Fibroblast Growth Factor 23 Regulation by Systemic and Local Osteoblast-Synthesized 1,25-Dihydroxyvitamin D

BASIC RESEARCH www.jasn.org

† ‡ | Loan Nguyen-Yamamoto,* Andrew C. Karaplis, Rene St–Arnaud,* § and David Goltzman*

Departments of *Medicine, ‡Surgery, and §Human Genetics, and †Department of Medicine, Sir Mortimer B. Davis Jewish General Hospital, McGill University, Montreal, Canada; and |Research Centre, Shriners Hospital for Children, Montreal, Canada

ABSTRACT Circulating levels of fibroblast growth factor 23 (FGF23) increase during the early stages of kidney disease, but the underlying mechanism remains incompletely characterized. We investigated the role of vitamin D metabolites in regulating intact FGF23 production in genetically modified mice without and with adenine- induced uremia. Exogenous calcitriol (1,25-dihydroxyvitamin D) and high circulating levels of calcidiol (25-hydroxyvitamin D) each increased serum FGF23 levels in wild-type mice and in mice with global deficiency of the Cyp27b1 gene encoding 25-hydroxyvitamin D 1-a-hydroxylase, which produces 1,25- hydroxyvitamin D. Compared with wild-type mice, normal, or uremic mice lacking Cyp27b1 had lower levels of serum FGF23, despite having high concentrations of parathyroid hormone, but administration of exogenous 1,25-dihydroxyvitamin D increased FGF23 levels. Furthermore, raising serum calcium levels in Cyp27b1-depleted mice directly increased FGF23 levels and indirectly enhanced the action of ambient vitamin Dmetabolitesvia the vitamin D receptor. In chromatin immunoprecipitation assays, 25-hydroxyvitamin D pro- moted binding of the vitamin D receptor and retinoid X receptor to the promoters of osteoblastic target genes. Conditional osteoblastic deletion of Cyp27b1 caused lower serum FGF23 levels, despite normal circulating levels of vitamin D metabolites. In adenine-induced uremia, only a modest increase in serum FGF23 levels occurred in mice with osteoblastic deletion of Cyp27b1 (12-fold) compared with a large increase (58-fold) in wild-type mice. Therefore, in addition to the direct effect of high circulating concentrations of 25-hydroxyvitamin D, local osteoblastic conversion of 25-hydroxyvitamin D to 1,25-dihydroxyvitamin D appears to be an important positive regulator of FGF23 production, particularly in uremia.

J Am Soc Nephrol 28: 586–597, 2017. doi: 10.1681/ASN.2016010066

Fibroblast growth factor 23 (FGF23) is a 32 kD and parathyroid hormone (PTH).10–13 Vitamin D re- (251 aa) hormone secreted mainly by skeletal sponse elements (VDREs) in the FGF23 promoter osteocytes and osteoblasts1 and was originally dis- have been reported14–16 and several in vitro studies 14–16 covered as a cause of autosomal dominant hypo- have shown that both 1,25(OH)2D and phosphatemic rickets.2 Subsequent studies have PTH10–13 can directly increase FGF23 gene transcription. conﬁrmed its role in other congenital and acquired hypophosphatemic/phosphaturic conditions in humans. Additionally, spontaneous and genetically Received January 19, 2016. Accepted July 10, 2016. engineered mouse models have demonstrated the Published online ahead of print. Publication date available at potent effect of circulating FGF23 on inhibiting re- www.jasn.org. 3–8 nal phosphate reabsorption. Correspondence: Dr. David Goltzman, McGill University Health The production of FGF23 has been reported to Centre, Glen Site, 1001 Decarie Blvd, Room EM1.3220, Mon- be stimulated by systemic factorssuchascirculating treal, QC, Canada, H4A 3J1. Email: [email protected] 9 calcitriol (1,25-dihydroxyvitamin D [1,25(OH)2D]) Copyright © 2017 by the American Society of Nephrology

586 ISSN : 1046-6673/2802-586 J Am Soc Nephrol 28: 586–597, 2017 www.jasn.org BASIC RESEARCH

34,35 However, 1,25(OH)2D/vitamin D receptor (VDR) induction of described, its exact function is unclear. Alternatively, 25 an intermediate factor appears to be a requirement for a full (OH)D, and also 1,25(OH)2D, can be 24-hydroxylated by a increase in FGF23 production.15 25-hydroxyvitamin D 24-hydroxylase (24[OH]ase) enzyme, Although dietary phosphate (P),17–19 serum P,20 and cal- CYP24A1, as a first step in the catabolism of these vitamin 20 cium (serum Ca) are able to increase circulating levels of D metabolites. In a negative feedback loop, 1,25(OH)2Dcan FGF23, the precise molecular mechanism whereby these inhibit renal CYP27B1, but 1,25(OH)2D can also stimulate ions regulate FGF23 is unclear. Serum Ca–mediated increases renal CYP24A1, thus reducing further 1,25(OH)2Dsynthesis in serum FