo cuando íbamos todas las tardes después de la escuela para alimentar a los corderos y ovejas en Corchuelo. Gracias a mi novia por soportarme, tratando de entender lo que hago, explicando a sus amigos en lo que trabajo, llenándome de felicidad los días de dolor y ser tan paciente como lo es la ciencia. Gracias a mis hermanos, sus miradas y su apoyo siempre me han ayudado a continuar esta larga y dura carrera de fondo. También quiero agradecer a mi "gran familia", a mis compañeros de carrera y a mis amigos, por hacerme sonreír, por compartir otros momentos que complementan perfectamente la vida de científico.

Gracias al gran equipo humano del laboratorio 0.8 de Fisiología Vegetal en Toledo: Ana Rapp, Marta, Javi, Alberto, Alfonso, Rocío, Ana Claudia, Virginia y Jonatan, os deseo lo mejor en vuestro futuro y gracias por traer felicidad en nuestra rutina diaria, sin vuestras bromas, no sería lo mismo. Os aprecio. Gracias a nuestros antiguos compañeros: Alejandra, Mari, Maleni, María Sánchez, Loli, Cristina, María Peñuelas, Juan y Joaquín por aportar su “granito de arena”.

Gracias a mis profesores de la escuela primaria e instituto, especialmente a D. José Fernández Serrano, Dña. Ana Sanz Casero y Dña. Mayte Muñoz Sáez por enseñarme la educación desde la pasión, el esfuerzo y el enriquecimiento como ser humano.

Gracias a mis estudiantes de grado que he dirigido su proyecto final de carrera durante mis años de Tesis: Silvia, Ana Celia, Ana Belén, Ana Cristina, José y Sonsoles. Finalmente, gracias a las auxiliares de servicios, María, Montse y Teresa, por su alegría y simpatía que endulzan la soledad de los pasillos.

- 20 -

Agradecimientos

2. - ABSTRACT (RESUMEN)

- 21 -

Eggs of Meloidogyne javanica nematode

- 22 -

Abstract

2.1. - ENGLISH (INGLÉS) Root knot nematodes (RKNs) of the genus Meloidogyne produce important agricultural losses. These nematodes infect plants at the root elongation zone and penetrate into the vascular cylinder through intercellular migration from the meristematic zone. They induce, from still unknown initial root cells, pseudo-organs called galls where tissue hypertrophy and hyperplasia occur. RKNs also induce their specialized feeding cells within the gall, called giant cells (GCs).

Our group has isolated early developing GCs by laser-capture microdisection and studied their differential transcriptome in Arabidopsis, revealing a high number of repressed genes, which is consistent with a process of gene reprogramming during the differentiation of these specialized cells. Accordingly, subsequent massive sequencing of small RNAs (sRNAs) showed changes in different populations of sRNAs within the galls; particularly, abundant in galls were the rasiRNAs that are known to be involved in epigenetic regulation. This strongly suggest a possible mechanism of gene silencing in RKNs feeding sites via sRNAs. Among them, the population of miRNAs in galls as compared to control non-infected roots was also differentially expressed. In this context, we have studied the involvement of miR390 and miR172 during the plant-nematode interaction; both are regulators of transcription factors, i.e. auxin responsive factors and AP2-like, respectively. Moreover, they showed a crucial role during galls/GCs development together with several intermediate transducers.

Likewise, the specific transcriptome of GCs at early developmental stages showed similarities with the transcriptome of undifferentiated cells from the root apical meristem (quiescent center; QC) and lateral root primordia (LRP). In this regard, we tested the expression and analyzed the function of a battery of genes involved in the key transduction pathway that operate during early stages of LR formation (preinitiation and initiation LR modules). Most of - 23 -

Abstract

these genes also play a crucial role during gall/GCs development; however, some molecular components involved in LR formation showed differences with galls. Thus, gall development present similarities with LR initiation during early stages, sharing, at least partially, molecular transduction pathways leading to the new organogenesis (to LR and/or gall/GCs).

- 24 -

Resumen

2.2. - ESPAÑOL (SPANISH) Los nematodos formadores de agallas (RKNs) del género Meloidogyne producen importantes pérdidas agrícolas. Estos nematodos infectan las raíces en la zona de elongación y penetran en el cilindro vascular migrando intercelularmente desde la zona meristemática. A partir de células de la raíz, de identidad todavía desconocida, inducen pseudo-órganos llamados agallas donde se produce hipertrofia e hiperplasia de los tejidos. Además, los RKNs también inducen dentro de la agalla sus células especializadas de alimentación, llamadas células gigantes (CGs).

Nuestro grupo ha aislado CGs a tiempos tempranos mediante microdisección por láser y ha estudiado su transcriptoma en la planta modelo Arabidopsis thaliana, revelando un alto número de genes diferencialmente reprimidos, lo cual es consistente con un proceso de reprogramación de la expresión génica durante la diferenciación de estas células de nutrición. Posteriormente, la secuenciación masiva de pequeños ARNs (sRNAs) identificó cambios en diferentes poblaciones de sRNAs dentro de las agallas; en concreto, los rasiRNAs, que eran más abundantes en las agallas que en tejido control sin infectar y que, además, están descritos como mediadores de procesos epigenéticos. Esto sugiere un posible mecanismo de silenciamiento de genes en los sitios de alimentación de los RKNs a través de los sRNAs. Entre ellos, la población de miRNAs en las agallas tuvieron también una expresión diferencial en comparación con las raíces control no infectadas. En este contexto, hemos estudiado la participación de los miR390 y miR172 en la interacción planta-nematodo; ambos son reguladores de factores de transcripción; el primero, de factores de respuesta a auxina; y el segundo, de factores de la familia AP2 implicada en floración. Además, ambos miRNAs mostraron un papel crucial durante el desarrollo de las agallas/CGs junto con varios transductores intermedios.

- 25 -

Resumen

Del mismo modo, el transcriptoma específico de CGs en las primeras etapas de desarrollo mostró similitudes con el transcriptoma de células indiferenciadas del meristemo apical de la raíz (el centro quiescente, CQ) y de los primordios de raíces laterales (RL). Por ello, analizamos la expresión y la función de un conjunto de genes implicados en las vías de transducción críticas durante las primeras etapas de la formación de RL (módulos de preiniciación e iniciación de las RL). La mayoría de ellos mostraron un papel crucial también durante el desarrollo de la agalla/CGs; sin embargo, otros componentes moleculares mostraron diferencias en las agallas. Aún así, el desarrollo de las agallas presenta importantes similitudes con el de las RL durante las primeras etapas, posiblemente compartiendo, al menos parcialmente, rutas de transducción de señales comunes en ambos procesos de generación de nuevos órganos (para RL y/o agallas/CGs).

- 26 -

Resumen

3. - INTRODUCTION

- 27 -

Meloidogyne javanica larvae on J2 stage

- 28 -

Introduction: Plant Parasitic Nematodes

3.1. - PLANT PARASITIC NEMATODES Nematodes are pluricellular organisms classified within the large phylum Nematoda that encompasses unsegment roundworms. They are widespread in almost all ecosystems and habitats throughout the planet, including different soils, and oceanic and fresh waters. Compared to free-living nematodes species, only a few are involved in the parasitism of plants (about 15%); however, they affect a wide variety of crops (Gómez & Montes, 2001). In addition, the negative effects that they produce directly can be amplified as they may favour the establishment of soil-borne fungi, bacteria and viruses (Perry & Moens, 2011). There are nematodes detrimental to agriculture, parasites of animal and humans, but also beneficial species, such as the entomopathogenic nematodes used in crops protection as insect control agents (Ravichandra, 2008; Lacey & Georgis, 2012), as well as free-living nematodes involved in soil nutrient turnover.

Approximately 25,000 species of nematodes has been described (Zhang, 2013), although it is believed that there may be up to half a million undiscovered. If this estimate is correct, nematodes occupy second place in terms of diversity, being surpassed only by arthropods (Abad & Williamson, 2010). So far, this number is constantly increasing as new species are discovered or redefined (Elling, 2013). Classic taxonomy proposed two classes, based on morphological and anatomical characters (Chromadorea and Adenophorea), which diverged over 550 million years ago. Recently, a more comprehensive phylogenetic classification based mainly on molecular analysis of small subunit of ribosomal DNA (ssUrDNA) was proposed: Chromadorea and Enoplea (De Ley & Blaxter, 2002; 2004; van Megen et al., 2009; Blaxter, 2011). Nematode species included within the Chromadorea class in the suborder Tylenchina (Table 3.1) have an especial relevance due to their great economic impact on agriculture. Plant parasitic nematodes (PPNs) affect frequently the root system, where they produce extensive damage such

- 29 -

Introduction: Plant Parasitic Nematodes

as galling and necrosis. As an indirect consequence of infection, aboveground plant parts are altered, showing a reduced growth, leaf chlorosis and wilting resulting in poor yield. Crop losses are sometimes underestimated because plant symptoms after the infection are unspecific and can be erroneously identified as nutritional deficiencies or abiotic stress. Some estimates suggest that PPNs cause crop losses of up to 107.000 million of euros worldwide each year (11% of production; McCarter, 2008).

The life cycle of most PPNs (Table 3.2) consists of four juvenile stages between egg and adult phase; the first juvenile stage is called J1 and develops within the egg. After the first moult, from the egg emerges the second stage juveniles (J2), which in some genres such as Meloidogyne represents the infective stage, for the majority of the species (Perry & Moens, 2011). The Meloidogyne spp. J2 larvae are mostly microscopic (from 300 µm to 400 µm in length; Table 3.2). J2 invade and feed on living plants through a protractible oral stylet that they use to puncture cells and to feed from them. Then, they moult resulting in the third and fourth juvenile stage (J3 and J4) to finally become an adult, developing females that lay eggs. Throughout their developmental stages, nematodes usually maintain a vermiform shape. Adult females of Meloidogyne spp. adopt a swollen and pear-like shape (Decraemer & Hunt, 2013). The duration of the life cycle varies between 4 and 8 weeks (Bartlem et al., 2013).

- 30 -

Introduction: Plant Parasitic Nematodes

Table 3.1.- Phylogenetic classification of PPNs according to De Ley & Blaxter (2002). In light green, phylogeny of Meloidogyne spp. (nematode genus studied during the development of this Thesis).

- 31 -

Introduction: Plant Parasitic Nematodes

PPNs are classified according to their lifestyle and feeding habits. Those that penetrate the host root to feed from different inner cell types are classified as endoparasites, whereas the nematodes that feed externally by inserting their mouth stylets into root cells from the root surface are called ectoparasites. Additionally, endoparasites are further sub-classified into sedentary, when they penetrate into the root system and take their food from highly modified cells, losing their mobility and maintaining an active feeding site; or migratory, when they migrate through the root tissues and nourish on plant cells (Lambert & Bekal, 2002; Decraemer & Hunt, 2013).

Sedentary endoparasitic nematodes are biotrophs and show the most sophisticated parasitism behaviour (Abad & Williamson, 2010); they develop an intimate relationship within their hosts, inducing highly specialized ‘pseudo- organs’ (Kyndt et al., 2013) to provide them with a continuous source of food. This group is represented mainly by the root-knot nematodes (RKNs; Meloidogyne spp.) and the cyst nematodes (CNs; e.g. Heterodera & Globodera spp.), receiving their names from the characteristic structures formed in the roots after their infection: the galls or knots and the syncytia.

3.1.1. - ROOT KNOT NEMATODES, AN OVERVIEW RKNs species are polyphagous and they can feed on almost all vascular plants (reviewed in Escobar et al., 2015). They show a broad host range, being able to parasitize hundreds of unrelated crop species. Meloidogyne (Table 3.1) is the most representative genus of RKNs formed by more than 90 species (Jones et al, 2013). Only a few species are known as major pests of agriculture, as they are considered the most abundant and damaging: Meloidogyne incognita (Mi), Meloidogyne javanica (Mj), Meloidogyne arenaria (Ma) in tropical and Mediterranean areas; and Meloidogyne hapla (Mh) in temperate zones (Perry & Moens, 2011). Other minor species of the genus as Meloidogyne enterolobii (Me), Meloidogyne

- 32 -

Introduction: Plant Parasitic Nematodes

fallax (Mf), Meloidogyne chitwoodi (Mc), etc. are gaining importance in recent years (Elling, 2013).

RKNs display a conserved basic body plan throughout their life stages (J1-J4; Table 3.2). Shortly, J2 outermost body structure consists of a body wall encompassing three layers: the cuticle, the hypodermis (also known as epidermis) and the somatic muscles (Decraemer & Hunt, 2013). In J2, the nervous system mainly controls the somatic musculature and sensory perception through the chemoreceptor organs (amphids and sensilla at the head, and phasmids at the posterior end). A distinctive feature of the nervous system is the nerve ring, that encircles the oesophagus behind the medium bulb (Eisenback, 1985), and is the coordinating centre for the nervous system.

Table 3.2. – Life cycle of RKNs. Each larvae type in the different developmental stages is indicated and size (length in micrometers, µm). Source: based on own work.

Meloidogyne spp. usually reproduces by mitotic parthenogenesis (e.g. Mj, Mi or Ma; Williamson, 1998) although some species, as Mh, Mf or Mc, multiplies by facultative meiotic parthenogenesis (van der Beek & G. Karssen, 1997; Liu et al., 2007). The female-to-male ratio is variable; in general, few males are produced and they develop under unfavourable conditions (e.g. insufficient nutrients, crowding or low temperature; Davide & Triantaphyllou, 1967). This decision is taken during the J2 parasitic stage (Triantaphyllou, 1973), but so far signals that promote this change have not been unravelled except for pruning stress under laboratory conditions (Snyder et al., 2006). - 33 -

Introduction: Plant Parasitic Nematodes

Figure 3.1. - Life cycle of Meloidogyne spp. The different stages are enumerated and summarized. Black arrows and N indicate the position of the nematode; asterisks, GCs. Scale bars: 100µm. Source: based on own work. - 34 -

Introduction: Plant Parasitic Nematodes

RKNs life cycle can be completed within 20-40 days, but its length is influenced by environmental conditions (Davide & Triantaphyllou, 1967) such as temperature, to a lesser extent, soil moisture, and by the host species (Ravichandra, 2008). A typical RKNs life cycle (Fig. 3.1) begins with the hatched J2s (Fig. 3.1(1-2)), that are attracted towards the host roots (Fig. 3.1(3)) after sensing chemical gradients of root diffusates (Teillet et al., 2013). When a suitable root tip (De Smet et al., 2015) is located in the soil, nematodes penetrate preferably behind the elongation zone (Fig. 3.1(4)), and migrate intercellularly down to the root tip. Once J2s reach the root tip, they rotate 180 degrees to enter the vascular cylinder and move upwards until near the differentiation zone, where they select several vascular cells to induce the formation of a nematode feeding site (NFS), a gall (Fig. 3.1(5)) (Perry & Moens, 2011).

Inside the gall, a group of selected cells (usually five to eight cells) begin to undergo dramatic morphological and metabolic changes, to become nutrient sinks (Bartlem et al., 2013). The nematode becomes sessile by atrophy of their somatic musculature, except for the head, and will alternate periods of feeding from the different GCs (Fig. 3.1(6)), having three consecutive moults (to J3, J4 and adult female). Under favourable conditions and sufficient nutrients (Bartlem et al., 2013), J4 suffers the final moult to the female adult stage and it starts to deposit hundreds of eggs containing the larvae in a gelatinous matrix of glycoproteinaceous nature that they secrete (Fig. 3.1(7) Sharon & Spiegel, 1993). This matrix is a barrier to water loss (Wallace, 1968) and provides a protection to developing larvae from external pathogenic agents like bacteria and fungi. Transition from J1 to J2 occurs inside the egg within the egg mass (Fig. 3.1(1)) and the life cycle begin again.

- 35 -

Introduction: Plant Parasitic Nematodes

3.1.2. – THE CONTROL OF ROOT KNOT NEMATODES Control strategies in agriculture includes the use of chemicals (nematicides and fumigants); biological control with nematode antagonists; physical methods, such as solarisation and fallowing; cultural methods as crops rotation, plus the use of resistant plants. The use of chemicals is gradually vanishing due to their toxicity and environmental contamination (Kearn et al., 2014). Biological control has resulted in a low efficiency strategy unless applied in combination with other techniques (Viaene et al., 2006). Solarisation and fallowing are high cost strategies showing reduced effectiveness over time. Crops rotation with non-host species or resistant cultivars have provided good results for RKNs control (Hooks et al., 2010). However, so far, only the Mi-1 gene has been successfully transferred to commercial tomato cultivars (Devran & Sögüt, 2010). Mi-1 confers resistance to three well-known Meloidogyne spp. (Mj, Mi and Ma), but is easily overcome when soil temperature increases above 28ºC. In this respect, crops that experience daily fluctuations in soil temperature could recover Mi-1 resistance more easily than longer heat treatments (Verdejo-Lucas et al., 2013; de Carvalho et al., 2015).

Yet, a practical limitation for the general use of Mi-1 in nematode resistance of different crops is that several attempts to transfer Mi-1 to crops other than tomato such as pepper, resulted in loss of resistance (Ornat & Sorribas, 2008). Moreover, orthologous Mi gene in pepper has been also tested (called Me genes); Six of these Me genes showed stable resistance against RKNs infection, i.e., Me1, Me3, and Me7 (N) are effective against a wide range of Meloidogyne spp., including Mj, Mi and Ma (Castagnone-Sereno et al. (2001); Djian-Caporalino et al. 2007). Recent studies on RKNs have shown that the genetic background of the plant greatly influences R-gene efficiency, potentially slowing the adaptation of pathogen populations to R- gene-carrying cultivars (Fournet et al., 2013; Barbary et al., 2014). In other pathosystems (potato virus, genus Potyvirus, and potato), greater durability - 36 -

Introduction: Plant Parasitic Nematodes

results from quantitative trait loci (QTLs), which slow the selection of variants virulent against the R-gene and decrease the size of the pathogen population (Quenouille et al., 2014). However, plant genetic background in breeding programs for RKNs resistance is rarely considered; despite its contribution to R-gene efficiency and durability; in fact, polygenic resistance proved more durable than monogenic resistance, but breeding strategies giving priority to major resistance factors may jeopardize the progress in durability expected from polygenic resistance.

On the other hand, there are practical limitations to the use of natural resistant genes (R genes) in Solanaceae (tomato, pepper, potato, etc.). Firstly, prospecting and evaluating new genetic resources are time-consuming with no guarantee of success. Moreover, it has been described that Me overcome the resistance of tomato and pepper carrying Mi-1 and Me7 (N) gene, respectively (Castagnone-Sereno, 2012; Verdejo-Lucas et al., 2012). Hence, it is difficult to manage these RKNs species, particularly in organic farming systems where chemical control is not an option (Kiewnick et al., 2009). In addition, the difficulties encountered in effectively crossing wild and cultivated relative species or alleles with adverse horticultural traits linked to RKNs resistance in the original resource (linkage drag) may slow down the progress. None of the currently known R genes in Solanaceae confers resistance to all RKNs species; therefore, the more or less narrow range of controlled nematode species constitutes another practical limitation of resistant cultivars to manage these pests in infested fields (Barbary et al., 2015).

In this context, rational management combining breeding and cultivation techniques, will allow the implementation of innovative, sustainable crops production systems that will protect the resistance genes and preserve their durability through generations. So, all these strategies should be combined in an integrated pest management-IPM system for an effective control of RKNs population in the field. A detailed evaluation of the cropping systems and

- 37 -

Introduction: Plant Parasitic Nematodes

accurate diagnosis of RKNs species must be performed for an IPM successful performance. Differences about host preferences that reveal races of a determined species should be also considered; e.g., for Mi, 4 races can infect tomato cv. Rutgers, whereas only races 3 and 4 can parasitize cotton cv. Deltapine (Mahdy, 2002). Consequently, designing an IPM is arduous and overall it needs to be locally considered; thus, there is still a clear requirement to deeply understand the mechanisms involved in the development and maintenance of the specific feeding structures induced in the plant host (Escobar et al., 2015), i.e., galls and GCs. This knowledge together with a deep understanding of the nematode biology could help to develop new biotechnology tools for RKNs control.

In this respect, the recent rapid advances in molecular biology techniques vastly increased the molecular understanding of RKNs–plant interactions, unravelling some of the mechanisms that enable RKNs to be successful plant pests. Studies on biotechnological approaches to RKNs control aims either to exploit natural resistance present in gene pools of crop species and their relatives (Yaghoobi et al., 1995; Ammiraju et al., 2003; Djian- Caporalino et al., 2007; Chu et al., 2011); or to employ synthetic forms of resistance, for instance those based on disruption of feeding cells; e.g. those based on RNA interference gene silencing (RNAi) (Huang et al., 2006; Dinh et al., 2014; Dutta et al., 2015) or on delivery of toxic compounds (Wang et al., 2008), among others.

Recent advances in breeding technology (Lusser & Davies, 2013) developed new techniques of genome editing for creating genetically modified organisms (GMOs) (Wolt et al., 2016), that is, the ability to make tailored changes to a genome sequence, as those based on the CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats) technology (Jansen et al., 2002; Mojica et al., 1995; 2005). Key observations indicated that CRISPR/Cas system has a role in adaptive immunity in prokaryotes (Koonin &

- 38 -

Introduction: Plant Parasitic Nematodes

Makarova, 2013) and proposed that these spacers serve as a template for RNA molecules. Moreover, Cas endonucleases can be reprogrammed by small guide RNAs allowing an extraordinary potential and plasticity for genome editing and being able to be designed for numerous DNA targeting applications including transcriptional control by sRNAs (Barrangou & Marraffini, 2014; Table 3.3). One of the advantages is that Agrobacterium based transformation with exogenous T-DNA will not be necessary avoiding the use of antibiotic selection markers. This is opening a new era of the biotechnology where those plants may have a better acceptance to the more conservative public opinions that are still very reticent to GMOs at least in Europe avoiding the use of exogenous DNA in the organism of interest. In addition, there are many other bio techniques already available to generate GMOs that can be developed alone or in combination with CRISPR/Cas or RNAi for biotechnological control of nematodes (Breyer et al. 2009).

Scientific academic progresses in plant-nematode have experienced a tremendous progress in the last 10 years; e.g., identifying secreted effectors; studying cell wall alterations; learning about their metabolism; developmental pathways mediated by hormones, etc. (Hassan et al., 2010; de Almeida-Engler & Favery, 2011; Cabello et al., 2014; De Smet et al., 2015). One of the most novel biotechnological technique developed for nematode control is RNAi- based approach to silence nematode effector and/or essential genes that relies on the production of stable transgenic plants expressing a double-stranded RNA (dsRNA) corresponding to targeted nematode genes or by ectopic administration of dsRNA or single-stranded (siRNA) molecules similar to the target gene (Dutta et al., 2015). Nevertheless, there is still a breach between the basic research and its practical application to control this crops pest. In the coming years, we should emphasize in the application of biotechnology within an IPM for nematode control, extrapolating more efficiently laboratory data to the field (Barbary et al., 2015).

- 39 -

Introduction: Plant Developmental Pathways Altered By Nematodes

3.2. – PLANT DEVELOPMENTAL PATHWAYS ALTERED BY NEMATODES WITHIN THEIR FEEDING SITES: MOLECULAR HALLMARKS OF GALLS AND GIANT CELLS Nowadays, it is still a great challenge to elucidate the cell processes involved in the dramatic morphological and physiological alterations induced in the initial root cells transformed into a specialized structure for the nematode nourishing, the gall and GCs (Fig. 3.2). The process of formation of this specialized structure involves radical modifications in gene expression (reviewed in Escobar et al., 2011). Different techniques for the study of local and global changes of gene expression after nematode infection were used, among others cDNA-ALFPs, differential display, root cDNA libraries, etc.; determining a large number of genes differentially expressed in response to nematode infection in galls/GCs (reviewed in Escobar et al., 2011). However, the technological advancements combining transcriptomic analysis to cell isolation techniques constituted a substantial step forward to the understanding of global changes in gene expression occurring specifically within the GCs. The transcriptomic changes of isolated GCs, mostly by laser capture microdissection were analysed in Arabidopsis, tomato, medicago and rice (Barcala et al., 2010; Damiani et al., 2012; Ji et al., 2013; Portillo et al., 2013). During GCs differentiaton, the first evidence of developing GCs inside the vascular cylinder of the root is the appearance of binucleate cells near the nematode head (de Almeida-Engler & Favery, 2011; Fig. 3.2). In this respect, the modification of the cell cycle with repeated mitosis with partial cytokinesis followed by endoreduplications (without mitosis) is believed to be caused by missexpression of genes encoding proteins that control cell cycle progression (Gheysen & Fenoll, 2002; de Almeida-Engler et al., 2011; de Almeida-Engler & Gheysen, 2013). Predominantly, there are described cyclin-dependent protein kinases (CDK2a and CDK2b) and mitotic cyclins (CYCA2;1 and CYCB1;1) involved in the control of the cell cycle step phases S to G2 and/or G2 to M (de Almeida-Engler et al., 1999) and endocycle genes like Ccs52 and Del1 that

- 40 -

Introduction: Plant Developmental Pathways Altered By Nematodes

cause endoreduplications in GCs (de Almeida-Engler et al., 2012; reviewed in de Almeida-Engler et al., 2015). Other early induced genes that probably contribute to the extensive morphological changes that result in irregular cell shape and remarkable volume increment (Cabrera et al., 2015a; see point 6.2) are those involved in cytoskeletal formation and organization like AtFh6 (FORMIN HOMOLOG 6 protein), AtActin (ACTIN 12 protein) and AtTub-1 (TUBULIN 1 protein) (de Almeida-Engler et al., 2004; Favery et al., 2004). Accordingly, a large number of unusual, randomly oriented actin bundles and cables were also observed in GCs at early differentiation stages (Caillaud et al., 2008).

Figure 3.2. – Cell cycle modifications in NFS. A. Gall induced by Mj at 7 dpi in Col-0 Arabidopsis ecotype. B. Representative Araldite® longitudinal section of a gall induced by Mj at

- 41 -

Introduction: Plant Developmental Pathways Altered By Nematodes

21 dpi with their nourishing cells (GCs). C. Detail at 20x of nuclei formed in the GCs at 21 dpi. D. Detail at 40x of nuclei formed in the GCs at 21 dpi. N, nematode; asterisks, GCs; arrows, GCs nuclei. Scale bars: 400 µm (a) and 50 µm (b-d). Source: based on own work.

The NFS must serve as unique source of food for the nematodes; they should undergo dramatic changes in metabolism. In this respect, it has been found that several genes involved in various metabolic pathways are induced into the NFS. Some are related to the metabolism of sugars as an Arabidopsis phosphoglucomutase encoded by AtPGM that is activated three days after infection (dai) with M. incognita and H. schachtii and is induced by auxins. In addition, experiments involving the A. thaliana auxin transport genes AUX1 and PIN2 (also called EIR1) suggest a local increase in auxin concentration during feeding site induction and maintenance (Goverse et al., 2000; Mazarei et al., 2003). Loss of function of genes such as AMINO ACID PERMEASE 3 (AtAAP3) and AMINO ACID PERMEASE 6 (AtAAP6), both encoding proteins involved in amino acid transmembrane transport, impaired Mi infection (Marella et al., 2013). Sucrose is assumed to be the main source of carbohydrates for the nematode, and Arabidopsis mutants sus1/sus4, cinv1 and cinv1/cinv2 for the two main enzymes that cleave the sucrose, invertases (INVs) and sucrose synthases (SUSs), showed altered gall formation by Mj (Cabello et al., 2014). Another group of induced genes in GCs/galls are those involved in response to heat shock (Vaghchhipawala et al., 2001; Barcala et al., 2010) whose promoters are activated quite specifically in GCs of Nicotiana tabacum and Arabidopsis thaliana (Escobar et al., 2003; Barcala et al., 2008). GCs are metabolically highly active, thus the accumulation of small heat shock proteins (sHSPs) proposed as molecular chaperons, might be also related to this physiological cellular state (Barcala et al., 2008). However, no molecular functions have been assigned yet during the plant-nematode interaction.

So far, GCs precursor cells have been described as vascular cells (Berg et al., 2008); however, the precise cell types chosen by the nematode as

- 42 -

Introduction: Plant Developmental Pathways Altered By Nematodes

well as the GCs ontogeny is still unclear. Thus, global transcriptomic similarities encountered between early developing GCs, 3 dpi (days post inoculation) and suspension cells differentiating into xylem elements (Escobar et al., 2011; Cabrera et al., 2014b) identified the crucial role of a transcription factor (TF) from the Lateral Organ Boundaries Domain (LBDs) (Xu et al., 2015) family, LBD16, during galls/GCs development and confirmed the importance of the pericycle, a root meristematic vascular tissue, during gall ontogeny similarly to what occurs during lateral root (LR) formation (De Rybel et al., 2010; Yadav et al., 2010; Dastidar et al., 2012; Cabrera et al., 2014b; Díaz-Manzano et al., 2017b). LBD16 is a molecular transducer integrated in a signalling cascade mediated by auxins for LRs and gall formation. These findings strongly suggest that nematodes might alter pre-existing developmental pathways in the precursor cells of GCs, probably interfering with transduction cascades modulated by hormones, such as auxins or cytokinins (Absmanner et al., 2013; Cabrera et al., 2015b; Chang et al., 2015), determining parallelisms between LRs development routes and the formation of NFS (GCs) (Cabrera et al., 2014b; 2015a).

3.2.1. – PARALELLS BETWEEN LATERAL ROOT FORMATION AND RKNs FEEDING SITES Auxins are a group of plant hormones studied for decades as essential for plant growth and development (Overvoorde et al., 2010; De Smet et al., 2015). Auxins play an important role in the formation of the embryonic axis, cell division, expansion and differentiation (Davies, 2010); tropisms (Muday, 2001); generation and regeneration of tissues, elongation and LR development; and formation and maturation of fruits, among other processes (Vanneste & Friml 2009; Weijers & Friml, 2009; Friml, 2010). The diversity of auxins regulated processes are not entirely determined by the routes of synthesis of the hormone, but also by their differential distribution levels within plant tissues (Paciorek & Friml, 2006; Friml, 2010). In cells, auxins accumulate at different levels what involves changes in their developmental program and/or their - 43 -

Introduction: Plant Developmental Pathways Altered By Nematodes

function (Dubrovsky et al., 2008). In recent studies, they were also brought as relevant in the plant response to environmental changes (Tromas & Perrot- Rechenmann, 2010).

Currently, auxins response models involve inducing changes in the expression of auxin-responsive genes through degradation of AUX / IAA (Gray et al., 2002), allowing activation of auxin response factors (ARFs) (Overvoorde et al., 2010) which act as activators or repressors to regulate gene expression (Kieffer et al., 2010). Moreover, auxins also regulate the expression of genes that define cell fate identity (Rademacher et al., 2012), e.g. during xylem differentiation and maturation (Schuetz et al., 2012); lateral root primordia (LRP) development (Lavenus et al., 2013; Atkinson et al., 2014) and root elongation (Bargmann et al., 2013).

The development of LRs is one of the clearest examples of auxin- mediated regulation (Lavenus et al., 2013; 2016). Recently, the parallels between transduction pathways mediated by auxins during the development of LRs (Fukaki et al., 2002; 2006; Fukaki & Tasaka, 2009; Lavenus et al., 2015) and galls was demonstrated by a common transducer LBD16 (a TF from LBDs family) that is crucial to the development of LRs and galls (Cabrera et al., 2014b). LBD16 is also induced by auxins in galls, and an auxin maxima response had been extensively described by using DR5, as a sensor in early developing galls and GCs (Karczmarek et al., 2004; Cabrera et al., 2014b). Thus, there are numerous evidences that indicate molecular links between LR initiation and NFS development. Among them, it was shown that the auxin- insensitive tomato mutant diaegotropica, dgt (Richardson & Price, 1982), which lacks LRs, was resistant to Mi and developed smaller syncytia upon CNs infection (Goverse et al., 2000). In tomato and M. truncatula, two TFs, Knotted1-like homeobox (KNOX1) and ARABIDOPSIS PHANTASTICA-LIKE 1 (PHAN1) are induced in both GCs and LR meristems (Bird & Koltai, 2000; Koltai et al., 2001). Furthermore, one of the first evidences for this parallel was

- 44 -

Introduction: Plant Developmental Pathways Altered By Nematodes

described by Barthels et al. (1997) using a promoter-tagging strategy to identify specific regulatory regions differentially activated in NFS as compared to uninfected roots. Unexpectedly, among the 103 promoter tag lines that displayed a distinct activation response to nematode infection, 39 also exhibited induction at LR initiation sites. This has been further confirmed by in silico analysis of transcriptomes from galls and GCs in Arabidopsis that showed an enrichment of characteristic genes from LR initial cells in the transcriptome of 3 dai GCs and galls (Cabrera et al., 2014b; Fig.3.3).

LRs originate from divisions in the xylem pole pericycle (XPP) cells following an auxin-mediated signalling pathway. Moreover, two XPP marker lines, that are induced at early stages in the LR primordia during LR formation, J0121 and J0192, showed strong and distinct GFP expression in the galls formed by Mj and genetic ablation of the XPP abolished almost totally gall formation in Arabidopsis (Cabrera et al., 2014b). In this context, in silico analysis of the GCs transcriptomes in Arabidopsis (Jammes et al., 2005; Barcala et al., 2010; Cabrera et al., 2014a) revealed that lateral root auxin- responsive genes (LRAG), were also differentially expressed during development of galls induced by Mj in Arabidopsis (this Thesis; Fig. 6.15; Fig. 3.3).

- 45 -

Introduction: Plant Developmental Pathways Altered By Nematodes

Figure 3.3. – Transcriptomic paralells between root cell types and early forming galls/GCs. A. Gall induced by Mj at 4 dpi in DR5::GUS Arabidopsis line showing GUS activity. B. Auxins signalling cascade leading to LR formation and schematic representation of root cell types with transcriptomic similarity to the transcriptomes of developing galls (dark brown), and GCs (light red), and both transcriptomes (red) induced by Mj. Shading Arabidopsis tissues: endodermis (dark brown), pericycle polar cells to LR formation (red), phloem (light red) and quiescent center (two lower cells in red). Source: modified from Cabrera et al., 2014b.

- 46 -

Introduction: Plant Developmental Pathways Altered By Nematodes

3.2.2. – GIANT CELLS, FLOWERING AND TUBER FORMATION: ARE THERE SIMILARITIES? The floral organization involves the establishment of four types of organs structured in concentric whorls: the sepals and petals, which comprise the non-reproductive perianth (outside floral part); and the stamens and carpels, which are the male and female reproductive organs (inside floral part). A. thaliana A-class genes APETALA1 (AP1) and APETALA2 (AP2) confer sepal identity in the first floral whorl. The C-class gene AGAMOUS (AG) specifies stamen identity in whorl three; while AG acts alone in the fourth whorl promoting carpel development. An essential postulate of the ABCE floral model is the antagonistic and reciprocally exclusive action of A and C function genes (Posé et al., 2012; Ó'Maoiléidigh et al., 2014). It has been reported that AP2 (A-class genes) mRNA accumulates not only in the perianth (outside), but also in reproductive organ (inside) primordia (Álvarez-Venegas et al., 2003; Zhao et al., 2007). AP2 expression is regulated at the post-transcriptional level by a the miR172 (Aukerman & Sakai, 2003; Chen, 2004; Jones-Rhoades et al., 2006). MiR172 is toughly up-regulated in the shoot meristem (Fig. 3.4). In young floral primordia, its expression pattern closely resembles that of AG, being mostly concentrated in the floral centre while AP2 accumulating predominantly in the periphery of floral primordia, with only limited overlap to miR172 (Yant et al., 2010). Recent studies have demonstrated that the miR172, which is activated by miR156-targeted SPLs (squamosa-promoter binding protein-like gene family), targets AP2-like TFs that negatively control FT (FLOWERING LOCUS T) expression in leaves (Fig. 3.4; Mathieu et al., 2009; Wang et al., 2009; Yant et al., 2010). In this respect, sequential Arabidopsis regulation between miR156 and miR172 (Huijser & Schmid, 2011; Yamaguchi & Abe, 2012), where miR172 controls the transition from juvenile to adult stage at flowering time (Chen, 2004; Lauter et al., 2005; Zhu & Helliwell, 2010); sexual determination and meristematic cells fate (Aukerman & Sakai, 2003; Chuck et al., 2007; Jung et al., 2007); etc.

- 47 -

Introduction: Plant Developmental Pathways Altered By Nematodes

Figure 3.4. – Interaction of AP2 genes and miR172 regulating flowering time in Arabidopsis. A. Long days and miR172 induced FT expression. The FT protein is transported through the vasculature to the apex where it acts as a potent floral inducer and triggering the floral transition network. There, FT interacts with the bZIP transcription factor FD and coordinately up-regulated floral identity genes like SOC1 and AGL24. SOC1 forms a positive feedback loop with AGL24. Finally, TOE1 repress FT to delay flowering time. Green shading, repressed genes in the microarray of GCs formed by Meloidogyne spp. according to Barcala et al., 2010; red shading, induced genes; green module, leaf; brown module, root. Source: modified from Wellmer & Riechmann, 2010.

From an agricultural point of view, the miR172 is also important in maize, rice and barley regulating the transition phase and determining the identity of floral organ in monocots (Zhu et al., 2009; Nair et al., 2010). This miRNA negatively regulates AP2 synthesis through a mechanism of translational inhibition. Several studies have demonstrated that overexpression of one of the AP2 target genes, called TARGET OF EAT3 (TOE3), causes late flowering phenotype. These results, together with analysis of loss of function of TOE1, TOE2 and TOE3 target genes indicated that at least some of the AP2 genes (TOEs), controlled by miR172, act as repressors of the flowering process (Zhu & Helliwell, 2010; Jung et al., 2011; 2014; Yant et al., 2010). Thus, miR172 is involved in floral organ identity, causing early flowering and

- 48 -

Introduction: Plant Developmental Pathways Altered By Nematodes

disrupting the specification of it when it is overexpressed in Arabidopsis (Aukerman & Sakai, 2003).

Furthermore, miR172 participates in the induction process of tuber formation in Solanum tuberosum (L.) subsp. andigena where tuberization is regulated by photoperiod (Sarkar, 2008). Short days strongly induce the formation of tubers and short days (SD) with interrupted night (NB) are moderately inductors; in contrast, long days (LD) repress tubers. Tubers are formed on stolons (underground stems) in response to signals generated in the leaves. MiR172 levels are higher in SD than in LD and stolon increases when they begin to thicken, i.e. at the start of tuberization, SD and SD + NB; thereby there is a positive correlation between high levels of miR172 and tuber induction. MiR172 overexpression in potato promotes flowering, accelerates tuberization under moderately inductive photoperiods (SD + NB) and triggers tuber formation under LD (Martin et al., 2009). Detection of miR172 in potato phloem cells and phloem exudates of several species, as well as graft transmission in Nicotiana benthamiana, is consistent with the notion of this miRNA being mobile element (Martin et al., 2009; Kasai et al., 2010). Several other miRNAs have also been discovered in phloem tissue (Válóczi et al., 2004; Sparks et al., 2013), but direct evidence for their long-distance transport is still lacking.

In this context of tuber remoting signals and miRNAs connectors from the leaves to the plant root, this Thesis provides a novel data on the regulation of miR172 and AP2 like (TOE1) during gall and GCs formation. Perhaps the conection between both processes is that NFS might be acting, like tubers, as metabolic sinks to provide nutrients for nematode life cycle attainment (reviewed in Escobar et al., 2015).

- 49 -

Introduction: Gene Silencing In Galls And Giant Cells

3.3. – GENE SILENCING IN GALLS AND GIANT CELLS Microarray analysis of the compatible interaction between Arabidopsis and Mi using GCs-enriched root tissues revealed that more than half of the differentially expressed genes (DEG) at various time post infection points were down-regulated (Jammes et al., 2005). Furthermore, specific analysis of laser microdissected GCs and hand-dissected galls induced by Mj at very early infection staes (3 dai), revealed that more than 70% of DEG were down- regulated (Barcala et al., 2010), indicating that sustained suppression could be associated with GCs initiation and development. Interestingly, this dramatic gene repression during the early stages of GCs development was conserved in tomato and Arabidopsis. The 76.5% of the identified tomato–Arabidopsis homologues were found to be co-repressed in both species, whereas less than 1% were co-induced in the developing GCs at 3 dpi (Portillo et al., 2013).

The establishment of RKNs on host plants related to dynamic suppression of plant defence mechanisms is well known. Nonetheless, gene repression in developing GCs seems to be a general tendency and it is not limited to genes related to defence response. In fact, almost all of the functional categories of DEG identified in these studies showed a higher number of down-regulated genes than up-regulated ones (Barcala et al., 2010; Portillo et al., 2013; Teillet et al., 2013).

Several mechanisms could be mediating this global gene repression described within the NFS. Among them, a plausible process might be through silencing mechanisms mediated by sRNAs. Those have diverse roles in gene silencing at the transcriptional and post-transcriptional levels.

- 50 -

Introduction: Gene Silencing In Galls And Giant Cells

Origin Primary groups Secondary groups Function

Not microRNAs (hairpin- Derived derived sRNAs, proto- from single- Hairpin RNAs miRNAs) MRNA stranded (hpRNAs) cleavage and precursors MicroRNAs (miRNAs) translational repression Natural antisense transcript siRNAs (natsiRNAs)

MRNA Derived from cleavage, Secondary siRNAs double- Small interfering translational (tasiRNAs, phasiRNAs and stranded RNAs (siRNAs) repression easiRNAs) precursors and DNA methylation

Heterochromatic siRNAs DNA (hetsiRNAs) methylation

Table 3.3. - Classification of plant sRNAs. Present arrangement of endogenous sRNAs from plants ranked by biogenesis (single or double-stranded precursors). In light green, miRNAs and their function in plants used in this Thesis (miR172 section). Source: modified from Borges & Martienssen, 2015.

In Arabidopsis, sRNAs are classified into two primary big groups (Table 3.3), the short-interfering RNAs (siRNAs) and the hairpin-RNAs (miRNAs). RNA silencing is a main mechanism in innate immunity used by plants to counteract pathogens including viruses, protists, nematodes and fungi (Bologna & Voinnet, 2014); as host, sRNAs respond to viral, bacterial or nematode infections to promote plant disease resistance (Katiyar-Agarwal & Jin, 2010). Conversely, they also stand out as important repressors that pathogens have to overcome to cause disease in plants (Peláez & Sánchez, 2013). Specifically, miRNAs participate in numerous plant responses to environmental stresses, both biotic and abiotic (Ruíz-Ferrer & Voinnet, 2009;

- 51 -

Introduction: Gene Silencing In Galls And Giant Cells

Sunkar et al., 2012). MiRNAs target just a small number of mRNAs, approximately 150, which is less than 1% of protein-coding genes (Addo- Quaye et al., 2008). Although, miRNAs are minor in number, the global impact of miRNA-controlled gene regulation in plants cannot be underrated because most of the target mRNAs are TFs, key regulators that participate in multitude of developmental and physiological processes occurring in the plant (Jones- Rhoades et al., 2006).

3.3.1. – SMALL RNAS IN GIANT CELLS In recent years, few studies have been described about miRNAs on the plant-nematode interaction (Hewezi et al., 2012; Cabrera et al., 2016a); moreover, only studies on CNs reported more widely the massive sequencing of sRNAs in NFS (Hewezi et al., 2008; 2012; Li et al., 2012; Xu et al., 2014; Hewezi & Baum, 2015). Sixteen differentially expressed miRNAs in syncytia at 4 and/or 7 dpi were identified in Arabidopsis. Several of them targeted transposons or retrotransposons of different types, suggesting a role for these miRNAs in controlling TE (transposable element) movement (Hewezi et al., 2008; Hewezi & Baum, 2015). In addition, two sequencing experiments of the sRNAs population from resistant and susceptible soybean lines infected with H. glycines, showed several miRNAs and siRNAs differentially expressed between resistant/susceptible plants (Li et al., 2012; Xu et al., 2014). Apart from isolated data about miRNAs role in systemic changes caused by the infection of RKNs-plant interaction, such as the miR319/TCP4 module that acts controlling a systemic defensive response mediated by jasmonic acid (Zhao et al., 2015); there is only one study focused on sRNAs differential expression (DE) from galls as compared to un-infected root tissues (Cabrera et al., 2016a). In this study, Cabrera et al. (2016a) described that distinctive gene repression in early-developing GCs could be facilitated by sRNAs/miRNAs, e.g. through epigenetic mechanisms mediated by 24nt-sRNAs and 21-sRNAs or regulation mediated by miRNAs.

- 52 -

Introduction: Gene Silencing In Galls And Giant Cells

The functional consequences of sRNAs/miRNAs DE in galls are not well known. MiRNAs show different modes of action that involve targeting mRNA for degradation and/or translational repression (Huntzinger & Izaurralde, 2011; Iwakawa & Tomari, 2015). Pathogen attack triggers massive miRNA changes that show regulatory roles through alteration of hormone pathways, or manipulating silencing pathways to counteract miRNA-mediated defences (reviewed in Balmer & Mauch-Mani, 2013). Only two miRNAs with a role during the interaction with Arabidopsis and endoparasitic nematodes have been described so far. MiR396 is down-regulated after infection with H. schachtii, what caused the induction of transcripts for two TFs, GRF1 (GROWTH-REGULATING FACTOR 1) and GRF3 (GROWTH-REGULATING FACTOR 3), necessary for correct syncytia initiation (Hewezi et al., 2012). MiR390 is up-regulated in galls and GCs at early infection stages. Its promoter is active in GCs and gall vascular tissues and it regulates TAS3-derived tasiRNAs formation in galls as loss-of-function lines for miR390a and TAS3a showed increased resistance to Mj and their galls were smaller than control plants. Thus, for the first time in the Arabidopsis–RKNs dialogue, a complex regulatory module that involves a miRNA highly abundant in galls, miR390, and the TAS3-derived tasiRNAs, actively functioning in both galls and GCs were described (Cabrera et al., 2016a). These results were further confirmed in crops by in situ hybridization as we adapted a novel protocol for a reliable in situ detection of miRNAs in galls induced by Mi (Díaz-Manzano et al., 2016a). In this framework, we have described the expression and functional role of the miRNA172 (miR172) in Arabidopsis during the RKNs interaction (Díaz- Manzano et al., 2017a; this Thesis). Additionally, the detection of miR172 in tomato (Solanum lycopersicum) and pea (Pisum sativum) galls induced by Mi was pioneer.

Interestingly, post-transcriptional silencing of endogenous RKNs transcripts by expressing double strands RNAs (dsRNAs) corresponding to

- 53 -

Introduction: Gene Silencing In Galls And Giant Cells

nematode genes has been clearly demonstrated in plant roots. In this respect, data from Huang et al. (2006) confirmed that 16D10 dsRNA construction in two Arabidopsis transgenic lines (16D10i-1 and 16D10i-2), showed a 63–90% reduction in the number of galls as well as a general decrease in gall size of Mj, Mi, Ma, and Mh. Similarly, Yang et al., (2013) used this RNAi silencing technique for this conserved effector gene (16D10) against RKNs in grapevine. The two 16D10 hairpin lines (pART27-42 and pART27-271) showed less susceptibility to nematode infection compared with control. Similarly, other studies in crops have confirmed the use of the dsRNAs interference against RKNs, e.g., Mc peptide in Arabidopsis (Mc16D10L; Dinh et al., 2014); and Mj, Mi, Ma, and Mh in potato (16D10; Dinh et al., 2015); against Mi pre-mRNA splicing factor in tobacco (prp-21; Yadav et al., 2006); against Mi mitochondrial stress-70 protein in soybean (Ibrahim et al., 2011); and Mi FMRF amide like peptides (flp-14 and flp-18; Papolu et al., 2013), Mi Rpn7 gene (Niu et al., 2012), and Mj retinol-binding protein (FAR-1; Iberkleid et al., 2013) in tomato. Thus, the widespread and conserved functions of sRNAs pathways led to the establishment of RNAi technique as a powerful useful genomic tool for nematode control. Thus, pioneering efforts have demonstrated the efficiency of using RNAi to diminish RKNs infection through host plant-induced gene silencing either for nematode genes or for plant genes/proteins important to the nematode (Lilley et al., 2012; Dutta et al., 2015).

- 54 -

Introduction: Gene Silencing In Galls And Giant Cells

4. – OBJECTIVES (OBJETIVOS)

- 55 -

Arabidopsis thaliana plant model

- 56 -

Objectives

4.1.- TO SET UP USEFUL METHODS TO STUDY THE RKN-PLANT INTERACTION

 To set up an efficient system for the amplification of nematode populations of the Meloidogyne genus in a monoaxenic in vitro culture.

 To standardize a protocol for GCs phenotyping induced by RKNs.

 To develop a method for in situ detection of miRNAs in tomato galls.

4.2.- TO COMPARE THE LATERAL ROOT FORMATION TO THE GALLS/GCS DEVELOPMENT

 To study the expression and function of a transcription factor crucial for lateral root formation, the Lateral Organ Boundaries Domain family 16, LBD16, during gall formation.

 To perform a comparative study of molecular signatures for lateral root formation in galls/GCs induced by Meloidogyne spp. by using reporter lines and loss of function mutants of different genes involved in auxin- related regulatory modules during LR initial formation.

4.3.- TO ESTABLISH THE ROLE OF THE REGULATORY MODULE MIRNA172/TOE1/FT IN THE FEEDING SITES INDUCED BY MELOIDOGYNE JAVANICA IN ARABIDOPSIS

 To analyse the expression of miR172, TOE1 and FT, during the RKNs infection.

 To study the function of miRNA172/TOE1/FT module during gall development.

- 57 -

- 58 -

Objetivos

4.1.- ESTABLECER MÉTODOS ÚTILES PARA EL ESTUDIO DE LA INTERACCIÓN PLANTA-NEMATODO

 Establecer un sistema eficiente para la amplificación de poblaciones de nematodos del género Meloidogyne en un cultivo in vitro monoaxénico.

 Estandarizar un protocolo para el fenotipado de las células de alimentación del nematodo (CGs) y/o agallas.

 Desarrollar un método para la detección in situ de microARNs en CGs y/o agallas de tomate.

4.2.- COMPARAR LA FORMACIÓN DE RAÍCES LATERALES CON EL DESARROLLO DE AGALLAS Y CÉLULAS GIGANTES

 Estudiar la expresión y función de un factor de transcripción crucial para la formación de raíces laterales, LBD16, durante la formación de la agalla y/o CGs.

 Realizar un estudio comparativo de las señales moleculares que llevan a la formación de raíces laterales en las agallas y/o CGs inducidas por Meloidogyne spp. mediante líneas delatoras y mutantes de pérdida de función de los diferentes genes de respuesta a auxina descritos en los módulos iniciales de formación de raíces laterales.

4.3.- ESTABLECER EL PAPEL DEL MÓDULO DE FLORACIÓN MIRNA172/TOE1/FT EN LOS SITIOS DE ALIMENTACIÓN INDUCIDOS POR MELOIDOGYNE JAVANICA EN ARABIDOPSIS

 Analizar la expresión de miR172, TOE1 y FT, durante la infección por el nematodo agallador Meloidogyne javanica.

 Estudiar la función del módulo descrito en floración miRNA172/TOE1/ FT durante el desarrollo de las agallas.

- 59 -

- 60 -

5. - METHODOLOGY

- 61 -

Meloidogyne javanica vibroslice at 4 dpi

- 62 -

Methodology: Material And Methods Used

5.1. – MATERIAL AND METHODS USED IN THIS THESIS All experimental procedures and techniques that we have explained below are those not included in sections 6.1-6.3 of this Thesis (maintenance and amplification of RKNs in Cucumis sativus roots, 3D phenotyping of GCs and in situ miRNAs detection, respectively).

5.1.1. – IN VITRO CULTURE OF ARABIDOPSIS Arabidopsis thaliana (L.) Heynh Columbia-0 (Col-0) plants were used throughout this Thesis. Seeds were surface sterilized with 30% commercial bleach and sown in 0.3% Gamborg medium (Gamborg et al., 1968) supplemented with 1.5% sucrose. Seeds were arranged in plates (diameter, 9 cm) in a row of 10 seeds for their expression analysis studies (GUS, GFP) or functional analysis (infection test, gall collection, GCs size, three-dimensional reconstruction). For stratification, plates were kept at 4°C for 2 days and thereafter, they were grown vertically in a growth chamber at 22°C± 2 °C, 0% relative humidity (RH) and at long-days (LD) photoperiod (16h light/8h darkness; 80-100 µmol m-2 s-1); except for the short-day experiments (Fig. 6.31) where the plants were kept under short-days (SD) photoperiod (8h light/16h darkness; 80-100 µmol m-2 s-1). Subsequently, 5 days after germination (dag), seedlings were inoculated with an average of 20 J2 per plant for expression analysis; and 10 J2 for functional analysis (Olmo et al., 2017). Moreover, for in vivo GFP monitoring (Fig. 6.11a-b & 6.13a-d), one seed was sown in a 35-mm dish with a central cover glass area (diameter, 18 mm); 3-4 dag, the seedling was inoculated with an average of 10 nematodes. Every gall was monitored to establish the infection timecourse.

5.1.2. – PLANT MATERIAL We used the following lines for the results of sections 6.4 & 6.5 (see Table 5.1):

- 63 -

Methodology: Material And Methods Used

Line used Figures Line type Reference J0121>>GFP 6.8 GFP Laplaze et al., 2005 J0121>>DTA 6.8 Diphtheria toxin Laplaze et al., 2005 J0192>>GFP 6.11 GFP Laplaze et al., 2005 J0192>>GUS 6.11 GUS Laplaze et al., 2005 pLBD16::GUS 6.12 GUS, 2500 bp Laplaze et al., 2005 DR5::GUS 6.12 & 6.13 GUS Ulmasov et al., 1997 DR5::GFP 6.13 GFP Ulmasov et al., 1997 lbd16-1 6.14 Mutant Okushima et al., 2007 35S::LBD16-SRDX 6.14 Chimeric repressor Okushima et al., 2007 pLBD16:LBD16-SRDX 6.14 Chimeric repressor Goh et al., 2012 iaa28 6.20 Mutant Rogg & Bartel, 2001 slr-gain 6.20 Gain of function Fukaki et al., 2002 skp2bL 6.20 Mutant Ren et al., 2008 arf7-arf19 6.20 Mutant Okushima et al., 2005 nph4-arf19 6.20 Mutant Okushima et al., 2005 GATA23::RNAi 6.20 RNAi De Rybel et al., 2010 arf6-/arf8+ 6.20 Mutant; (-) mutant (+) wildtype Ripoll et al., 2015 bdl-2Col-0 6.20 Mutant in Col-0 background Ripoll et al., 2015 slr-loss 6.20 Loss of function Goh et al., 2012 lbd16 6.21 Mutant Goh et al., 2012 lbd18 6.20 & 6.21 Mutant Goh et al., 2012 lbd16-18 6.20 & 6.21 Mutant Goh et al., 2012 lbd16-18-33 6.20 & 6.21 Mutant Goh et al., 2012 LBD29-SRDX (lbd16 ) 6.20 & 6.21 Chimeric repressor Goh et al., 2012 ARF5/MP::GUS 6.16 & 6.18 GUS Vidaurre et al., 2007 ARF7::GUS 6.16 GUS Okushima et al., 2005 ARF19::GUS 6.16 GUS Okushima et al., 2005 GATA23::GUS 6.16 & 6.18 GUS De Rybel et al., 2010 IAA28::GUS 6.17 GUS Rogg et al., 2001 SKP2BL::GUS 6.17, 6.18 & 6.22-24 GUS, 1700 bp Manzano et al., 2012 SKP2BC::GUS 6.17 & 6.18 GUS, 500 bp Manzano et al., 2012 ProCycB1;1:CycB1;1(NT)-GUS 6.17 & 6.18 GUS Colón-Carmona et al., 1999 LBD18::GUS 6.19 GUS Lee et al., 2009 LBD29::GUS 6.19 GUS Okushima et al., 2007 LBD33::GUS 6.19 GUS Okushima et al., 2007 miRNA172::GUS 6.27 & 6.28 GUS, five genes a-e Ripoll et al., 2015 miRNA172C-AuxRE-/-::GUS S6d GUS Ripoll et al., 2015 ft-10 6.26 Mutant Yoo et al., 2005 35S::TOE1 R -A12 6.25 & 6.31 Overexpressor Own achieved 35S::TOE1 R -D81 6.25 & 6.31 Overexpressor Own achieved 35S::TOE1 R -E82 6.25 & 6.31 Overexpressor Own achieved 35S::TOE1 R -G73 6.25 & 6.31 Overexpressor Own achieved 35S::MIMICRY172-7 6.30 & 6.31 Mimicry Own achieved 35S::MIMICRY172-23 6.30 & 6.31 Mimicry Own achieved Columbia 0 (Col0) Control Arabidopsis ecotype Own achieved Wassilewskija (WS) Control of iaa28 Arabidopsis ecotype Own achieved Moneymaker 6.10 & 6.29 Tomato ecotype Díaz-Manzano et al., 2016a Hoffman's Johanna Cucumber 6.2 Cucumber ecotype Díaz-Manzano et al., 2016b

Table 5.1. – Lines used for the results obtained in this Thesis. Observe different annotations (figures, line type and reference paper).

- 64 -

Methodology: Material And Methods Used

5.1.3. – HOMOZYGOUS LINES SELECTION IN SOIL Arabidopsis thaliana 35S:MIMICRY172-7 and 35S:MIMICRY172-23 plants (MIM172) are resistant to BASTA (Todesco et al., 2010). For the homozygous lines selection, we performed a double-checking. A selection according to the expected late flowering phenotype (Fig. S8a,b) as compared to Col-0 and a selection based on BASTA resistance, with 120mg/L (DL- PHOSPHINOTHRICIN, Duchefa® Biochemie, Ref.: P0159 0250 and Silwet-77 surfactant 500µL/L (Lehle Seeds) as described by Bouchez et al. (1993). Plants were grown in soil (a mixture of peat substrate, Kekkilä PROJAR 70L 50/50, and vermiculite, 3:1) at 21°C, 60% humidity and 16 hours light/ 8 hours darkness for 6 weeks.

5.1.4. – LATE FLOWERING ASSAYS Plants were grown on soil at 21ºC± 2 °C, 60%RH, under LD photoperiod (16h light/8h darkness; 130-150 µmol m-2 s-1). At least 10 plants per genotype were included. After four weeks, rosette leaves were counted. Finally, after six weeks, flowering genotypes were photographed. Similarly, we performed this type of analysis for the mimicry lines (Fig. S8).

Name ID Tair database Primer Sequence Length Tm TOE1 resistant miR172 At2g28550 Forward CTCAGTTGCAGCAGCATCGTCGGGCTTCTCACATTTCCGGCCA 43 60 TOE1 resistant miR172 At2g28550 Reverse TGGCCGGAAATGTGAGAAGCCCGACGATGCTGCTGCAACTGAG 43 60 GAPDH At1g13440 Forward GAGATTCGTAATGTTTTGATTTCG 24 60 GAPDH At1g13440 Reverse CTTTCGGTGGAGGTCTTGTC 20 60 TOE1 At2g28550 Forward GCGTGGAGTTAGCTTGAGGA 20 60 TOE1 At2g28550 Reverse TCCAGTAAAGGCGATGATCC 20 60 FT At1g65480 Forward CTGGAACAACCTTTGGCAAT 20 60 FT At1g65480 Reverse AGCCACTCTCCCTCTGACAA 20 60

Table 5.2. – Primers used for PCRs and qPCRs obtained during this Thesis. It is described the name of each primer (forward and reverse), their TAIR database ATG, type, sequence, length and temperature of melting (Tm).

Lines scored were a TOE1 version resistant to miR172 with only a single mutation amplified from Col-0 with the primers described (see Table 5.2) which expression is driven by the CaMV 35S promoter: 35S:TOE1R-A12, 35S:TOE1R-D81, 35S:TOE1R-E82 and 35S:TOE1R-G73 compared to Col-0.

- 65 -

Methodology: Material And Methods Used

5.1.5. – ASSESING LR FOUNDER CELL NUMBER IN INFECTED VERSUS UN-INFECTED PLANTS We performed a GUS expression analysis for a promoter GUS line described by Manzano et al. (2012), pSKP2B:GUS, (At1g77000; ARABIDOPSIS HOMOLOG OF HOMOLOG OF HUMAN SKP2 2). It is a clear and early marker of LR founder cells. Once the A. thaliana seeds were sterilized, we sowed in divided plates 9 mm diameter with four seeds on each side. Stratification and growth was as described in previous point 5.1.1. At 5 dag, they were inoculated with 10 freshly hatched J2 Mj juveniles per main root apex.

At least, three sets of independent experiments were performed giving similar results. Every plant (80 per time point) was monitored at 12, 24, 48 and 72 hours post inoculation (hpi). We considered those galls observed at the first checkpoint (at 12 hpi) were the oldest (galls of 72 hpi) at the end of the experiment; and the last ones observed (at 72 hpi) were the youngest (galls of 12 hpi). For each checked point, we labelled the root growth for both inoculated and for uninoculated (Fig. 5.1).

At the end of each experiment, a GUS assay (point 5.1.10) was performed to determine LR founder cells along the roots. The number of positions where founder cells were identified and counted under a stereomicroscope Leica Mz125. We separated the plants into four categories: uninoculated plants (UI); total plants inoculated (with or without gall) (TI); only plants with galls (G); and plants with galls considering the gall as LRP (GP). Data values were statistically analysed using t-Student function.

- 66 -

Methodology: Material And Methods Used

Figure 5.1. – Methodology used for counting LR founder cells from uninoculated / inoculated at 5 dag seedlings with 10 J2 Mj. Observe different check points post inoculation. HPI, hours post inoculation; G, age of galls in hours. Scale bar: 2 cm.

5.1.6. – MAINTENANCE AND AMPLIFICATION OF NEMATODES Meloidogyne javanica (Mj), Meloidogyne incognita (Mi) and Meloidogyne arenaria (Ma) were amplified and maintained at in vitro conditions on cucumber plants as it is described in Díaz-Manzano et al. (2016b) (Fig. 6.2). For the CNs Heterodera schachtii (Hs) population (obtained from Dr. Hofmann, BOKU, Austria), they were amplified in white mustard seedlings (Sinapsis alba cv. Albatros) following as it is described in Grundler et al. (1991). Egg hatching was stimulated in sterile water for three-four days before inoculation for RKNs

(Díaz-Manzano et al., 2016b); and in sterile 3 mM ZnCl2 for CNs (Fig. S2) for

CNs. Additionaly, J2 from CNs hatching were washed four times in sterile water before inoculation.

- 67 -

Methodology: Material And Methods Used

5.1.7. – IN VITRO INOCULATION WITH NEMATODES Plates with seedlings five days after germination, were inoculated with RKNs just behind to the root tip with an average of 20 J2 nematodes per main root for expression analysis and 10 J2 nematodes for functional analysis (Olmo et al., 2017). A thin temperate film (30-37°C) of 0.3% agarose in Gamborg medium was placed over the roots to facilitate nematode penetration. Plants were carefully examined every 12 hours under a Leica Mz125 stereomicroscope to establish the infection timeline and to obtain a maximum error of 12 h when we set the zero point to determine gall age. Galls were hand-dissected at the timepoint of interest.

It is important to point that RKNs nematodes are pluricellular organisms with proper motion and behaviour; hence, synchronic infections are almost impossible. Therefore, on plant-nematode interaction empirical approaches must contemplate an estimation error when we defined the time of infection studied. Hence, when we refer to “post inoculation time”, it is the time (in hours, days, months) since nematodes are in contact with the host plant. However, when we refer to “post infection time”, it is the time from the first observation of a J2 inside the plant root near the root tip that we set as zero point. In this context, there will always be a maximum error of 12 hours in the estimation of the “post infection time”, as we made checkpoints every 12 hours. For CNs (Fig. S2), we followed as it is described in the previous point 5.1.6.

5.1.8. – ANALYSIS OF REPRODUCTION PARAMETERS IN SOIL To determine nematode reproduction parameters, Arabidopsis seedlings were planted individually into 15mL clay pots containing steam- sterilized river sand. Arabidopsis plants were grown at 25± 2 °C, 60%RH, and SD photoperiod (8h light/16h darkness, 130-150 µmol m-2 s-1) for 2 months; then, we inoculated with 200 J2 per pot. Nematode inoculum’s was obtained as described in Andrés et al. (2012). After inoculation plants were watered as needed and fertilized with 1mL of a 0.5% solution of 20-20-20(N-P-K) every

- 68 -

Methodology: Material And Methods Used

fifteen days per pot. Each line analysed was replicated (galls or eggs) at least three times with 10 plants per experiment. Reproductive parameters were evaluated 2 months after inoculation (i.e., 4 months after planted). The number of galls/egg masses per fresh root gram was counted from each root system. Egg production was obtained by extracting the eggs from the entire root system (Hussey & Barker, 1973).

A. thaliana lines scored were lbd16 and lbd18 singles; lbd16-lbd18 double; lbd16-lbd18-lbd33 triple mutant; and LBD29-SRDX(lbd16) SRDX line; and Col-0 as a control (Fig. 6.21); 35S:MIMICRY172-7 and 35S:MIMICRY172- 23 (Figs. 6.30d&6.31b); and 35S:TOE1R-A12, 35S:TOE1R-D81 and 35S:TOE1R-G73 (Fig. 6.31b). For more lines details, see Table 5.1.

5.1.9. – NEMATODE PERFORMANCE IN POTATO MIR172 OVEREXPRESSOR LINES Solanum tuberosum (L.) subsp. andigena overexpression lines of miR172 were grown in 0.3% Gamborg medium (Gamborg et al., 1968) supplemented with 3% sucrose to multiply through cuttings plants. Independent transgenic potato lines were 35S::miRNA172-6, 35S::miRNA172- 8, 35S::miRNA172-22 and ecotype Andigena 7540 as control. Potato grafts (2- 3 cm) were planted in 14 cm diameter plates (2 grafts per plate; Fig. S7c). They were grown vertically at 22ºC± 2 °C 16h light/8h darkness (80-100 µmol m-2 s-1). At 14 days post graft they were inoculated with 100 Mj J2 per root developed (Fig. S7d-e). Inoculation was performed as described in 5.1.7. Galls were counted at 7 dpi. At least three independent in vitro infection tests were performed for functional analysis with a minimum of 10 plants per line and individual experiment. In addition, two galls (Fig. S7f-i) per line were included for phenotypic analysis as it is described in section 6.2 of this Thesis.

- 69 -

Methodology: Material And Methods Used

5.1.10. – GUS ANALYSIS AND GFP EXPRESSION For GUS staining, hand-dissected galls were prefixed in 2% glutaraldehyde in a vacuum pump for 5 min and washed three times for 5 min in 50mM sodium-phosphate buffer (pH 7.2). Galls were incubated at 37ºC for 1-4 h (GUS lines from section 6.4) and/or 22-52h (GUS lines from section 6.5) in a solution containing 5mM EDTA (pH8), 0.05% Triton X-100, 0.5 mM

K3Fe(CN)6, 0.5 mM K4Fe(CN)6 and 1mg/mL X-GlcA in 50mM sodium- phosphate buffer. Positive galls were photographed under a Leica Mz125 stereomicroscope or Nikon eclipse 90i microscope.

For GFP expression analysis, a Leica TCS SP2 confocal laser scanning microscope was used for the detection of GFP expression. Most galls were also hand-sectioned and immediately stained in 0.5 µg/mL propidium iodide (PI) in PBS for 5 min or freshly embedded in 5% low melting agarose and subsequently sectioned in a vibratome (Leica VT1000 S). Vibroslices (30- 70 µm) were stained with PI under the same conditions and immediately observed under the confocal microscope (Fig. 6.13). The emission spectrum was set to 515 nm, 600-700 nm and 617 nm for GFP, chloroplast autofluorescence and PI, respectively. A long-pass 500 nm dichroic beam splitter was used.

5.1.11. – GCs & GALL TRANSCRIPTOMES IN SILICO ANALYSIS The genes that were up-regulated at 3 dai in galls and microdissected GCs of Arabidopsis and tomato gall transcriptomes (Barcala et al., 2010; Portillo et al., 2013) were manually compared to enriched gene sets of each root cell type described by Brady et al,. (2007). To identify the transcripts enriched in GCs and galls, the chi-square (2) parameter was used with a significance level of p<0.05. The abundance of each group in the Arabidopsis genome was used as background. Further transcriptomic analyses were performed with NEMATIC (Cabrera et al., 2014a; see at http://www.uclm.es/grupo/gbbmp/english/nematic.asp) to determine genes

- 70 -

Methodology: Material And Methods Used

(TFs and/or miRNAs) induced in galls/GCs formed by Meloidogyne spp. and/or phytohormone-related expression profiles in galls/GCs.

5.1.12. – IN SILICO ANALYSIS OF PLANT AUXIN CIS-ELEMENTS Using available databases (TAIR) and bioinformatics tools we searched for cis-elements, particularly those defined as auxin responsive elements (AuxRE) in the 1000 bp of the promoter regions of pmiRNA172a::GUS, pmiRNA172b::GUS, pmiRNA172c::GUS, pmiRNA172d::GUS and pmiRNA172e::GUS lines. To complement this in silico analysis we performed exogenous auxins treatments and we studied the promoters activity (Fig. S5).

5.1.13. – PHARMACOLOGICAL TREATMENTS For auxin treatments, plantlets were germinated and grown on 0.5 MS medium, as described in Chapman et al. (2012), transferred to media containing the corresponding auxin (IAA) concentration or DMSO (for the mock controls) (Fig. S5 & S6). Similarly, an auxins inhibitor treatment was performed at 7 dag with freshly 300 µM α-(phenyl ethyl-2-one)-indole-3-acetic acid (PEO- IAA) (Fig. S1; Cabrera et al., 2014b). They were left 24-48h under the treatment (or DMSO mocked) and we made the GUS assays. Plants were carefully handled with tweezers for microscopy inspection and photographing.

For miR172c-d expression, the tissue was incubated for 30 minutes with IAA and total RNA was extracted using Trizol (Life Technologies) and treated for cDNA synthesis as previously described (Ripoll et al., 2015). 5 µg of total RNA was used for cDNA synthesis with an oligo (dT) primer and Superscript III reverse transcriptase (Life Technologies, Carlsbad, California, USA). After 1/10 dilution of the cDNA, 1 μl was used as a template for the subsequent qPCR reactions. Relative changes in gene expression levels were determined using the 2ΔΔ-CT method. RNA levels were normalized to the constitutively expressed gene ACTIN2 as previously reported (Ripoll et al.,

- 71 -

Methodology: Material And Methods Used

2011). Each experiment was executed using three biological replicates. Primers used for this set of experiments can be found in Ripoll et al. (2015).

5.1.14. – PLANT RNA ISOLATION AND QPCR ANALYSIS

Total RNA was extracted from 25 hand-dissected root plant tissues (control root segments and/or galls from infected plants) using the miRNeasy Micro Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. 0.75 microgram from each sample of RNA (control root segments and/or galls) was used for cDNA synthesis with the High Capacity cDNA Reverse Transcription Kit with random primers (Applied Biosystems, Foster City, California, USA) according to the company’s guidelines (35 cycles). The cDNA was diluted up to 1/10 and one nanogram was used from each sample as a template for the subsequent qPCR transcript analysis for TOE1 (TARGET OF EARLY ACTIVATION TAGGED 1, AT2G28550); and 45 nanograms for FT (FLOWERING LOCUS T, AT1G65480) as its expression level is very low in most tissues.

Quantitative PCR analysis was done with SYBR-Green technology (SYBR Green Master Mix 2X, no ROX, Thermo Scientific) in a Roche LightCycler® 480 II machine. Quantification of the relative changes in gene expression levels was determined using the E-Method (Tellmann, 2006). In all cases, at least three independent experiments each with three technical replicates of each reaction were performed. Arabidopsis thaliana GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C2 (GAPC2, AT1G13440) was used as internal control to normalize gene expression levels. Primers used for PCRs and qPCRs are described in Table 5.2.

5.1.15. – PLANT IN SITU HYBRIDIZATION In situ hybridizations were done following the protocol described by Díaz-Manzano et al. (2016a) (see section 6.3) for tomato and pea.

- 72 -

Methodology: Material And Methods Used

Hybridization signals (Figs. 6.10&6.29) within the nematodes were detected with anti-DIG antibody conjugated with alkaline phosphatase; specimens were observed and photographed with a Nikon® Eclipse 90i light microscope with a Nikon® DXM 1200C camera adapted.

5.1.16. – BLASTN ANALYSIS IN CROPS To complement experimental results obtained by in situ hybridization for the miR172c (Fig. 6.29); we searched for TOE1 homologue sequences in crop species. We selected miR172c Arabidopsis sequence (http://www.mirbase.org), and performed an analysis of complementarity of bases (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch) against tomato (S. lycopersicum; taxid: 4081) and pea (P. sativum; taxid: 3888). As a result, we found SlAP2d (NM_001247718.2) and AP2-like (AF325506.1) genes with a 100% cover query for tomato and pea, respectively (Fig. 6.29g). In order to find the one left nucleotide in the 3´ to complete the full miR172c target for pea, we downloaded the nucleotide sequences of AP2-like gene (AF325506.1) and we searched for the region determined by blastn analysis (nucleotides 1615-1596).

5.1.17. – DATA PROCESSING

Data achieved were represented with histograms with mean values and/or percentages per line/treatment and standard errors (±SE). Statistical analysis of the infection and reproduction parameters; and GCs volumes and areas were performed using the T-test in the SPSS package (IBM, Armonk, NY, USA). The corresponding confidence intervals (CI) were calculated with a significance level of 5% (p <0.05) which was indicated with an asterisk. Moreover, data from q-PCRs were represented with histograms with pairing- fold change values (line/treatment versus control) and standard errors (±SE). Statistical analysis were performed as described before.

- 73 -

- 74 -

6. - RESULTS AND DISCUSSION

- 75 -

Gall of Col-0 ecotype at 14 dpi embedded in araldite

- 76 -

Results and Discussion: Long Term In Vitro System In Cucumber

The first part of my Thesis was dedicated to standardize and stablish protocols for in vitro amplification of RKNs, GCs phenotyping and miRNA in situ hybridization. They were the basis to perform different studies on gene roles and expression analysis.

6.1.- LONG-TERM IN VITRO SYSTEM FOR MAINTENANCE AND AMPLIFICATION OF RNKS IN CUCUMIS SATIVUS ROOTS RKNs are polyphagous plant-parasitic roundworms that produce large crop losses, representing a relevant agricultural pest worldwide. After the infection, they induce swollen root structures called galls containing the GCs, indispensable for their development. Efficient control methods are under revision. Among them, there are new biotechnology-based control methods that require a deep knowledge of underlying molecular processes leading to gall/GCs induction and development. Aseptic experimental conditions are essential for the analyses of infected material with highly sensitive molecular biology techniques, such as transcriptomics (by massive sequencing or microarray hybridization), proteomics or metabolomics, as undetected contamination with other microorganisms will greatly interfere with the interpretation of the results.

We present a simple, efficient and long lasting method for nematode amplification at in vitro grown cucumber roots. Amplification of juveniles (J2) from the starting inoculum is around 40-fold. The method was validated for three Meloidogyne species (Mj, Mi and Ma), producing viable and robust freshly hatched J2s for further in vitro infection of different plant species such as Arabidopsis, tobacco and tomato, as well as enough J2s to maintain the population. The method allowed maintaining around 90 Meloidogyne spp. generations (one every two months) from a single initial female over 15 years.

- 77 -

Results and Discussion: Long Term In Vitro System In Cucumber

Material and methods

The monoxenic nematode culture on cucumber roots was initiated using egg masses from soil-grown infected tomato plants according to Verdejo- Lucas (1995) (Fig. 6.1). These egg masses were used to obtain sterilized eggs to inoculate the first pool of 21 days old in vitro-grown cucumber seedlings 15 years ago. Every month a new cucumber batch was inoculated with the hatched J2s from egg masses produced in cucumber roots that were inoculated 2 months before (Fig. 6.1).

Figure 6.1. – Flowchart showing the Meloidogyne spp. maintenance and amplification protocol. Pool No. 1 consists of 10 cucumber plates inoculated with sterilized egg masses from - 78 -

Results and Discussion: Long Term In Vitro System In Cucumber

soil-grown plants following Verdejo-Lucas (1995). The plates are incubated for two months to obtain egg masses. The population of nematodes is maintained in successive cucumber pools grown for three weeks after two days of stratification at 4 ºC before inoculation. The nematodes for inoculation are always obtained by hatching egg masses from plates two months after inoculation. As only one plate is needed for each amplification round, nine extra plates are always left in order to provide nematodes for in vitro experiments or to safeguard the population in the case of contamination or other technical problems. Source: Díaz-Manzano et al., 2016b.

Plant material and growth conditions

Fifty Cucumis sativus (L.) cv. Hoffmanns Giganta seeds (Buzzy Seeds, Catalog Number: 02186) were surface sterilized with undiluted commercial bleach (35 gr. active chlorine/L) for 45 minutes under shaking and subsequently washed 5 times with sterile distilled water under a laminar flow hood. Ten Petri dishes (14 cm diameter) containing modified Gamborg B5 solid media supplemented with 3% sucrose were used to sow five seeds/plate with tweezers. Tweezers must be previously sterilized using a glass bead sterilizer, which allows quick re-sterilization when necessary. Plates were sealed with one layer of Parafilm® first, then with Micropore® tape and finally covered with aluminium foil to favour the development of the radical system in darkness and avoid contamination, as it should be a long-lasting monoaxenic culture. Long incubation periods at 26ºC (2 months or longer) make the Parafilm® to tear, favouring plate contamination. The extra Micropore® layer helps to avoid this contamination. After 2 days of stratification at 4ºC, the plates were transferred to a darkness growth chamber at 26ºC for 21 days, allowing seedlings to fully develop the radical system (Fig. 6.2a). Just before inoculation with J2s, the etiolated aerial parts of the cucumber seedlings were removed to promote further root growth.

- 79 -

Results and Discussion: Long Term In Vitro System In Cucumber

Nematode inoculation

Four days before inoculation, 50 sterile egg masses (from one or several previous plates of cucumber plants two months after inoculation) (Fig. 6.2b) were placed in a hatching jar consisting in a sterile cell strainer (with a 70 µm nylon mesh) inside a beaker filled with 5 mL of sterile tap water. The beaker is also placed inside a glass jar with a tight lid. The mesh retains the egg masses but allows the movement of the hatched J2s toward the water in the beaker. Cucumber plates used to collect the egg masses must be carefully checked under a stereo-microscope to detect any visible contamination. Egg masses selected for hatching should have an amber colour (Fig. 6.2b-c) when they are around 2 months old. Darker brown egg masses (Fig. 6.2d) must be avoided as they are old and will produce a lower number of less vigorous J2 nematodes. It is recommended to observe some hatched J2 moving around the egg masses as this indicates a proper estate of the egg mass (Fig. 6.2c). In the case of old egg masses, several dead juveniles will be observed around them (Fig. 6.2d). Hatching is allowed to proceed in the darkness at 26ºC for 4 days and 1 mL of the freshly hatched J2s are used to inoculate the cucumber plates every 23 days (Fig. 6.1). Generally, one Petri dish is enough to provide the 50 egg masses needed for inoculating 10 new cucumber plates; the remaining nine cucumber plates infected in each batch could be used for hatching J2s for in vitro experiments (Fig. 6.1). After J2 inoculation, the plates were double sealed, covered with aluminium foil and placed back into the growth chamber for about 2 months (Fig. 6.1) for RKNs to complete their life cycle producing new egg masses. These egg masses can be used again to obtain more juveniles for new cucumber seedlings inoculation (Fig. 6.1). Instead of freshly hatched J2s, egg masses from the infected cucumber seedlings could also be used to inoculate new plates. In this case, from 3 to 5 egg masses per plate are placed on the agar medium with the help of sterile tweezers. However, this procedure will make asynchronous infections, as juveniles hatch gradually from the eggs. It is also important to point that if - 80 -

Results and Discussion: Long Term In Vitro System In Cucumber

required, several amplification rounds could be performed from a plate infected with a single egg mass coming from a single female. This can be crucial in some experiments where clonal nematodes are required to reduce variability. We recommend doing this once the culture is stablished and use the plates from this clonal amplification of females for further experiments and amplifications. It is advisable to settle a new stock of cucumber plates every 21 days, so that several different stock plates at different stages coexist (Fig. 6.1).

Figure 6.2. – Photographs illustrating different steps of the method described. A. Etiolated Cucumis sativus seedlings at 21 days after germination showing extensive root development before nematode inoculation. B. Close-up of Mj infected C. sativus roots showing the galls induced by this nematode and the egg masses deposited by the female outside the root (black arrowheads). C. Close-up of a gall containing one female laying an egg mass with amber color in an optimum stage for hatching to obtain vigorous J2s. Hatched J2s around the egg mass are marked by white arrowheads. D. Close-up of an unviable dark brown egg mass containing juveniles which are often dead. The dead J2s are easily observed around the egg mass and gall (yellow arrowheads). Scale bars: 1 cm (a,b) and 200 µm (c,d). Source: Díaz-Manzano et al., 2016b. - 81 -

Results and Discussion: Long Term In Vitro System In Cucumber

Results and Discussion

We determined the ability to hatch of egg masses produced following the protocol described above for three different species of RKNs: Mj, Mi and Ma. For this, 50 egg masses (2 months-old) coming from a single female clonal culture were collected for each species and incubated for 4 days in 5 mL of sterile tap water into a hatching jar. At this time, the 5mL were collected and their J2 content was estimated by counting under the stereo-microscope three aliquots, 30 µl each. The average among the three replicates was considered a good estimation for the total hatched J2. Mj egg masses yielded the higher number of J2s per egg mass and mL (21.8 J2s/Em·mL; Table 6.1). A slightly smaller number was obtained for Ma (19.7 J2s/Em·mL), and Mi (17.9 J2s/Em·mL) (Fig. 6.3a; Table 6.1). After the first hatching, a new volume of 5 mL of sterile tap water was placed in the hatching jar to favour a second hatching round from the same eggs for another 4 days. The number of juveniles obtained in this second round was higher than in the first hatching for Mj and Mi (Table 6.1; 25.3 and 24.3 J2s/Em·mL, respectively), while the number was maintained for Ma (Fig. 6.3a; Table 6.1). In a third hatching round, under the same conditions, the number of juveniles decreased from the first and second rounds in the three species (Fig. 6.3a; Table 6.1). Considering that each hatching jar contained 50 egg masses in 5 mL of sterile distilled water, we obtained in each hatching round an average of 5290, 4777 and 4625 J2s of Mj, Mi and Ma, respectively (Fig. 6.3a; Table 6.1) that could be used for inoculation of in vitro grown plants. The sum of all three hatchings from the 50 egg masses of each species yielded a total number of 15869, 14330 and 13875 juveniles from Mj, Mi and Ma, respectively (Fig. 6.3a; Table 6.1). As the nematodes came from a monoxenic culture, there was no need for chemical sterilization of J2s, a treatment that reduces their vigour and viability and usually resulted a high variation in the infection ability of the J2s, ranging from very inefficient infection to wounding effects when too many nematodes aim to penetrate into the same root. - 82 -

Results and Discussion: Long Term In Vitro System In Cucumber

Table 6.1. – Hatching rate and reproduction parameters for the three Meloidogyne spp. in cucumber root cultures. Source: modified from Díaz- Manzano et al., 2016b.

- 83 -

Results and Discussion: Long Term In Vitro System In Cucumber

In contrast, using J2s hatched from sterile and in vitro obtained egg masses, the juveniles are in an optimum infectivity state that does not vary much in different batches, allowing the use of a reduced nematode inoculum (10 nematodes per plant) to avoid undesired root damage and consequent plant defence responses (Cabrera et al., 2014b; 2015). Another advantage of the method described is that it allows to easily planning three independent biological replicates by infecting plants grown with 4 days difference with J2 hatched from the same egg mass pool coming also from three independent hatchings separated 4 days in time. In our hands, that fact also contributes to homogenize the infection efficiency, reducing variability among experiments. All hatching data presented are from the average of more than 20 amplification rounds (n=45 for Mj; n=20 for Mi and Ma) performed along the five last years (ten years after the initial inoculation). It is important to point that the amplification ability of the population may have changed since the first set of infections 15 years ago. Thus, our in vitro amplification data cannot be compared to amplification of field populations.

Juveniles from Mj, Mi and Ma obtained from monoxenic cultures were used to inoculate plates with five etiolated cucumber seedlings 23-days after sowing. Two months after inoculation, the number of egg masses developed in each plate was counted under a stereo microscope and, subsequently, the “No. of egg masses per 500 J2s of the initial inoculum” index was calculated (Table 6.1; Fig. 6.3b). Each plate was routinely inoculated with 1 mL of sterile tap water containing J2s from the hatching jar from any of the hatching rounds. Thus, the average number of J2 in the inoculum was 1058, 955 and 925 for Mj, Mi and Ma, correspondingly (Table 6.1). With this inoculum, it was possible to obtain an average of 132, 90 and 113 egg masses for each species in each plate (Table 6.1). Mj and Ma juveniles seemed to be the species with a greater capacity to reproduce in vitro in cucumber roots as 62 and 61 egg masses were obtained in each plate per 500 J2 from the initial inoculum, respectively (Table 6.1; Fig. 6.3b). The number of egg masses obtained from Mi was - 84 -

Results and Discussion: Long Term In Vitro System In Cucumber

slightly smaller, 47 egg masses in each plate for each 500 J2 inoculum (Fig. 6.3b). Mj seemed to be the species with the best hatching and reproduction parameters in our system (Fig. 6.3; Table 6.1) but all the three species reproduced efficiently in the cucumber roots and a substantial amount of egg masses and juveniles could be recovered for all of them. The amount of juveniles could be increased 10-fold from the initial inoculum by using 10 plates with five cucumber seeds.

Comparison with amplification methods in soil are precluded, as the plant growing conditions also influence nematode reproduction. According to the number of hatched J2 obtained for each egg mass, it would be possible to obtain a total number of 41,776, 25,888 and 31,497 J2s (Table 6.1) for Mj, Mi and Ma, respectively, from all the egg masses produced in a single plate of cucumber. Data from tomato in vitro roots transformed with Agrobacterium rhizogenes, point to a production of 20,000 nematodes per plate after 8 weeks of growth from an aggressive Mh population (Mitkowski & Abawi, 2002). Regardless of differences due to different Meloidogyne spp. we obtained in all three species a higher amplification rate in a similar period. Moreover, for Mj it almost doubled that Mh in transformed tomato roots.

The amplification ratio from the initial J2 population used for inoculation (Pf/Pi) was 39.5 (Mj), 27.1 (Mi) and 34.1 (Ma) (Table 6.1). This is in the range obtained in A. rhizogenes transformed roots from bindweed, bean, carrot and tropic tomato for Mj, but lower than the amplification obtained in potato and tomato (Solanum lycopersicum Mill. cv. South Australian Early Dwarf Red), transgenic roots (Pf/Pi= 83 and 161 respectively; Verdejo et al., 1988). Although this last method based on in vitro infected transgenic roots is efficient to amplify Meloidogyne spp. in monoxenic cultures, the method based on cucumber roots is simpler, as it does not require root transformation. When, occasionally, cucumber root plates contaminate, a new batch of seeds can be easily germinated. In contrast, when using hairy root systems extensive

- 85 -

Results and Discussion: Long Term In Vitro System In Cucumber

contamination of transformed roots plates might require a new transformation event.

In vitro protocols for RKNs maintenance are very scarce and, to our knowledge, none was described in cucumber roots. Here, we report the use of cucumber as suitable host for Meloidogyne spp. maintenance in monoxenic cultures. Following this protocol that we present here, we have been able to maintain different Meloidogyne spp. over 15 years routinely in the laboratory. As mentioned before, cucumber is easily handled for in vitro culture, and fulfils the requirement to be a host for in vitro RKNs (Sikora & Fernández, 2005). Cucumber seedlings develop a dense radical system in solid media plate within a short time, which extends further after removing the aerial part, providing multiple infection points to assure good infection rates. We have been able to amplify Mj, Mi and Ma populations at least 39.5, 27.1 and 34.1 times respectively from the initial J2 inoculum. The difference in ratio amplification among the different species is probably caused by virulence differences on cucumber of the nematode populations used (Semblat et al., 2000).

Finally, our system results very convenient as is not time-consuming, requires simple equipment and is low cost. In addition, this system has the advantage to be easily restored in case of in vitro culture crack or collapse, e.g. after a massive plate contamination or an accidental heat-shock or other problems caused by growth chamber failures. Our main proof of the suitability of the method is that a population of Mj started from a single female was maintained in a cucumber monoxenic culture in our laboratory following carefully this protocol for more than 15 correlative years.

- 86 -

Results and Discussion: Long Term In Vitro System In Cucumber

Figure 6.3. – Nematode production. A. Number of J2 from Mj, Mi and Ma per egg mass obtained after hatching in sterile tap water. H1, H2 and H3 correspond to three consecutive rounds of hatching for four days each at 26 ºC carried out in 5 mL of sterile tap water in the same hatching jar. B. Number of egg masses obtained from 500 J2 used to inoculate a plate with five seedlings of C. sativus grown for 21 days. Three different species of RKNs were assessed as indicated. Source: modified from Díaz-Manzano et al., 2016b.

- 87 -

Results and Discussion: Phenotyping Nematode Feeding Sites

6.2.- PHENOTYPING NEMATODE FEEDING SITES: THREE‐DIMENSIONAL RECONSTRUCTION AND VOLUMETRIC MEASUREMENTS OF GIANT CELLS INDUCED BY ROOT‐KNOT NEMATODES IN ARABIDOPSIS In order to study functions of different genes identified in transcriptomic analysis, such as early developing GCs (Barcala et al., 2010), during the plant- nematode interaction, one of the putative approaches is the use of loss of function lines compared to a wild type (WT) line. However, the effects of particular mutations in the RKNs classical infection or reproduction parameters (e.g., number of galls/gr root weight; number of eggs/gr root weight), was not sufficient, as some genes, as LBD16 (Cabrera et al., 2014b) have participated in cell/plant development processes. Therefore, there was a need to develop a standardised reliable and reasonable fast method for phenotyping root- nematode feeding cells by which the effects on GCs morphology of the mutant lines could be compared to that of the control lines.

Classical GCs phenotyping has been based on visual observations of histological sections from embedded resin galls induced by nematodes, mostly Araldite® or Technovit®, at bright field optics and images have been collected with digital cameras (Kyndt et al., 2013). So far, data regarding 3D shape, volume and changes of those parameters during nematode infection are absent. This is mainly due to the complex structure in which GCs are embedded in the root surrounded by other tissues. The cortex is hypertrophied and tiny dividing cells in the vascular tissue surround the GCs divided, increasing along the infection stages (Bird, 1961; Bleve-Zacheo & Melillo, 1997).

In this context, we developed a new method and obtained 3D reconstructions of GCs at different infection stages, from early to late development stages (3, 5, 7, 9, 11, 21 and 40 dpi; Fig. 6.4a-f). It combines the images obtained by conventional light microscopy from the complete serial - 88 -

Results and Discussion: Phenotyping Nematode Feeding Sites

histological sectioning of galls induced by Mj in Arabidopsis roots (Fig. 6.4g-i), with a software specialized in the 3D reconstruction of biological structures, TrakEM2 (Cardona et al., 2012). We provided for the first time 3D models of complete GCs and different parameters related to their volume and shape. These results were required to develop a simplified method for GCs size comparison, based on 2D images from gall sections, as we detected a high correlation between the volume of all GCs within a gall and the total area occupied by all the GCs in the section/s where they show their maximum expansion. Moreover, we demonstrate that this standardized method can be used for comparison of GCs from different Arabidopsis plant lines and we propose that it can be also applied to galls from different plant species and growing conditions.

Material and methods

Nematode populations

Meloidogyne javanica (MIK) population was maintained in vitro on cucumber plants grown at 26ºC (Portillo et al., 2009; Díaz-Manzano et al., 2016b) in darkness in 0.3% Gamborg medium (Gamborg et al., 1968) supplemented with 3% sucrose. Egg hatching was stimulated in sterile water for three-four days.

Plant material, growth conditions and nematode inoculation

Arabidopsis thaliana (L.) Heynh Columbia-0 (Col-0) plants were used throughout this study. Seeds were surface sterilized with 30% commercial bleach and sown in 0.3% Gamborg medium (Gamborg et al., 1968) supplemented with 1.5% sucrose. For stratification, plates were kept at 4°C for 2 days and thereafter, the plates were kept growing vertically in a growth chamber at 22°C± 2 °C, 0%RH, and LD photoperiod (16h light/8h darkness; 80-100 µmol m-2 s-1). Five days later, the plates were inoculated just behind the

- 89 -

Results and Discussion: Phenotyping Nematode Feeding Sites

root tip with 10 Mj juveniles per main root. A thin temperate film (30-37°C) of 0.3% agarose in Gamborg medium was placed over the roots to facilitate nematode penetration. Plants were carefully examined every 12 hours under a Leica Mz125 stereomicroscope to establish a penetration and infection timeline, resulting in a maximum error of 12 h when assessing gall age (Barcala et al., 2010). Galls were hand-dissected at 3, 5, 7, 9, 11, 21 and 40 dpi.

Gall fixation and embedding

Galls were rinsed twice for 10 minutes in sodium phosphate buffer 50 mM and fixed overnight in 2% glutaraldehyde. Galls dehydration was carried out in five steps of 1 hour at increasing ethanol concentrations (10%, 30%, 50%, 75% and 85%), two steps of 1 hour in 90% ethanol, three steps of 1 hour in 100% ethanol and finally, two steps of 15 minutes in acetone 100%. All previously described steps were performed at 4ºC. Afterwards, galls were embedded in Araldite® (Durcupan ACM Fluka) following several steps of incubation in an Araldite®:Acetone solution: 2 hours in a 1:3 solution, overnight incubation in a 1:1 solution and three steps of 1 hour in a 3:1 solution. Finally, galls were oriented vertically (to get longitudinal sections for three- dimensional reconstruction; e.g., Figs. 6.14e-f; 6.25g; 6.26e) or horizontally (to get cross sections for promoter expression analysis; e.g., Figs. 6.11c; 6.12i-j; 6.28g,i) in silicone moulds filled with 100% Araldite® and maintained at 60ºC during 48 hours for Araldite® polymerization. In the case of Technovit® resin embedding, it was done in the same way, replacing the Araldite® for Technovit® and following morphological analysis procedure described by Vieira et al., 2012.

Gall sectioning and imaging capture

Galls at 3, 5, 7, 9, 11, 21 and 40 dpi (Fig. 6.4a-f) were fully sectioned at 2µm with a diamond knife in an ultramicrotome (Microm HM360, Thermo

- 90 -

Results and Discussion: Phenotyping Nematode Feeding Sites

Scientific). Longitudinal sections were carefully recovered and sorted one by one in glass slides. Sections were stained for 5 minutes with 1% toluidine blue (TB) in 1% borax solution (TAAB) at 40ºC. Araldite® semithin sections were photographed under a Nikon eclipse 90i microscope using bright- or dark-field filters. High quality photographs of the 2µm sections containing GCs were obtained at magnification 10x under a light microscope (Nikon Eclipse 90i) equipped with a digital camera (Nikon DXM 1200c). TrakEM2 software provided together with FIJI image processing package was downloaded from http://fiji.sc/Fiji and was used for the alignment and 3D reconstruction of the samples (Fig. 6.4g-j). Detailed step by step video tutorials on the use of TrakEM2 created by the authors in collaboration with the software developers are available at http://fiji.sc/TrakEM2_tutorials. Most of the pre-established parameters of the software were maintained for all the samples reconstructed with the exception of: pixel width (0.2µm), pixel height (0.2µm), voxel depth (2 µm), and steps per scale (5), feature descriptor size (8), maximum alignment error (50) and iterations for mesh smoothing (15). Measurements of volume, area, maximum diameter or surface of the GCs were calculated by trakEM2 depending on the number of pixels occupied by each GCs (Fig. 6.7).

The sections were stained with 1% TB in 1% TAAB. The TrakEM2 (Cardona et al., 2012) plug-in for FIJI was used to measure GCs areas (Schindelin et al., 2012). Two representative galls from each genotype were entirely sectioned into 2 µm sections. The ten sections in which the GCs showed the greatest expansion in each gall were selected to quantify the area (µm2) occupied by the GCs as well as to obtain the mean area and standard errors among the sections (Cabrera et al., 2015a). Statistical analyses of the functional parameters were performed via ANOVA analysis and Student’s t- test. For GCs area we used the Schefeé’s test. All analyses were performed using the SPSS package version 18 (IBM, Armonk, NY, USA). The significance level was set at P<0.05. Likewise, we proceeded to carry out the phenotypic studies of GCs in lines J0121>>GFP (Fig. 6.8) and J0121>>DTA (Fig. 6.8); - 91 -

Results and Discussion: Phenotyping Nematode Feeding Sites

35S::LBD16-SRDX (Fig. 6.14d) and Col-0 (Fig. 6.14d); 35S:TOE1R lines (Fig. 6.25f); terminal flower FT gene was performed in ft-10 mutant line (Fig. 6.26d);

mimicry lines (Fig. 6.30c) and potato lines (Fig.S7e).

Figure 6.4. – Three-dimensional (3D) reconstruction procedure in galls induced by Mj in Col-0 roots. A-F. Mj galls from Col-0 showing NFS development at 3, 5, 7, 11, 21 and 40 dpi,

- 92 -

Results and Discussion: Phenotyping Nematode Feeding Sites

respectively. Scale bars, 500 µm except c and e, 200 µm. G. Three basic steps of section processing prior to the 3D reconstruction of a gall induced by Mj in Arabidopsis. Five representative sections of the whole two µm-section series (indicated by numbers) from a gall stained with TB+TABB are shown (consecutive nonaligned images). H. Consecutive aligned images. I. Consecutive aligned images with GCs labelled. J. Serial sectioning of an Arabidopsis gall induced by Mj with aligned images and coloured GCs (numbers are indicated at the top left of the image). Two-micrometer sections with TB+TABB are stained. This method enables detailed characterization of cell morphology across the series (left panel, only TB+TABB staining; right panel, coloured cells with nematode in black colour). It avoids misinterpretation arising from the observation of single isolated sections or a small group of sections. Source: modified from Cabrera et al., 2015a.

Galls and GCs phenotyping for TOE1 and MIM lines

The volume or the estimation of the size of the GCs (n≥ 10 per line tested) induced by M. javanica in Col-0, 35S:TOE1R , MIM172 and ft-10 were obtained after 3D reconstruction following the method described before (Cabrera et al., 2015a) using the plugin TrakEM2 (Cardona et al., 2012) and for FIJI (Schindelin et al., 2012). Gall diameters were measured from micrographs from each gall (n≥20 per line tested) by using the straight line and measurement tools from FIJI (Schindelin et al., 2012).

Results and Discussion

GCs labeling from galls serial sections using TrakEM2

Here, we used a simple technique to have a complete overview of the phenotypic characteristics and the volume occupied by the GCs during the nematode life cycle progression. A total of 2240 longitudinal histological sections (2µm thickness) from 162 GCs through 7 different stages (3, 5, 7, 9, 11, 21 and 40 dpi) (Fig. 6.5a-h) were processed. The average number of sections occupied by the GCs inside the galls increased during development

- 93 -

Results and Discussion: Phenotyping Nematode Feeding Sites

(from 20 at 3 dpi to 99 at 40 dpi). The stack of light microscope photographs obtained was imported into TrakEM2 software (http://fiji.sc/Fiji) that allows 3D modeling from serial histological sections (Fig. 6.4j). TrakEM2 has been already successively used in other fields, as in the reconstruction of neuronal circuits from Drosophila (Cardona et al., 2012). TrakEM2 has the advantage of being free, open source and public available for download together with the FIJI image processing package (a distribution of ImageJ, broadly used in several laboratories for microscopy images processing), contrary to other commercial software previously used in 3D reconstruction studies made in Arabidopsis (Vanhaeren et al., 2010). For an optimal recognition of the GCs, the sections were rotated and translated to align them onto each other by making use of the tools for free affine transform provided by TrakEM2. The high similarity between consecutive sections (as they were only 2µm thickness) allowed TrakEM2 to analyze their pixels for similar features on images and displace the upper image (rotate and/or translate) for an optimal match over the consecutive image on the bottom (Fig. 6.4j) and continue consecutively down through the other sections until the end of the stack. The alignment of the successive sections made easier to define each GC within a gall by making use of the area list tool used to label them with a color code that was maintained in all the consecutive sections in which every particular GC could be distinguished (Fig. 6.4j).

Moreover, the alignment obtained proved to be particularly useful to avoid misinterpretation in the number and size of each GC, as a single cell could be traced along the entire gall. It allowed to distinguish between multiple GCs and those unique cells that in some 2D sections seemed to be divided in more than one because they were interspersed with other vascular cells, as the blue GC in Fig. 6.4j, that turned out to be a unique cell with different prominences (Fig. 6.4j, blue GC). The position of the GCs with respect to the nematode, (Fig. 6.4j, pink GC) was also clearly identified as GCs that in a determined slice seemed to be far away from the nematode, eventually were - 94 -

Results and Discussion: Phenotyping Nematode Feeding Sites

close to the parasite in any of the next sections in which this cell appeared (Fig. 6.4j, pink GC). Usually, GCs presented an elongation in their shape adjacent to the nematode, conferring them a tubular form in this area in contrast with the expanded shapes that they presented in the area more distant from the nematode (Fig. 6.5i-l). This strongly suggests that all GCs have been in contact with the nematode at some stage of the gall development. Moreover, it was possible to detect exactly the number of GCs in each gall that ranged from 4 to 13. The number of GCs varied in galls at any stage of development between 3 dpi and 40 dpi. Over again, misinterpretations coming from those sections where cells were interspersed with other cells as in Fig. 6.4 were avoided. Those observations, particularly the absence of correlation between the number of GCs and the stage of development, reinforce the idea that once the nematode become sedentary within the vascular cylinder, differentiation of those selected cells into GCs is in progress. Thus, the nematodes should move their head from one cell to the other for nutrient uptake until complete their life cycle (Golinowski et al., 1996; Bleve- Zacheo & Melillo, 1997).

Therefore, with the help of the free software TrakEM2 we aligned histological sections from galls. The quick and intuitive alignment of the sections facilitated the recognition and observation of the GCs induced by the RKNs within the gall and reduced the multiple sources of misinterpretation on their number and position. It also allowed the easy collection of accurate qualitative and quantitative data from histological sections very useful in the phenotyping of the GCs as shown in the following section.

- 95 -

Results and Discussion: Phenotyping Nematode Feeding Sites

Figure 6.5. – Representative samples of reconstructed GCs shapes. A-H. Three- dimensional (3D) reconstruction showing the highly diverse morphology of the GCs at 21 (a), 7

- 96 -

Results and Discussion: Phenotyping Nematode Feeding Sites

(b-f) or 5 (g-h) dpi. Note the remarkably irregular shapes. I-L. Three-dimensional reconstruction of GCs together with the nematode. A protruding GC end next to the nematode head is always observed. Source: modified from Cabrera et al., 2015a.

3D reconstruction and volumes

After the alignment and the assignment of a color code to each GC, we obtained their 3D models with the plugin ImageJ 3D viewer incorporated to TrakEM2. All the 3D models achieved in this work can be visualized and handled online at https://sketchfab.com/jcabrerachaves/models, besides the visualization of cell morphological characteristics. One of the most valuable applications of the 3D reconstruction is to obtain volumetric data. We measured the volumes of 162 GCs obtained from 2240 independent sections from seven different stages (3, 5, 7, 9, 11, 21 and 40 dpi). The volumes achieved for the GCs ranged from 7081µm3 (found at 11dpi) to 14,537,585µm3 (at 40dpi). The volume of individual GCs did not correlate well with the stage of development of the gall, e.g. some 3 dpi GCs had bigger volumes than some 21 dpi GCs (Fig. 6.6a).

However, the average volume occupied by all the GCs as a pool within a gall at each infection time, showed a clear trend to increase as the infection progressed (Fig. 6.6b). The amplitude of the volumes measures obtained for GCs in the same developmental stage showed that the GCs at the early stages of development were more homogenous than the older GCs (Fig. 6.6a-b). The fact that the volumes of individual GCs did not show a correlation with their developmental stage, in contrast to the data achieved when we considered the whole pool of GCs within a gall at each infection stage, that showed a noticeable positive correlation (see exponential line tendency at Fig. 6.6b); it suggested that GCs should grow asynchronically during gall development. This might be due to mechanical restrictions or to an intense stimulation of particular cells by the nematode. All these findings emphasized

- 97 -

Results and Discussion: Phenotyping Nematode Feeding Sites

the importance of the GCs pool within a gall, as a whole functional “pseudo- organ”.

Figure 6.6. – Volume evolution, sphericity and surface area to volume ratio (SA : V) of GCs formed by Mj in Arabidopsis along infection time. A. Volume of each individual 162 GCs reconstructed. B. The average volume occupied by all the GCs corresponding to the same developmental stage. The x‐axes in the two graphs indicate galls at different infection stages: at 3 (n = 20), 5 (n = 19), 7 (n = 19), 9 (n = 33), 11 (n = 26), 21 (n = 23) and 40 d post infection (dpi; n = 22); in (b) bars indicate ± SE. C. The ratio of the total surface area (SA) to the final volume (V) occupied by single GC (SA : V ratio). The ratio becomes smaller as the volume increases. D. Sphericity (Ψ) measurement of the GCs at the different stages of development. Note that sphericity is different in each GC at all developmental stages indicated. Vp, volume of the GC; Ap, surface area for each GC. Source: modified from Cabrera et al., 2015a. - 98 -

Results and Discussion: Phenotyping Nematode Feeding Sites

The surface area for each GC was obtained after the reconstruction, and the ratio surface area to volume (SA:V ratio) was also calculated (Fig. 6.6c). This parameter measures the ability of a cell to exchange solutes with its environment, since the rate of diffusion is proportional to the surface area. Thus, the larger cells will have slower diffusion rates than smaller cells. Thus, the higher SA:Volume ratio on a cell, the more effective solute exchange process, and a high metabolic activity could easily be maintained. In the case of GCs, the SA:V ratio decreased with the increase in size of the GCs, from values above 0.4 in the smallest cells to values under 0.1 in the biggest (Fig. 6.6c). This parameter seem to indicate a decrease in the capacity to interact with the rest of the cells within the gall as the infection progress, what probably influence also their competence to sustain a high metabolic rate. Consequently, GCs at the first stages of development would be metabolically more active than older stages. In contrast to this assumption, studies in which protein content has been measured, indicated that the maximum metabolic activity within the GCs coincides with the time of egg laying stage (Bird, 1961) when the feeding cells are fully expanded. Accordingly, Class I of sHSPs are highly abundant in developed GCs as compared to the rest of the gall, what correlated with the activation of several sHSPs promoters. These chaperone- based mechanisms are probably related to the maintenance of a proper protein folding preventing the aggregation of abundantly synthesized proteins in highly active cells (Escobar et al., 2003; Barcala et al., 2008). Thus, all these findings emphasized the importance of the transfer cell-like structure of the GCs, as the coincidence in time of low SA:V ratios and high metabolic activities, apparently a contradiction, it may offer a clear explanation for the need to increase the effective solute exchange area through the differentiation of cell wall ingrowths (CWIs) in the feeding sites (Cabrera et al., 2014b). Interestingly, in GCs, the amplification of the plasma membrane surface area could be up to 20-fold (Jones & Goto, 2011). Thus, feeding cells with apparently the same size may cause different levels of nutrient withdrawal from the plant depending of the

- 99 -

Results and Discussion: Phenotyping Nematode Feeding Sites

optimization of their SA:V ratio by the development of CWIs. In this respect, characterization of CWIs in some loss of function lines showing no effect on GCs size might be worth as pointed in Cabrera et al. (2014b).

Further investigation about the GCs morphology was their sphericity calculation at the different developmental stages studied. Sphericity is a measure of the roundness of an object defined as the ratio of the surface area of a sphere showing the same volume of the object of interest and the surface area of this object, hence the sphericity of a sphere should be 1 (Girshovitz & Shaked, 2012). Our results showed that the shape of the GCs measured by their sphericity seemed to be the same during the development (Fig. 6.6d). No spherical cells were present in our study, obtaining values of sphericity between 0.4 and 0.7 for all the GCs (Fig. 6.6d). Accordingly, it is accepted that at the same volume value, spherical cells will have slower diffusion rates than elongated cells. GCs shape looks clearly more elongated than spherical (Fig. 6.5a-h), that could be another explanation for a way to compensate the low SA:V ratio of GCs at late developmental stages. The low sphericity values were also in accordance to the presence of different protuberances that avoid them to become spherical giving an irregular shape. This is possibly due to the presence of the nematode and other cells that are mechanically pushing and pulling the GCs. As shown in the 2D sections, GCs showed regions of polarized growth, clearly illustrated in the 3D models (Fig. 6.5a-h) where a great variety of shapes could be observed. Moreover, some common features were detect among them as all showed a protuberance adjacent to the nematode, also shown in Fig. 6.4j, though, it is more easily appreciated in the 3D reconstruction, (Fig. 6.5i-l).

In conclusion, 3D GCs reconstruction proved to be useful to measure GCs volumes and for the identification of their morphological characteristics. Thus, it represents a step forward in feeding cells phenotyping, obtaining valuable and standardized information of the number, shape, position and - 100 -

Results and Discussion: Phenotyping Nematode Feeding Sites

volume, and minimizing misinterpretations from 2D images. Furthermore, the method used could be easily applied to galls of different plant species having different thickness, providing that the tissues are well fixed to maintain galls morphology in the sections.

Relationship between single-slices areas and the total volume of the galls: a simplified phenotyping standardized method

Given the aforementioned results, GCs phenotyping would provide valuable information to add to the commonly performed infection tests. While methods to study nematode resistance or susceptibility with infection tests are fairly well understood and established, no such standardized methods exist for the phenotyping of the GCs. Our study represents the first time that the volumes of the GCs induced by Mj within the gall are quantitatively measured, constituting itself a good starting point to establish a methodology to infer phenotypic differences between GCs.

Recent studies on the interaction between RKNs and plants investigated the differences in the GCs size between WT and loss of function or overexpressing lines by inference from 2D sections in different ways (Cabrera et al., 2015a). Our results have already demonstrated the multiple sources of misinterpretation of 2D data on the gall sections at a first glance; as those related to the number, position and GCs shape (Fig. 6.4j). Even more, several of these studies did not collect quantitative measures from the GCs and compared their sizes by direct visual observations of 2D sections (Cabrera et al., 2015a). Other studies collected some quantitative data from gall sections. Three different parameters were used: the maximum diameter of the GCs or the maximum area occupied by either individual GCs or all GCs as a pool within the gall sections (Cabrera et al., 2015a). This study has shown that the morphology of the GCs is severely irregular. Thus, inferring differences in GCs size from one or two dimension parameters such as the diameter and areas seems not very accurate. Volumetric data obtained through this study - 101 -

Results and Discussion: Phenotyping Nematode Feeding Sites

allowed us to determine GCs size accurately. However, as shown in Fig. 6.4, 3D reconstruction of GCs within a gall is a tedious, dedicated and time- consuming work that requires the processing of many sections per gall.

Therefore, we investigated the correlation between the volume of the GCs obtained in this work and the different parameters used to phenotype the GCs. The maximum diameter showed a Pearson correlation index of 0.61, p<0.05 (Fig. 6.7a), whereas 0.93, p<0.05, was achieved for the correlation between the volume and the area of the individual GCs measured in the section where they showed a maximum expansion (Fig. 6.7b). However, the maximum correlation indexes were obtained between the volume of the total pool of GCs contained in a gall, and their total area in the section showing its maximum expansion, 0.97, p<0.05 (Fig. 6.7c). Interestingly, a high correlation value was also achieved, 0.97, p<0.05 between the volume of the total pool of GCs contained in a gall and the average GCs area in the ten sections where GCs showed their maximum expansion (Fig. 6.7d). Yet, the area of the GCs as a pool within a gall is more related to their volume than their diameter or even the area of single GCs.

- 102 -

Results and Discussion: Phenotyping Nematode Feeding Sites

Figure 6.7. – Schematic representation of the simplified method for GCs size phenotyping. A-B. Serial sections of the two main types of gall detected in this study (one-dome or two-dome shape, respectively). Ten sections with the largest GCs expanded area are coloured. C. Correlation between the average GCs pool area of the two sections of 4 µm with maximum GCs expansion (y-axis) and their volume (x-axis). D. The same as (c) but with sections of 8 µm. Pearson correlation coefficients: p<0.05. Source: modified from Cabrera et al., 2015a.

- 103 -

Results and Discussion: Phenotyping Nematode Feeding Sites

However, these methods presented some technical difficulties evidenced in these manuscript, e.g., the election of the appropriate section in which individual GCs or the GCs pool showed their maximum expansion area could be easily misinterpreted without a previous alignment, labeling and measure of the full GCs. In the case of the election of the sections where individual GCs occupy its maximum area, different sections corresponding to each of the different GCs within a gall should be selected, increasing the probability of error in the election. In the literature, GCs per gall were chosen for area measurement. By selecting individual GCs, the striking differences on volumes among GCs of the same age showed in this work are not taken into account. If the whole volume occupied by the GCs pool within a gall is not measured, it may introduce significant errors. Nevertheless, the election of the section with maximum area occupied by the GCs pool also would require the measurement of all the sections of a gall to avoid misinterpretations leading to errors.

For all these reasons exposed, we propose a simplified method that minimizes those problems and speeds up considerably the processing. The method is based in a 2D parameter with a high correlation to the final volume of the GCs pool. We showed that the average area occupied by the GCs pool within a gall from the 10 sections with maximum expansion maintained a high correlation with the volume (Fig. 6.7d). Additionally, by using a mathematic algorithm in which the area of 2 of the 10 sections with the largest GCs pool are randomly selected with 1000 iterations (Wichman & Hill, 1982), we obtained a minimum correlation index of 0.968 and a maximum of 0.972 to that of the GCs volume. The identification of 2 random sections among those 10 sections with the largest area occupied by the GCs pool within a completely sectioned gall can be performed easily, accurately and with minimum errors at a first glance. Moreover, to facilitate a large-scale phenotyping of the GCs, it is a prerequisite to minimize the number of sections achieved from a gall, as sectioning an entire gall at 2µm is a tedious work. If routinely the galls could be - 104 -

Results and Discussion: Phenotyping Nematode Feeding Sites

sectioned at 4-8µm for phenotyping, the number of sections for each gall would dramatically decrease (2 to 4-times less than at 2µm), i.e., from 100 sections to 50 or 25. Moreover, the differences in the area occupied by the GCs pool among thicker sections are easily detected at a naked eye. We showed schematically in Fig. 6.7b the reduction in the number of sections obtained from two different types of galls (A and B), that were artificially classified depending on their GCs areas distribution. In A, the sections with the maximum GCs areas are correlative (one-dome shape), whereas in B, there are two groups of sections with maximum areas (two-dome shape). Those shapes were detected among the 162 GCs scored in this study (https://sketchfab.com/jcabrerachaves/models). Thus, we show that when a gall is sectioned at 4µm, and sections are selected with the maximum GCs area, at least 2 of the sections would be among those 10 with the maximum GCs area expansion from the gall if sectioned at 2µm (Fig. 6.7c). It is the same case for the 8 µm sections (Fig. 6.7d) and it will be also maintained for 5, 6, 7 µm sections (data not shown). In this way, by selecting and measuring the area of the GCs pool in the two sections with the highest GCs expansion at either 4 or 8µm (easily observed at a first glance as the differences between sections) are higher than at 2µm; the correlation index with the GCs volume is maintained to 0.97, p<0.05 in both cases (Fig. 6.7c-d). It also will be extensible to sections between 8 and 4 µm thicknesses. This final method proposed reduce the number of sections necessary for large-scale phenotyping and it seems one of the most accurate. It is based in a 2D parameter that we demonstrated as proportional to the size of the GCs developed by Mj inside the gall, the area of the GCs pool within a gall.

Volumetric measurements of different Arabidopsis lines

In order to confirm the utility of the simplified proposed method, we compared the GCs size from galls induced by Mj in the transgenic line J0121>>DTA to the control line J0121>>GFP as a proof of concept

- 105 -

Results and Discussion: Phenotyping Nematode Feeding Sites

(validation). It has been described that the GCs pool of the J0121>>DTA is smaller than the control line J0121>>GFP based in the area measurement of GCs from 4µm individual sections (Cabrera et al., 2014b), but accurate volumetric data is still lacking. To further demonstrate the validity of our method to phenotype the GCs, we reconstructed the GCs from two 14dpi galls from the line J0121>>DTA and from its correspondent control J0121>>GFP (Fig. 6.8a) from 4 µm sections. The average volume occupied by the GCs pool in the control line is at least two-fold larger than that occupied by them in the J0121>>DTA (Fig. 6.8b). When the GCs pool area from the 2 sections with the maximum GCs expansion (Fig. 6.8c) among all sections achieved from each gall were compared, the same difference ratio (~2-fold) was obtained between both lines as when using their total GCs volumes (Fig. 6.8c). This is due to the high correlation (Pearson correlation coefficient, R=0.97 p<0.05) of both parameters described in the former section. Thus, we confirmed that a 2D parameter, area of the GCs pool from the 2 sections with the maximum expansion area of the GCs selected by naked eye, is a clear index to compare GCs sizes between two different plant genotypes. As observed, no differences in the typically irregular shape are evident between both lines.

This example further validate a simple, quick and standardized method that could be useful to detect phenotypic differences between GCs from different Arabidopsis lines with a high confidence of being representative of the differences in the total volume occupied by the GCs. This seems a good morphologic parameter for phenotyping GCs, since, the volume intrinsically contemplate the cell shape that is shown completely irregular, different for each cell, and with no geometric figure that could match it.

- 106 -

Results and Discussion: Phenotyping Nematode Feeding Sites

Figure 6.8. – A proof of concept (validation): simplified GCs phenotyping method applied to a specific case. A. Toluidine‐stained 4‐μm representative sections of 14 dpi galls from each Arabidopsis line as indicated: J0121 ≫ GFP and J0121 ≫ DTA. Scale bars, 50 μm. Asterisks indicate, GCs. B. Histograms indicate the average volume occupied by the GCs pool from two representative galls of each line as indicated (± SE). Asterisks indicate, p<0.05. C. The average volume and the average area of the two largest sections per gall for each genotype. Dpi, days post inoculation. Source: modified from Cabrera et al., 2015a. - 107 -

Results and Discussion: A Reliable Protocol For In Situ MicroRNAs Detection

6.3.- A RELIABLE PROTOCOL FOR IN SITU MICRORNAS DETECTION IN FEEDING SITES INDUCED BY ROOT-KNOT NEMATODES In order to understand the role of a gene/miRNA is to identify the tissue and cell type within which it is expressed. However, gene/miRNA abundance using whole plants or organs is predominantly analyzed while many of them in few cell types are only expressed. A clear example in the context of general gene expression profiles came from the comparison of the transcriptomes of both entire galls (that contain GCs) and isolated GCs that were strikingly different, and a strong dilution of the GCs-specific transcripts was observed when whole galls were analyzed (Barcala et al., 2010; Portillo et al., 2013; Cabrera et al., 2014b).

Therefore, the study of regulatory gene/miRNA that might be exclusive for GCs formation and/or maintenance from whole-gall RNA samples can be very arduous, as frequently the analysis of the whole organ fails to attribute the proper cell-specific functions to a gene/miRNA. Such questions have led to the development of this method that allow scientists to examine the expression of specific gene/miRNA in particular cells (Cabrera et al., 2014b; 2016a); by cell isolation techniques or in situ localization, e.g. in NFS (Portillo et al., 2009; Szakasits et al., 2009; Barcala et al., 2012; Anjam et al., 2016).

Until the date, there was no protocol for miRNAs localization in GCs described; thus, we decided to present for the first time an adapted and standardized in situ hybridization (ISH) protocol to detet miR390 in tomato galls/GCs induced by Mi based in tissue paraffin embedding and on-slide miRNAs ISH.

- 108 -

Results and Discussion: A Reliable Protocol For In Situ MicroRNAs Detection

Material and methods

Plant growth and tissue sampling While this protocol focuses on the detection of miRNAs from root tissues and galls in tomato (Solanum lycopersicum, L., 1753), we think that it can be easily adapted to other crop species with subtle changes during fixation and embedding. Plant roots grown in soil or agar should be immersed repeatedly in sterile water, using a soft paintbrush to remove particulate matter while minimizing harm to the roots. It is important to consider the stage of plant growth and tissue type since gene expression may differ. We sampled galls and uninfected root segments (URS) from plants at seven days post- germination. Time should be minimized between collection and fixation to avoid degradation of target miRNA while enough URS and gall tissue should be used for hybridization with each probe (Fig. 6.9a). Three independent experiments are recommended.

Tissue preparation The proposed method for tissue preparation involves formaldehyde fixation, ethanol dehydration, Histo-Clear® clearing and paraffin embedding. A reasonably fast and simple procedure that conserves sufficiently tissue morphology, plus preserving miRNAs. We reduced sample fixation time in formaldehyde for 14 hours at 4 ºC; contrary to classic mRNA ISH which may fix longer than one week (de Almeida-Engler et al., 2001). Following formaldehyde fixation, the tissue should be embedded in Paraplast® (Fig. 6.9a). Images of Paraplast® sections (10 µm; Fig. 6.9a) should be better defined than thicker sections, like those obtained from agarose-mounted specimens (100-300 μm). We recommend limiting the number of galls to each mold so that liquid paraffin can polymerize between the samples (0.5 cm2 and/or 1 cm2 of tissue in 8 cm3 of paraffin; Fig. 6.9a).

- 109 -

Results and Discussion: A Reliable Protocol For In Situ MicroRNAs Detection

Figure 6.9. – Protocol flowchart. Diagram of ISH procedure representing all necessary steps from collecting the samples to colorimetric detection of miRNAs. The whole procedure takes 10 days. A. Plant tissue is fixed in a formaldehyde/ethanol solutions/histoclear, followed by embedding in Paraplast® X-tra and sectioning. B. An anti-DIG antibody conjugated with alkaline phosphatase and its substrate is used for the detection of the DIG labeled products. DIG, digoxigenin; E, enzyme; NB: NBT/BCIP violet product. Source: Díaz-Manzano et al., 2016a. - 110 -

Results and Discussion: A Reliable Protocol For In Situ MicroRNAs Detection

Sectioning one paraffin block should yield enough tissue sections of multiple galls or URS to perform ISH of at least two to three miRNA probes. We suggest carrying out at least 12–16 sections per probe and per independent experiment corresponding to one biological replicate (gall or URS; Fig. 6.9a) to check that the expression pattern is consistent within the tissues. Simultaneously, a negative control probe is recommended with equivalent or correlative sections of the same paraffin block. Sufficient sections for each probe plus its negative control (24–32 sections) of galls and URS should be used for hybridization (Fig. 6.9b) as they might be damaged during the procedure. It is also important to check the integrity of the tissues and the homogeneous adherence to the slides under the microscope after sectioning, since the tissue may separate from the paraffin or detach from the slides during the procedure.

Probe design Double-labelled LNA modified oligonucleotide probes were used during the detection stage, solving the problem of a low annealing temperature that would be required by the small probe length as they enable high hybrid stability. Therefore, hybridization can be performed at 50ºC. Double-labelling of probes at both ends also facilitates a more intense signal, making detection easier and increasing significantly the signal resolution and sensitivity, thus radioactive 35S-labeled probes can be circumvented (de Almeida-Engler et al., 2001). We used LNA probes from Exiqon®, but another option is to make your own customized probes. Oligonucleotides should be 18–24 bases long and they should have an annealing temperature around 70°C. Using a negative control probe is highly recommended, preferably one that does not match any miRNAs in the available web databases. Herein, we used Scramble from Exiqon®, a probe with no hits or >70% homology to any sequence in any organism in the NCBI database; and no homology to sequences in the miRBase database. Many pre-designed specific probes for known miRNAs are

- 111 -

Results and Discussion: A Reliable Protocol For In Situ MicroRNAs Detection

available together with negative control probes. The specific mature probe detected here is sly-miR390b-5p from tomato (MIMAT0035479), and it is 100% homologous to that from Arabidopsis. The method confirmed the expression of the miR390 in tomato (Fig. 6.10).

Optimization of ISH conditions Before hybridization of any plant tissue (e.g. Arabidopsis, corn, potato, rice, tomato, etc.), probe concentration, hybridization temperature and buffer concentrations need to be optimized to maximize the sensitivity of the in situ experiment. It is then essential to test different concentrations of each probe in order to optimize signal specificity. Therefore, it is recommended to perform an opening experiment to determine the most appropriate concentration of the probe to be used. Herein, we tested different concentrations of the probes (5, 10, 15 and 20nM) and hybridization temperatures (40, 48, 50 and 55°C; data not shown). In our hands, one of the best concentrations was 20nM for tomato paraffin sections to maximize discrimination of miRNA abundance between tissue types (infected versus URS) for miR390. It is recommended to use the lowest possible hybridization temperature that still does not produce any background signal and minimize damage into tissue samples. We found that 50°C was the most appropriate temperature according to the probe used, hybridization conditions and sections preservation.

Validation and controls To validate the expression pattern for the miRNA of interest, we routinely performed multiple technical replicates of at least 2 slides containing multiple sections. Herein, it is recommended to follow the protocol with a total of 24–32 paraffin sections per independent biological sample; 1 gall or 1-2 URS (Fig. 6.9a). A negative control (here, Scramble) is also used in half of the 24-32 sections for absence of signal since it should not show specific miRNA hybridization. It is highly recommended to include it alongside each tissue type

- 112 -

Results and Discussion: A Reliable Protocol For In Situ MicroRNAs Detection

analyzed (galls and URS; Fig. 6.10a-c). Another recommended control is to omit the probe during the hybridization. The miRNA probe used in this study is also suitable as a positive control (miR390) for galls if other miRNAs are examined as it gives a clear positive signal in gall tissue at 4 to 7 dpi (Fig. 6.10d-f). To tackle potential problems that may occur during the protocol, see supplementary data at http://journal.frontiersin.org/article/10.3389/fpls.2016.00966/full.

Results and Discussion

A role for miR390 during RKNs infection

We developed an efficient and improved protocol for miRNA ISH and their localization in root tissues induced by endoparasitic nematodes. We tested tomato galls from the genus Meloidogyne. From our data obtained from massive sequencing of sRNAs present in galls from Arabidopsis as compared to URS showed that miR390 was consistently induced in galls at early infection stages compared to uninfected roots (Cabrera et al., 2016a). However, galls are pseudo-organs containing a mixture of heterogeneous tissues, some experiencing mitosis and/or hyperplasia (de Almeida-Engler et al., 1999; de Almeida-Engler & Gheysen, 2013). Consequently, it is important to distinguish the specific tissues and/or cells where a particular sRNA/miRNA is expressed within the gall. Transcriptomes of hand-dissected galls and of GCs after laser microdissection were consistently different. Furthermore, a clear dilution effect of the GCs specific transcripts was observed in galls (de Almeida-Engler et al., 2012; Cabrera et al., 2015b). This was true for both species Arabidopsis and tomato (Portillo et al., 2013; reviewed in Escobar et al., 2015).

Transcript abundance and transcriptional profiles are different in GCs compared to the rest of the gall tissues (neighbouring cells and cortical cells). Hence, it was crucial to develop a method for the localization of miRNAs in - 113 -

Results and Discussion: A Reliable Protocol For In Situ MicroRNAs Detection

cells and/or tissues within the gall where a particular miRNA is expressed and compare its relative abundance. The expression pattern of miR390 had been studied during LR formation and in galls, using transgenic plants with reporter genes fused to the promoters of genes coding for miR390, such as pMIR390a/b:GUS-GFP (Marin et al., 2010; Cabrera et al., 2016a). However, ISH of this particular miRNA had not been performed. Though the ISH experiments presented herein yielded reliable results, several problems were encountered during the course of protocol optimization. Among these, lack/weak hybridization signal or overstaining due to low or excess probe concentration; respectively. Tissue fragility may also be encountered during sectioning, or due to protease-RNase treatment, washing steps and high hybridization temperatures. A good pre-selection for high quality slides prior to starting the experiment is essential, along with the application of a specific probe in its optimal concentration thence; probe concentration should be adjusted depending on the target abundance. So, this protocol can be adapted for detection of miRNAs in other plant species and potentially be suitable to detect miRNAs in other crops yet unstudied for miRNAs (Table 6.2).

Reliable signal within tomato GCs and neighboring gall cells (Fig. 6.10e-f) and URS was obtained using a specific double-labelled LNA probe. Negative control with Scramble did not show any signal or background on either URS (Fig. 6.10a) or gall tissues (Fig. 6.10b-c). A clear ISH signal for miR390 was localized for first time in GCs at 4 and 7 dpi (Fig. 6.10e-f). It was more intense at 4 dpi than at 7 dpi and a low signal was found in URS (Fig. 6.10d). These results indicate that although the miR390 is present in uninfected tissues, it is more abundant in GCs within the gall. Finally, miR390 shows 100% homology among several plant crops species (Table 6.2), therefore the Arabidopsis specific probe was successfully used to localize its tomato miRNA counterpart in galls.

- 114 -

Results and Discussion: A Reliable Protocol For In Situ MicroRNAs Detection

Table 6.2. – MiR390 sequences in different crop species. BLASTN from miRBase (http://www.mirbase.org/) was used to search for miRNA homologues in different crop species matching the miR390 probe sequence (GGCGCTATCCCTCCTGAGCTT). The homology (score value) and significance are specified (E-value). Asterisks indicate 100% homology. Source: modified from Díaz-Manzano et al., 2016a.

- 115 -

Results and Discussion: A Reliable Protocol For In Situ MicroRNAs Detection

The method here described has been successfully adapted to detect miRNAs (miR390) in particular cells and tissue types such as GCs within tomato galls and URS. The method is based on the hybridization of paraffin sections with LNA-double-labelled probes. This protocol is an important tool for the study of the cellular and tissue specific expression pattern of genes/miRNAs that might have putative roles during gall formation and/or maintenance. Furthermore, we think that the method can be applied to other vegetable crops that are resilient or more difficult to transform than plant models such as Arabidopsis.

Figure 6.10. – In situ detection of mature miR390 expression in tomato roots. (A-C) Scramble was used as a negative control, alongside a miR390 specific probe (D-F). A and D, uninfected root segments; B and E, Mi galls at 4 dpi, C and F, galls at 7 dpi. Asterisks indicate GCs; N, nematodes; VC, vascular cylinder; E, endodermis. Scale bars: 50 µm B and E; 100 µm A, C, D and F. Source: modified from Díaz-Manzano et al., 2016a. - 116 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

6.4. A COMPARATIVE STUDY OF LATERAL ROOT FORMATION AND THE DEVELOPMENT OF GALLS/GCS THROUGH AUXIN REGULATED PATHWAYS GOVERNING LATERAL ROOT INITIATION A role for LBD16, a transcription factor from the Lateral Organ Boundaries Domain family, during RKNs infection The analysis of transcriptomes of early developing GCs showed that they were very similar to those of undifferentiated LRP cells, particularly those of LRP founder cells and quiescent center cells (Cabrera et al., 2014b; Fig. 3.3b). Hence, we decided to study LRP marker lines as the J0192>>GFP line where GFP expression is driven by the promoter region of LBD16 (At2g42430; Laplaze et al., 2005), which encodes a transcription factor (TF) expressed specifically during the first stages of LRP formation and is positively regulated by auxins (Lee et al., 2009).

Figure 6.11. – Analysis of J0192>>GFP and J0192>>GUS lines after Mj infection. A-B. Confocal images of galls stained with propidium iodide (red fluorescence) showing GFP signal (green) at 2 and 6 dpi from line J0192>>GFP. C. Semithin Araldite® cross section of

- 117 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

J0192>>GUS line at 7 dpi observed in dark field. N= nematode; asterisks, GCs. Scale bars, 100 μm. Source: modified from Cabrera et al., 2014b.

Results indicated that the J0192>>GFP line was active after nematode infection as early as 2 dpi, and the GFP signal increased at 7 dpi (Fig. 6.11). Additionally, a transgenic line containing 2500 bp of the LBD16 promoter region fused to GUS gene delator (pLBD16::GUS; Okushima et al., 2007) was infected with Mj; and compared to the expression pattern of the "auxin sensor" synthetic DR5 promoter (Ulmasov et al., 1997; Fig. 6.12). It showed strong expression at 3 dpi in the centre of the gall (Fig. 6.12a), similar to DR5::GUS (Fig. 6.12e). The expression was also strong at 7 dpi in both marker lines (Fig. 6.12b, f). However, at 13 dpi the intensity of the GUS signal in the pLBD16::GUS galls decreased, with some galls no longer expressing GUS (Fig. 6.12c); yet, DR5-driven GUS expression remained strong at this timepoint (Fig. 6.12g). In completely expanded 21 dpi galls, we seldom observed any LBD16 expression (Fig. 6.12d); however, most 21 dpi galls in DR5::GUS remained GUS-positive (Fig. 6.12h). A comparative graph of the GUS-positive galls in both lines (Fig. 6.12k) shows that at 2 dpi all galls tested from both lines showed GUS staining, but the percentage of LBD16::GUS-positive galls dropped to 9% at 15 dpi, whereas DR5 expression was maintained until 29 dpi (80%), although with lower intensity than at early stages. A clear signal was observed in all cell types inside the vascular cylinder from the pericycle inwards in stained pLBD16::GUS gall sections, including the GCs at 4 dpi (Fig. 6.12i), which parallels the J0192>>GUS and J0192>>GFP lines (Fig. 6.11) and the DR5::GUS line at 4 dpi (Fig. 6.12k). Thus, pLBD16::GUS and DR5::GUS are expressed in Mj galls at early infection stages in the same gall tissues and cells; however, at medium-late infection stages, their activation patterns are different.

- 118 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.12. – LBD16::GUS and DR5::GUS activation patterns show strong similarities only at early infection stages. A-B. M. javanica galls from LBD16::GUS showed a strong stain in the centre of the gall at 3 and 7 dpi, respectively. C-D. Mj galls from LBD16::GUS at 13 and 21 dpi with a decreasing signal. E-F. Activation patterns of DR5::GUS auxin control at the early stages of infection (3 and 7 dpi). G-H. Activation patterns of DR5::GUS at medium-to-late stages of infection (13 and 21 dpi), a clear signal was still present in DR5::GUS (g, h) but not in LBD16::GUS (d). I-J. Representative semithin (2 µm) sections of 4 dpi galls from LBD16::GUS and DR5::GUS. K. A comparative graph of the positive galls in both lines shows that the percentage of LBD16::GUS (light green) positive galls dropped to 8% at 15 dpi and eventually to 0% at 21 dpi, whereas the GUS staining for DR5 expression (dark green) was maintained in over 80% of the galls until 29 dpi, dropping to 50% as late as 45 dpi. N= nematode; asterisks, GCs. Scale bars, 200 μm, except to i and j, 50 μm. Source: modified from Cabrera et al., 2014b. - 119 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Our results obtained with the DR5::GUS line and Mj are somehow contradictory to those of Karczmarek et al. (2004) with Mi, who showed that DR5 was active at very early stages (18-24 hpi) around the nematode head but decreased at 3-5 dpi and eventually disappeared from 10 dpi onwards. In our case, until late infection stages GUS signal was maintained (more than 29 dpi; Fig. 6.12k); this discrepancy could be due to the differences in the nematode species (Mi and Mj versus Ma) or experimental conditions. To rule out that GUS protein stability could influence our results transgenic lines carrying DR5::GFP were inoculated, because GFP has a shorter half-life than GUS (de Ruijter et al., 2003). Strong GFP fluorescence was detected at 11, 15, 21 and 29 dpi in the centre of the galls (Fig. 6.13a-h), which matches the GUS staining pattern achieved with the DR5::GUS line inside the vascular cylinder including the GCs (Fig. 6.13i-l). These results confirm that the galls formed by Mj in Arabidopsis contained auxins as late as 29 dpi, when the gall is completely

developed.

Figure 6.13. – The auxin sensor DR5 is active in galls during Mj life cycle. A-D. Confocal images of galls from the DR5::GFP line at 11, 15, 21 and 29 dpi, respectively. E-H. In vivo - 120 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

vibratome sections (70 μm) of galls embedded in agarose (5%) from the DR5::GFP line at 11, 15, 21 and 29 dpi, correspondingly. I-L. Semithin Technovit® longitudinal sections (3 μm) from the DR5::GUS line at 11, 15, 21 and 29 dpi. N, nematode; asterisks, GCs. Scale bars, 100 μm to A-D; 50 μm to E-L. Source: modified from Cabrera et al., 2014b.

In order to elucidate the putative role of LBD16 during the plant- nematode interaction, Mj nematode infection tests with different LBD16 loss-of- function lines were carried out (Fig. 6.14). Lbd16-1, a homozygous insertion mutant line that was characterized for LR formation (SALK_095791; Okushima et al., 2007), exhibited a significant reduction in the number of infections per root compared with Col-0 (Fig. 6.14a; 36%, P<0.05). Three independent 35S::LBD16-SRDX lines (Fig. 6.14b), containing the LBD16 coding sequence fused to the transcriptional repressor domain SRDX driven by the 35S promoter showed also a strong reduction (42-52%). The same protein fusion driven by the native LBD16 promoter showed a reduction in the infection rate slightly lower than lines with the 35S promoter, but significant (22%, Fig. 6.14c, P<0.05). Those successfully established nematodes in 35S::LBD16-SRDX lines formed galls with consistently less expanded GCs than in controls at 14 dpi (3- or 4-fold reduction in the mean total area occupied by the GCs; Fig. 6.14d-f; P<0.05).Therefore, the function of LBD16 is crucial for proper gall formation and GCs development.

- 121 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.14. – LBD16 function is crucial for gall development. A. The loss-of-function lbd16-1 mutant shows significant reduction in Mj infection rate compared with Col-0. B. Infection tests with three independent 35S::LBD16-SRDX lines showed a strong reduction as compared to Col-0. C. Infection tests with three independent lines of pLBD16::LBD16-SRDX showed a significant reduction as compared to Col-0. Statistical analysis was performed with three independent experiments per line; at least 60 plants per experiment using ANOVA and the Schefeé test, asterisks indicate significant differences (p<0.05), values are means ±SE. D. GCs average area 35S::LBD16-SRDX line, showing significant differences (*, p<0.05, n=20 sections of 2 µm from each of the lines tested) to Col-0. E-F. Representative semithin (2 µm) sections of 14 dpi galls from Col-0 (e) and the 35S::LBD16-SRDX line (f); N, nematode; GCs, asterisks. Scale bars, 50 μm. Source: modified from Cabrera et al., 2014b. - 122 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

PPNs transform host root cells into their feeding sites (Gheysen & Mitchum, 2011). H. schachtii select a single procambial or pericycle cell to initiate their syncytia in Arabidopsis roots (Golinowski et al., 1996; Sobczak et al., 1997). No such certainty exists for the ontogeny of RKNs galls and GCs, although root pericycle and cortical cells proliferate around the nematode, contributing to the formation of galls (Berg et al., 2008). Division of pericycle cells is necessary for LRs formation, where LBD16 participates in the auxin- signalling cascade leading to the division of specific XPP cells to form the new organ (Goh et al., 2012).

We have addressed the expression pattern and the functional role of LBD16 in galls. Our results confirm the importance of specific gene expression in the XPP for NFS formation, and identify one molecular component: the TF LBD16, involved in both LR formation and gall development following auxin responses (Figs. 6.11-6.14). Moreover, our findings showed the importance of LBD16 in early gall development, consistent with its role in LR and callus development (Cabrera et al., 2014b; 2015b). In this context, syncytia induced by CNs are also known to develop from pericycle cells (Golinowski et al., 1996, Sobczak et al., 1997) and auxins have also been shown to play a role during CNs infection (Goverse & Bird, 2011). Therefore, we analyzed the activation pattern of LBD16 and its putative function during infection with H. schachtii and their syncytium establishment. The 2500 bp LBD16::GUS line did not stain positively for GUS inside the feeding cells at any of the stages of syncytium development (Fig. S2a), nor during syncytium expansion (6 dpi; Fig. S2b), or in a well-established syncytium (11 dpi; Fig. S2c). However, this line showed clear GUS staining in the LRP in the same roots, as expected (Fig. S2a, b arrows). In agreement with this result, three independent 35S::LBD16-SRDX lines showed no differences in the infection rate by H. schachtii compared to Col-0 (Fig. S2d). Thus, the lines with the most severe phenotype during RKNs infection (Fig. 6.14b) did not show any significant effect on CNs; suggesting

- 123 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

that pericycle molecular components other than LBD16 participate in syncytia formation.

LBD16 is specifically expressed in the LRP only during the early stages of development and is regulated by auxins (Laplaze et al., 2005). In plants infected with Mj, LBD16 expression was detected very early after infection, 2 dpi up to 11–15 dpi (Figs. 6.11 & 6.12), and was regulated by auxins in galls as shown by its inhibition by PEO-IAA, an auxin antagonist that inhibits the auxin- signalling pathway by binding to the SCFTIR1/AFBs ubiquitin-ligase complex (Fig. S1). This regulation is similar during LRP formation (Okushima et al., 2007; Lee et al., 2009; Cabrera et al., 2014b). Although LBD16 promoter expression at early stages of infection seems to correlate with the presence of auxins in the same cell types, as shown by the DR5::GUS line, at later stages the mere presence of auxins in the gall was not sufficient to activate LBD16 expression (Figs. 6.11-6.13; Cabrera et al., 2014b). These results may indicate the necessity for a threshold level of auxins in the gall to allow LBD16 expression, which would mimic the scenario that occurs during the first divisions of LR development. In this context, it is possible that nematode secretions directly or indirectly activate XPP cells to start proliferation, as they appear on both sides of the vascular cylinder upon Mj infection. Support for this comes from the irregular cell divisions observed in developing galls of the J0192>>GFP line (Fig. 6.11; Cabrera et al., 2014b). Furthermore, overexpression of CLE peptides in Arabidopsis caused strikingly irregular anticlinal divisions (symmetric and asymmetric) in the pericycle (Meng et al., 2012) and the establishment of asymmetry in Arabidopsis LR founder cells is regulated by LBD16 and other LBD proteins (Goh et al., 2012). Thus, RKNs might interfere with these mechanisms for gall formation. LBD16 is described as a key regulator in the auxin-signaling pathway leading to the formation of new LRs (Okushima et al., 2007).

- 124 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

As we have pointed before, the involvement of auxins in NFS development is broadly accepted (Goverse & Bird, 2011). The activation of the DR5 based sensor is very high in early GCs, as brief incubation with the GUS substrate in conditions where diffusion is minimized produces a clear and strong signal specifically within the GCs (Fig. 6.12) until the late stages (45 dpi) of Mj and Ma infection (Cabrera et al., 2014b). These results suggest a putative role for auxins not only during the initial infection stages (nematode establishment) but also in feeding site maintenance. Some genes induced in NFS until late infection stages contain auxin response cis-elements in their promoters (Wang et al., 2008; Karczmarek et al., 2008; Wieczorek et al., 2008; Swiecicka et al., 2009). Most of the relevant studies related to the role of auxin in NFS formation were performed using CNs and were focused on alterations in auxins transport (Goverse & Bird, 2011; Absmanner et al., 2013). However, auxin transduction pathways that trigger the activation of nematode-induced genes have been scarcely studied. An exception is a member of the TF family WRKY (WRKY23). The response of WRKY23 to auxins is controlled by the Aux/IAA protein SLR/IAA14 (Grunewald et al., 2008). Its transcription is induced by both RKNs and CNs, and loss-of-function wrky23 mutants were more resistant to infection by CNs (Grunewald et al., 2009a).

The expression patterns of crucial molecular components of the auxin- signalling pathway (ARFs family) have been recently studied during syncytium development in Arabidopsis (Hewezi et al., 2014). At early infection stages, 2– 3 days after H. schachtii infection, ARF3, 6, 10–12, 14, 15 and 20–22 are expressed inside the developing syncytium. ARF1, 2, 4, 5, 9, 18 and 19 are active in both the syncytial and neighbouring cells. ARF7 and 17 are mainly expressed at the edge of the syncytial and neighbouring cells. ARF8 and 16 show a weak response to H. schachtii infection. Suppression of components of the auxin-signalling pathway mediated by ARFs, such as AXR/IAA7, resulted in a reduction in the number of developing CNs (Goverse et al., 2000). All these data suggest a subtle and complex regulation of auxin-mediated pathways - 125 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

based on a tight temporal and spatial control of molecular components such as ARFs in CNs feeding sites. However, a lack of knowledge of the regulation of these genes after RKNs infection is still faced.

Finally, the transcriptomes of root cell types similar to developing galls were those of LR initials and quiescent center cells (Fig. 3.3b). These genes have varied functions, as cell cycle regulation and cytoskeleton or cell wall remodelling (de Almeida-Engler & Favery, 2011); some are TFs, i.e., H. SCHACHTIIFB4, characteristic of the quiescent center transcriptome (Cabrera et al., 2014b). Other genes related to cell wall relaxation, as the expansin AtEXPA6 induced in galls and GCs in transcriptomic analyses and validated by q-PCR (Barcala et al., 2010), are also characteristic of the LRP (Fig. 3.3a). Additionally, the resistance to Mi of the auxin-insensitive tomato mutant diageotropica (dgt) (Richardson & Price, 1982), which lacks LRs, as well as the similarities in the expression of plant TFs (e.g. Medicago truncatula homologues to PHANTASTICA and Class I knotted, Mt-phan and Mt-knox-1, respectively) and cell cycle regulators during the development of galls, LRs and rhizobia-induced nodules have pointed a correlation between these processes (Goverse et al., 2000; Hassan et al., 2010; Sozzani et al., 2010; Boivin et al., 2016). Moreover, 39 out of 103 promoter tag lines displaying a distinct response to nematode infection also exhibited activity at LR initiation sites (Barthels et al., 1997). As a final point, molecular confirmation of this parallel is inferred from the analysis described in the present section centered in the role of LBD16 in galls. All these data reinforce the similarity between gall and LRP development at early stages. Therefore, we decided to study representative LR transducers during early stages of LR formation, particularly those regulated by auxins, and test their putative role during Meloidogyne spp.- induced gall/GCs development (see following section).

- 126 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Genes involved in lateral root formation play a crucial role during gall development induced by Mj in Arabidopsis thaliana roots

Most of the genes described in different modules mediated by auxins crucial for LR development (Dastidar et al., 2012) were tested during RKNs infection for their expression and function. After analysing their transcriptomic profiles from two different transcriptomic datasets of galls and laser microdisected GCs (Jammes et al., 2005; Barcala et al., 2010; this Thesis, section 3.2.1), throughout NEMATIC in silico tool developed by Cabrera et al. (2014a) (see at http://www.uclm.es/grupo/gbbmp/english/nematic.asp) we obtained the profiles summarized in Fig. 6.15. Some of these representative genes were also studied at the promoter activation level by using promoter- gene reporter GUS lines (Figs. 6.16-6.19) to determine the spatiotemporal induction pattern.

The ARF7 and ARF19 promoter lines were activated in the galls at 3, 7 and 14 dai (Fig. 6.16d-f & 6.16g-i, respectively) as indicated by the ARF7::GUS and ARF19::GUS lines. The signal was distributed in the whole gall tissues with no specific signal related to the nematode establishment (Fig. 6.16d-i). ARF7 gene was not differentially expressed on the transcriptomic analysis in any of the infection points tested; however, ARF19 gene was induced only in GCs at early infection times, 3 dpi (Fig. 6.15c).

- 127 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.15. – Transcriptomic profiling of lateral root auxin-responsive genes (LRAG) after nematode infection. A. Diagram of Arabidopsis LRP formation during the first three stages of development (arrows: preinitiation, initiation and growth). The different cell layers are represented: epidermis (yellow), cortex (orange), endodermis (blue), pericycle (green), stele (white) and LRP (red). B. Scheme of the auxins signalling cascade leading to the LR formation according to Dastidar et al. (2012) with the genes described. It has been also added the SKP2B gene (Manzano et al., (2012)). In blue shading, modules analysed in plant-nematode interaction. C. Transcriptional profiling of LRAG in GCs at 3 dpi and galls at 3 and 7 dpi according to Cabrera et al., 2014a. Induced genes (red); repressed (green); and UD-non-differentially expressed (white) as compared to control non infected roots. - 128 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

In contrast, ARF5/MP::GUS signal was intense and centred within the gall (Fig. 6.16a-c). This strong GUS signal is also consistent to the high expression levels observed in laser microdissected GCs after transcriptomic analysis at 3 dpi and also in galls (Fig. 6.15c). GUS signal decayed from 3 dai and it was almost abolished at medium infection stages (7 dai; Fig. Fig. 6.18d; Fig. 6.16 a, b, c) what indicates that its activation takes place very early after nematode infection. Similarly, the promoter of GATA23 is clearly activated from very early infection stages (1 dai) up to 21 days (Fig. 6.16j,k & 6.18c), although its transcripts do not accumulate in galls (Fig. 6.15c). The SKP2B promoter was tested in two different versions, one with 1700 bps (SKP2BL::GUS) that contains two Auxin Responsive Elements (AuxRE); and a shorter version of 500 bps (SKP2BC::GUS) that contains only one AuxRE (Manzano et al., 2012) and specifically drives the expression in LRP because it contains a Lateral Root Expression Domain (LRED; Manzano et al., 2012). In both cases, it was induced in scattered cells as shown by its patchy pattern at early infection stages (Fig. 6.17d-i). Interestingly, the induction pattern of ProCycB1;1:CycB1;1(NT)-GUS, clearly mimics that of the SKP2BC, showing also a dotted GUS expression, indicative of signal in scattered cells that was observed very early during the stablishment and only maintained up to 3 dai (Fig. 6.17j-l & 6.18e). Therefore, G2 to M phase is very active in small grous of cells at very early infection stages (earlier than 3 dai), but it is very scarce beyond this. It is thus probable that cell division contributes to gall development at early infection stages, but expansion of the GCs, as well as hypertrophy (caused by endoreduplications without mitosis; reviewed in de Almeida-Engler et al., 2015) of some other cells might greatly contribute to gall girth at later stages (Jones & Goto, 2011). Additionally, the promoter of IAA28 was activated at 3 dai (Fig. 6.17a) with a pattern similar to SKP2B, as it had a scattered signal and was not detected beyond 7-14 dai (Fig. 6.17b-c), but its transcript accumulation pattern does not seem to parallel its promoter activation (Fig. 6.15c). Thus, IAA28 and SKP2B seem to have an activation

- 129 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

pattern that highly correlates to that of the G2/M phase marker line (Figs.17 & 18; Manzano et al., 2012; Nayeri et al., 2014).

Figure 6.16. – Activation patterns of promoter::GUS LRAG lines after Mj infection. A-L. Representative images of ARF5/MP::GUS (a-c), ARF7::GUS (d-f), ARF19::GUS (g-i), and GATA23::GUS (j-l) reporter lines in Arabidopsis galls induced by Mj at 3, 7 and 14 dai, respectively. The lines ARF5/MP::GUS and GATA23::GUS presented GUS signal within the galls at early stages of infection (3 dai); however, GUS signal was diffuse for ARF7::GUS and ARF19::GUS. Scale bars, 500 µm. At least 40 galls per time point and line were analysed. - 130 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.17. – Activation patterns of promoter::GUS LRAG lines after Mj infection. A-L. Representative images of IAA28::GUS (a-c), SKP2BL::GUS (d-f), SKP2BC::GUS (g-i), and ProCycB1;1:CycB1;1(NT)-GUS (j-l) reporter lines in Arabidopsis galls induced by Mj at 3, 7 and 14 dai, respectively. All lines presented patched or scattered GUS signal within the galls at early stages of infection (3 dai) that fades into middle-late stages of infection (7-14 dai). Scale bars, 500 µm. At least 40 galls per time point and line were analysed. - 131 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Moreover, according to our results of LBD16 obtained by Cabrera et al. (2014b), we decided to extend the study on other members of the LBD gene family involved in LR development (Goh et al., 2012) and analyse their putative role during the establishment and development of galls induced by Mj. All of them are genes encoding TFs acting downstream in the transduction cascade proposed for LR formation (Fig. 6.15a,b; Dastidar et al., 2012). As we can see in the Figure 6.19, only the LBD33::GUS line presented GUS signal at 3-7 dai within the gall. These results complemented our previous transcriptional studies (Fig. 6.15c) where LBD33 was induced in galls at 3 dpi (Fig. 6.15c) as compared to control non-infected roots, similarly to its promoter activation (Fig. 6.19g-i). Both LBD18::GUS and LBD29::GUS, showed neither induction in transcriptomic analysis nor expression in promoter GUS lines (Fig. 6.15c & 6.19a-f).

In summary, for some tested genes the expression data from microarrays (Fig. 6.15c) were consistent with their promoter activation patterns (Figs. 6.16-19) (i.e. ARF5/MP, ARF19, LBD18, LBD29 and LBD33), but in some cases, differences were encountered (i.e. IAA28, ARF7, GATA23 and SKP2B). Several explanations are possible; one is that the control material used for reference in the microarrays could contain some LRP founder cells, and differences in the transcripts accumulation in some cases were not so high when we compared to the galls, as most of the genes are expressed in LRPs. Another explanation could be that the statistical analysis of the microarrays use parameters quite restrictive to consider significant differences (Barcala et al., 2010), but the GUS signal within the tissues is not restricted by mathematical analysis and is therefore more sensitive.

- 132 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.18 – Timecourse of GUS expression of some representative early induced LRAG lines during nematode infection. A-E. We have used an auxin response factor (ARF5/MP::GUS), a downstream LR transcription factor (GATA23::GUS), a LR founder cell marker related to cell cycle regulation, SKP2B::GUS (short (SKP2BC::GUS) and long (SKP2BL::GUS) version) and a cell cycle G2/M marker line (ProCycB1;1:CycB1;1(NT)- GUS). The timecourse of LRP reporter lines in Arabidopsis galls induced by Mj were analysed from 1 to 29 dai. At least 40 galls per time point and line were considered.

- 133 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.19. – Activation patterns of LBDs::GUS lines after nematode infection. A-I. Representative images of the induction patterns of LBD18::GUS (a-c), LBD29::GUS (d-f), and LBD33::GUS (g-i) reporter lines in Arabidopsis galls induced by Mj at 3, 7 and 14 dai as indicated. J. The percentaje of blue galls (j) was scored over a timecourse for the same reporter lines in Arabidopsis galls induced by Mj at 3 (in blue shading), 7 (red) and 14 dai (green). At least 10 galls per time point and line were analysed for blue signal. Only the LBD33::GUS line presented GUS signal within the galls at early stages of infection (3-7 dai) that fades at medium- late stages of infection (14 dai). Scale bars, 200 µm. - 134 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

However, it is also possible that those genes showed a different regulation of the transcript level abundance, as compared to their promoter activation in galls. In any case, most of the promoters tested, particularly those driving gall-centered expression, showed a clear correlation to that of the DR5::GUS expression pattern at early infection stages (Fig. 6.12). Nevertheless, DR5::GUS signal was on until late stages of the development, although the signal looked weaker at late infection stages (21-29 dpi; Fig. 6.13k,l). This suggested that it is necessary an auxin threshold for the activation of those promoters in galls what is consistent with the GUS activation patterns of most of the LRP signal markers, which vanished at 3-7 dai (i.e. SKP2B and ARF5/MP; Fig. 6.18 a,b,d). This is similar to that occurring during LRP formation (Eckardt, 2009; De Rybel et al., 2010; Yadav et al., 2010). Interestingly, the activation patterns of two of the genes, IAA28 and SKP2B, were highly in concordance to that of the G2/M phase transition marker line ProCycB1;1:CycB1;1(NT)-GUS, with a scattered expression in particular cells or groups of cells within the vascular tissue of the gall. These suggest that small groups of cells are activated to initiate mitosis in very young galls and that two genes involved at very early phases of LRP formation (Fig. 6.15a,b), expressed in LR founder cells are also activated in those cells. This brings the idea that the nematodes could be triggering the initiation of several groups of gall/GCs founder cells-like at early stages of infection within the vascular tissue of the roots.

In order to explore the role of LR marker genes during gall/GCs formation after RKNs infection, we tested loss of function lines for most of the former analysed genes that showed a clear induction in galls at different

developmental stages.

- 135 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.20. – Function of LRAG lines after Mj infection. A. Diagram of the auxins signalling cascade leading to the LR formation according to Dastidar et al. (2012). The SKP2B gene has also been added (Manzano et al., (2012)). B. In vitro infection tests of upstream genes in the auxin signalling cascade leading to LR formation; iaa28 and its control, WS; slr-gain of function, slr-loss of function, bdl-2-Col-0, skp2bL and Col-0 control. C. In vitro infection tests of ARFs genes as arf7-arf19; and nph4(arf7)-arf19 double mutants; arf6-/8+ mutant and Col-0. D. In vitro infection tests of loss of function lines for LBDs lines as pLBD16:LBD16-SRDX; lbd16 and lbd18 singles; lbd16-lbd18 double; lbd16-lbd18-lbd33 triple; LBD29-SRDX(lbd16); and GATA23::RNAi. Controls, WS and Col-0, as indicated (in red). In blue, green and yellow shading, analysed genes corresponding to their different auxin-cascade LR levels (upstream (blue), middle stream (green) and downstream genes (yellow)). At least 120 plants per line were analysed. Asterisks, significant differences (t-Student; p<0.05).

When LRAG loss of function lines were infected in vitro with Mj J2 juveniles, all of them presented a reduction in the infection of at least 10% (Fig. 6.20b-d). Mutants that showed no significant resistant phenotype were slr-loss

- 136 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

of function (11% increase as compared to the control); double mutant nph4(arf7)-arf19 (3% increase), arf7-arf19 (7% reduction); and triple mutant lbd16-lbd18-lbd33 (9% reduction). Nevertheless, the line bdl-2-Col-0 single (71% reduction; p<0.05); slr-gain of function (55% reduction; p<0.05); LBD29- SRDX (lbd16) (45% reduction; p<0.05); and lbd16-lbd18 double (43% reduction; p<0.05) were severally affected and showed significant differences to that of the wild type. We also studied reproductive parameters in soil, by inoculating LBD mutant lines in pots (in collaboration with Dr. Maria Fe Andrés; CSIC, Madrid) (Fig. 6.21). The reproductive parameters were intensely affected on LBDs mutant lines (p<0.05) with significant differences respect to control lines; as a reduction in the number of eggs per plant and weight up to 91%, e.g., in the lbd16-lbd18-lbd33 triple mutant (Fig. 6.21a) and in the number of viable females up to 62% (Fig. 6.21d). The eggs number was also reduced in the rest of the LBDs mutant lines with an average of 55% reduction versus Col-0 (Fig. 6.21b,c). These results confirmed our hypothesis that nematodes partially hijack LR transduction routes in Arabidopsis (Cabrera et al., 2014b; this Thesis; Díaz-Manzano et al., 2017b).

However, it is important to highlight that the percentage of galls per main root showed no significant differences in the ARFs lines (arf7-arf19 and nph4(arf7)-arf19) and LBDs triple mutant (lbd16-lbd18-lbd33). Nonetheless, in soil, differences in the reproductive parameters for the line lbd16-lbd18-lbd33 were remarkable and significant. Regarding ARFs double mutants, it is described that arf7-arf19 has few LRs (Okushima et al., 2005) and arf7 and arf19 mutations are epistatic to lbd16-1, consistent with the model that ARF7 and ARF19 redundantly regulate LR formation via LBDs action (Okushima et al., 2007; reviewed in Fukaki & Tasaka, 2009). Moreover, it has been established that both ARFs are crucial in the LR initiation module (nuclear polarization) through activation of the plant-specific transcriptional regulators of the LBDs family (LBD16, LBD18 and LBD29; Dastidar et al., 2012).

- 137 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Additionally, Goh et al. (2012) described that a promoter marker line of XPP cells (J0121) fused to LBD16 in the ARFs double mutant background (J0121>>LBD16/arf7-arf19) developed LRs, indicating that targeted expression of LBD16 in XPP partially rescues the ability to form LRs in the arf7-arf19 double mutant. Therefore, LBD16 is downstream of ARF7 and ARF19 for LR formation (initiation zone, Fig. 6.15b). This does not seems the case during gall development, as RKNs infected normally arf7-arf19 double mutant plants, what is consistent with the GUS promoter expression pattern of both genes after nematode infection in galls, not distinguishable from the rest of the root, neither centered in the gall (Figs. 6.16d-i & 6.20c). Thus, it seems that RKNs, as mentioned before, share only partially LR formation pathways, but not totally. It is possible that other ARFs could be mediating LBD16 activation in galls, such as ARF5/MP, whose promoter showed a clear signal centered in the gall (Fig. 6.16a,b) and its transcripts accumulated highly in GCs (i.e. 3 dpi = 4.1; Fig. 6.15c). In this respect, it is important to point that arf6-/8+ mutant was severely resistant to nematode infection. ARF6 and ARF8 auxin response factors play important roles during fruit development in Arabidopsis activating the expression of a miR172-encoding gene to promote valve growth (Ripoll et al., 2015). Thus, putative ARFs participating on the partial LR cascade used by nematodes in galls could be ARF5/MP, ARF6; and/or ARF8. Alternatively, nematodes could be bypassing ARFs signalling to directly or indirectly regulate LBD16. Some ways to modulate those processes could be by modifying plant cell polarity and/or auxins pattern balance in the root through PIN conveyors (PIN4) at early stages (Bhatia et al., 2016; Kyndt et al., 2016); being crucial for gall and LR formation (Cabrera et al., 2015b); or inducing auxin efflux and influx carriers (PIN3 and LAX3) that are regulated indirectly by ARF7, also activated in galls (Fig. 6.16d) (LAX3; Porco et al., 2016).

In conclusion, mutants of either upstream crucial genes for LR formation, such as IAA28 or IAA14, IAA12 (iaa28, slr and bdl-2-Col-0;

- 138 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

respectively) or downstream as GATA23 and LBDs, showed a decrease in the number of galls per main root, reaffirming the idea presented in this Thesis about the important role of LR modules mediated by auxins in the formation of NFS induced by Meloidogyne species (Fig. 6.20). Finally, soil test analysis of reproductive indexes on LBD mutant lines (Fig. 6.21) reaffirmed the role of LBDs in the maintenance of the NFS induced by Mj, what is consistent with in vitro results obtained in this Thesis (Fig. 6.20) and those described by Cabrera et al. (2014b). However, the triple mutant (lbd16-lbd18-lbd33) did not show a reduction of the infection parameters, but a strong decrease of reproduction rates as compared to the control. This might suggest a putative role of LBD33 during GCs development and maintenance that may affect the reproductive capability of RKNs females, more than a role during nematode establishment during the first steps of a gall formation. In this respect, it has been described that the non-emerged LRP density (number of non-emerged LRP per primary root) of lbd16-lbd18-lbd33 triple mutant was higher than that of Col-0 although the final number of emerged LRs was lower than in the WT (Goh et al., 2012). In this context, gall formation is directly related to a crucial founder cells marker (LBD16, Cabrera et al., 2014b). Hence, the largest number of non-emerged LRP in the triple mutant might correlate with the ability to induce galls from a higher number of founder-cells like; what would explain that the triple mutation had no effect on the infection rate with values even slightly higher than the wildtype (Fig. 6.20d). In future work, It will be necessary to phenotype the GCs of this line in order to clarify whether GCs expansion or development is affected in this mutant, what could be directly related to the decrease in the reproduction rate of the nematodes.

- 139 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.21. – Reproductive parameters in LBDs mutant lines in soil tests. A. Infection tests of lbd16 and lbd18 singles; lbd16-lbd18 double; lbd16- lbd18-lbd33 triple; LBD29-SRDX(lbd16) SRDX line; and Col-0 as a control. The number of eggs per plant and weight were lower in all LBDs lines than Col-0. B. Total number of eggs obtained per female and line. C. Total number of eggs attained per egg masses and line. D. Number of viable females i.e., number of females counted at the end of the reproduction tests respect to the initial inoculum per line (survivability). At least 50 plants per line were analysed. Asterisks, significant differences (t-Student; p<0.05). - 140 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Do nematodes recruit LRP for the formation of their galls/GCs?

Nematodes modify the balance of cell auxins transport in the plant root through PIN conveyors at early stages of GCs development (Grunewald et al., 2009a; Kyndt et al., 2016). It has also been described that nematode secretions contain primary effector molecules (auxins) stimulating GCs formation (Berg et al., 2008); the local auxins accumulation could also be due to the formation of a new cell type in plant roots, the primary feeding site (Gheysen & Mitchum, 2011). At any rate, the presence of an auxin maximum and the involvement of a functional auxin perception module through the synthetic sensor (DR5) during gall establishment has been demonstrated (Karczmarek et al., 2004; Cabrera et al., 2014b; Fig. 6.12e-h).

Auxins are also crucial for LR formation at early stages. In fact, exogenous auxins treatment increases the number of LRP (Lavenus et al., 2013). Nematodes might alter pre-existing developmental pathways modifying auxins levels, e.g. those that originate LRP, to induce their feeding cells (reviewed in Escobar et al., 2015); however, how nematodes interfere with the LR transduction cascades mediated by auxins it is not known. Our hypothesis is that RKNs partially hijack some components of the LR formation transduction cascades, such as LBD16 and other genes described in the former section, but they do not compromise LR formation from the basal meristem. Instead, nematodes might be able to induce new founder-like cells, as those expressing LBD16 that probably develop into GCs (Cabrera et al., 2014b; this Thesis; Díaz-Manzano et al., 2017b).

- 141 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.22. – Number of total LRP initial cells and LRP expressing GUS for the SKP2BL::GUS line after Mj inoculation. A. Number of total blue LRP initials per treatment. The number of primordia considering those plants with galls only (in blue colour) was lower than the control (in red) during the first 24-72 hpi (p<0.05). B. Percentage of total primordia, showing the same tendency as in A. At least 80 plants per time point were analysed. UI, uninoculated plants (in red); TI, total plants inoculated (with or without gall, in green); G, only plants with galls (blue); GP, G plants considering the gall as LRP (yellow); HPI, hours after inoculation. Asterisks, statistically significant differences (t-Student; p<0.05). - 142 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Thereby, we performed infection tests with Mj in an LRP founder cell marker line, SKP2BL, early expressed in galls (Fig. 6.17d), whose pattern highly correlates with the G2/M phase entry and it also labels those initial cells suffering the first anticlinal division to originate the LRP (see point 5.1.5; Fig.6.16; Manzano et al., 2012; De Smet et al., 2015). We categorized plants into four classes and scored in each class the number of marker-expressing cell groups (LRP): un-inoculated plants (UI); total plants inoculated (with or without gall) (TI); plants with only galls (G); and plants with galls plus LRP (GP). We scored for the number of LRP expressing GUS at 5 dag. We obtained that the total (absolute) number of LRP (regardless root length) was lower in all treatments (TI, G and GP) than in the uninoculated control (UI) at 24-72 hpi (Fig. 6.22) with significant differences in the plants with galls (G; p<0.05).

- 143 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.23. – Root length in SKP2BL::GUS line after Mj inoculation. A. Number of total cm per treatment. The number of cm considering those plants with nematodes, total inoculated and plants with galls were lower than the control during the first 12-72 hpi. B. Percentage of cm, showing the same tendency as in A. At least 80 plants per time point were analysed. UI, uninoculated plants (in red); TI, total plants inoculated (with or without gall, in green); G, only plants with galls (blue); HPI, hours after inoculation. Asterisks, statistically significant differences (t-Student; p<0.05).

- 144 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

From the absolute data, we could suspect that nematodes might be recruiting founder cells of LRP for the formation of their NFS. However, we also observed that the length of the roots varied between treatments (lower in those with nematodes inoculated; Fig. 6.23). Hence, we decided to standardize it based on the existing literature by root centimeter (cm) (Goh et al., 2012). The number of primordia per cm of root length in infected plants with galls (with nematodes inside) was not different to that of the controls (in blue, Fig. 6.24) respect to their control (in red, Fig. 6.24) at 12-24 hpi. None of the treatments showed differences with the controls, except when the galls as a LRP were scored (in yellow; Fig. 6.24). Thus, after normalizing the data per root length and comparing all plant types no significant differences were encountered. In this framework, our data indicate that nematodes do not affect the number of LRP initiation sites after infection and therefore, they do not recruit LRP founder cells for the formation of their feeding sites (galls/GCs). Furthermore, considering the auxin maxima at early stages of infection, identified with the DR5 sensor (Figs. 6.12 & 6.13), and the activation of LRAGs (Figs. 6.16-6.19); it is conceivable that RKNs trigger a local increase in auxin concentrations either directly through effectors from their esophageal glands, or modifying PINs conveyors (Gheysen & Mitchum, 2011; Kyndt et al., 2016; Lavenus et al., 2016). Nematodes are known to produce auxin compounds (De Meutter et al., 2005; Goverse & Bird, 2011) that could be released directly into the root tissues via apoplast (through the cell wall) and/or cell‐to‐cell (via symplastic- cytoplasm) causing local auxin maxima (Petrášek & Friml, 2009). Our data (Figs. 6.22 & 6.24) support that this process could be at least partially independent of the endogenous auxin maxima generated for LR formation in the basal meristem (Moreno-Risueno et al., 2010). In addition, it has been described that local auxin maxima at the root tip induces changes in the surface cuticle and behaviour of Meloidogyne spp., increasing stylet thrusting (repulsion/retraction of the stylet) and motility (Curtis, 2007).

- 145 -

Results and Discussion: A Comparative Study Of Lateral Root Formation And Galls/GCs

Figure 6.24. – Number of LRP initials expressing GUS of SKP2BL::GUS after Mj inoculation per root lenght. A. Number of primordia per cm. The number of primordia considering the gall as an LRP (in yellow colour) was higher than the control (in red) during the first 12-48 hpi. B. Percentage of primordia by root centimeter. Data were similar to A. At least 80 plants per time point were analysed. UI, uninoculated plants (in red); TI, total plants inoculated (with or without gall, in green); G, only plants with galls (blue); GP, G plants considering the gall as LRP (yellow); HPI, hours after inoculation. Asterisks, statistically significant differences (t- Student; p<0.05).

- 146 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

6.5. - THE GENE REGULATORY MODULE MIRNA172/TOE1/FT IS ACTIVE IN THE FEEDING SITES INDUCED BY MELOIDOGYNE JAVANICA IN ARABIDOPSIS AND HAS A ROLE DURING THE GALL AND GIANT CELLS DEVELOPMENT In the last decade, major advances have been made to understand the molecular mechanisms underlying the formation of the gall/GCs. Interestingly, genes previously defined to have key functions in plant developmental pathways also showed a role during gall/GCs development in Arabidopsis (reviewed in Cabrera et al., 2015c). Some of them are transcription factors participating in root development, e.g. LBD16 or WRKY23 that are also crucial during the CNs and RKNs interaction in syncytia and gall and/or GCs development (Grunewald et al., 2008; Cabrera et al., 2014b, respectively). Moreover, small signaling peptides such as CLAVATA3/ESR (CLE)-like or C- TERMINALLY ENCODED PEPTIDEs (CEP) peptides that participate in root and shoot apical meristem maintenance, vascular development and lateral root formation (Mohd-Radzman et al., 2016; Yamaguchi et al., 2016), were identified in RKNs secretions (Betsuyaku et al., 2011; Mitchum et al., 2012; Bobay et al., 2013). The role of CLE-like peptides have been studied more deeply in CNs than in RKNs. One of the most recent studies indicates a clear link between nematode B-type CLE signaling and the WOX4-mediated cell proliferation pathway for feeding cell formation (Guo et al., 2017). In this respect, 16D10 is a secretory peptide with a CLE-Like sequence identified in Meloidogyne spp., with a role during the RKN interaction (Huang et al., 2006). Hence, one of the putative strategies used by RKNs to differentiate their specialized feeding sites is to hijack or interfere with established plant developmental pathways to induce the formation of their feeding sites (Cabrera et al., 2015c).

Several transcriptomic analyses of galls and/or GCs induced by Meloidogyne spp. in a number of plant species have been performed,

- 147 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

delivering extensive lists of mis-regulated genes (up-regulated or down- regulated) in the nematode galls and GCs (Cabrera et al., 2016b). Interestingly, a conspicuous trait that prevails in all these studies is the large number of significantly down-regulated genes, particularly at early infection stages (Barcala et al., 2010; Damiani et al., 2012; Portillo et al., 2013). Therefore, gene repression can be considered a signature for proper nematode establishment and feeding site formation. In line with this, the overexpression of the repressed gene TPX1 in tomato caused a reduction in the infectivity and in the size of the GCs (Portillo et al., 2013). Similarly, in CNs, the overexpression of the repressed gene RAP2.6 led to an enhanced resistance against H. schachtii and to smaller feeding cells in Arabidopsis (Ali et al., 2013). Bearing in mind the putative role of gene repression, changes in the sRNAs population in the feeding sites induced by RKNs and CNs have been studied by high-throughput sequencing (Hewezi et al., 2008; Li et al., 2012; Xu et al., 2014; Zhao et al., 2015; Cabrera et al., 2016a). However, we have just started to delineate the functional role of sRNAs and their targets during the nematode infection. Evidence showed that miR396 and its GRFs target genes participate in the regulation of a large number of genes in the CNs nematode feeding cells (Hewezi et al., 2012; Hewezi & Baum, 2015). Similarly, Hewezi et al. (2016) demonstrated that the miR827 and its target gene NLA (NITROGEN LIMITATION ADAPTATION) had a role in mediating the infectivity of H. schachtii. Furthermore, Arabidopsis loss of function lines for the module miR390/TAS3/ARFs displayed a decrease in the infectivity and smaller galls during RKNs infection (Cabrera et al., 2016a) and in situ localization of miR390 in tomato indicated accumulation of miR390 in galls/GCs (Díaz-Manzano et al., 2016a) what suggest conserved roles in tomato. Additionally, miR319 and its target gene TCP4 regulate the systemic defense response during RKN infection in tomato (Zhao et al., 2015).

The riboregulator miR172 post-transcriptional targets a small group of AP2/EREBP regulatory repressor genes (AP2, TOE1,2,3, SNZ and SMZ); it - 148 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

has been previously studied because of its key role in controlling plant aging, flowering time, tuber formation and fruit growth (Martin et al., 2009; Zhu & Helliwell, 2010; Yan et al., 2013; Wang et al., 2014; Ripoll et al., 2015). Our investigations show that the miR172-dependent regulatory module miRNA172/TOE1/FT is active and de-regulated in the feeding sites induced by Mj in Arabidopsis roots, and also participates in gall and GCs development. This study adds knowledge on how RKNs interfere with endogenous developmental pathways and contributes to a better understanding of the molecular signatures associated to nematode feeding cells development.

Results

Repression of TOE1 in galls and GCs induced by Mj in Arabidopsis is necessary for the correct progression of the infection and the development of the feeding sites

Firstly, we corroborated by qPCR that TOE1 expression was two-fold down-regulated in galls induced by Mj in Arabidopsis at 3 dpi (days post infection; Fig. 6.25b), in line with the results obtained in previous microarray experiments (Barcala et al., 2010). TOE1 expression is regulated by miR172 during the floral transition (Zhu & Helliwell, 2010). Consistent with this observation and the down-regulation of TOE1, pri-miR172d expression was clearly induced in the same microarrays of micro-dissected Arabidopsis GCs as compared to vascular control cells (Barcala et al., 2010). Hence, we generated four independent transgenic lines overexpressing a modified version of TOE1 resistant to the degradation by miR172 (35S:TOE1R; Fig. 6.25c). All these lines (A12, D81, E82, G73) showed a noticeable increase in TOE1 transcripts abundance as compared to the Col-0 WT line, although there were differences in the expression levels among lines (Fig. 6.25c). As we expected by the described role of TOE1 as floral repressor in Arabidopsis (Zhang et al., 2015), all four 35S:TOE1R lines showed a conspicuous delay in flowering time (p<0.05) under SD conditions, while two of them (A12 & D81) flowered - 149 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

significantly late under LD (Fig. S8c). When we challenged these 35S:TOE1R plants with juveniles of Mj, all independent lines showed a significant reduction in the percentage of galls per plant in the range of 15% to 44% (Fig. 6.25d). Remarkably, the flowering phenotype was correlated with the nematode resistant traits, as those lines with the strongest flowering phenotypes also showed the highest reduction in nematode infection rates (see lines A12 & D81 in Fig. 6.25d and Fig. S8a,c,e).

Our next step was to characterize in more detail the gall/GCs phenotypes in the 35S:TOE1R lines with the most extreme phenotypic alterations (Fig. 6.25e-f). Galls of 35S:TOE1R lines were around 15% smaller than Col-0 at 14 dpi (Fig. 6.25e; p<0.05). In addition, the GCs formed in these galls at 14 dpi were reduced in size to two-thirds compared to those formed in Col-0 galls at the same infection stage (Fig. 6.25f-g; p<0.05), measured after 3D reconstruction following Cabrera et al. (2015a). Thus, we corroborated that down-regulation of TOE1 by miR172 in the GCs and galls induced by Mj in Arabidopsis is important for proper nematode establishment, and gall/GCs

development.

- 150 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

Figure 6.25. – TARGET OF EAT1 (TOE1) is involved in the RKN infection. A. Schematic representation of miRNA712c-d (GACGTCGTAGTAGTTCTAAGA) target sequence for TOE1 (CAGCAGCATCATCAGGATTCT)and TOE1resistant (CAGCAGCATCGTCGGGCTTCT). In red bold, non-matching base pairs; underlined, mutated TOE1 resistant base pairs respect to TOE1. B. Q-PCR analysis of TOE1 abundance in galls as compared to control un-infected root segments. TOE1 decreased two-fold in galls induced

- 151 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

by Mj. C. Q-PCRs of 35S:TOE1R lines of uninfected roots. The four lines showed higher TOE1 transcript abundance compared to their endogenous control Col-0. D. In vitro infection tests of four independent 35S:TOE1R lines challenged with Mj. The percentage of galls per main root was lower in all TOE1 lines than in Col-0. E. Galls diameter of 35S:TOE1R-A12 and 35S:TOE1R-D81. Both lines showed a smaller gall diameter than their control Col-0 at 14 dpi (P<0.05). A total of ±550 longitudinal sections (2µm thickness) from six galls at 14 dpi were processed. Gall diameters were measured from micrographs from each gall (n≥20 per line tested). F. GCs volume in 35S:TOE1R-A12 and 35S:TOE1R-D81 lines was smaller than that of Col-0 at 14 dpi (P<0.05). G. Representative pictures of 35S:TOE1R lines and Col-0 of Araldite® gall sections (2µm) at 7 dpi. Statistical analysis was performed with three independent experiments per line using t-Student, significant differences with Col-0 or corresponding controls are indicated by asterisks, P < 0.05; values are means ±SE. N, nematodes; Scale bars: 100 µm. GCs are labelled with a white asterisk.

FT, a defined target of TOE1, has a crucial role during gall development

It has been recently identified that the TOE1 regulatory protein directly binds to the promoter region of the gene FT and represses its expression in the vascular tissue of the leaves during the floral transition (Zhang et al., 2015). Previous results have shown that FT expression in roots is quite low (Bouche et al., 2016), and that the root-specific expression of FT is not enough to rescue the flowering time phenotype of the ft mutant. These observations indicate that the expression of FT in roots is not sufficient - albeit it might contribute – for the function of FT protein in the regulation of flowering (Abe et al., 2005).

Because TOE1 expression was repressed in 3 dpi galls induced by Mj in Arabidopsis (Fig. 6.26a), we checked by qPCR whether the expression levels of FT were altered after nematode infection in Col-0 roots (Fig. 6.26a). Interestingly, FT transcript levels were moderately increased in the galls while they were almost undetectable in the uninfected Col-0 control roots (Fig. - 152 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

6.26a). In contrast, FT expression in 35S:TOE1R lines were barely detectable either in control roots or in galls, similarly to the uninfected control Col-0 roots (Fig. 6.26a). This is consistent with TOE1R repressing the expression of FT in galls, what suggests that the down-regulation of TOE1 in galls probably mediates the accumulation of FT transcripts in those cells. This results showed the difficulty of FT transcripts detection (error bars prevented finding significant differences), in spite of performing three independent experiments with three biological replicates per line and gene studied.

To decipher the role of FT during the gall and GCs formation we performed six independent infection tests using a previously characterized complete loss-of-function FT mutant allele (ft-10) of Arabidopsis that displayed a late flowering time phenotype (Yoo et al., 2005). Mutant plants for FT showed a significant reduction in the number of galls, 24% compared with those formed in the wildtype plants (Fig. 6.26b), suggesting that FT function is required for the proper establishment of Mj in Arabidopsis. This idea is reinforced by the fact that the galls formed in the ft-10 mutant plants were smaller than Col-0 at 14 dpi (Fig. 6.26c; p<0.05). Although the size of the GCs was not reduced (Fig. 6.26d-e), it seems that a higher number of GCs are distinguished from the sections in the ft mutant as compared to WT plants (Fig. 6.26e). A total of ±700 longitudinal sections (2µm thickness) from six galls at 14 dpi were processed (Fig. 6.26d-e) as it is described in the previous point 6.2 (Cabrera et al., 2015a). Gall diameters were measured from micrographs from each gall (n≥20 per line tested).

- 153 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

Figure 6.26. – FLOWERING LOCUS T (FT) is functional during RKN interaction. A. Q-PCR analysis of the FT transcript in galls at 3 dpi compared to uninfected roots in background Col-0 and 35S:TOE1R-A12. FT was induced five-fold in galls formed by Mj in the ecotype Col-0 as compared to un-infected control root samples, but not in 35S:TOE1R lines. B. In vitro infection tests of ft-10 mutant line. The percentage of galls per main root was significantly lower in the ft- 10 line than in the ecotype Col-0. C. Galls diameter of ft-10 mutant line showing smaller values than their control Col-0 at 14 dpi (P<0.05). A total of ±700 longitudinal sections (2µm thickness) from six galls at 14 dpi were processed. Gall diameters were measured from micrographs from each gall (n≥20 per line tested). D. GCs volume measurement compared to Col-0 at 14 dpi. The volume occupied by the pool of GCs within the gall showed no significant differences between ft- 10 and Col-0. E. Representative images of Araldite® gall sections (2µm) of ft-10 line and Col-0 at 14 dpi. Asterisks, statistically significant differences (graphics; t-Student; p<0.05) and GCs (pictures); N, nematode; Scale bars: 100 µm. - 154 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

MiR172 is up-regulated in the galls induced by M. javanica in Arabidopsis and other crop species

While TOE1 downstream regulation is at least partially mediating FT transcript accumulation, TOE1 is regulated upstream by the action of the miR172 during Arabidopsis flowering (Aukerman & Sakai, 2003). As mentioned earlier, from the 83 pre-miRNAs that were detected in the microarray of developing GCs (Barcala et al., 2010), the pre-miR172d was induced, being the only one differentially expressed in GCs as compared to non-infected vascular cells (Díaz-Manzano et al., 2017a). To investigate the expression pattern of the gene family that generate the mature miR172 in the feeding sites induced by Mj in Arabidopsis, we assayed the GUS-reporter lines for the promoters for all five miR172-encoding loci (MiR172a, MiR172b, MiR172c, MiR172d and MiR172e), fused to the coding sequence of the GUS marker gene (Ripoll et al., 2015). In roots of uninfected plants, the promoters of the five precursors for the miR172 showed DE patterns. PmiR172a::GUS, pmiR172b::GUS and pmiR172e::GUS were expressed along the vascular cylinder of the root (Fig. 6.27a,b,e), except in the elongation zone and root apex in the case of pmiR172a::GUS and e (Fig. 6.27a1,e1). In contrast, the expression of the promoters for the precursors of MIR172c and MIR172d was not detectable along the vascular cylinder in the elongation or differentiation zones, being a specific signal only noticeable in the root tip (Fig. 6.27c-d, c1- d1). Hence, pmiR172c::GUS and pmiR172d::GUS showed a restricted expression pattern in root tips and both originate identical mature miR172 (Fig. S5p).

Because pri-miR172d was induced in the transcriptome of 3dpi GCs (Díaz-Manzano et al., 2017a), we infected these two lines with RKNs to check their activation patterns during gall development (Fig. 6.28). At 4 dpi the GUS- activity for both reporters was localized specifically in the vascular cylinder inside the galls induced by Mj in Arabidopsis (Fig. 6.28a,d).

- 155 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

Figure 6.27. – Analysis of endogenous GUS expression of miR172 lines. A-E. Basal GUS expression for root (a-e) and root apex (a1-e1). The expression is shown in the root and root apex for the five promoter lines of miR172 (pmiRNA172a::GUS; pmiRNA172b::GUS; pmiRNA172c::GUS; pmiRNA172d::GUS and pmiRNA172e::GUS). Only miR172c and miR172d promoter lines showed specific expression in the root apex (c1 and d1, respectively). The promoter lines miR172a (a, a1), miR172b (b, b1) and miR172e (e, e1) presented no signal or the signal was delocalized. Scale bars: 200 µm except in magnifications, 50 µm.

The signal remained visible and specific in the centre of the galls at intermediate stages of development (7 dpi; Fig. 6.28b,e). The number of galls with positive GUS signal decreased at 11dpi (Fig. 6.28h,j) and eventually, at 14 dpi, more than 90% of the galls in the lines pmiR172c::GUS and pmiR172d::GUS did not express GUS (Fig. 6.28c,f,h,j). Moreover, pmiR172c::GUS and pmiR172d::GUS were clearly expressed in the GCs

- 156 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

induced by the nematode and in adjacent vascular cells inside the galls at 4 dpi as shown in semithin sections (Fig. 6.28g,i). These results indicate a specific induction of pmiR172c::GUS and pmiR172d::GUS within the galls and GCs in roots upon nematode infection. However, no specific GUS pattern in galls of pmiR172a::GUS, pmiR172b::GUS and pmiR172e::GUS lines was observed as they are highly activated along the vascular cylinder of the non-infected roots and their expression pattern was similar within the galls (Fig. 6.27a,b,e; a1,b1, e1). Although it cannot be ruled out that, these three miRNAs also might contribute, to some extent, to the total amount of miR172 molecules in the gall

and GCs, no changes in the pattern of expression have been observed.

- 157 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

Figure 6.28. – MiR172c and MiR172d promoter lines analysis. A-F. Representative pictures of GUS assays of pmiRNA172c::GUS (a-c) and pmiRNA172d::GUS (d-f) lines in galls induced by Mj in Arabidopsis at 4, 7 and 14 dpi, respectively. G-I. Characteristic images of Araldite® cross sections of galls at 7dpi. H-J. Timecourse of GUS galls analysed at 4, 5, 7, 11 and 14 dpi for the two-miR172 promoter lines, pmiRNA172c::GUS (h) and pmiRNA172d::GUS (j). Asterisks, GCs; N, nematode. Scale bars: A-F, 200 µm; G and I, 50 µm.

MiR172 is highly conserved in the plant kingdom in angiosperms, gymnosperms, ferns, and across all tracheophytes (Luo et al., 2013), i.e., the sly-miR172a and sly-miR172b from tomato showed a 100% homology across 20 out of 21 nucleotides to miR172c from Arabidopsis (Fig. 6.29g).

- 158 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

Figure 6.29. – In situ detection of mature miR172c expression in crops. Tissues analysed alongside Scramble as a negative control and miR172c specific probe in tomato (a-c) and pea (d-f). A. Cross section of tomato uninfected root. B. Longitudinal section of M. incognita (Mi) tomato gall at 7 dpi. C. Cross section of Mi tomato gall at 7 dpi. D. Longitudinal section of pea uninfected root apex. E. Longitudinal section of Mi pea gall at 7 dpi. F. Longitudinal section of Mi pea gall at 7 dpi. Asterisks indicate GCs; N, nematodes; VC, vascular cylinder; E, endodermis. Scale bars: 100 µm. G. Complementarity of the Arabidopsis miR172c probe used for hybridisation (GACGTCGTAGTAGTTCTAAGA) to that of TOE1 in Arabidopsis and homologues in different crop species studied (tomato and pea). In red bold, non-matching base pairs.

- 159 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

Although the sequence for miR172 from pea has not been yet identified, miR172 is described as an active molecular partner during nodulation in legumes (Yan et al., 2013), a process with some molecular similarities to gall formation (Grunewald et al., 2009b; Boivin et al., 2016; Lelandais-Brière et al., 2016). Hence, we performed in situ hybridisation in galls of tomato and pea with the Arabidopsis miR172c probe. Our results confirmed accumulation of miR172 in galls and particularly in GCs of tomato and pea at 7 dpi (Fig. 6.29c, f, respectively). No signal was observed in either non-infected roots or galls of tomato or pea with a negative control probe (Scramble; Fig. 6.29a,d,b,e). Interestingly, analysis of bases complementarity from miRBase of the miR172c from Arabidopsis against the tomato and pea available genomes identified putative AP2-like gene targets with a high complementarity to miR172, was similar to TOE1 in Arabidopsis (Fig. 6.29g). Those results suggest that induction of miR172 in galls is probably a mechanisms conserved in these crop species. Herein, we decided to study several miR172 overexpressor potato lines previously described for their altered tuberization phenotype at SD (Sarkar, 2008; Abelenda et al., 2011). The 35S::miR172 infection rates were similar (line 8 & 22) or higher (line 6) than wildtype andigena 7540 (Fig. S7d). Complementary studies of GCs area (Fig. S7e) confirmed quantitative measure differences of GCs development at 7 dpi for line 6 (lower GCs size, Fig. S7h) and line 22 (greater GCs size, Fig. S7i). These results suggest that misexpresion of miR172 in potato causes phenotypic effects during the RKN-interaction.

MiR172 interferes with gall and GCs development after nematode infection in Arabidopsis

To further investigate the putative role of miR172 in galls and GCs development, we tested two independent target mimicry (MIM) lines for miR172 (MIM172.7 and 23; Franco-Zorrilla et al., 2007; Fig. 6.30e) in which the - 160 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

function of this miRNA was impaired. The two insertion MIM lines largely reproduced the late flowering phenotype showed by the 35S:TOE1R plants (Fig. S8), either at SD or LD (Fig. S8d,f), as we expected when TOE1 is not repressed by miR172. When the MIM lines were inoculated with Mj, both presented a conspicuous reduction in the infection levels (at least 40%; Fig. 6.30a), resembling again the phenotype displayed by the 35S:TOE1R lines after nematode infection (Fig. 6.25d). Moreover, the galls and GCs formed in the MIM lines were smaller than Col-0 (Fig. 6.30b-c; p<0.05). Interestingly, the reproductive parameter egg masses per gall was also dramatically affected in the MIM lines, with a reduction in the number of egg masses per gall and plant of up to 75% in one of the lines (MIM172-23.1; Fig. 6.31b; p<0.05). These results further support a role for miR172 during gall and GCs development.

- 161 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

Figure 6.30. – Target mimicry lines for miR172 analysis against RKNs. A. In vitro infection tests of two independent mimicry (MIM) lines 7 and 23 showing significant differences (p<0.05) respect to Col-0. The percentage of galls was 40-50% lower in MIM lines as compared to control. B. Gall diameter measured of MIM lines and Col-0. MIM lines showed less gall diameter than their control Col-0 at 21 dpi. A total of ±350 longitudinal sections (2µm thickness) from nine galls were processed. Gall diameters were measured from micrographs from each gall (n≥20 per line tested). C. GCs volume was measured and compared to Col-0 at 21 dpi. D. Representative

- 162 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

pictures of Araldite® gall sections (2 µm) of MIM lines and Col-0 at 21 dpi. E. Schematic comparison of miR172c-d, MIMICRY (MIM172) and miR172-TOE1 target sequences. In red bold, non-matching base pairs respect to miR172c-d. Asterisks, significant differences (t- Student; p<0.05). Values are means ±SE. N, nematode; Scale bars: 100 µm. GCs are labelled with a white asterisk.

Auxin regulation of miR172 function

The importance of auxin response maxima during the formation of the nematode feeding cells has been demonstrated (reviewed in Cabrera et al., 2015a; Kyndt et al., 2016). On the other hand, the auxin response factors (or ARFs) orchestrate auxin responses, by targeting the cis-motifs called Auxin Response Elements (AuxREs) to regulate gene expression (Chapman & Estelle, 2009). Interestingly, miR172 function is directly modulated by the auxin-signaling pathway via the regulation of miR172c. The promoter of miR172c contains two canonical AuxREs and it is already known that the miR172 is regulated by different ARFs during fruit development in Arabidopsis (Ripoll et al., 2015).

We analyzed the first 1000 bps promoter region upstream of miR172b, miR172c and miR172d loci, revealing the presence of canonical AuxREs (Fig. S11). To test whether auxins was influencing miR172c and miR172d expression in root tissues, we first treated seedlings with different auxin concentrations and measured transcript abundance for both loci. In both cases, auxin treatments increased transcript abundance when compared to mock treated samples (Fig. S6e). We next tested the activity of the GUS reporters for miR172c and miR172d after treatment with the auxin signaling inhibitor PEO-IAA. The signal for the reporters was largely abolished in the root zones where GUS activity was present in the mock treated roots (Fig. 6.27c1,d1 & S6a,b). Moreover, when we challenged MiR172c/AuxRE-:GUS plants bearing two mutated AuxREs motifs (Ripoll et al., 2015) with Mj

- 163 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

juveniles, no induction was observed in the galls at 5 dpi as compared with the control reporter line MiR172c:GUS where a strong signal was detected in the center of the gall (Fig. S6c,d). Altogether, these results indicate that the miR172 is regulated by auxins both in uninfected roots and in the galls induced by the nematode infection in Arabidopsis.

A role for miR172 and TOE1 in the plant-RKNs interaction at different day length regimes and plant developmental stages

The previously infection tests shown for the miR172 and the 35S:TOE1R lines were carried out in vitro under LD photoperiod (16h light/8h dark; Figs. 6.25&6.30). However, it has been reported that miR172 expression changes with the length of the light period, being higher under longer photoperiods (Jung et al., 2007). Besides, the expression of miR172 is regulated temporally, with no miR172 transcripts detected 2 dag, and progressively more steady state transcript accumulation was seen with age (Aukerman & Sakai, 2003; Chuck et al., 2007). With this in mind, we performed similar infection assays to those described above but under SD (8h light/16h darkness) and we also analyzed reproductive parameters in soil-grown plants under these conditions (Fig. 6.31). The reduction in the infection parameters for the MIM and 35S:TOE1R plants was also observed and even enhanced in some cases under SD as compared to LD (Fig. 6.31a; p<0.05). Interestingly, a reproductive parameter as the number of eggs per root weight was severely impaired in most of the lines grown in soil and infected around two months after germination (Fig. 6.31b; p<0.05) which indicates that the module miRNA172/TOE1/FT is crucial for nematode infection and also for reproduction, in agreement with the reduction of galls and GCs sizes observed in the MIM and 35S:TOE1R lines in LD (Figs. 6.25&6.30). These results confirmed that the miR172 performs an important function during the gall and GCs development affecting also the reproductive cycle of the nematode. Therefore, the miR172 and TOE1 play a role in galls and GCs development

- 164 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

under different photoperiods and plant developmental stages, yet it seems to be independent of the day light regime (this Thesis; Díaz-Manzano et al.,

2017a).

Figure 6.31. – TOE1-miR172 resistant lines, 35S:TOE1R and target mimicry lines (MIM) for miR172 show resistance to root-nematode infection under short days. A. In vitro grown analysis of 35S:TOE1R lines A12, D81, E82 and G73 (in green); and MIM lines 7 and 23 (yellow). The percentage of galls per main root was significantly lower in all lines studied than ecotype Col-0 (red). At least 80 plants per line were analyzed. B. Soil reproduction tests for 35S:TOE1R lines A12, D81 and G73; and MIM lines 7 and 23. The percentage of number of eggs per root weight was lower in all lines than in Col-0 (P<0.05). At least 30 plants per line were analyzed. Asterisks, significant differences (t-Student; p<0.05). Three independent experiments were performed for each treatment. Values are means ±SE. - 165 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

Discussion

RKNs constitute a major problem for the agriculture, exacerbated in recent years due to the ban of effective but contaminant chemical nematicides (Directives 91/414/EEC or 2009/128/EU). Meloidogyne spp. nematodes establish an obligate and endoparasitic interaction with a broad spectrum of valuable agronomic crops by inducing their feeding cells, GCs, inside the gall, a de novo developed structure (pseudo-organ) within the host roots (Escobar et al., 2015). Increasing knowledge of the molecular mechanisms orchestrating GCs and galls formation could assist in the development of new biotechnological tools against the RKNs (Fosu-Nyarko & Jones, 2015). Our results reveal the activation in the nematode feeding sites (GCs and galls) of a well-documented gene regulatory module (miRNA172/AP2-like), implicated in other developmental processes directing de novo emerging organs in plants like flowers (Aukerman & Sakai, 2003), tubers (Martin et al., 2009), fruit (Ripoll et al., 2015) or nodules (Yan et al., 2013; Wang et al., 2014).

The riboregulator miRNA172 regulates the abundance of a number of AP2-like transcription factors, like TOE1, at both transcriptional and translational levels (Chen, 2004). Yet, in our transcriptomic study of microdissected GCs compared to non-infected cells, the only flowering related AP2-like gene repressed was TOE1 (Barcala et al., 2010). Therefore, an increase in the level of expression of miR172 in the cell would involve a reduction of TOE1 transcript abundance and/or protein accumulation. Our expression analyses by q-PCR confirmed TOE1 down-regulation in galls (Fig. 6.25b) while the promoters of the precursor genes for the miR172c and miR172d (Fig. 6.27c,d) were up-regulated in galls and GCs induced by Mj in Arabidopsis. As mentioned, this is in agreement with previous results of microarrays experiments of laser-capture microdissected GCs at 3 dpi in Arabidopsis (Barcala et al., 2010; Díaz-Manzano et al., 2017a). Our previous work showed a massive and conserved down-regulation of genes in the

- 166 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

transcriptome of early developing GCs in Arabidopsis and tomato (Barcala et al., 2010; Portillo et al., 2013) also evident in galls (Jammes et al., 2005; Barcala et al., 2010). The repression of TOE1 expression seems to have a role for proper nematode establishment as infection was reduced in overexpressing lines resistant to the miR172 mediated silencing (Fig. 6.25d). Similarly, TPX1, a peroxidase coding gene was repressed in tomato GCs and in Arabidopsis GCs (Portillo et al., 2013). Overexpression of TPX1 in the plant conferred not only a higher resistance to the infection but impaired NFS development, showing smaller GCs. Likewise, RAP2.6, a transcription factor containing an AP2 domain, was down-regulated in syncytia induced by H. schachtii in Arabidopsis (Szakasits et al., 2009) and its overexpression enhanced the resistance against the nematode, resulting in smaller syncytia cells (Ali et al., 2013).

In our study we have observed that in genetic backgrounds with either impaired miR172 function or misexpressed TOE1-miR172-resistant (MIM172 and 35S:TOE1R, respectively) lead to lower infection and reproductive levels. Moreover, in those lines the growth of galls and GCs is dramatically impaired when compared to the corresponding controls (Figs. 6.25; 6.26 & 6.30). These results suggest a role for the repression of TOE1 in the morphogenetic processes leading to gall/GCs development. Our results are in line with previous publications showing that AP2-like target repression by miR172 is essential for correct tuberization and fruit morphogenesis (Licausi et al., 2013; Ripoll et al., 2015). This is in accordance with previous studies that showed the interference caused by the nematodes in different plant developmental pathways, hijacking regulatory circuits to use them on their own benefit for the development of feeding organs (reviewed in Cabrera et al., 2015c).

MiR172 regulates the expression of a small group of AP2-like transcription factors during flowering, including TOE1 (Zhu & Helliwell, 2010). In this respect, we demonstrated the activation of the promoters of the

- 167 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

precursor genes for miR172c and miR172d at early infection stages within the galls, with a high specific pattern in GCs and the adjacent vascular cell layers (Fig. 6.28) and the accumulation of miR172 homologues to Arabidopsis miR172c in galls from tomato and pea (Fig. 6.29). These observations are in line with a role for miR172 in the NFS. The regulation of TOE1 by miR172 is reinforced by the fact that MIM lines for miR172 showed late flowering phenotype either at SD or LD similar to 35S:TOE1R lines (Fig. S8) and a significant reduction in the infection parameters and size of the galls and GCs (Figs. 6.25 & 6.30), somehow mimicking the phenotype observed for 35S:TOE1R also during nematode infection. In this respect, although, the results were not highly consistant among lines, the study of potato lines overexpressing miR172 previously described for their altered tuberization phenotype at SD (Sarkar, 2008; Abelenda et al., 2011), suggested that the susceptibility to Meloidogyne spp. and the phenotype of the NFS were also altered in those plants.Thus, missexpression of miR172 seems to correlate with altered GCs phenotypes.

The relevance of the down-regulation of a gene for the proper NFS development has been recently demonstrated, i.e. miR827 was induced and its target gene NLA, repressed, being this process necessary for the correct establishment of CNs feeding sites (Hewezi et al., 2016). Moreover, ARF3 is down-regulated by the induction of the auxin responsive miR390 in Arabidopsis (Cabrera et al., 2016a) and mutants for the miR390 activity showed a decrease in the infection parameters and a reduction in the galls size (Cabrera et al., 2016a). This latter example suggested a connection between the hormone auxin and the regulation of genes by miRNAs in galls. Here, we demonstrated the regulation of miR172 by auxins in RKNs-induced galls by two independent assays, one after exposure to a TIR inhibitor, PEO-IAA, and the second by mutating two AuxREs in the miR172 promoter (MIR172c/AuxRE-::GUS). In both cases the specific activation of MIR172c::GUS in galls disappeared (Fig.

- 168 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

S6a,d). The regulation of miR172 expression by auxins has also been demonstrated during the Arabidopsis fruit development, where miR172 is induced by different auxin response factors (ARF6 and ARF8) and targets the expression of AP2 (TOE3), mediating in this way the proper fruit growth (Ripoll et al., 2015). The presence of RKNs in the roots alters the auxin levels, showing a high accumulation during early stages of feeding site development and it is a key signal for the formation of GCs and galls (Karczmarek et al., 2004; Cabrera et al., 2014b; Kyndt et al., 2013; 2016). Auxins also drive fruit development and flowering (Ripoll et al., 2011; 2015). Moreover, nodulation also shows some parallelisms with that of the gall formation (Mathesius, 2003), such as the accumulation of auxins at early stages (Grunewald et al., 2009b). In addition, the regulatory module miR172-AP2 also plays a role during the formation of nodules in legumes (Yan et al., 2013; Wang et al., 2014). In parallel, miR172c expression induced in the nodules negatively regulates an AP2-like transcription factor, NNC1, allowing in this way the proper formation of the new organ (Wang et al., 2014). Interestingly, MIM lines showed abnormal phenotype of the GCs, as they were smaller than in wild type plants (Fig. 6.30b,c). Similarly, during fruit development in MIM lines smaller valve cells are formed (Ripoll et al., 2015). All these suggest common regulatory networks mediated by miR172 in apparently distant processes of development and during biotic interactions.

Zhang et al., (2015) showed that TOE1 binds the FT promoter in leaves and that the expression levels of FT increased in an overexpressing line for the miR172 and in the double mutant line toe1/toe2, suggesting that TOE1 acts as a negative regulator of FT expression. We showed that FT transcripts accumulated in galls formed by Mj in Arabidopsis roots (Fig. 6.26a). These data together with the fact that the phenotype of MIM lines as well as of 35S:TOE1R lines was maintained at different day length regimes, suggest, that RKNs might induce local changes in FT abundance. In line with this, mutant ft-

- 169 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

10 lines showed a decrease in the infection by RKNs and in the gall size (Fig. 6.26b,c). FT is a mobile molecule broadly characterized as a positive regulator of flowering (Turck et al., 2008). This data in addition to the down-regulation of TOE1 (Fig. 6.25b) and the up-regulation of miR172 (Fig. 6.28) supports a scenario in which the expression of these three genes could be coordinated in NFS (Fig. 7.2). Belowground, FT orthologous genes have been identified to positively regulate tuber formation in potato (Navarro et al., 2011) or bulb formation in onion (Lee et al., 2013). These results correlate well with the up- regulation and positive role demonstrated for miR172 repressing the expression of a TOE1 relative, the AP2-like transcription factor RAP1, during the tuber formation in potato (Martin et al., 2009). Thus, taking into consideration all of the above, it is reasonable to postulate that all those developmental programs (tuber formation, nodule formation, gall development fruit growth) share a common gene regulatory architecture mediated by miR172.

Our data support a model where the miRNA172/TOE/FT regulatory module is shared by seemingly unrelated and distant processes such as flowering in the aerial parts and responses to pathogens in roots that encompass de novo morphogenetic processes (Fig. 7.2). Hence, the initial cells leading to de novo formation of those organs might share some characteristics. For instance, the establishment of floral organ founder cells precedes an auxin response maxima, providing local competence for G1-S cell cycle progression (Chandler, 2011; Seeliger et al., 2016). In this respect, although the founder cells of RKN feeding cells, GCs, are still undetermined, an auxin maxima occurs early during nematode establishment (Karczmarek et al., 2004; Cabrera et al., 2014b; Kyndt et al., 2013; 2016) preceding successive mitosis and endoreduplication events during GCs differentiation (de Almeida-Engler et al., 2013; 2015; Coelho et al., 2017).

- 170 -

Results and Discussion: The Gene Regulatory Module MiRNA172/TOE1/FT

In conclusion, here we showed the participation of the regulatory module miRNA172/TOE1/FT in GCs and gall development induced by M. javanica in Arabidopsis (Fig. 7.2). Our data show that the activity of this module plays an important role in correct GCs and gall development, as several genotypes affected in the activities of this module show lower susceptibility to nematode infection and smaller galls/GCs. The regulation of miR172 by auxin response factors together with previous results highlights the key role of auxin signaling during early GC and gall development, strongly suggesting that this regulatory module is in turn regulated by auxins during feeding cells development. Moreover, FT, a gene encoding a mobile molecule that positively regulates flowering, is induced in galls and its loss of function compromised nematode infection levels. Further studies should be performed to understand these common regulatory networks. Yet, common regulatory molecular partners at the cellular level should be controlling different organogenetic processes triggered either by developmental cues, or by biotic interactions, as plant/nematodes, probably coordinated by internal hormonal signals.

- 171 -

- 172 -

7. - GENERAL DISCUSSION

- 173 -

Meloidogyne javanica gall fixed with glutaraldehyde

- 174 -

General Discussion

7.1. – GENERAL DISCUSSION OF THIS THESIS

Nematodes are pluricellular organisms that actually affect a wide-range of crops (Gómez & Montes, 2001). The negative consequences that they induce directly on the ground can be amplified as they may favour the establishment of fungi, bacteria and viruses (Perry & Moens, 2011). The necessity to study these nemathelminths required the adaptation of an in vitro system for their conservation and management in axenic conditions that could allow scientists handling and use them with no contamination from other microorganisms, quite abundant in the soil.

Reviewing during my Thesis the methods available in the literature, I observed that there was no an in vitro protocol, easy to use, simple, fast and reliable to maintain and reproduce RKNs in monoaxenic conditions. In response, I decided to tackle the problem with the development of a new in vitro method previously showed (see section 6.1). This method will allow scientists to develop studies based on highly sensitive techniques as “omics” (transcriptomics, metabolomics, proteomics and methylomics) among others. An obligate requirement is the only presence of the nematode in the collected tissue with no contamination of other microorganisms and an efficient amplification method for the infective J2 stage. The monoaxenic culture developed present these characteristics. With this protocol, we amplified more than 34 times from the initial J2 inoculum of three species of nematodes (Mj, Mi and Ma) in monoaxenic conditions.

After setting up an important biological tool to tackle the study of this biological system at the molecular level, I aimed to decipher those molecular cues shared between LR and gall development. In Figure 7.1 are shown different modules and genes described during early LR formation and those studied during the plant nematode interaction. Similarities will be plausible within a context were this polyphagous group of nematodes (Meloidogyne spp.) might be able to use or interfere with plant transductional pathways - 175 -

General Discussion

conserved in many plant species, as for example those driving plant developmental processes to differentiate their feeding sites. Importantly, previous analysis within the group showed high in silico similarities of the GCs/galls transcriptome at early developing stages to that of LR primordia (Cabrera et al., 2014b). This was the main observation pillar sustaining the hypothesis mentioned.

Figure 7.1. – Overview of LRP development model and nematode analysis. A. Illustration of Arabidopsis LRP development during the first three stages of development (arrows: preinitiation, initiation and growth). The different cell layers are represented: epidermis (yellow), cortex (orange), endodermis (blue), pericycle (green), stele (white) and LRP (red). B. Plant LRP model described previously by Dastidar et al. (2012) that have been studied on plant-pathogen interaction during this Thesis (preinitiation and initiation). Moreover, we have also considered miR390 described in Cabrera et al. (2016a) and we have added the SKP2B gene in the second module (initiation zone) regulated by SLR according to Manzano et al. (2012) results and from this Thesis.

- 176 -

General Discussion

In line with this, in this Thesis, I participated in the study of the LBD16 transcription factor that resulted in an important transducer common in both processes, LR and galls/GCs formation Cabrera et al. (2014b). It is integrated in molecular pathways modulated by auxins (Fukaki & Tasaka, 2009; Goh et al., 2012; Cabrera et al., 2015b) leading to LR formation. In NFS (GCs), auxin accumulation occurs probably from the intracellular distribution conducted by PINs conveyors (Grunewald et al., 2009a; Kyndt et al., 2016; Lavenus et al., 2016). Auxins cause changes in developmental programs and function (Tromas & Perrot-Rechenmann, 2010) inducing ARFs to regulate gene expression (Kieffer et al., 2010). In this context, the different modules of LR development analysed are also integrated in cascades modulated by auxins (Figure 7.1). We obtained conclusive results where nematodes use LRP pathways for the formation of the galls and their nourishing cells (Figs. 3.3 & 7.1). Basically, most of genes traditionally described in LRP modules (preinitiation and initiation, Fig. 7.1) showed GUS expression within the galls (Figs. 6.16-6.19), and a reduction on their infection rates in loss of function lines (Fig. 6.20 & 6.21). Herein, we confirmed their involvement in the plant- nematode interaction during GCs formation, strongly suggesting that nematodes partially hijack transductional LR routes in Arabidopsis for its own benefit (this Thesis; Díaz-Manzano et al., 2017b).

Another part of my Thesis was also based in former studies from our group. Within the transcriptome of GCs at early developing stages in Arabidopsis isolated by laser-capture microdissection, it was shown a massive and unexpected number of repressed genes (Barcala et al., 2010). This is consistent with a process of gene reprogramming during the differentiation of these specialized cells. Accordingly, subsequent massive sequencing of small RNAs (sRNAs) showed changes in different populations of sRNAs within the galls (Cabrera et al., 2016a). Among them, the population of miRNAs was also differentially accumulated in galls as compared to control non-infected roots. This suggest a possible mechanism of gene silencing in RKN feeding sites via - 177 -

General Discussion

sRNAs, which is my starting hypothesis. In this context, we studied the involvement of miR172, a highly expressed pre-miRNA in GCs, in the root-knot nematode interaction (see section 6.5).

Functional and expression studies of miRNAs regulation under stress responses have been extensive in the last recent years in plants (Sunkar et al., 2012); however, few studies have been centered in NFS (Hewezi et al., 2008; 2012; Li et al., 2012; Xu et al., 2014; Zhao et al., 2015; Cabrera et al., 2016a). The riboregulator miR172 post-transcriptional targets a small group of AP2/EREBP regulatory repressor genes (AP2, TOE1,2,3, SNZ and SMZ), and it has been previously studied because of its key role in controlling plant aging, flowering time, tuber formation and fruit growth (Martin et al., 2009; Zhu & Helliwell, 2010; Khan et al., 2014; Ripoll et al., 2015). Our investigations have shown that the miR172-dependent regulatory module miRNA172/TOE1/FT is active and de-regulated in the feeding sites induced by M. javanica in Arabidopsis roots, participating in gall and GCs development. This was inferred from Arabidopsis backgrounds with altered activities of either miR172, or TARGET OF EAT1 (TOE1), and FLOWERING LOCUS T (FT). For the miR172 we used two target mimicry lines (35S::MIM172, 7 and 23; Todesco et al., 2010), for the function of TOE1 we used four 35S::TOE1-miR172-resistant lines (35S::TOE1R A12, D81, E82 and G73) and for the activity of FT, a mutant line (ft-10) previously characterized (Yoo et al., 2005). All those lines showed lower susceptibility to the RKNs and smaller feeding sites (galls) (Figs. 6.25e, 6.26c & 6.30b). Additionally, the expression of those genes in galls was also recorded by q-PCR with specific primers and with reporter lines for miR172 (Table 5.2; Figs. 625b & 6.26a). MiRNA172::GUS (c and d) showed restricted expression in galls/GCs and are regulated by auxins through ARFs as IAA induce their expression and PEO-IAA treatment and mutations in AuxRe motifs abolish its expression in galls (Figs. S5, S6 & S11).

- 178 -

General Discussion

Figure 7.2. – Schematic model of the miR172/TOE1/FT function and regulation during the plant-nematode interaction. As a result of the cross talk between Arabidopsis thaliana and

- 179 -

General Discussion

Meloidogyne spp. hormonal signalling pathways such as auxins should be altered. Auxins are a positive signal for miR172c and d accumulation through ARFs activation that induce the miR172c promoter, and probably through intermediate partners still not characterized. MiR172 mediates gene silencing of TOE1 that strongly correlates to the accumulation of FT transcripts, thus TOE1 should regulates FT either directly or indirectly through other partners, also still not known. Scale bars: 20 µm for egg picture; 50 µm for nematode; 200 µm for gall; 1 cm for Arabidopsis. In red are shown those induced genes in the microarray of microdissected GCs according to Barcala et al. (2010); in green, repressed; in black, non-differentially expressed.

We also described for the first time the localization of the mature miR172 in crops as tomato and pea in galls at 7 dpi (Fig. 6.29). Abundant miR172 was localized in galls and particularly in GCs. Those results suggest that induction of miR172 in galls is probably a mechanisms conserved in crops. Herein, we decided to study several miR172 overexpressor potato lines previously described for their altered tuberization phenotype at SD (Sarkar, 2008; Abelenda et al., 2011). As expected, 35S::MiR172 infection rates were similar (line 8 & 22) or higher (line 6) than wild type andigena 7540 (Fig. S7d). Complementary studies of GCs areas, confirmed quantitative differences of GCs development at 7 dpi for line 6 (lower GCs size) and line 22 (greater GCs size) (Fig. S7e; S7f-i). Although, the results were not highly consistant among lines, they suggested that the phenotype of the NFS were altered due to miR172 overexpression.

In conclusion, all these results presented showed that the activity of the regulatory module miRNA172/TOE1/FT plays an important role in correct GCs and gall development where miR172 should be modulated by the auxin signaling pathway (Fig. 7.2). This study adds knowledge on how RKNs interfere plant endogenous developmental pathways and contributes to a better understanding of the molecular signatures regulating feeding cells development. - 180 -

General Discussion

For all the functional analyses mentioned before, it was relevant a previous study where I actively participated on the 3D-dimensional reconstruction of GCs (Figs. 6.5-6.7). Overall, we proposed a simplified standardized method for GCs phenotyping based on the comparison of 2D parameters, GCs area, to that of their total volume after 3D reconstruction that showed a strong correlation. This method was systematically used along this Thesis for phenotyping the GCs in different loss or gain of function lines from Arabidopsis (Figs. 6.8; 6.14d; 6.25e-f; 6.26c-d & 6.30b-c). An important finding was that the volume of a single GCs, is not much relevant for the accurate phenotyping of the NFS, but the total area occupied by all contained GCs within the gall. This finding also might sustain a functional relevance on the nematode development. In this framework, galls and GCs phenotyping in this Thesis was performed based on this principle.

- 181 -

- 182 -

8. - GENERAL CONCLUSIONS (CONCLUSIONES GENERALES)

- 183 -

Lateral root primordia of SKP2BL::GUS line

- 184 -

General Conclusions

8.1. – GENERAL CONCLUSIONS OF THIS THESIS

1. A simple, efficient and long-term method for nematode amplification on cucumber roots grown in vitro in monoaxenic conditions was set up. Amplification of J2 nematodes from the starting inoculum was around 40-fold. The method was validated for three Meloidogyne species (Meloidogyne javanica, M. incognita, and M. arenaria), producing viable and robust freshly hatched J2s. These J2s can be used for further in vitro infection of different plant species such as Arabidopsis, tomato and potato, as well as to maintain and amplify the population for it study.

2. We have standardized a protocol for the phenotyping of giant cells induced by root knot-nematodes that combines images obtained by bright-field microscopy from the complete serial sectioning of galls with TRAKEM2 software. It is based on a two-dimensional (2D) parameter for comparison of giant cells from different Arabidopsis genotypes, which is also appropriate to galls from different plant species and in different growing conditions, whenever thickness or transparency is not a restriction.

3. We presented for the first time an adapted and standardized in situ protocol to detect miRNAs in giant cells induced by nematodes based on tissue paraffin embedding and on-slide-in situ hybridization of miRNAs. Successful localization of miR390 in tomato giant cells constitutes a validation of this method that could be easily extended to other crops and/or syncytia induced by cyst nematodes.

- 185 -

- 186 -

General Conclusions

4. A comparative study of molecular signatures for lateral root formation and the development of galls/giant cells induced by Meloidogyne species confirmed the existence of molecular parallels between the cellular signal transduction pathways that originate lateral roots and galls.

a. The role of a key transcription factor for lateral root primordia initiation, LBD16, during gall development showed that it is a significant component of the auxin signaling pathway for the gall/giant cells development.

b. Fundamental genes involved in different regulatory modules during lateral root formation (IAA28, ARF6, ARF8, and GATA23 from lateral root preinitiation module; and SLR, BDL, SKP2B and LBDs from the initiation module) showed a critical role during gall/giant cells growth at early stages.

5. We have shown that a miRNA-dependent gene regulatory module composed of a miR172, its cognate target TOE1 and the flowering long-range signaling gene FT, critically modulates gall/giant cells development in Arabidopsis thaliana roots.

6. Our results suggest that, strikingly, the miRNA172/TOE1/FT regulatory module is a molecular hub for two, a priori, unrelated signaling pathways (root developmental responses after plant nematode interaction and flowering).

- 187 -

- 188 -

Conclusiones Generales

8.1. - CONCLUSIONES GENERALES DE ESTA TESIS

1. Se estableció un método simple, eficiente y de cultivo a largo plazo para la amplificación de nematodos en raíces de pepino en condiciones monoaxénicas. La amplificación de los nematodos J2s del inóculo inicial es de aproximadamente 40 veces. El método fue validado para tres especies de Meloidogyne (Meloidogyne javanica, M. incognita y M. arenaria), produciendo J2s viables y robustos. Estos J2s pueden utilizarse para una infección in vitro adicional en diferentes especies de plantas tales como Arabidopsis, tomate y patata; así como, mantener y amplificar la población para su estudio.

2. Hemos estandarizado un protocolo para el fenotipado de células gigantes inducidas por nematodos agalladores que combina imágenes obtenidas por microscopía de campo claro con la serie completa de las agallas a partir del software TRAKEM2. Se basa en un parámetro bidimensional (2D) que se correlaciona con las medidas volumétricas en 3D y permite la comparación de células gigantes de diferentes genotipos de Arabidopsis. De igual manera, es apropiado para las agallas de diferentes especies de plantas y en diferentes condiciones de crecimiento, siempre que el espesor o la transparencia tisular no sea una restricción al sistema.

3. Presentamos por primera vez un protocolo adaptado y estandarizado para detectar microARNs in situ en células gigantes inducidas por nematodos basado en la inclusión del tejido en parafina y la hibridación del microARN en secciones de agallas. La localización exitosa del microARN390 en células gigantes de tomate constituye una validación de este método que podría extenderse fácilmente a otros cultivos y/o sincitios inducidos por nematodos formadores de quistes.

- 189 -

- 190 -

Conclusiones Generales

4. El estudio comparativo de las señales moleculares para la formación de raíces laterales y el desarrollo de agallas y/o células gigantes inducidas por nematodos del género Meloidogyne confirmó la existencia de paralelismos moleculares entre las vías de transducción de señales celulares que originan las raíces laterales y las agallas.

a. El papel de un factor de transcripción clave para la iniciación de los primordios de las raíces laterales, LBD16, durante el desarrollo de las agallas, mostró que tiene una función significativa en la ruta de señalización por auxinas para el desarrollo de la agalla y/o células gigantes.

b. Los principales genes involucrados en los diferentes módulos de regulación de la formación de la raíz lateral (IAA28, ARF6, ARF8 y GATA23 del módulo de preiniciación de la raíz lateral; y SLR, BDL, SKP2B y LBDs del módulo de iniciación) mostraron un papel fundamental durante el desarollo de la agalla y/o células gigantes en las etapas tempranas de diferenciación.

5. Hemos demostrado que un microARN descrito en floración, el microARN172, cuyo gen diana es TOE1, y el factor de floración FT, regula críticamente el desarrollo de la agalla y/o de las células gigantes en raíces de la planta modelo Arabidopsis thaliana.

6. Nuestros resultados sugieren que, sorprendentemente, el módulo microARN172/TOE1/FT es un integrador en dos vías de señalización, a priori, no relacionadas (alteraciones en el desarrollo de la raíz como consecuencia del establecimiento de nematodos y la floración).

- 191 -

- 192 -

General Conclusions

9. - SUPPLEMENTAL DATA

- 193 -

Leaves of DR5::GUS line at five days after germination

- 194 -

Supplemental Data

In this section, we have added and showed the most relevant supplemental figures and tables developed during my Thesis.

Figure S1. – LATERAL ORGAN BOUNDARIES DOMAIN 16 (LBD16) is induced by auxins in galls. LBD16 is regulated by auxins. Two dpi LBD16::GUS (2500-bp version) Arabidopsis galls infected with Mj were transferred to plates containing either 300 µM α-(phenyl ethyl-2-one)- indole-3-acetic acid (PEO-IAA; inhibitor of auxin signalling that antagonize auxin activation) in DMSO or only DMSO (mocked), which was used as a control. GUS activity was examined 4 days later. A-B. A clear signal was detected in both the lateral root primordia (LRP) (a) and within the gall (b) in the DMSO treatment. C-D. PEO-IAA treatment led to the disappearance of GUS signal in the LRP (c) and in the centre of the gall (d). Scale bars: 200 µm. Source: modified from Cabrera et al., 2014b.

- 195 -

Supplemental Data

Figure S2. – LBD16 expression and functional analysis do not support a role for LBD16 in syncytia development. A-C. The LBD16::GUS line showed no signal in syncytia formed by H. schachtii at 3, 6 or 11 dpi (black arrows). Only LRP in a and b showed GUS staining (black arrows). D. An infection test of three independent 35S:LBD16-SRDX lines showed no significant effect on the infection rate compared with the Col-0 control. This result was based on measurements of the relative percentage of syncytia over the length of the main root. Statistical analysis was performed with three independent experiments per line; at least 50 plants per experiment were tested. ANOVA and the Schefeé test were performed (P<0.05). Scale bars, 200 μm. Source: modified from Cabrera et al., 2014b.

- 196 -

Supplemental Data

Figure S3. – In vitro phenotyping of Arabidopsis lateral root mutants and transgenic lines compared to Col-0 WT. Representative pictures of different seedlings lines were arranged vertically in groups of three. A, D and G, arf7-arf19 double mutant, arf7 single and Col-0 ecotype at 5, 7 and 13 days after germination (dag), respectively. B, E and H, nph4(arf7)-arf19 double, nph4(arf7) single and GATA23::RNAi line. C, F and I, slr, arf19 and lbd16 singles. All lines are described at the top plate and dag is indicated on the left side. All lines studied showed no root phenotype at inoculation time (5 dag). Plates were grown under long-day photoperiod (16h light/8h darkness; 80-100 µmol m-2 s-1) and they were selected from at least ten independent plates by set of three. Arrows, first lateral roots. Scale bars, 2 cm. - 197 -

Supplemental Data

Figure S4. – In vitro phenotyping of Arabidopsis lateral root mutant and transgenic lines compared to WT. Seedlings were arranged vertically in groups of three. A, D and G, LBD29- SRDX(lbd16), WS ecotype and iaa28 lines at 5, 7 and 13 days after germination (dag), respectively. B, E and H, lbd16-lbd18-lbd33 triple, lbd16-lbd18 double and lbd18 single mutant. C, F and I, skp2bL, arf6-/8+ and bdl-2Col-0 lines. All lines are described at the top plate and dag on the left side. All lines studied showed no root phenotype at inoculation time (5 dag). All lines had as a control Col-0 (see Fig. S3) except for iaa28 line (WS backgroundl). Plates were grown under long-day photoperiod (16h light/8h darkness; 80-100 µmol m-2 s-1) and they were selected from at least ten independent plates by set of three. Arrows, first lateral roots. Scale bars, 2 cm.

- 198 -

Supplemental Data

Figure S5. – In vitro exogenous auxins treatment for miR172 lines. Mocked samples GUS expression for aerial part (a, d, g, j, m), root (b, e, h, k, n) and root apex (c, f, i, l, o) at 7 dag. Then, 20 µM of synthetic auxins 2,4-Dichlorophenoxyacetic acid (2,4-D) was added. Auxin treated GUS expression in aerial part (a1, d1, g1, j1, m1), root (b1, e1, h1, k1, n1) and root apex (c1, f1, i1, l1, o1). Only C and D promoter lines showed localized expression in the root apex (I and L, respectively) and were clearly induced after auxins treatment (i1 and l1). P. Sequences of the five genes of miR172. Name of each gene is detailed (ID). MiRNAs sometimes have several mature products that arise from the 5′ hairpin arm (5p) or from the 3′ hairpin arm (3p) that are incorporated into the RISC complex. When it has not been determined experimentally, it is not specified in the database (ND). Moreover, in colors described pairs of identical sequences among the five genes (a-b; b-e; and c-d). Scale bars, detailed in each image.

- 199 -

Supplemental Data

Figure S6. – Analysis of pmiRNA172c::GUS and pmiRNA172d::GUS promoter lines under PEO-IAA and auxins treatments. A-B. Auxins inhibitor treatment. Both lines that previously showed localized expression in the root apex were treated with an auxin synthetic inhibitor (PEO-IAA) showing no signal. C-D. Galls of pmiRNA172c::GUS induced by Mj at 5 dpi. The promoter line pmiRNA172c::GUS (c) showed located signal in the gall; however, the pmiR172c/AuxRE-::GUS line with two mutated auxin-binding element (d) presented no signal. E. Fold change expression value of mRNA172c and mRNA172d after auxins increasing concentration treatments up to 50 micromolar of IAA. Scale bars: 200 µm. - 200 -

Supplemental Data

Figure S7. – Phenotyping of miR172 overexpressing lines (35S::miR172) in potato. See below for next page (description).

- 201 -

Supplemental Data

Figure S7. – Phenotyping of potato miR172 overexpressor lines. A. Cultivation of potato grafts (2-3 cm) in 14 cm diameter plates (2 grafts per plate). They were grown vertically at 22ºC± 2 °C, 0%RH, 16h light/8h darkness (80-100 µmol m-2 s-1). B-C. Representative pictures of line 6 root system (b) and Andigena 7540 ecotype (c) at 14 dag. D. Potato in vitro infection test of 35S::miRNA172-6, 35S::miRNA172-8, 35S::miRNA172-22 transgenic lines compared to Andigena. Number of galls by root centimeter did not show differences except in line 6 that showed more susceptibility to RKNs than the control Andigena (p<0.05). E. GCs area measured and compared to Andigena at 7 dpi. Histograms indicate the average area occupied by the pool of GCs within the 10 central sections from two representative galls of each line as indicated (± SE). Line 6 showed less GCs area than Andigena and the reduction was significative (p<0.05); line 22 showed greater GCs size than Andigena (p<0.05). F-I. Representative images of longitudinal galls sections included in Araldite resin and stained with TB+TABB blue at 7 dpi. Black asterisks, significant differences (t-Student; p<0.05). White asterisks, GCs; N, nematode. Scale bars: 2 cm to a-c; 100 µm to f-i.

- 202 -

Supplemental Data

Figure S8. – Soil flowering phenotype assays of 35S:TOE1R and MIM lines and Col-0 control. A-B. Plant phenotypes under long-day conditions at 6 weeks after germination. We used Col-0 ecotype, and 35S:TOE1R-A12, 35S:TOE1R-D81 (a); 35S:MIMICRY172-7.1, 35S:MIMICRY172-7.4, 35S:MIMICRY172-23.1 and 35S:MIMICRY172-23.3 transgenic lines. All lines studied showed late flowering phenotype compared to the control. C-D. Number of rosette leaves of each line at 4 weeks after germination under long-day conditions. All lines studied, 35S:TOE1R (c) and MIM (d) showed greater number of rosette leaves compared to Col-0 except 35S:TOE1R-G73 and 35S:TOE1R-E82 (c). E-F. Number of rosette leaves of each line at 4 weeks after germination under short-day conditions. All lines studied, 35S:TOE1R (c) and MIM (d) showed greater number of rosette leaves compared to Col-0. Rosette leaves were counted from at least ten independent plants per line and experiment. Three independent experiments were done. Each line is detailed. Scale bars, 2 cm. Asterisks, significant differences (t-Student; p<0.05). - 203 -

Supplemental Data

Figure S9. – In vitro phenotype of MIM and TOE1 resistant lines compared to Col-0 ecotype. Seedlings were arranged vertically in groups of three. A, D, G, J and M, Col-0 ecotype, 35S:MIMICRY172-7.4 and 35S:MIMICRY172-7.1 lines at 5, 7, 10, 13 and 20 days after germination (dag), respectively. B, E, H, K and N for Col-0 ecotype, 35S:MIMICRY172-23.3 and 35S:MIMICRY172-23.1. C, F, I, L and O for 35S:TOE1R-E82, 35S:TOE1R-D81 and 35S:TOE1R- A12 lines. All lines are described at the top of the plate and dag on the left side. They did not show any root phenotype at inoculation time (5 dag) or at later germination times. Plates were grown under long-day photoperiod (16h light/8h darkness; 80-100 µmol m-2 s-1) and they were selected from at least ten independent plates by set of three. Three independent experiments were done. Scale bars, 2 cm. - 204 -

Supplemental Data

Figure S10. – Long and short day’s root growth phenotypes of TOE1 resistant and MIM lines compared to Col-0. No differences in the root phenotypes grown at long or short-day conditions was evident. Days after germination (dag) are detailed at the top of the image as well as the light treatment; LD, long-day photoperiod (16h light/8h darkness; 80-100 µmol m-2 s-1) or SD, short-day (8h light/16h darkness; 80-100 µmol m-2 s-1). All lines are also described at the top of each plate at four dag. Lines tested were Col-0 ecotype, and 35S:TOE1R-A12, 35S:TOE1R- D81, 35S:TOE1R-E82, 35S:TOE1R-G73, 35S:MIMICRY172-7.1, 35S:MIMICRY172-7.4, 35S:MIMICRY172-23.1 and 35S:MIMICRY172-23.3 transgenic lines. Plates were selected from at least ten independent plates per line and treatment. Three independent experiments were done. Scale bars, 2 cm.

- 205 -

Supplemental Data

Figure S11. – Auxin responsive elements (AuxREs) present in the promoter regions of five genes that transcribe to ath-miR172 and their sequence. A. MiR172 mature sequences, in black, identical sequences among the five genes (a-b; c-d; and e), in red bold, non-matching base pairs between the five ath-miR172 gene sequences. The number of auxin boxes in each of the gene regions are also indicated (AuxREs). Identification of the AuxRE motifs were performed with the online tool RSAT (van Helden, 2003). Name of each gene is detailed (Loci). B. Ath- miR172c sequence homology with tomato (S.lycopersicum) and pea (P. sativum) miR172.

- 206 -

Supplemental Data

10. - BOOK CHAPTERS ALREADY PUBLISHED

- 207 -

Araldite resin cross section

- 208 -

Book Chapters Already Published: Developmental Pathways and Hormones

10.1. - DEVELOPMENTAL PATHWAYS MEDIATED BY HORMONES IN NEMATODE FEEDING SITES Javier Cabrera, Fernando E. Díaz-Manzano, Carmen Fenoll and Carolina Escobar*.

Laboratory of Plant Physiology, Department of Environmental Sciences, Facultad de Ciencias Ambientales y Bioquímica, Universidad de Castilla-La Mancha, Avenida de Carlos III s/n, 45071 Toledo, Spain.

*Author for correspondence: Carolina Escobar. Tel: +34925268800 ext. 5476. Email: [email protected]

Download the full version at: http://www.sciencedirect.com/science/article/pii/S0065229614000068

Keywords

Auxins, Cytokinins, Endoparasitic nematodes, Giant cells, Nematode- secretions, Root development, Syncytia, Transcriptomic signatures, Transfer cells.

Abstract

Sedentary plant endoparasitic (root-knot and cyst) nematodes induce the formation of their feeding sites by directing the transdifferentiation of normal plant root cells into nematode feeding cells, namely GCs and syncytia. In the last years, transcriptomic analyses combined with molecular cell biology have revealed dramatic and specific changes in gene expression in syncytia and GCs. Among the genes whose expression is modified to establish feeding sites are those involved in hormone regulated developmental pathways in the roots, particularly those related to auxins and cytokinins. The high concentrations of auxins and cytokinins in galls and syncytia have been - 209 -

Book Chapters Already Published: Developmental Pathways and Hormones

described in detail by the use of reporter genes driven by specific promoters as “sensors” of both phytohormones, such as DR5, ARR5 or TCS. Moreover, several molecular evidences link the formation of NFS to developmental processes as maintenance of the root apical meristem, lateral root initiation or vascular tissue development, in which the two hormones are involved. The mechanisms that nematodes use to interfere with plant developmental pathways are unclear, but some seem to involve nematode secreted molecules, such as the CLE-like and the CEP peptides. Only in a few cases, plant hormone transduction and developmental circuits hijacked by nematodes to induce and maintain feeding sites have been studied in detail. Analysis combining hormone genetic sensors, mutants and comparative transcriptomics, lead to the identification of relevant plant regulators that are exploited for NFS differentiation. We present the current knowledge connecting the hormonal-controlled developmental processes of the root with the development of the NFS, which seem to be different for GCs and syncytia. For instance, LBD16 and WRKY23, two key TFs in the signal transduction leading to lateral root formation mediated by auxins, play distinctive roles during gall/GC and syncytia formation, respectively. We also highlight the evidences linking gall and GCs ontogeny to the pericycle and discuss the transfer cell-like identity of feeding cells.

Introduction

PPNs induce the formation of sophisticated feeding structures inside the root that operate as physiological sinks to supply nutrients to the nematode (Perry & Moens, 2011). Among the most damaging groups of plant parasitic nematodes (PPNs) are the root-knot nematodes (RKNs; Meloidogyne spp.) and the cyst nematodes (CNs; Heterodera spp. and Globodera spp.), representing major threats to agriculture (Bird et al., 2009; Moens et al., 2009). One of the most remarkable changes regarding cell morphogenesis directly

- 210 -

Book Chapters Already Published: Developmental Pathways and Hormones

induced by nematode effectors (See Chapters 11, 12 and 13) is the formation of GCs by RKNs and syncytia by CNs. They are cells specifically induced by nematodes to sustain their feeding and their obligated development inside the plant. Together, both nematode groups are able to infect almost all species of crops, as RKNs show a polyphagous behaviour (Moens et al., 2009), suggesting that the nematodes interfere with biological processes shared by most plant species in order to develop their feeding sites. One possibility is that they may “hijack”, at least partially, fundamental mechanisms of plant development, necessary for the survival and appropriate plant performance, as described for molecular transducers common to lateral root (LR) and gall formation (Cabrera et al., 2014a). Understanding NFS formation based on a deep knowledge of the developmental processes occurring in a non-infected root was proposed before the blast of the omics (Scheres et al., 1997). In the age of trancriptomics, when hundreds of genes have been identified as differentially expressed during the process of plant-nematode interaction, it becomes a prerequisite to connect those molecular evidences to the signalling cascades mediating developmental processes in a non-infected root. Several evidences show that PPNs develop their feeding sites through modulation or interloping of those developmental mechanisms present in the plant. This chapter summarizes the advances in this topic. The molecular mechanisms used by microorganisms to interfere with plant processes are surprisingly subtle but can effectively modify predefined plant developmental patterns. A recent example is the phytoplasma virulence protein SAP54 that promotes the degradation of flowering regulatory proteins, generating a short circuit in a developmental process that transforms flowers into leaves, helping attractiveness to leafhopper vectors for phytoplasma reproduction and propagation (MacLean et al., 2014). Similarly, effector molecules secreted by the nematodes seem to interfere with developmental pathways, although still there is a lack of clear evidence about the particular transduction cascades

- 211 -

Book Chapters Already Published: Developmental Pathways and Hormones

modified or perturbed by nematode effectors (this Chapter and Chapters 11 and 12; Lee et al., 2011).

In order to modify the molecular pathways used by the plants to develop their basic functional structures, it is reasonable to presume that the nematode interferes with the upstream hormonal control of these particular transduction cascades. In this respect, early experiments already pointed to the importance of auxins and cytokinins in the development of NFS induced within the root, as increased concentrations of both phytohormones or their precursors were detected in galls induced by RKNs (Balasubramaniam and Rangaswami, 1962; Krupasagar and Barker, 1969). More recently, mass spectrometric analysis confirmed the presence of auxins and cytokinins in the secretions of H. schachtii and M. incognita (De Meutter et al., 2003; 2005), which suggests a role for both hormones during NFS development. Moreover, the use of “hormone-sensor systems” based on reporter genes evidences the activation of both auxin and cytokinin signalling pathways in the formation/maintenance of GCs, galls and syncytia. Early experiments showing the activation of the auxin-responsive promoter GH3 in the galls formed by RKNs in white clover (Hutangura et al., 1999) have been further confirmed with the use of the synthetic auxin responsive promoter DR5. It showed a clear activation in the GCs, galls and syncytia induced by PPNs in Arabidopsis either with GUS or GFP at early (Karczmarek et al., 2004; Grunewald et al., 2009a) and late NFS developmental stages (Absmanner et al., 2013; Cabrera et al., 2014a). The activation of the DR5 based sensor occurs very early during GCs formation, as brief incubation with the GUS substrate in conditions where diffusion is minimized shows a strong signal specifically within the GCs (Fig. 1A). However, the signal was also present in the surrounding vascular cells after longer incubation times, suggesting that, not surprisingly, auxins are also present in the vascular cell layers surrounding the GCs (Fig. 1B-C; Cabrera et al., 2014a). Similarly, the activation of cytokinin regulated genes has been demonstrated by using the responsive promoter ARR5, induced during early - 212 -

Book Chapters Already Published: Developmental Pathways and Hormones

stages of the RKNs establishment (Lohar et al., 2004), and the synthetic cytokinin-responsive promoter TCS, that is induced in syncytia formed by H. schachtii in Arabidopsis but not in galls (Absmanner et al., 2013). Thereby, the overexpression in Lotus japonica of CKX, the enzyme that catalyzes the degradation of cytokinins, resulted in a reduction in the infection by RKNs (Lohar et al., 2004).

The auxin–cytokinin cross-talk is considered as the main hormonal control system regulating the developmental processes occurring in the roots, such as, the root apical meristem (RAM) maintenance, lateral root (LR) emergence or vascular tissue development (Dello Ioio et al., 2007; Bielach et al., 2012; Bishopp et al., 2011a).There are several molecular evidences showing that both hormones act antagonistically, i.e., auxins induces cell division in the meristems, while cytokinin stimulates the differentiation of these cells (reviewed in Moubayidin et al., 2009; Bishopp et al., 2011b; Bielach et al., 2012; Saini et al., 2013).

We present in this chapter the state of the art regarding our understanding of how nematodes interfere with hormone regulated developmental pathways in the roots to establish their feeding sites, particularly those related to auxins and cytokinins. New data regarding morphometric parameters after GCs reconstruction are also discussed in relation to their acquisition of transfer cell-like nature.

Nematode peptide hormones as interceptors of plant development to form feeding sites

One of the major evidences demonstrating that nematodes actively interfere with the programmed development of the roots came from the discovery of a protein, Hg-SYV46, secreted by the CN H. glycine that contains a structural motif of the CLAVATA3/ESR-related (CLE) family in Arabidopsis (Wang et al., 2001; Wang et al., 2005). CLV3-like peptide hormones have been

- 213 -

Book Chapters Already Published: Developmental Pathways and Hormones

shown to have multiple functions in many aspects of plant development and morphogenesis (Leasure and He, 2012). The similarities between CLV3 and the nematode peptide Hg-SYV46 are not merely structural. The overexpression of Hg-SYV46 in clv3 mutant plants rescues their phenotype, while Hg-SYV46 overexpression in WT plants results in strong down- regulation of WUSCHEL (WUS), similarly to that occurring in the plants overexpressing CLV3 (Wang et al., 2005). In Arabidopsis, membrane receptor kinases and several of the WUSCHEL-RELATED HOMEBOX (WOX) TFs participate in CLE signalling (Leasure and He, 2012). While CLV3 acts in the shoot apical meristem repressing the expression of WUS and regulating the SAM stem cell number through a negative feedback loop (Schoof et al., 2000), CLE40, another CLV3-like peptide, acts in the RAM regulating the expression of WOX5 (Stahl et al., 2009) through the receptor-like kinase CRINKLY4 (ACR4). Overexpression of CLE40 alters the expression of WOX5 and promotes the differentiation of distal columella stem cells to columella cells (Stahl et al., 2009). Since the description of Hg-SYV46, more CLE-like genes have been described in H. glycines (Wang et al., 2010), H. schachtii (Patel et al., 2008; Wang et al., 2011) and G. rostochiensis (Lu et al., 2009; Guo et al., 2011; see chapters 11 and 12 for detailed explanation). Functional analysis via targeting these nematode CLE-like genes in plants by RNAi (Bakhetia et al., 2007; Patel et al., 2008) or by the infection of Arabidopsis CLE receptor mutants such as clv1, clv2 and rpk2 showed a decrease in the infection rate and in the size of syncytia. These constitute experimental evidences that confirm the role of CLE-like peptides in syncytia development (Replogle et al., 2011; 2013). All these data together suggest a role of the nematode peptide hormones in the development of the syncytia in Arabidopsis, possibly interfering with the aforementioned plant developmental pathways.

The 16D10 gene from Mi encoding a secretory peptide with a CLE-like sequence also showed functional characteristics of a component of a CLE-

- 214 -

Book Chapters Already Published: Developmental Pathways and Hormones

related pathway. In vivo expression of 16D10 dsRNA in Arabidopsis resulted in an increase in the resistance against RKN (Huang et al., 2006). Additionally, the overexpression of 16D10, that directly interacts with SCARECROW-like TFs (SCR; Huang et al., 2006), does not rescue the clv3 phenotype but stimulates root growth in Arabidopsis and tobacco, i. e, calli were formed in tips cut for subculturing (Huang et al., 2006). These results demonstrate 16D10 being an effector that substantially alters plant development. SCR, expressed specifically in the endodermis and cortex/endodermis initial cells of the root (Di Laurenzio et al., 1996), is a key regulator of radial patterning in the Arabidopsis root (Levesque et al., 2006) and is also directly activated by SHORT-ROOT (SHR; Levesque et al., 2006), therefore regulating root meristem identity and root development. Strikingly, transcripts from both SCR and SHR were down- regulated in isolated GCs at 3 dpi (Barcala et al., 2010); however, transcriptomes specific of GCs are not available in earlier time points when developmental switches concerning cell development are probably crucial. Thus, the 16D10 gene constitutes another example of how nematodes could interfere with hormonal controlled developmental pathways of the root to generate their feeding sites.

The putative role of CLE-like nematode peptides might not be merely related to the meristems development. Yet, another group of CLE peptides as TDIF, a peptide hormone derived from CLE41/44 (Ito et al., 2006) that induces the expression of WOX4 in cambium cells (Hirakawa et al., 2010), participates in the vascular development by promoting the division of cambium cells preventing their differentiation into xylem. Changes in auxin levels, as those happening in nematode feeding cells, are necessary as the trigger signal for vascular development mediated by the TDIF/WOX4 pathway (Scarpella et al., 2006; Wenzel et al., 2007; Donner et al., 2009). This agrees with the high degree of similarity found between the transcriptomes of 3 dpi GCs and suspension cells treated with brassinolide/boric acid that are differentiating into tracheids (Kubo et al., 2005; Barcala et al., 2010). These findings strongly point - 215 -

Book Chapters Already Published: Developmental Pathways and Hormones

to pro- vascular cells as putative precursors of the GCs, and are in agreement to initial data based on histological observations that proposed metaxylem, protoxylem or xylem parenchyma cells as the initial cells that develop into GCs (Christie, 1936; Dropkin and Nelson, 1960; Bird, 1961; Niebel et al., 1993; Williamson & Hussey, 1996; Bird & Koltai, 2000). In addition, proliferating tracheids and phloem elements have been described around GCs and syncytia (Hoth et al., 2008; Absmanner et al., 2013; Bartlem et al., 2013). The development of these vascular elements is governed by the balance between auxins and cytokinins, as those vascular cells from the galls that differentiate into phloem elements respond to auxins, but not to cytokinins, before differentiation (Absmanner et al., 2013). In contrast, the phloem around syncytia responded to both auxins and cytokinins (Absmanner et al., 2013). An example of the interference of the RKNs with the process of the vascularization in the galls is that overexpression of the enzyme chorismate mutase, secreted by Mj, inhibits the final differentiation of root vascular cells (Doyle & Lambert, 2003), a phenotype that can be rescued by adding IAA. This suggests that nematode-secreted chorismate mutase acts by reducing IAA levels. Interestingly, both CNs and RKNs encode in their genome proteins homologues to plant chorismate mutases (Bekal et al., 2003; Jones et al., 2003; Huang et al., 2005; Vanholme et al., 2009; Chronis et al., 2014). Therefore, the secretion of chorismate mutases by PPNs might be a way to interfere with the auxin/cytokinin balance within the vascular cylinder in order to redirect the differentiation of vascular elements to NFCs.

Auxin gradients, generated by the PIN proteins, have been shown to be a common signal for the formation of different new organs in the plant (Benková et al., 2003; Vanneste & Friml, 2009). In this context, tomato plants treated with the polar auxin transport inhibitor NPA showed a reduction in the establishment of CNs and abnormal syncytia development (Goverse et al., 2000). Grunewald et al. (2009a) studied the DE of PIN coding genes during early syncytia development in Arabidopsis confirming opposite regulation for - 216 -

Book Chapters Already Published: Developmental Pathways and Hormones

different members of the family. A model was proposed in which PIN1 mediates the influx of auxins to the initial syncytia cells and PIN3 and PIN4 distribute the accumulated auxins laterally, allowing the expansion of the NFS (Grunewald et al., 2009a). Thereby, CNs infection rates and syncytia development are affected in pin3 mutant plants (Grunewald et al., 2009a). Together with PIN1, another auxin influx carrier, LAX3, that is expressed in the syncytium and in cells to be incorporated into the syncytium together with LAX1 (Lee et al., 2011), allow the syncytia growth by increasing auxin levels in the neighbouring cells. Strikingly, an effector protein from H. schachtii (Hs19C07) can interact with LAX3 (Lee et al., 2011). Additionally, AUX1, a closely related AUX/LAX family member, was up-regulated in syncytia developed by H. schachtii and in galls induced by Mi in Arabidopsis (Mazarei et al., 2003). Both the aux1/lax3 double mutant and the aux1/lax1/lax2/lax3 quadruple mutant showed significant decrease in the number of female nematodes at both 14 and 30 dpi (Lee et al., 2011), suggesting that the LAX3- Hs19C07 interaction could alter auxin levels to promote syncytia establishment. The analysis of Arabidopsis mutant lines pin1/ttg-1 and pin2 after H. schachtii infection, resulting in the reduction of nematode and syncytia development, confirmed the role of auxin transporters during the plant- nematode interaction (Goverse et al., 2000). However, most of the existing data are based on CNs and further analysis should be made in galls induced by RKNs to know the putative role of these proteins in this process.

Novel classes of peptide hormones as CEP (C-terminally Encoded Peptide) are emerging as regulators of the developmental process leading to gall formation. CEP genes have been identified in Mi and Mh genomes (Goverse & Bird, 2011; Bobay et al., 2013) but not in the false RKN Nacobbus aberrans (Eves-van den Akker, et al., 2014), neither in CNs (H. glycines and Globodera rostochiensis), migratory nematodes (Radopholus similis and Pratylenchus coffeae) nor the free-living nematode (Caenorhabditis elegans; Bobay et al., 2013). In particular, MhCEP11 from M. hapla shows a significant - 217 -

Book Chapters Already Published: Developmental Pathways and Hormones

sequence homology (Bobay et al., 2013) with the Arabidopsis-encoded CEP1 that is expressed in LR primordia. Overexpression of AtCEP1 with a constitutive promoter resulted in a reduced number of cells in the RAM (Ohyama et al., 2008). In Medicago truncatula, the constitutive overexpression of MtCEP1 altered root development in several ways, by inhibition of lateral root formation, enhancement of nodulation and cortical, epidermal and pericycle cell divisions (Imin et al., 2013). Future functional studies involving these molecules will elucidate their role as putative regulators of the gall and/or GCs formation.

Auxins, lateral root formation and feeding sites

CEPs are one of the most recently identified molecules that relate a root developmental process, LR formation, to gall development (Imin et al., 2013), but it is not the only connecting link. The aforementioned local increase of auxin levels favoured by PIN proteins is needed as well during the formation of LRs (Benkova et al., 2003). There are several pieces of evidence that point to similarities and molecular connections between the processes of LR and NFS development. Among them, it was early shown that the auxin-insensitive tomato mutant diaegotropica, dgt (Richardson and Price, 1982), which lacks LRs, was resistant to Mi and developed smaller syncytia upon CNs infection (Goverse et al., 2000). In tomato and M. truncatula, two TFs, KNOX and PHAN, are induced in both GCs and LR meristems (Bird & Koltai, 2000; Koltai et al., 2001). In Arabidopsis the down-regulation of the KNOX TF KNAT6 yields an increment in the number of LRs (Dean et al., 2004), in agreement to the suggested antagonistic action between auxins and KNOX TFs in organogenesis (reviewed in Scofield & Murray, 2006). Moreover, Barthels et al. (1997) used a promoter-tagging strategy to identify specific regulatory regions differentially activated in NFS as compared to uninfected roots. Surprisingly, among the 103 promoter tag lines that displayed a distinct activation response to nematode infection, 39 also exhibited induction at LR initiation sites. This

- 218 -

Book Chapters Already Published: Developmental Pathways and Hormones

has been further confirmed by in silico analysis of transcriptomes from galls and GCs in Arabidopsis that showed an enrichment of characteristic genes from LR initial cells in the transcriptome of 3 dpi GCs and galls (Cabrera et al., 2014a). LRs originate from divisions in the xylem pole pericycle (XPP) cells following and auxin- mediated signalling pathway. Two XPP marker lines, J0121 and J0192, showed strong and distinct GFP expression in the galls formed by Mj (Cabrera et al., 2014a; Fig.2A-B). Strikingly, in both lines GFP expression was mostly observed at both sides of the vascular cylinder and progressed inwards during gall development, which partially differs with the expression pattern found during LR formation (Laplaze et al., 2005; Cabrera et al., 2014a). In addition, the regular anticlinal and periclinal divisions observed during LR formation (Lavenus et al., 2013), were substituted by abnormal division planes in the cells proliferating inside the galls (Cabrera et al., 2014a). The expression pattern of LBD16, the gene whose promoter drives GFP expression in the J0192 enhancer trap line, mimics that of J0192 line (Fig. 2C). LBD16 expression is detected in galls from Mj and Ma from 1 dpi up to 11–15 dpi and was regulated by auxins, as shown by its inhibition by PEO-IAA, an antagonist of IAA, similarly to what happens in LR primordia (Cabrera et al., 2014a; Okushima et al., 2007; Lee et al., 2009). Although its expression at early stages appeared to correlate with the presence of auxins in the same cell types, at later stages the mere presence of auxins in the gall was not sufficient to activate LBD16 expression (Cabrera et al., 2014a). These results may indicate the necessity for a threshold level of auxins in the gall to allow LBD16 expression, which would mimic the scenario that occurs during the first divisions of LR development. However, the absence of signal in the syncytia formed in the LBD16::GUS line, where the “auxin sensor” DR5 was also activated (Karczmarek et al., 2004), suggests that other signals apart from auxins could be contributing to the early activation of LBD16 in galls and GCs. In this respect, secretions from Mi juveniles were also able to induce LBD16 expression in Arabidopsis leaf protoplasts, suggesting an activation of the

- 219 -

Book Chapters Already Published: Developmental Pathways and Hormones

LBD16 promoter by nematode secretions, in an autonomous manner. Furthermore, a reduction in gall formation of at least 20% was observed in LBD16 loss of function lines as compared to WT controls (Cabrera et al., 2014a). Interestingly, the expression pattern of the marker line ProCycB1;1:CycB1;1(NT)-GUS, active only during the G2/M transition, mimicked that of J0192 in XPP cells during early nematode establishment, and in most cells inside the vascular cylinder of the gall as the infection progressed. These results suggest that the founder cells contained in the XPP that divide to form a new LR (Péret et al., 2009) also divide during early gall formation (Cabrera et al., 2014a). LBD16 loss of function lines showed abnormal GC development, pointing to a role of the pericycle during this process. The importance of XPP-specific genes during infection in Arabidopsis was further demonstrated by genetic ablation using a J0121>>DTA line that showed a dramatic reduction in the infection and in the size of the GCs as compared to a control J0121>>GFP line (Cabrera et al., 2014a).

The induction of LBD16 during gall formation not only connects this process with LR formation but with the generation of calli (Cabrera et al., 2014a; Demeulenaere and Beeckman, 2014). LBD TFs and pericycle cells have been shown to be essential for the generation of calli from different organs through ectopic activation of a LR developmental program (Sugimoto et al., 2010). The ectopic expression of LBDs triggers spontaneous callus formation but its suppression inhibits the process (Fan et al., 2012); whether or not gall development is somehow related to this process of callus formation through the activation of a LR initiation-like program remains to be elucidated. In silico data comparison supported this hypothesis, as those genes coregulated with LBD16 in different transcriptomes were integrated in signalling cascades mediated by auxins during LR and callus formation, as a particular feature of early developing RKN feeding sites (3dpi) distinct to CNs. In contrast, cytokinin-induced genes were enriched in syncytia, whose transcriptomes hold a high similarity with the transcriptome of shoot - 220 -

Book Chapters Already Published: Developmental Pathways and Hormones

regeneration from callus, modulated by cytokinins (Cabrera et al., 2014b, c). In agreement with these analyses, subtle changes in the balance between cytokinin and auxin levels could be mediating the appearance of chloroplast- like structures inside 7dpi GCs induced by M. graminicola in rice, as showed by confocal microscopy (Kyndt et al., 2013; Ji et al., 2013) and in syncytia (Szakasits et al., 2009). Transcriptomic studies performed in isolated GCs and syncytia in the last recent years reflected the predominance of genes regulated by phytohormones among the DEG as compared to non-infected tissues (reviewed in Escobar et al., 2011; Cabrera et al., 2014b, c). In this way, a direct in silico comparison of the transcriptomes of isolated GCs and syncytia at early developmental stages in Arabidopsis and the transcriptomes from seedlings treated with exogenous phytohormones contributed to increase the vast number of genes regulated by hormones that are also induced or repressed in NFCs (Cabrera et al., 2014b, c). Clear differences between the hormone- related transcriptional balances of the two NFC types were found. While the percentage of auxin-induced genes stands out (26%) in GCs, in syncytia there are 21% of cytokinin-induced genes. On the contrary, in GCs there are more cytokinin-repressed genes as compared to those up-regulated; but in syncytia the number of cytokinin up-regulated genes is higher than the number of down- regulated ones. Interestingly, the number of genes repressed by auxins or cytokinins in GCs or syncytia was high, suggesting that gene repression driven by these hormones may be also crucial for the development of the NFS (Cabrera et al., 2014b, c).

WRKY23 is another TF regulated by auxins and induced by both RKN and CN. Loss of function lines showed an increased resistance to CNs (Grunewald et al., 2009a). WRKY23 acts downstream of the signalling cascade (SLR/IAA14)-(auxin responsive factors) (ARF7/ARF19) during NFs and LR formation (Grunewald et al., 2008; Bielach et al., 2012) and it is needed for LR development through the stimulation of local flavonols biosynthesis (Grunewald et al., 2012). However, WRKY23 expression is activated in NFS by an - 221 -

Book Chapters Already Published: Developmental Pathways and Hormones

independent auxin pathway, suggesting the existence of other nematode- dependent signals in regulating WRKY23 expression. This could be also the case for LBD16 expression that is activated by nematode secretions as previously mentioned (Cabrera et al., 2014a). Other members of the LBDs TFs family as LBD41, are activated in both M. incognita and H. schachtii feeding sites (Fuller et al., 2007), in agreement with transcriptomic analysis of GCs in Arabidopsis (Barcala et al., 2010).

The expression patterns of crucial molecular components of the auxin- signalling pathway, encoded by genes of the ARFs family, have been recently addressed during syncytium development in Arabidopsis (Hewezi et al., 2014). At early infection stages, 2–3 days after H. schachtii infection, ARF3, 6, 10–12, 14, 15 and 20–22 were expressed inside the developing syncytium, while ARF1, 2, 4, 5, 9, 18 and 19 were active in both syncytial and neighbour cells. ARF7 and 17 were mainly expressed at the edges of the syncytial and neighbouring cells and ARF8 and 16 showed a weak response to H. schachtii infection (Hewezi et al., 2014). At 9–10 days after infection, ARF1–3, 7, 17 and 20–22 were expressed in fully developed syncytium, whereas the expression of the other ARFs was restricted to the syncytial cells around the nematode head (Hewezi et al., 2014). Although still under investigation, the DE patterns of the ARFs genes seem to be essential for the correct development of the CNs feeding cells. All these data suggest a subtle and complex regulation of auxin-mediated pathways based on a tight temporal and spatial control of molecular components such as ARFs in CNs feeding sites. A lack of knowledge of the regulation of these genes after RKN infection is still faced.

Giant cells morphogenesis and transfer cells nature

In the previous sections, we described parallelisms between feeding site formation and developmental programs during the plant life cycle, such as LR formation. Although syncytia and GCs differ in their ontogeny and global - 222 -

Book Chapters Already Published: Developmental Pathways and Hormones

transcriptional signatures, both develop cell wall ingrowths (CWIs) to facilitate high rates of apoplastic/symplastic solute exchange. Both feeding site types also show similarities to the transfer cells (TC) that appear in different plant organs during plant development (reviewed in Offler et al., 2003).

In GCs the amplification of the plasma membrane surface area could be up to 20-fold (reviewed in Jones & Goto, 2011). Syncytia induced by H. schachtii are symplastically isolated at 10-15 dpi (Hofmann et al., 2007) and the CWIs are smaller in male than in female-developed syncytia, suggesting that CI size control is based on the nutrient demand of the nematode (reviewed in Sobczak & Golinowski, 2008). Recently, three-dimensional reconstruction and volume measurements of GCs in Arabidopsis (Cabrera et al., 2014e) brought some interesting findings that might explain, at least partially, their TCs characteristics. The abnormally large size of the GCs implies a reduction in their surface area to volume ratio (SA:V ratio; Cabrera et al., 2014e), what may compromise its functioning during nematode nourishing. Thus, the extensive formation of wall ingrowths lined with plasma membrane at certain developmental stages that defines them as TCs (Jones & Dropkin, 1976; Siddique et al., 2012) could be a response for a functional requirement to compensate the decrease of the S/V ratio as the GCs expand (reviewed in Rodiuc et al., 2014; Cabrera et al., 2014e). Moreover, size regulation affects cell function in multiple ways, e.g., not only nutrient and water movement can be changed by altered surface/volume ratio, but intercellular signalling might be influenced by changes in cell size and geometry. Recent studies in yeast revealed that transcription also changes specifically in response to cell dimensions (Wu et al., 2010; Sablowski & Dornelas, 2014).

Cell wall anatomy and composition in NFCs are quite similar to other TCs that develop in plants, and it is mainly composed of polysaccharides such as cellulose, hemicelluloses and pectin (reviewed in Rodiuc et al., 2014). Although regulatory signals for TC differentiation are not well known, the TF - 223 -

Book Chapters Already Published: Developmental Pathways and Hormones

ZmMRP-1, that has been described as a key component in the pathway leading to the formation of the TCs (Gomez et al., 2002), is also induced in Arabidopsis galls (Barrero et al., 2009). Auxins and ethylene are the major phytohormones described as regulators of TC differentiation from several cell types (Dibley et al., 2009; Thiel et al., 2008, 2012a,b; Zhou et al., 2010; Xiong et al., 2011). Common genes related to the auxin signalling cascades and transport from the IAA/ARF/PIN families play a role and/or show differential regulation in both TCs and NFCs (reviewed in Cabrera et al., 2014d; this chapter). Genes related with ethylene synthesis and signalling as those encoding membrane receptors, ACC oxidases or ACC synthase, are also to be induced in NFS (Tucker, 2010; Cabrera et al., 2014d). Increased concentration of ethylene in tomato galls was described long ago (Glazer et al., 1983). Moreover, functional analysis performed with ethylene-related mutants reinforce the importance of this hormone during plant-nematode interaction as ethylene overproducing mutants eto2 and eto3 were more susceptible to CNs (Goverse et al., 2000; Wubben et al., 2001). Interestingly, ethylene overproduction in eto2 mutants stimulated the formation of CWIs or protuberances in syncytia along the vascular tissue, at late infection stages (Goverse et al., 2000), providing a direct evidence for a putative role of ethylene in the stimulation of syncytia TCs identity. In the other hand, mutants compromised in the ethylene signalling cascade (etr1-1, ein2-1, ein3-1, eir1-1, and axr2) showed a lower susceptibility to the infection by CNs (Wubben et al., 2001; Goverse et al., 2000). Interestingly, the most clarifying study of a functional implication in TCs characteristic of NFCs, as the CWIs formation, comes from the analysis of UDP-glucose dehydrogenase (UGD) coding genes. UGDs act through oxidation of UDP-glucose producing several cell wall polysaccharides. UGD2 and UGD3 are necessary for the production of CWIs in syncytia and loss of function in double mutants severely affected nematode development (Siddique et al., 2012).

- 224 -

Book Chapters Already Published: Developmental Pathways and Hormones

In conclusion, there are several evidences that nematodes may interfere or partially “hijack” signal transduction pathways used by the plant to initiate and/or maintain developmental processes where auxins and cytokinins play a central role, such as SAM and RAM maintenance, and LR and vascular tissue formation. Additionally, nematodes may also interfere with transduction pathways leading to the differentiation of specialized plant cell types such as TCs. The understanding of the plant molecular components necessary to reprogram normal plant cells into NFCs are an outstanding topic to be deciphered, what would contribute to the basic understanding of the plant- nematode interaction. This will also help to identify the interactions of nematode effectors with plant components, and at the end, their mode of action while interfering with the plant developmental programs. Furthermore, this knowledge will constitute a powerful tool for engineering nematode resistance in plants and to direct the search for specific nematode control strategies.

- 225 -

- 226 -

Book Chapters Already Published: A Standardized Method To Asses Infection Rates

10.2. - A STANDARDIZED METHOD TO ASSESS INFECTION RATES OF ROOT-KNOT AND CYST NEMATODES IN ARABIDOPSIS THALIANA MUTANTS WITH ALTERATIONS IN ROOT DEVELOPMENT RELATED TO AUXIN AND CYTOKININ SIGNALLING Rocío Olmo*, Ana Cláudia Silva*, Fernando E. Díaz-Manzano, Javier Cabrera, Carmen Fenoll and Carolina Escobarϯ.

Facultad de Ciencias Ambientales y Bioquímica, Universidad de Castilla-La Mancha, Av. Carlos III s/n, E-45071 Toledo, Spain.

ϯ Corresponding Author: [email protected]

* These authors contribute equally to this work.

Download the full version at: http://link.springer.com/protocol/10.1007%2F978-1-4939-6831-2_5

Summary

PPNs cause a great impact in agricultural systems. The search for effective control methods is partly based on the understanding of underlying molecular mechanisms leading to the formation of NFS. In this respect, crosstalk of hormones such as auxins and cytokinins (IAA, CK) between the plant and the nematode seems to be crucial. Thence, the study of loss of function or overexpressing lines with altered IAA and CK functioning is entailed. Those lines frequently show developmental defects in the number, position and/or length of the lateral roots what could generate a bias in the interpretation of the nematode infection parameters. Here we present a protocol to assess differences in nematode infectivity with the lowest interference of root architecture phenotypes in the results. Thus, tailored growth conditions and normalization parameters facilitate the standardized phenotyping of nematode infection. - 227 -

Book Chapters Already Published: A Standardized Method To Asses Infection Rates

Keywords

Auxin; Cytokinin; Root-knot nematodes; Cyst nematodes; Lateral root; Infection assay.

Introduction

The phytohormones auxin (IAA) and cytokinin (CK) antagonistically regulate the formation and development of the lateral roots in plants. CK negatively regulates the formation of lateral roots while IAA induces their development (1). Therefore, plant lines carrying mutations in genes related with the IAA and CK signaling pathways show developmental defects in the number, position and/or length of the lateral roots (2).

Plant parasitic nematodes (PPNs), root-knot nematodes (RKNs) and the cyst nematodes (CNs), constitute one of the major pest for the agriculture these days, causing important yield losses every year worldwide (3). RKNs and CNs are obligate parasites and need to establish in the plant roots to complete their life cycle (4, 5). Therefore, root shape and architecture strongly affect the penetration and establishment capacities of these parasites into the roots. RKNs penetrate intercellularly into the roots through the root tip; therefore the number of available root tips in the plant should be taken into account to measure their infectivity capacity. CNs, however, penetrate intracellularly into the root through any part of the root surface and therefore, root number and length are the parameters to be considered. Several studies reinforce the role of the IAAs and CKs signaling pathways during RKNs and CNs establishment (6, 7, 8, 9, 10). Moreover, it has been demonstrated that the nematode secretions contain IAAs and CKs that could alter the balance of these two phytohormones in the infection site (9, 11, 12). Additionally, genes directly involved in the IAA signaling pathway leading to the formation of lateral roots are crucial during the CNs and RKNs infection (7, 13, 14).

- 228 -

Book Chapters Already Published: A Standardized Method To Asses Infection Rates

Infection tests are used routinely for the study of the plant- nematode interactions as a way to infer the impact of the loss of function or overexpression of a gene during the nematode infection by comparing the number of infections between mutant/transgenic and WT plants. Plants affected in the IAA and CK signaling or synthesis pathways show developmental defects in the number, position and/or length of the lateral roots (2) what could generate a bias in the interpretation of the nematode infection parameters. Therefore, to assess differences in infectivity with the lowest interference of root architecture in the final data is unavoidable to design growth conditions and to stablish normalization parameters that could facilitate the standardized phenotyping of nematode infection in these lines with altered root-growth. Bearing this in mind, we developed a modified infection test system in which the root phenotypes of WT and mutant/transgenic plants are equivalent at inoculation time. This method is suitable to assess nematode- infection parameters in mutant/transgenic plants affected in the IAA and CK signaling pathways with altered root systems. It facilitates the measurement of the number and length of the roots to normalize the number of infections. Moreover, our system could be useful for the study of those plant lines interacting with other root microorganisms.

Material

2.1 Medium preparation and Arabidopsis thaliana seeds sterilisation and sowing:

1. Modified Gamborg B5 medium: 15 g/L sucrose, 3.05 g/L Gamborg B5 basal salt mixture including vitamins, 6 g/L Daishin Agar and adjust the pH to 7.0 with 1M KOH.

2. 90mm Ø Petri dishes.

- 229 -

Book Chapters Already Published: A Standardized Method To Asses Infection Rates

3. A. thaliana mutant/transgenic plants with alterations in root development plus the correspondent WT accessions for comparison.

4. Sterilization solution: 30% commercial bleach (35 gr. of active chlorine per L) with 1µg/µL Tritón X-100

5. 1.5 mL Eppendorf® tubes.

6. Nutating mixer.

7. Sterile distilled water.

8. Laminar flow hood cabinet.

9. Micropipettes.

10. Micropipette tips (20-200 µL).

11. Parafilm®.

12. Aluminium foil.

13. Growth chamber.

2.2 Nematode inoculation:

1. Sterile cell strainer (70 µm nylon mesh).

2. 50 mL beaker.

3. 300-400 mL glass jar with hermetic lid.

4. Tweezers.

5. Glass bead sterilizer.

- 230 -

Book Chapters Already Published: A Standardized Method To Asses Infection Rates

6. Sterile tap water.

7. 3 mM ZnCl2 solution.

8. Microscope slides.

9. Stereomicroscope.

10. Modified Gamborg B5 medium (see recipe above).

11. Micropipettes.

12. Micropipette tips.

13. Parafilm®.

14. Aluminium foil.

15. Growth chamber.

16. Gauze.

2.3 Measurement of infection parameters:

1. Stereomicroscope.

2. Scanner.

3. ImageJ software (15).

4. Microsoft® Excel.

- 231 -

Book Chapters Already Published: A Standardized Method To Asses Infection Rates

Methods

3.1 Medium preparation, Arabidopsis thaliana seeds sterilisation and sowing:

1. Prepare 1 L of modified Gamborg B5 medium as indicated in the recipe and autoclave (121ºC for 20 min, +1 atm) – see Note 1.

2. Pour media into 90mm Ø petri dishes (around 25 mL/plate) and let them to solidify (see Note 2).

3. Surface sterilize A. thaliana seeds (50 to 100 seeds) in a 1.5 mL Eppendorf® tube per independent line with 1 mL sterilization solution for 12 minutes in constant agitation in a nutating mixer.

4. Discard the solution and rinse the seeds 5-6 times, each with 1mL sterile distilled water in the Eppendorf® tube.

5. Immediately after the last washing step, place 8-10 seeds in a single row with the help of a micropipette in the upper area of the previously prepared modified Gamborg B5 media plates (Fig.1a) – see Note 3.

6. Seal the plates with Parafilm® and cover them with aluminium foil. Keep the plates at 4 °C for 2 days for seed stratification, thereby promoting the synchronous germination of all the seeds.

7. Transfer the plates to a growth chamber at 23°C with a LD photoperiod (16-8 hours light-dark; 0% humidity - see Note 4 - 104 µmol/m2.s light intensity) for 5 days. Place the plates allowing the plants to grow vertically to prevent early appearance of lateral roots. Five days after germination, roots should not show any lateral root (Fig. 1b). Therefore, the root phenotypes of the WT (controls) and the mutant/transgenic plants for the IAA/CK signalling pathways should be similar regarding lateral root appearance. For infection with CNs root length is also considered (see Note 5). - 232 -

Book Chapters Already Published: A Standardized Method To Asses Infection Rates

3.2 Inoculation with RKNs:

1. Prepare a hatching jar with 5 mL of sterile tap water and collect 50 egg masses from previously inoculated cucumber seedlings growth in monoaxenic conditions, accordingly to Díaz-Manzano et al. (16).

2. Inoculate each root tip with around 10 nematodes (see Note 6). Each root tip should be inoculated independently to ensure that each plant is inoculated with the same amount of nematodes.

3. Add 1 mL of a thin layer of temperate modified Gamborg B5 medium on the top of the root tips until covering them (see Note 7), hence facilitating nematode penetration. When the plants are maintained vertically, the roots grow over the medium surface and do not penetrate into the agar (Fig. 1c). RKNs have more difficulties to penetrate into roots grown in the root surface; hence it is necessary to add this temperate medium layer to cover the roots.

4. When the medium is solidified, seal again the plates with Parafilm®, cover them with aluminium foil (see Note 8) and transfer them to a growth chamber at 23°C with a LD photoperiod (16-8 hours light-dark; 0% humidity) for 3 days keeping them vertically.

5. Revise the plates every 12 hours after inoculation under the stereomicroscope for nematode penetration. The first day post infection is established when the nematode is inside the root. It is recommended to label a dot in the back of the plate with a coloured marker pen indicative of the T0 infection time.

6. Three days post inoculation; remove the aluminium foil and cover the plates with gauze to protect the plants and the nematodes from an excessive light exposure. Light intensity received by the plants at this point is 48 µmol/m2.s (Fig. S1) (see Note 9).

- 233 -

Book Chapters Already Published: A Standardized Method To Asses Infection Rates

3.3 Inoculation with CNs:

1. Heterodera spp. juveniles are obtained by the method described by Bohlmann and Wieczorek (17).

2. Inoculate each root with around 10 nematodes (see Note 6).

3. Follow the same steps 3-6 described above for RKNs inoculation.

3.4 Measurement of infection parameters for RKNs:

1. Count the number of galls at 14 days post inoculation per main root under a stereomicroscope (Fig. 2). Avoid counting those galls induced by RKNs in the lateral roots grown after the inoculation was made.

2. Before the inoculation, the plates should be scanned in order to record the number of main roots per plant and its length by using the imaging software ImageJ (15).

3. Calculate infection rates (number of galls per plant or main root) with the help of a spreadsheet such as Microsoft® Excel and compare the results between the WT and the mutant line with alterations in root development. This protocol can be followed by galls phenotyping to check differences in size (18).

3.5 Measurement of infection parameters for CNs:

1. Count the number of females and males at 14 days post inoculation per main root under a stereomicroscope (Fig. 2). Avoid counting those syncytia induced in the lateral roots grown after the inoculation if present.

2. Before the inoculation, the plates should be scanned in order to record the number of main roots per plant and its length by using the imaging software ImageJ (15).

- 234 -

Book Chapters Already Published: A Standardized Method To Asses Infection Rates

3. Calculate infection rates (number of females and males per plant; total number of nematodes per plant and female/male ratio per plant and line) with the help of a spreadsheet such as Microsoft® Excel and compare the results between the WT and the mutant line with alterations in root development. As every plant has been imaged, it should be easy to measure the main root length per plant and refer the infection rates to the root length by using the straight, segmented or freehand line tools from the image software ImageJ. Alternatively measure it directly in the plate with a ruler.

Notes

1. From this step onwards, the protocol must be carried out under sterile conditions in a laminar flow cabinet.

2. Plates can be parafilm–sealed and stored at 4ºC if they are not going to be immediately used. Do not allow accumulation of liquid on the medium surface as it will promote future contaminations.

3. It is recommendable to prepare 5 plates with 8-10 seeds per line and per assay in order to have around 50 plants per line and a good infection rate for each one of them.

4. Humidity in the growth chamber should be set to 0% to avoid accumulation of water inside the plates and therefore to prevent their contamination.

5. Before inoculation, WT and mutant line roots should be qualitatively compared. For both CNs and RKNs, the roots that present a considerable different size as compared to the rest within a plate/line should be removed.

6. Take up the necessary volume from the hatching jar containing 10 nematodes with an automatic pipette and add it directly into the root tip.

- 235 -

Book Chapters Already Published: A Standardized Method To Asses Infection Rates

The number of J2/mL is normally assessed under a stereomicroscope by counting the number of J2s in 3 independent 30 µL drops from the hatching jar. The average among the three estimations (16) is considered.

7. The medium should be at approximately 30°C and should only cover the plant roots and not the aerial part. The temperature could be measured in the laminar flow chamber with an acetone- cleaned thermometer.

8. The plates should be covered by aluminium foil for 3 days in order to facilitate the nematode penetration on the plant roots in darkness.

9. The gauze should replace the aluminium foil in order to avoid etiolation of the plants, while protecting the nematodes from an excessive light exposition detrimental for the infection.

- 236 -

11. - BIBLIOGRAPHY

- 237 -

Meloidogyne javanica giant cell fixed with propidium iodide

- 238 -

Bibliography

Abad, P., & Williamson, V. M. (2010). Plant nematode interaction: a sophisticated dialogue. Advances in Botanical Research, 53, 147-192.

Abe, M., Kobayashi, Y., Yamamoto, S., Daimon, Y., Yamaguchi, A., Ikeda, Y., ... & Araki, T. (2005). FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science, 309(5737), 1052-1056.

Abelenda, J. A., Navarro, C., & Prat, S. (2011). From the model to the crop: genes controlling tuber formation in potato. Current Opinion in Biotechnology, 22(2), 287-292.

Absmanner, B., Stadler, R., & Hammes, U. Z. (2013). Phloem development in nematode-induced feeding sites: the implications of auxin and cytokinin. Frontiers in Plant Science, 4, 241.

Addo-Quaye, C., Eshoo, T. W., Bartel, D. P., & Axtell, M. J. (2008). Endogenous siRNA and miRNA Targets Identified by Sequencing of the Arabidopsis Degradome. Current Biology, 18(10), 758-762.

Ali, M. A., Abbas, A., Kreil, D. P., & Bohlmann, H. (2013). Overexpression of the transcription factor RAP2. 6 leads to enhanced callose deposition in syncytia and enhanced resistance against the beet cyst nematode Heterodera schachtii in Arabidopsis roots. BMC Plant Biol., 13(1), 1.

Álvarez-Venegas, R., Pien, S., Sadder, M., Witmer, X., Grossniklaus, U., & Avramova, Z. (2003). ATX-1, an Arabidopsis homolog of trithorax, activates flower homeotic genes. Current Biology, 13(8), 627-637.

Ammiraju, J. S., Veremis, J. C., Huang, X., Roberts, P. A., & Kaloshian, I. (2003). The heat-stable root-knot nematode resistance gene Mi-9 from Lycopersicon peruvianum is localized on the short arm of chromosome 6. Theoretical and Applied Genetics, 106, 478-484.

- 239 -

Bibliography

Andrés, M. F., González-Coloma, A., Sanz, J., Burillo, J., & Sainz, P. (2012). Nematicidal activity of essential oils: a review. Phytochemistry Reviews, 11(4), 371-390.

Anjam, M. S., Ludwig, Y., Hochholdinger, F., Miyaura, C., Inada, M., Siddique, S., & Grundler, F. M. (2016). An improved procedure for isolation of high-quality RNA from nematode-infected Arabidopsis roots through laser capture microdissection. Plant Methods, 12(1), 1.

Atkinson, J. A., Rasmussen, A., Traini, R., Voß, U., Sturrock, C., Mooney, S. J., ... & Bennett, M. J. (2014). Branching out in roots: uncovering form, function, and regulation. Plant Physiology, 166(2), 538-550.

Aukerman, M. J., & Sakai, H. (2003). Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes. The Plant Cell, 15, 2730-2741.

Balmer, D., & Mauch-Mani, B. (2013). Small yet mighty–microRNAs in plant-microbe interactions. MicroRNA, 2(1), 73-80.

Barbary, A., Palloix, A., Fazari, A., Marteu, N., Castagnone-Sereno, P., & Djian-Caporalino, C. (2014). The plant genetic background affects the efficiency of the pepper major nematode resistance genes Me1 and Me3. Theoretical and Applied Genetics, 127(2), 499-507.

Barbary, A., Djian‐Caporalino, C., Palloix, A., & Castagnone‐Sereno, P. (2015). Host genetic resistance to root‐knot nematodes, Meloidogyne spp., in Solanaceae: from genes to the field. Pest Management Science, 71(12), 1591- 1598.

Barcala, M., García, A., Cubas, P., Almoguera, C., Jordano, J., Fenoll, C., & Escobar, C. (2008). Distinct heat-shock element arrangements that mediate the heat shock, but not the late-embryogenesis induction of small

- 240 -

Bibliography

heat-shock proteins, correlate with promoter activation in root-knot nematode feeding cells. Plant Molecular Biology, 66(1-2), 151-164.

Barcala, M., García, A., Cabrera, J., Casson, S., Lindsey, K., Favery, B., ... & Escobar, C. (2010). Early transcriptomic events in microdissected Arabidopsis nematode‐induced giant cells. The Plant Journal, 61(4), 698-712.

Bargmann, B. O., Vanneste, S., Krouk, G., Nawy, T., Efroni, I., Shani, E., ... & Birnbaum, K. D. (2013). A map of cell type‐specific auxin responses. Molecular Systems Biology, 9(1), 688.

Barrangou, R., & Marraffini, L. A. (2014). CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity. Molecular Cell, 54(2), 234-244.

Barthels, N., van der Lee, F. M., Klap, J., Goddijn, O. J., Karimi, M., Puzio, P., ... & Sijmons, P. C. (1997). Regulatory sequences of Arabidopsis drive reporter gene expression in nematode feeding structures. The Plant Cell, 9(12), 2119-2134.

Bartlem, D. G., Jones, M. G., & Hammes, U. Z. (2013). Vascularization and nutrient delivery at root-knot nematode feeding sites in host roots. Journal of Experimental Botany, ert415.

Berg, R. H., Fester, T., & Taylor, C. G. (2008). Development of the root- knot nematode feeding cell. In R. H. Berg, & C. G. Taylor (Eds.), Cell Biology of Plant Nematode Parasitism (pp. 115-152). Berlin: Springer.

Betsuyaku, S., Takahashi, F., Kinoshita, A., Miwa, H., Shinozaki, K., Fukuda, H., & Sawa, S. (2011). Mitogen-activated protein kinase regulated by the CLAVATA receptors contributes to shoot apical meristem homeostasis. Plant and Cell Physiology, 52(1), 14-29.

- 241 -

Bibliography

Bhatia, N., Bozorg, B., Larsson, A., Ohno, C., Jönsson, H., & Heisler, M.G. Auxin Acts through MONOPTEROS to Regulate Plant Cell Polarity and Pattern Phyllotaxis. Current Biology, 26, 1-7.

Bird, A. F. (1961). The ultrastructure and histochemistry of a nematode- induced giant cell. The Journal of Bioph and Bioch Cytology, 11(3), 701-715.

Bird, D. M., & Koltai, H. (2000). Plant parasitic nematodes: habitats, hormones, and horizontally acquired genes. Journal of Plant Growth Regulation, 19(2), 183-194.

Blaxter, M. (2011). Nematodes: the worm and its relatives. PLoS Biol, 9(4), e1001050.

Bleve-Zacheo, T., & Melillo, L.T. (1997). The biology of giant cells. In C. Fenoll, F.M.W. Grundler, & S.A. Ohl (Eds), Cellular and Molecular Aspects of Plant-Nematode Interactions (pp. 65-79). Dordrecht, The Netherlands: Kluwer Academic Publishers.

Bobay, B. G., DiGennaro, P., Scholl, E., Imin, N., Djordjevic, M. A., & Mck Bird, D. (2013). Solution NMR studies of the plant peptide hormone CEP inform function. FEBS Letters, 587(24), 3979-3985.

Boivin, S., Fonouni-Farde, C., & Frugier, F. (2016). How auxin and cytokinin phytohormones modulate root microbe interactions. Frontiers in Plant Science, 7, 1240.

Bologna, N. G., & Voinnet, O. (2014). The diversity, biogenesis, and activities of endogenous silencing small RNAs in Arabidopsis. Annual Review of Plant Biology, 65, 473-503.

Borges, F., & Martienssen, R. A. (2015). The expanding world of small RNAs in plants. Nature Reviews Molecular Cell Biology, 16, 727-741.

- 242 -

Bibliography

Bouche, F., D’Aloia, M., Tocquin, P., Lobet, G., Detry, N., & Perilleux, C. (2016). Integrating roots into a whole plant network of flowering time genes in Arabidopsis thaliana. Scientific Reports, 6, 29042.

Bouchez, D., Camilleri, C., & Caboche, M. (1993). A binary vector based on Basta resistance for in planta transformation of Arabidopsis thaliana. Comptes Rendus de l'Académie des Sciences. Série 3, Sciences de la Vie, 316(10), 1188-1193.

Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., ... & Benfey, P. N. (2007). A high-resolution root spatiotemporal map reveals dominant expression patterns. Science, 318(5851), 801-806.

Breyer, D., Herman, P., Brandenburger, A., Gheysen, G., Remaut, E., Soumillion, P., ... & Reheul, D. (2009). Commentary: Genetic modification through oligonucleotide-mediated mutagenesis. A GMO regulatory challenge? Environmental Biosafety Research, 8(02), 57-64.

Cabello, S., Lorenz, C., Crespo, S., Cabrera, J., Ludwig, R., Escobar, C., & Hofmann, J. (2014). Altered sucrose synthase and invertase expression affects the local and systemic sugar metabolism of nematode-infected Arabidopsis thaliana plants. Journal of Experimental Botany, 65(1), 201-212.

Cabrera, J., Bustos, R., Favery, B., Fenoll, C., & Escobar, C. (2014a). NEMATIC: a simple and versatile tool for the in silico analysis of plant– nematode interactions. Molecular Plant Pathology, 15(6), 627-636.

Cabrera, J., Díaz-Manzano, F. E., Sánchez, M., Rosso, M.-N., Melillo, T., …, & Escobar, C. (2014b). A role for LATERAL ORGAN BOUNDARIES- DOMAIN 16 during the interaction Arabidopsis–Meloidogyne spp. provides a molecular link between lateral root and root-knot nematode feeding site development. New Phytologist, 203, 632-645.

- 243 -

Bibliography

Cabrera, J., Díaz‐Manzano, F. E., Barcala, M., Arganda‐Carreras, I., Almeida-Engler, J., Engler, G., ... & Escobar, C. (2015a). Phenotyping nematode feeding sites: three‐dimensional reconstruction and volumetric measurements of giant cells induced by root‐knot nematodes in Arabidopsis. New Phytologist, 206(2), 868-880.

Cabrera, J., Fenoll, C., & Escobar, C. (2015b). Genes co-regulated with LBD16 in nematode feeding sites inferred from in silico analysis show similarities to regulatory circuits mediated by the auxin/cytokinin balance in Arabidopsis. Plant Signaling & Behavior, 10(3), e990825.

Cabrera, J., Díaz-Manzano, F.E., Fenoll, C., & Escobar, C. (2015c). Developmental Pathways Mediated by Hormones in Nematode Feeding Sites. In C. Escobar, & C. Fenoll (Eds.), Advances in Botanical Research, Vol. 73 (pp. 167-188). Oxford, UK: Elsevier.

Cabrera, J., Barcala, M., García, A., Rio‐Machín, A., Medina, C., Jaubert‐Possamai, S., ... & Escobar, C. (2016a). Differentially expressed small RNAs in Arabidopsis galls formed by Meloidogyne javanica: a functional role for miR390 and its TAS3‐derived tasiRNAs. New Phytologist, 209(4), 1625- 1640.

Cabrera, J., Barcala, M., Fenoll, C., & Escobar, C. (2016b). The Power of Omics to Identify Plant Susceptibility Factors and to Study Resistance to Root-Knot Nematodes. Current Issues in Molecular Biology, 19, 53.

Caillaud, M. C., Dubreuil, G., Quentin, M., Perfus-Barbeoch, L., Lecomte, P., de Almeida-Engler, J., ... & Favery, B. (2008). Root-knot nematodes manipulate plant cell functions during a compatible interaction. Journal of Plant Physiology, 165(1), 104-113.

- 244 -

Bibliography

Cardona, A., Saalfeld, S., Schindelin, J., Arganda-Carreras, I., Preibisch, S., Longair, M., ... & Douglas, R. J. (2012). TrakEM2 software for neural circuit reconstruction. PloS One, 7(6), e38011.

Castagnone‐Sereno, P., Bongiovanni, M., & Djian‐Caporalino, C. (2001). New data on the specificity of the root‐knot nematode resistance genes Me1 and Me3 in pepper. Plant Breeding, 120(5), 429-433.

Castagnone-Sereno, P. (2012). Meloidogyne enterolobii (= M. mayaguensis): profile of an emerging, highly pathogenic, root-knot nematode species. Nematology, 14(2), 133-138.

Chandler, J. W. (2011). Founder cell specification. Trends in Plant Science, 16(11), 607-613.

Chang, L., Ramireddy, E., & Schmülling, T. (2015). Cytokinin as a positional cue regulating lateral root spacing in Arabidopsis. Journal of Experimental Botany, 66(15), 4759-4768.

Chapman, E. J., & Estelle, M. (2009). Mechanism of auxin-regulated gene expression in plants. Annual Review of Genetics, 43, 265-285.

Chapman, E. J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T. P., & Estelle, M. (2012). Hypocotyl transcriptome reveals auxin regulation of growth-promoting genes through GA-dependent and-independent pathways. PLoS One, 7(5), e36210.

Chen, X. (2004). A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science, 303, 2022-2025.

Chu, Y., Wu, C. L., Holbrook, C. C., Tillman, B. L., Person, G., & Ozias- Akins, P. (2011). Marker-assisted selection to pyramid nematode resistance and the high oleic trait in peanut. The Plant Genome, 4, 110-117.

- 245 -

Bibliography

Chuck, G., Meeley, R., Irish, E., Sakai, H., & Hake, S. (2007). The maize tasselseed4 microRNA controls sex determination and meristem cell fate by targeting Tasselseed6/indeterminate spikelet1. Nature Genetics, 39(12), 1517-1521.

Coego, A., Brizuela, E., Castillejo, P., Ruíz, S., Koncz, C., Del Pozo, J. C., ... & León, J. (2014). The TRANSPLANTA collection of Arabidopsis lines: a resource for functional analysis of transcription factors based on their conditional overexpression. The Plant Journal, 77(6), 944-953.

Coelho, R. R., Vieira, P., de Souza Júnior, A., Dijair, J., Martin‐Jimenez, C., De Veylder, L., ... & Almeida Engler, J. (2017). Exploiting cell cycle inhibitor genes of the KRP family to control root‐knot nematode induced feeding sites in plants. Plant, Cell & Environment, 12912.

Curtis, R. H. (2007). Do phytohormones influence nematode invasion and feeding site establishment? Nematology, 9(2), 155-160.

Damiani, I., Baldacci‐Cresp, F., Hopkins, J., Andrio, E., Balzergue, S., Lecomte, P., ... & Hérouart, D. (2012). Plant genes involved in harbouring symbiotic rhizobia or pathogenic nematodes. New Phytologist, 194(2), 511- 522.

Dastidar, M. G., Jouannet, V., & Maizel, A. (2012). Root branching: mechanisms, robustness, and plasticity. Wiley Interdisciplinary Reviews: Developmental Biology, 1(3), 329-343.

Davide, R. G., & Triantaphyllou, A. C. (1967). Influence of the environment on development and sex differentiation of root-knot nematodes. Nematologica, 13(1), 102-110.

Davies, P. J. (2010). The plant hormones: their nature, occurrence, and functions. In Plant Hormones (pp. 1-15). Netherlands: Springer. - 246 -

Bibliography

De Almeida-Engler, J., De Vleesschauwer, V., Burssens, S., Celenza, J. L., Inzé, D., ... & Gheysen, G. (1999). Molecular markers and cell cycle inhibitors show the importance of cell cycle progression in nematode-induced galls and syncytia. The Plant Cell, 11(5), 793-807.

De Almeida-Engler, J., De Groodt, R., Van Montagu, M., & Engler, G. (2001). In situ hybridization to mRNA of Arabidopsis tissue sections. Methods, 23(4), 325-334.

De Almeida-Engler, J., Van Poucke, K., Karimi, M., De Groodt, R., Gheysen, G., Engler, G., & Gheysen, G. (2004). Dynamic cytoskeleton rearrangements in giant cells and syncytia of nematode‐infected roots. The Plant Journal, 38(1), 12-26.

De Almeida-Engler, J., Engler, G., & Gheysen, G. (2011). Unravelling the plant cell cycle in nematode induced feeding sites. In J. Jones, G. Gheysen, & C. Fenoll (Eds.), Genomics and Molecular Genetics of Plant- Nematode Interactions (pp. 349-368). Netherlands: Springer.

De Almeida-Engler, J., & Favery, B. (2011). The plant cytoskeleton remodelling in nematode induced feeding sites. In J. Jones, G. Gheysen, & C. Fenoll (Eds.), Genomics and Molecular Genetics of Plant-Nematode Interactions (pp. 369-393). Netherlands: Springer.

De Almeida-Engler, J., Kyndt, T., Vieira, P., Van Cappelle, E., Boudolf, V., Sanchez, V., ... & Gheysen, G. (2012). CCS52 and DEL1 genes are key components of the endocycle in nematode‐induced feeding sites. The Plant Journal, 72(2), 185-198.

De Almeida-Engler, J., & Gheysen, G. (2013). Nematode induced endoreduplication in plant host cells: why and how? Molecular Plant–Microbe Interactions, 26, 17-24.

- 247 -

Bibliography

De Almeida-Engler, J., Vieira, P., Rodiuc, N., Grossi de Sa, M.F., & Gilbert, E. (2015). The Plant Cell Cycle Machinery: Usurped and Modulated by Plant-Parasitic Nematodes. In C. Escobar, & C. Fenoll (Eds.), Advances in Botanical Research, Vol. 73 (pp. 91-118). Oxford, UK: Elsevier.

De Carvalho, L. M., Benda, N. D., Vaughan, M. M., Cabrera, A. R., Hung, K., Cox, T., ... & Teal, P. E. (2015). Mi-1-Mediated Nematode Resistance in Tomatoes is Broken by Short-Term Heat Stress but Recovers Over Time. Journal of Nematology, 47(2), 133.

De Ley, P., & Blaxter, M. (2002). Systematic position & phylogeny. In D. L. Lee (Eds.), The Biology of Nematodes (pp. 1-30). London: Taylor & Francis Publishers.

De Ley, P., & Blaxter, M. (2004). A new system for Nematoda: combining morphological characters with molecular trees, and translating clades into ranks and taxa. In R. Cook, & D. J.Hunt (Eds.), Nematology Monographs and Perspectives (pp. 633-653). Leiden: E.J. Brill.

De Ruijter, N. C. A., Verhees, J., Leeuwen, W., & Krol, A. D. (2003). Evaluation and comparison of the GUS, LUC and GFP reporter system for gene expression studies in plants. Plant Biology, 5(2), 103-115.

De Rybel, B., Vassileva, V., Parizot, B., Demeulenaere, M., Grunewald, W., Audenaert, D., ... & Möller, B. (2010). A novel aux/IAA28 signalling cascade activates GATA23-dependent specification of lateral root founder cell identity. Current Biology, 20(19), 1697-1706.

De Smet, S., Cuypers, A., Vangronsveld, J., & Remans, T. (2015). Gene Networks Involved in Hormonal Control of Root Development in

- 248 -

Bibliography

Arabidopsis thaliana: A Framework for Studying Its Disturbance by Metal Stress. International Journal of Molecular Sciences, 16(8), 19195-19224.

Decraemer, W., & Hunt, D. J. (2013). Structure and classification. In R. N. Perry, & M. Moens (Eds.), Plant Nematology (pp. 3-39). Wallingford, UK: CABI Publishers.

Devran, Z., & Söğüt, M. A. (2010). Occurrence of virulent root-knot nematode populations on tomatoes bearing the Mi gene in protected vegetable-growing areas of Turkey. Phytoparasitica, 38(3), 245-251.

Díaz-Manzano, F. E., Barcala, M., Engler, G., Fenoll, C., De Almeida Engler, J., & Escobar, C. (2016a). A reliable protocol for in situ microRNAs detection in feeding sites induced by root-knot nematodes. Frontiers in Plant Science, 7, 966.

Díaz-Manzano, F. E., Olmo, R., Cabrera, J., Barcala, M., Escobar, C., & Fenoll, C. (2016b). Long-term in vitro system for maintenance and amplification of root-knot nematodes in Cucumis sativus roots. Frontiers in Plant Science, 7, 124. Díaz-Manzano, F. E., Cabrera, J., Ripoll, J.J., del Olmo, I., Andrés, M. F., Silva, A.C., Barcala, M., Sánchez, M., … & Escobar, C. (2017a). The gene regulatory module miRNA172/TOE1/FT is active in the feeding sites induced by Meloidogyne javanica in Arabidopsis and has a role during the gall and giant cell development. Submitted.

Díaz-Manzano, F. E., Cabrera, J., Barcala, M., Fukaki, H., Andrés, M. F., Fenoll, C.,… & Escobar, C. (2017b). Lateral root development and nematode feeding sites in Meloidogyne spp.-Arabidopsis interaction: a parallel story? Submitted.

- 249 -

Bibliography

Dinh, P. T. Y., Brown, C. R., & Elling, A. A. (2014). RNA interference of effector gene Mc16D10L confers resistance against Meloidogyne chitwoodi in Arabidopsis and potato. Phytopathology, 104, 1098-1106.

Dinh, P. T., Zhang, L., Mojtahedi, H., Brown, C. R., & Elling, A. A. (2015). Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10. Journal of Nematology, 47(1), 71.

Djian-Caporalino, C., Fazari, A., Arguel, M. J., Vernie, T., VandeCasteele, C., Faure, I., ... & Abad, P. (2007). Root-knot nematode (Meloidogyne spp.) Me resistance genes in pepper (Capsicum annuum L.) are clustered on the P9 chromosome. Theoretical and Applied Genetics, 114(3), 473-486.

Dropkin, V. H. (1969). Cellular responses of plants to nematode infections. Annual Review of Phytopathology, 7(1), 101-122.

Dubrovsky, J. G., Sauer, M., Napsucialy-Mendivil, S., Ivanchenko, M. G., Friml, J., Shishkova, S., ... & Benková, E. (2008). Auxin acts as a local morphogenetic trigger to specify lateral root founder cells. PNAS, 105(25), 8790-8794.

Dutta, T. K., Banakar, P., & Rao, U. (2015). The status of RNAi-based transgenic research in plant nematology. Frontiers in Microbiology, 5, 760.

Eckardt, N. A. (2009). A High-Resolution Map of Auxin Distribution in the Arabidopsis Root Apex. The Plant Cell, 21(6), 1621-1621.

Eisenback, J. D. (1985). Detailed morphology and anatomy of second- stage juveniles, males, and females of the genus Meloidogyne (root-knot

- 250 -

Bibliography

nematode). In J. N. Sasser, & C. C. Carter (Eds.), An Advanced Treatise On Meloidogyne, Vol. 1 (pp. 47-78). Raleigh: North Carolina State University. Elling, A. A. (2013). Major emerging problems with minor Meloidogyne species. Phytopathology, 103(11), 1092-1102.

Escobar, C., Barcala, M., Portillo, M., Almoguera, C., Jordano, J., & Fenoll, C. (2003). Induction of the Hahsp17.7G4 promoter by root-knot nematodes: involvement of heat-shock elements in promoter activity in giant cells. Molecular Plant-Microbe Interactions, 16(12), 1062-1068.

Escobar, C., Horowitz, S.B., & Mitchum, M.G. (2011). Transcriptomic and proteomic analysis of the plant response to nematode infection. In J. Jones, G. Gheysen, & C. Fenoll (Eds.), Genomics and Molecular Genetics of Plant-Nematode Interactions, pp. 157-173. New York: Springer.

Escobar, C., Barcala, M., Cabrera, J., & Fenoll, C. (2015). Overview of Root-Knot Nematodes and Giant Cells. In C. Escobar, & C. Fenoll (Eds.), Advances in Botanical Research, Vol. 73 (pp.1-32). Oxford, UK: Elsevier.

Directive 91/414/EEC of 15 July 1991 concerning the placing of plant protection products on the market [WWW document] URL http://eur- lex.europa.eu/legal-content/EN/TXT/?uri=uriserv%3Al13002a [accessed 16 may 2017].

Directive 2009/128/EC of the European Parliament and of the Council of 21 October 2009 establishing a framework for Community action to achieve the sustainable use of pesticides [WWW document] URL http://eur- lex.europa.eu/legal-ontent/EN/TXT/?uri=CELEX%3A32009L0128 [accessed 16 may 2017].

Favery, B., Chelysheva, L. A., Lebris, M., Jammes, F., Marmagne, A., de Almeida-Engler, J., ... & Abad, P. (2004). Arabidopsis formin AtFH6 is a

- 251 -

Bibliography

plasma membrane–associated protein up-regulated in giant cells induced by parasitic nematodes. The Plant Cell, 16(9), 2529-2540.

Fournet, S., Kerlan, M. C., Renault, L., Dantec, J. P., Rouaux, C., & Montarry, J. (2013). Selection of nematodes by resistant plants has implications for local adaptation and cross‐virulence. Plant Pathology, 62(1), 184-193.

Franco-Zorrilla, J. M., Valli, A., Todesco, M., Mateos, I., Puga, M. I., Rubio-Somoza, I., ... & Paz-Ares, J. (2007). Target mimicry provides a new mechanism for regulation of microRNA activity. Nature Genetics, 39(8), 1033- 1037.

Friml, J. (2010). Subcellular trafficking of PIN auxin efflux carriers in auxin transport. European Journal of Cell Biology, 89(2), 231-235.

Fosu-Nyarko, J., & Jones M.G.K. (2015). Application of Biotechnology for Nematode Control in Crop Plants. In Escobar, C., & Fenoll, C., (Eds.). Advances in Botanical Research: Plant-Nematode Interactions, Vol. 73 (pp. 339-376). Oxford, UK: Elsevier.

Fukaki, H., Tameda, S., Masuda, H., & Tasaka, M. (2002). Lateral root formation is blocked by a gain‐of‐function mutation in the SOLITARY‐ROOT/IAA14 gene of Arabidopsis. The Plant Journal, 29(2), 153- 168.

Fukaki, H., Taniguchi, N., & Tasaka, M. (2006). PICKLE is required for SOLITARY‐ROOT/IAA14‐mediated repression of ARF7 and ARF19 activity during Arabidopsis lateral root initiation. The Plant Journal, 48(3), 380-389.

Fukaki, H., & Tasaka, M. (2009). Hormone interactions during lateral root formation. Plant Molecular Biology, 69(4), 437-449.

- 252 -

Bibliography

Gamborg, O. L., Miller, R., & Ojima, K. (1968). Nutrient requirements of suspension cultures of soybean root cells. Experimental Cell Research, 50(1), 151-158.

Gheysen, G., & Fenoll, C. (2002). Gene expression in nematode feeding sites. Annual Review of Phytopathology, 40(1), 191-219.

Gheysen, G., & Mitchum, M. G. (2011). How nematodes manipulate plant development pathways for infection. Current Opinion in Plant Biology, 14(4), 415-421.

Girshovitz, P., & Shaked, N. T. (2012). Generalized cell morphological parameters based on interferometric phase microscopy and their application to cell life cycle characterization. Biomedical Optics Express, 3(8), 1757-1773.

Goh, T., Joi, S., Mimura, T., & Fukaki, H. (2012). The establishment of asymmetry in Arabidopsis lateral root founder cells is regulated by LBD16/ASL18 and related LBD/ASL proteins. Development, 139(5), 883-893.

Golinowski, W., Grundler, F. M. W., & Sobczak, M. (1996). Changes in the structure of Arabidopsis thaliana during female development of the plant- parasitic nematode Heterodera schachtii. Protoplasma, 194(1-2), 103-116.

Gómez, M. & Montes, M. (2001). Manejo de nematodos endoparásitos: Proyecciones Futuras. Food and Agriculture Organization of the United Nations (FAO). Cuba.

Goverse, A., de Almeida-Engler, J., Verhees, J., van der Krol, S., Helder, J., & Gheysen, G. (2000). Cell cycle activation by plant parasitic nematodes. Plant Molecular Biology, 43(5-6), 747-761.

Goverse, A., & Bird, D. (2011). The role of plant hormones in nematode feeding cell formation. In J. Jones, G. Gheysen, & C. Fenoll (Eds.), Genomics

- 253 -

Bibliography

and Molecular Genetics of Plant-Nematode Interactions (pp. 325-347). Dordrecht, Heidelberg, London & New York: Springer.

Gray, W. M., Hellmann, H., Dharmasiri, S., & Estelle, M. (2002). Role of the Arabidopsis RING-H2 protein RBX1 in RUB modification and SCF function. The Plant Cell, 14(9), 2137-2144.

Grundler, F., Betka, M., & Wyss, U. (1991). Influence of changes in the nurse cell system (syncytium) on sex determination and development of the cyst nematode Heterodera schachtii: Total amounts of proteins and amino acids. Phytopathology, 81(1), 70-74.

Grunewald, W., Karimi, M., Wieczorek, K., Van de Cappelle, E., Wischnitzki, E., Grundler, F., ... & Gheysen, G. (2008). A role for AtWRKY23 in feeding site establishment of plant-parasitic nematodes. Plant Physiology, 148(1), 358-368.

Grunewald, W., Cannoot, B., Friml, J., & Gheysen, G. (2009a). Parasitic nematodes modulate PIN-mediated auxin transport to facilitate infection. PLoS Pathogen, 5(1), e1000266.

Grunewald, W., Van Noorden, G., Van Isterdael, G., Beeckman, T., Gheysen, G., & Mathesius, U. (2009b). Manipulation of auxin transport in plant roots during Rhizobium symbiosis and nematode parasitism. The Plant Cell, 21(9), 2553-2562.

Guo, X., Wang, J., Gardner, M., Fukuda, H., Kondo, Y., Etchells, J. P., ... & Mitchum, M. G. (2017). Identification of cyst nematode B-type CLE peptides and modulation of the vascular stem cell pathway for feeding cell formation. PLoS Pathogens, 13(2), e1006142.

- 254 -

Bibliography

Hassan, S., Behm, C.A., & Mathesius, U. (2010). Effectors of plant parasitic nematodes that re-program root cell development. Functional Plant Biology, 37 (10), 933-942.

Hewezi, T., Howe, P., Maier, T. R., & Baum, T. J. (2008). Arabidopsis small RNAs and their targets during cyst nematode parasitism. Molecular Plant-Microbe Interactions, 21(12), 1622-1634.

Hewezi, T., Maier, T. R., Nettleton, D., & Baum, T. J. (2012). The Arabidopsis microRNA396-GRF1/GRF3 regulatory module acts as a developmental regulator in the reprogramming of root cells during cyst nematode infection. Plant Physiology, 159(1), 321-335.

Hewezi, T., Piya, S., Richard, G., & Rice, J. H. (2014). Spatial and temporal expression patterns of auxin response transcription factors in the syncytium induced by the beet cyst nematode Heterodera schachtii in Arabidopsis. Molecular Plant Pathology, 15(7), 730-736.

Hewezi, T., & Baum, T.J. (2015). Gene silencing in nematode feeding sites. In Escobar, C., & Fenoll, C., (Eds.). Advances in Botanical Research: Plant-Nematode Interactions, Vol. 73 (pp. 221–239). Oxford, UK: Elsevier.

Hewezi, T., Piya, S., Qi, M., Balasubramaniam, M., Rice, J. H., & Baum, T. J. (2016). Arabidopsis miR827 mediates post‐transcriptional gene silencing of its ubiquitin E3 ligase target gene in the syncytium of the cyst nematode Heterodera schachtii to enhance susceptibility. The Plant Journal, 88(2), 179- 192.

Hooks, C. R., Wang, K. H., Ploeg, A., & McSorley, R. (2010). Using marigold (Tagetes spp.) as a cover crop to protect crops from plant-parasitic nematodes. Applied Soil Ecology, 46(3), 307-320.

- 255 -

Bibliography

Huang, G., Allen, R., Davis, E. L., Baum, T. J., & Hussey, R. S. (2006). Engineering broad root-knot resistance in transgenic plants by RNAi silencing of a conserved and essential root-knot nematode parasitism gene. PNAS, 103(39), 14302-14306.

Huijser, P., & Schmid, M. (2011). The control of developmental phase transitions in plants. Development, 138(19), 4117-4129.

Huntzinger, E., & Izaurralde, E. (2011). Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nature Reviews Genetics, 12(2), 99-110.

Hussey, R.S., & Barker, K.R. (1973). A comparison of methods of collecting inocula of Meloidogyne spp., including a new technique. Plant Dis. Rep., 57, 1025-1028.

Iberkleid, I., Vieira, P., de Almeida-Engler, J., Firester, K., Spiegel, Y., & Horowitz, S. B. (2013). Fatty acid-and retinol-binding protein, Mj-FAR-1 induces tomato host susceptibility to root-knot nematodes. PloS One, 8(5), e64586.

Ibrahim, H. M., Alkharouf, N. W., Meyer, S. L., Aly, M. A., Abd El Kader, Y., Hussein, E. H., & Matthews, B. F. (2011). Post-transcriptional gene silencing of root-knot nematode in transformed soybean roots. Experimental Parasitology, 127(1), 90-99.

Iwakawa, H. O., & Tomari, Y. (2015). The functions of microRNAs: mRNA decay and translational repression. Trends in Cell Biology, 25(11), 651- 665.

- 256 -

Bibliography

Jammes, F., Lecomte, P., Almeida-Engler, J., Bitton, F., Martin‐Magniette, M. L., Renou, J. P., ... & Favery, B. (2005). Genome‐wide expression profiling of the host response to root‐knot nematode infection in Arabidopsis. The Plant Journal, 44(3), 447-458.

Jansen, R., Embden, J., Gaastra, W., & Schouls, L. (2002). Identification of genes that are associated with DNA repeats in prokaryotes. Molecular Microbiology, 43(6), 1565-1575.

Ji, H., Gheysen, G., Denil, S., Lindsey, K., Topping, J. F., Nahar, K., ... & De Meyer, T. (2013). Transcriptional analysis through RNA sequencing of giant cells induced by Meloidogyne graminicola in rice roots. Journal of Experimental Botany, 64(12), 3885-3898.

Jones, M. G. K., & Goto, D. B. (2011). Root-knot nematodes and giant cells. In J. Jones, G. Gheysen, & C. Fenoll (Eds.), Genomics and Molecular Genetics of Plant-Nematode Interactions (pp. 83-100). Netherlands: Springer.

Jones, J. T., Haegeman, A., Danchin, E. G., Gaur, H. S., Helder, J., Jones, M. G., ... & Perry, R. N. (2013). Top 10 plant‐parasitic nematodes in molecular plant pathology. Molecular Plant Pathology, 14(9), 946-961.

Jones-Rhoades, M. W., Bartel, D. P., & Bartel, B. (2006). MicroRNAs and their regulatory roles in plants. Annu. Rev. Plant Biol., 57, 19-53.

Jung, J. H., Seo, Y. H., Seo, P. J., Reyes, J. L., Yun, J., Chua, N. H., & Park, C. M. (2007). The GIGANTEA-regulated microRNA172 mediates photoperiodic flowering independent of CONSTANS in Arabidopsis. The Plant Cell, 19(9), 2736-2748.

Jung, J. H., Seo, P. J., Kang, S. K., & Park, C. M. (2011). MiR172 signals are incorporated into the miR156 signalling pathway at the SPL3/4/5

- 257 -

Bibliography

genes in Arabidopsis developmental transitions. Plant Molecular Biology, 76(1- 2), 35-45.

Jung, J. H., Lee, S., Yun, J., Lee, M., & Park, C. M. (2014). The miR172 target TOE3 represses AGAMOUS expression during Arabidopsis floral patterning. Plant Science, 215, 29-38.

Karczmarek, A., Overmars, H., Helder, J., & Goverse, A. (2004). Feeding cell development by cyst and root‐knot nematodes involves a similar early, local and transient activation of a specific auxin‐inducible promoter element. Molecular Plant Pathology, 5(4), 343-346.

Karczmarek, A., Fudali, S., Lichocka, M., Sobczak, M., Kurek, W., Janakowski, S., ... & Helder, J. (2008). Expression of two functionally distinct plant endo-β-1, 4-glucanases is essential for the compatible interaction between potato cyst nematode and its hosts. Molecular Plant-Microbe Interactions, 21(6), 791-798.

Kasai A., Kanehira A., & Harada T. (2010). MiR172 can move long distances in Nicotiana benthamiana. Open Plant Sci. J., 4, 1-6.

Katiyar-Agarwal, S., & Jin, H. (2010). Role of small RNAs in host- microbe interactions. Annual Review of Phytopathology, 48, 225.

Kearn, J., Ludlow, E., Dillon, J., O’Connor, V., & Holden-Dye, L. (2014). Fluensulfone is a nematicide with a mode of action distinct from anticholinesterases and macrocyclic lactones. Pesticide Biochemistry and Physiology, 109, 44-57.

Khan, M. R. G., Ai, X. Y., & Zhang, J. Z. (2014). Genetic regulation of flowering time in annual and perennial plants. Wiley Interdisciplinary Reviews: RNA, 5(3), 347-359.

- 258 -

Bibliography

Kieffer, M., Neve, J., & Kepinski, S. (2010). Defining auxin response contexts in plant development. Current Opinion in Plant Biology, 13(1), 12-20.

Kiewnick, S., Dessimoz, M., & Franck, L. (2009). Effects of the Mi-1 and the N root-knot nematode-resistance gene on infection and reproduction of Meloidogyne enterolobii on tomato and pepper cultivars. Journal of Nematology, 41(2), 134.

Kyndt, T., Vieira, P., Gheysen, G., & de Almeida-Engler, J. (2013). Nematode feeding sites: unique organs in plant roots. Planta, 238(5), 807-818.

Kyndt, T., Goverse, A., Haegeman, A., Warmerdam, S., Wanjau, C., Jahani, M., ... & Gheysen, G. (2016). Redirection of auxin flow in Arabidopsis thaliana roots after infection by root-knot nematodes. Journal of Experimental Botany, 67(15), 4559-4570.

Koltai, H., Dhandaydham, M., Opperman, C., Thomas, J., & Bird, D. (2001). Overlapping plant signal transduction pathways induced by a parasitic nematode and a rhizobial endosymbiont. Molecular Plant–Microbe Interactions, 14(10), 1168-1177.

Koonin, E. V., & Makarova, K. S. (2013). CRISPR-Cas: evolution of an RNA-based adaptive immunity system in prokaryotes. RNA Biology, 10(5), 679-686.

Lacey, L. A., & Georgis, R. (2012). Entomopathogenic nematodes for control of insect pests above and below ground with comments on commercial production. Journal of Nematology, 44(2), 218.

Lambert, K. & Bekal, S. (2002). Introduction to Plant-Parasitic Nematodes. The Plant Health Instructor.

Laplaze, L., Parizot, B., Baker, A., Ricaud, L., Martiniere, A., Auguy, F., ... & Haseloff, J. (2005). GAL4-GFP enhancer trap lines for genetic - 259 -

Bibliography

manipulation of lateral root development in Arabidopsis thaliana. Journal of Experimental Botany, 56(419), 2433-2442.

Lavenus, J., Goh, T., Roberts, I., Guyomarc’h, S., Lucas, M., De Smet, I., ... & Laplaze, L. (2013). Lateral root development in Arabidopsis: fifty shades of auxin. Trends in Plant Science, 18(8), 450-458.

Lavenus, J., Goh, T., Guyomarc’h, S., Hill, K., Lucas, M., Voß, U., ... & Guilfoyle, T. J. (2015). Inference of the Arabidopsis lateral root gene regulatory network suggests a bifurcation mechanism that defines primordia flanking and central zones. The Plant Cell, 27(5), 1368-1388.

Lavenus, J., Guyomarc’h, S., & Laplaze, L. (2016). PIN transcriptional regulation shapes root system architecture. Trends in Plant Science, 21(3), 175-177.

Lauter, N., Kampani, A., Carlson, S., Goebel, M., & Moose, S. P. (2005). MicroRNA172 down-regulates glossy15 to promote vegetative phase change in maize. PNAS, 102(26), 9412-9417.

Lee, H. W., Kim, N. Y., Lee, D. J., & Kim, J. (2009). LBD18/ASL20 regulates lateral root formation in combination with LBD16/ASL18 downstream of ARF7 and ARF19 in Arabidopsis. Plant Physiology, 151(3), 1377-1389.

Lee, C., Chronis, D., Kenning, C., Peret, B., Hewezi, T., Davis, E. L., ... & Mitchum, M. G. (2011). The novel cyst nematode effector protein 19C07 interacts with the Arabidopsis auxin influx transporter LAX3 to control feeding site development. Plant Physiology, 155(2), 866-880.

Lee, R., Baldwin, S., Kenel, F., McCallum, J., & Macknight, R. (2013). FLOWERING LOCUS T genes control onion bulb formation and flowering. Nature Communications, 4.

- 260 -

Bibliography

Lelandais-Brière, C., Moreau, J., Hartmann, C., & Crespi, M. (2016). Noncoding RNAs, Emerging Regulators in Root Endosymbioses. Molecular Plant-Microbe Interactions, 29(3), 170-180.

Li, X., Wang, X., Zhang, S., Liu, D., Duan, Y., & Dong, W. (2012). Identification of soybean microRNAs involved in soybean cyst nematode infection by deep sequencing. PloS One, 7(6), e39650.

Licausi, F., Ohme‐Takagi, M., & Perata, P. (2013). APETALA2/Ethylene Responsive Factor (AP2/ERF) transcription factors: mediators of stress responses and developmental programs. New Phytologist, 199(3), 639-649.

Lilley, C. J., Davies, L. J., & Urwin, P. E. (2012). RNA interference in plant parasitic nematodes: a summary of the current status. Parasitology, 139(05), 630-640.

Liu, Q. L., Thomas, V. P., & Williamson, V. M. (2007). Meiotic parthenogenesis in a root-knot nematode results in rapid genomic homozygosity. Genetics, 176(3), 1483-1490.

Lusser, M., & Davies, H. V. (2013). Comparative regulatory approaches for groups of new plant breeding techniques. New Biotechnology, 30(5), 437- 446.

Mahdy, M. (2002). Biological control of plant parasitic nematodes with antagonistic bacteria on different host plants (Doctoral dissertation, Universitäts-und Landesbibliothek Bonn).

Manzano, C., Ramirez-Parra, E., Casimiro, I., Otero, S., Desvoyes, B., De Rybel, B., ... & del Pozo, J. C. (2012). Auxin and epigenetic regulation of SKP2B, an F-box that represses lateral root formation. Plant Physiology, 160(2), 749-762.

- 261 -

Bibliography

Marella, H. H., Nielsen, E., Schachtman, D. P., & Taylor, C. G. (2013). The amino acid permeases AAP3 and AAP6 are involved in root-knot nematode parasitism of Arabidopsis. Molecular Plant-Microbe Interactions, 26(1), 44-54.

Martin, A., Adam, H., Díaz-Mendoza, M., Żurczak, M., González- Schain, N. D., & Suárez-López, P. (2009). Graft-transmissible induction of potato tuberization by the microRNA miR172. Development, 136(17), 2873- 2881.

Mathesius, U. (2003). Conservation and divergence of signalling pathways between roots and soil microbes–the Rhizobium-legume symbiosis compared to the development of lateral roots, mycorrhizal interactions and nematode-induced galls. Plant & Soil, 255(1), 105-119.

Mathieu, J., Yant, L. J., Mürdter, F., Küttner, F., & Schmid, M. (2009). Repression of flowering by the miR172 target SMZ. PLoS Biol, 7(7), e1000148.

Mazarei, M., Lennon, K. A., Puthoff, D. P., Rodermel, S. R., & Baum, T. J. (2003). Expression of an Arabidopsis phosphoglycerate mutase homologue is localized to apical meristems, regulated by hormones, and induced by sedentary plant-parasitic nematodes. Plant Molecular Biology, 53(4), 513-530.

McCarter, J.P. (2008). Molecular Approaches toward Resistance to Plant-Parasitic Nematodes. In R. H. Berg, & C. G. Taylor (Eds.), Cell Biology of Plant Nematode Parasitism (pp. 239-267). Berlin: Springer.

Meng, L., Buchanan, B. B., Feldman, L. J., & Luan, S. (2012). CLE-like (CLEL) peptides control the pattern of root growth and lateral root development in Arabidopsis. PNAS, 109(5), 1760-1765.

- 262 -

Bibliography

Mitchum, M. G., Wang, X., Wang, J., & Davis, E. L. (2012). Role of nematode peptides and other small molecules in plant parasitism. Annual Review of Phytopathology, 50, 175-195.

Mitkowski, N., & Abawi, G. (2002). Monoxenic maintenance and reproduction of root-knot nematode (Meloidogyne hapla) on multiple-species in vitro root culture systems. Plant Cell Reports, 21(1), 14-23.

Mohd-Radzman, N. A., Laffont, C., Ivanovici, A., Patel, N., Reid, D. E., Stougaard, J., ... & Djordjevic, M. A. (2016). Different pathways act downstream of the peptide receptor CRA2 to regulate lateral root and nodule development. Plant Physiology, pp-00113.

Mojica, F. J. M., Ferrer, C., Juez, G., & Rodríguez‐Valera, F. (1995). Long stretches of short tandem repeats are present in the largest replicons of the Archaea Haloferax mediterranei and Haloferax volcanii and could be involved in replicon partitioning. Molecular Microbiology, 17(1), 85-93.

Mojica, F. J., García-Martínez, J., & Soria, E. (2005). Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements. Journal of Molecular Evolution, 60(2), 174-182.

Moreno-Risueno, M. A., Van Norman, J. M., Moreno, A., Zhang, J., Ahnert, S. E., & Benfey, P. N. (2010). Oscillating gene expression determines competence for periodic Arabidopsis root branching. Science, 329(5997), 1306-1311.

Muday, G. K. (2001). Auxins and tropisms. Journal of Plant Growth Regulation, 20(3), 226-243.

Nair, S. K., Wang, N., Turuspekov, Y., Pourkheirandish, M., Sinsuwongwat, S., Chen, G., ... & Komatsuda, T. (2010). Cleistogamous

- 263 -

Bibliography

flowering in barley arises from the suppression of microRNA-guided HvAP2 mRNA cleavage. PNAS, 107(1), 490-495.

Navarro, C., Abelenda, J. A., Cruz-Oró, E., Cuéllar, C. A., Tamaki, S., Silva, J., ... & Prat, S. (2011). Control of flowering and storage organ formation in potato by FLOWERING LOCUS T. Nature, 478(7367), 119-122.

Nayeri, F. D., (2014). Identification of transcription factors linked to cell cycle regulation in Arabidopsis. Plant Signaling & Behavior, 9(11), e972864.

Niu, J., Jian, H., Xu, J., Chen, C., Guo, Q., Liu, Q., & Guo, Y. (2012). RNAi silencing of the Meloidogyne incognita Rpn7 gene reduces nematode parasitic success. European Journal of Plant Pathology, 134(1), 131-144.

Okushima, Y., Overvoorde, P. J., Arima, K., Alonso, J. M., Chan, A., Chang, C., ... & Onodera, C. (2005). Functional genomic analysis of the AUXIN RESPONSE FACTOR gene family members in Arabidopsis thaliana: unique and overlapping functions of ARF7 and ARF19. The Plant Cell, 17(2), 444-463.

Okushima, Y., Fukaki, H., Onoda, M., Theologis, A., & Tasaka, M. (2007). ARF7 and ARF19 regulate lateral root formation via direct activation of LBD/ASL genes in Arabidopsis. The Plant Cell, 19(1), 118-130.

Olmo, R., Silva, A. C., Díaz-Manzano, F. E., Cabrera, J., Fenoll, C., & Escobar, C. (2017). A Standardized Method to Assess Infection Rates of Root- Knot and Cyst Nematodes in Arabidopsis thaliana Mutants with Alterations in Root Development Related to Auxin and Cytokinin Signaling. Auxins and Cytokinins in Plant Biology: Methods and Protocols, 73-81.

Ó'Maoiléidigh, D. S., Graciet, E., & Wellmer, F. (2014). Gene networks controlling Arabidopsis thaliana flower development. New Phytologist, 201(1), 16-30.

- 264 -

Bibliography

Ornat, C., & Sorribas, F.J. (2008). Integrated management of root-knot nematodes in mediterranean horticultural crops. In Ciancio, A., & Mukerji, K. G., (Eds.). Integrated Management and Biocontrol of Vegetable and Grain Crops Nematodes (pp. 295-319). Netherlands: Springer.

Overvoorde, P., Fukaki, H., & Beeckman, T. (2010). Auxin control of root development. Cold Spring Harbor Perspectives in Biology, 2(6), a001537.

Paciorek, T., & Friml, J. (2006). Auxin signalling. Journal of Cell Science, 119(7), 1199-1202.

Papolu, P. K., Gantasala, N. P., Kamaraju, D., Banakar, P., Sreevathsa, R., & Rao, U. (2013). Utility of host delivered RNAi of two FMRF amide like peptides, flp-14 and flp-18, for the management of root knot nematode, Meloidogyne incognita. PloS One, 8(11), e80603.

Peláez, P., & Sánchez, F. (2013). Small RNAs in plant defence responses during viral and bacterial interactions: similarities and differences. Frontiers in Plant Science, 4, 343.

Perry, R., & Moens, M. (2011). Introduction to plant-parasitic nematodes; modes of parasitism. In J. Jones, G. Gheysen, & C. Fenoll (Eds.), Genomics and Molecular Genetics of Plant-Nematode Interactions (pp. 3-20). Netherlands: Springer.

Petrášek, J., & Friml, J. (2009). Auxin transport routes in plant development. Development, 136(16), 2675-2688.

Porco, S., Larrieu, A., Du, Y., Gaudinier, A., Goh, T., Swarup, K., ... & Casimiro, I. (2016). Lateral root emergence in Arabidopsis is dependent on transcription factor LBD29 regulation of auxin influx carrier LAX3. Development, 143(18), 3340-3349.

- 265 -

Bibliography

Portillo, M., Lindsey, K., Casson, S., García-Casado, G., Solano, R., Fenoll, C., & Escobar, C. (2009). Isolation of RNA from laser‐capture‐microdissected giant cells at early differentiation stages suitable for differential transcriptome analysis. Molecular Plant Pathology, 10(4), 523- 535.

Portillo, M., Cabrera, J., Lindsey, K., Topping, J., Andrés, M. F., Emiliozzi, M., ... & Escobar, C. (2013). Distinct and conserved transcriptomic changes during nematode‐induced giant cell development in tomato compared with Arabidopsis: a functional role for gene repression. New Phytologist, 197(4), 1276-1290.

Posé, D., Yant, L., & Schmid, M. (2012). The end of innocence: flowering networks explode in complexity. Current Opinion in Plant Biology, 15(1), 45-50.

Quenouille, J., Paulhiac, E., Moury, B., & Palloix, A. (2014). Quantitative trait loci from the host genetic background modulate the durability of a resistance gene: a rational basis for sustainable resistance breeding in plants. Heredity, 112(6), 579-587.

Rademacher, E. H., Lokerse, A. S., Schlereth, A., Llavata-Peris, C. I., Bayer, M., Kientz, M., ... & Weijers, D. (2012). Different auxin response machineries control distinct cell fates in the early plant embryo. Developmental Cell, 22(1), 211-222.

Ravichandra, N. G. (2008). Plant Nematology. New Delhi, India: I. K. International Pvt Ltd.

Richardson, L., & Price, N. S. (1982). Host–parasite relationships of Meloidogyne incognita and the dia-geotropica tomato mutant. Journal of Nematology, 14, 465-466.

- 266 -

Bibliography

Ripoll, J. J., Roeder, A. H., Ditta, G. S., & Yanofsky, M. F. (2011). A novel role for the floral homeotic gene APETALA2 during Arabidopsis fruit development. Development, 138(23), 5167-5176.

Ripoll, J. J., Bailey, L. J., Mai, Q. A., Wu, S. L., Hon, C. T., Chapman, E. J., ... & Yanofsky, M. F. (2015). MicroRNA regulation of fruit growth. Nature Plants, 1, 15036.

Ruíz-Ferrer, V., & Voinnet, O. (2009). Roles of plant small RNAs in biotic stress responses. Annual Review of Plant Biology, 60, 485-510.

Sarkar, D. (2008). The signal transduction pathways controlling in planta tuberization in potato: an emerging synthesis. Plant Cell Reports, 27(1), 1-8.

Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., ... & Tinevez, J. Y. (2012). Fiji: an open-source platform for biological-image analysis. Nature Methods, 9(7), 676-682.

Schuetz, M., Smith, R., & Ellis, B. (2012). Xylem tissue specification, patterning, and differentiation mechanisms. Journal of Experimental Botany, ers287.

Seeliger, I., Frerichs, A., Glowa, D., Velo, L., Comelli, P., Chandler, J. W., & Werr, W. (2016). The AP2-type transcription factors DORNRÖSCHEN and DORNRÖSCHEN-LIKE promote G1/S transition. Molecular Genetics and Genomics, 291(5), 1835-1849.

Semblat, J. P., Bongiovanni, M., Wajnberg, E., Dalmasso, A., Abad, P., & Castagnone-Sereno, P. (2000). Virulence and molecular diversity of parthenogenetic root-knot nematodes, Meloidogyne spp. Heredity, 84(1), 81- 89.

- 267 -

Bibliography

Sharon, E., & Spiegel, Y. (1993). Glycoprotein characterization of the gelatinous matrix in the root-knot nematode Meloidogyne javanica. Journal of Nematology, 25(4), 585.

Sikora, R.A. & Fernandez, E. (2005). Nematode Parasites of Vegetables. In M. Luc, R.A. Sikora, & J. Bridge (Eds.), Plant Parasitic Nematodes in Subtropical and Tropical Agriculture, pp. 319-392. Wallingford, UK: CABI.

Snyder, D. W., Opperman, C. H., & Bird, D. M. (2006). A method for generating Meloidogyne incognita males. Journal of Nematology, 38(2), 192.

Sobczak, M., Golinowski, W., & Grundler, F. M. (1997). Changes in the structure of Arabidopsis thaliana roots induced during development of males of the plant parasitic nematode Heterodera schachtii. European Journal of Plant Pathology, 103(2), 113-124.

Sozzani, R., Cui, H., Moreno-Risueno, M. A., Busch, W., Van Norman, J. M., Vernoux, T., ... & Benfey, P. N. (2010). Spatiotemporal regulation of cell- cycle genes by SHORTROOT links patterning and growth. Nature, 466(7302), 128-132.

Sparks, E., Wachsman, G., & Benfey, P. N. (2013). Spatiotemporal signalling in plant development. Nature Reviews Genetics, 14(9), 631-644.

Sunkar, R., Li, Y. F., & Jagadeeswaran, G. (2012). Functions of microRNAs in plant stress responses. Trends in Plant Science, 17(4), 196-203.

Swiecicka, M., Filipecki, M., Lont, D., van Vliet, J., Qin, L., Goverse, A., ... & Helder, J. (2009). Dynamics in the tomato root transcriptome on infection with the potato cyst nematode Globodera rostochiensis. Molecular Plant Pathology, 10(4), 487-500.

- 268 -

Bibliography

Szakasits, D., Heinen, P., Wieczorek, K., Hofmann, J., Wagner, F., Kreil, D. P., ... & Bohlmann, H. (2009). The transcriptome of syncytia induced by the cyst nematode Heterodera schachtii in Arabidopsis roots. The Plant Journal, 57(5), 771-784.

Teillet, A., Dybal, K., Kerry, B. R., Miller, A. J., Curtis, R. H., & Hedden, P. (2013). Transcriptional changes of the root-knot nematode Meloidogyne incognita in response to Arabidopsis thaliana root signals. PloS One, 8(4), e61259.

Tellmann, G. (2006). The E-Method: a highly accurate technique for gene-expression analysis. Nature Methods| Application Notes, i-ii.

Todesco, M., Rubio-Somoza, I., Paz-Ares, J., & Weigel, D. (2010). A collection of target mimics for comprehensive analysis of microRNA function in Arabidopsis thaliana. PLoS Genet, 6(7), e1001031.

Triantaphyllou, A. C. (1973). Environmental sex differentiation of nematodes in relation to pest management. Annual Review of Phytopathology, 11(1), 441-462.

Tromas, A., & Perrot-Rechenmann, C. (2010). Recent progress in auxin biology. Comptes Rendus Biologies, 333(4), 297-306.

Turck, F., Fornara, F., & Coupland, G. (2008). Regulation and identity of florigen: FLOWERING LOCUS T moves center stage. Annu. Rev. Plant Biol., 59, 573-594.

Ulmasov, T., Murfett, J., Hagen, G., & Guilfoyle, T. J. (1997). Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. The Plant Cell, 9(11), 1963-1971.

Vaghchhipawala, Z., Bassüner, R., Clayton, K., Lewers, K., Shoemaker, R., & Mackenzie, S. (2001). Modulations in gene expression and mapping of - 269 -

Bibliography

genes associated with cyst nematode infection of soybean. Molecular Plant- Microbe Interactions, 14(1), 42-54.

Válóczi, A., Hornyik, C., Varga, N., Burgyán, J., Kauppinen, S., & Havelda, Z. (2004). Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Research, 32(22), e175-e175.

Van der Beek, J. G., & Karssen, G. (1997). Interspecific hybridization of meiotic parthenogenetic Meloidogyne chitwoodi and M. fallax. Phytopathology, 87(10), 1061-1066.

Van Helden, J. (2003). Regulatory sequence analysis tools. Nucleic Acids Research, 31(13), 3593-3596.

Van Megen, H., Van den Elsen, S., Holterman, M., Karssen, G., Mooyman, P., Bongers, T., ... & Helder, J. (2009). A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences. Nematology, 11(6), 927-950.

Vanhaeren, H., Gonzalez, N., & Inzé, D. (2010). Hide and seek: uncloaking the vegetative shoot apex of Arabidopsis thaliana. The Plant Journal, 63(3), 541-548.

Vanneste, S., & Friml, J. (2009). Auxin: a trigger for change in plant development. Cell, 136(6), 1005-1016.

Verdejo, S., Jaffee, B. A., & Mankau, R. (1988). Reproduction of Meloidogyne javanica on plant roots genetically transformed by Agrobacterium rhizogenes. Journal of Nematology, 20(4), 599.

Verdejo-Lucas, S. (1995). Dual culture: nematodes. In R.P. Sing, & U.S. Sing (Eds.), Molecular Methods in Plant Pathology, pp. 301-312. London: CRC Lewis Publishers. - 270 -

Bibliography

Verdejo-Lucas, S., Talavera, M., & Andrés, M. F. (2012). Virulence response to the Mi-1 gene of Meloidogyne populations from tomato in greenhouses. Crop Protection, 39, 97-105.

Verdejo-Lucas, S., Blanco, M., Cortada, L., & Sorribas, F. J. (2013). Resistance of tomato rootstocks to Meloidogyne arenaria and Meloidogyne javanica under intermittent elevated soil temperatures above 28ºC. Crop Protection, 46, 57-62.

Viaene, N., Coyne, D. L., & Kerry, B. R. (2006). Biological and cultural management. In R. Perry, & M. Moens (Eds.), Plant Nematology, pp. 346-369. Wallingford, UK: CABI.

Vieira, P., Engler, G., & de Almeida Engler, J. (2012). Whole‐mount confocal imaging of nuclei in giant feeding cells induced by root‐knot nematodes in Arabidopsis. New Phytologist, 195(2), 488-496.

Wallace, H. R. (1968). The influence of soil moisture on survival and hatch of Meloidogyne javanica. Nematologica, 14, 231-242.

Wang, Z., Shuie, L., & Jones, M. G. K. (2008). Use of a double promoter system to target nematode feeding cells. In Proceedings of the EU COST ACTION 872 Workshop, Exploiting Genomics to Understand Plant- Nematode Interactions. Postonja, Slovenia.

Wang, J. W., Czech, B., & Weigel, D. (2009). MiR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell, 138(4), 738-749.

Wang, Y., Wang, L., Zou, Y., Chen, L., Cai, Z., Zhang, S., ... & Gresshoff, P. M. (2014). Soybean miR172c targets the repressive AP2 transcription factor NNC1 to activate ENOD40 expression and regulate nodule initiation. The Plant Cell, 26(12), 4782-4801.

- 271 -

Bibliography

Weijers, D., & Friml, J. (2009). SnapShot: auxin signalling and transport. Cell, 136(6), 1172-1172.

Wellmer, F., & Riechmann, J. L. (2010). Gene networks controlling the initiation of flower development. Trends in Genetics, 26(12), 519-527.

Wieczorek, K., Hofmann, J., Blöchl, A., Szakasits, D., Bohlmann, H., & Grundler, F. M. (2008). Arabidopsis endo‐1, 4‐β‐glucanases are involved in the formation of root syncytia induced by Heterodera schachtii. The Plant Journal, 53(2), 336-351.

Williamson, V. M. (1998). Root-knot nematode resistance genes in tomato and their potential for future use. Annual Review of Phytopathology, 36, 277-293.

Wolt, J. D., Wang, K., & Yang, B. (2016). The Regulatory Status of Genome‐edited Crops. Plant Biotechnology Journal, 14(2), 510-518.

Xu, M., Li, Y., Zhang, Q., Xu, T., Qiu, L., Fan, Y., & Wang, L. (2014). Novel miRNA and phasiRNA biogenesis networks in soybean roots from two sister lines that are resistant and susceptible to SCN race four. PloS One, 9(10), e110051.

Xu, C., Luo, F., & Hochholdinger, F. (2016). LOB domain proteins: beyond lateral organ boundaries. Trends in Plant Science, 21(2), 159-167.

Yadav, B. C., Veluthambi, K., & Subramaniam, K. (2006). Host- generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection. Molecular and Biochemical Parasitology, 148, 219-222.

Yadav, S.R., Bishopp, A. & Helariutta, Y. (2010). Plant development: early events in lateral root initiation. Current Biology, 20, 843-845.

- 272 -

Bibliography

Yaghoobi, J., Kaloshian, I., Wen, Y., & Williamson, V. M. (1995). Mapping a new nematode resistance locus in Lycopersicon peruvianum. Theoretical and Applied Genetics, 91(3), 457-464.

Yamaguchi, A., & Abe, M. (2012). Regulation of reproductive development by non-coding RNA in Arabidopsis: to flower or not to flower. Journal of Plant Research, 125(6), 693-704.

Yamaguchi, Y. L., Ishida, T., & Sawa, S. (2016). CLE peptides and their signaling pathways in plant development. Journal of Experimental Botany, 67(16), 4813-4826.

Yan, Z., Hossain, M. S., Wang, J., Valdés-López, O., Liang, Y., Libault, M., ... & Stacey, G. (2013). MiR172 regulates soybean nodulation. Molecular Plant-Microbe Interactions, 26(12), 1371-1377.

Yang, Y., Jittayasothorn, Y., Chronis, D., Wang, X., Cousins, P., & Zhong, G.-Y. (2013). Molecular characteristics and efficacy of 16D10 siRNAs in inhibiting root-knot nematode infection in transgenic grape hairy roots. PLoS One, 8, 69463.

Yant, L., Mathieu, J., Dinh, T. T., Ott, F., Lanz, C., Wollmann, H., ... & Schmid, M. (2010). Orchestration of the floral transition and floral development in Arabidopsis by the bifunctional transcription factor APETALA2. The Plant Cell, 22(7), 2156-2170.

Yoo, S. K., Chung, K. S., Kim, J., Lee, J. H., Hong, S. M., Yoo, S. J., ... & Ahn, J. H. (2005). Constans activates suppressor of overexpression of constans 1 through Flowering Locus T to promote flowering in Arabidopsis. Plant Physiology, 139(2), 770-778.

Zhang, Z. (2013). Animal biodiversity: An update of classification and diversity in 2013. In Zhang, Z.-Q. (Ed.) Animal Biodiversity: An Outline of

- 273 -

Bibliography

Higher-level Classification and Survey of Taxonomic Richness (Addenda 2013). Zootaxa, 3703(1), 5–11.

Zhang, B., Wang, L., Zeng, L., Zhang, C., & Ma, H. (2015). Arabidopsis TOE proteins convey a photoperiodic signal to antagonize CONSTANS and regulate flowering time. Genes & Development, 29(9), 975-987.

Zhao, L., Kim, Y., Dinh, T. T., & Chen, X. (2007). MiR172 regulates stem cell fate and defines the inner boundary of APETALA3 and PISTILLATA expression domain in Arabidopsis floral meristems. The Plant Journal, 51(5), 840-849.

Zhao, W., Li, Z., Fan, J., Hu, C., Yang, R., Qi, X., ... & Wang, S. (2015). Identification of jasmonic acid-associated microRNAs and characterization of the regulatory roles of the miR319/TCP4 module under root-knot nematode stress in tomato. Journal of Experimental Botany, 66(15), 4653-4667.

Zhu, Q. H., Upadhyaya, N. M., Gubler, F., & Helliwell, C. A. (2009). Over-expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa). BMC Plant Biology, 9(1), 149.

Zhu, Q. H., & Helliwell, C. A. (2010). Regulation of flowering time and floral patterning by miR172. Journal of Experimental Botany, erq295.

- 274 -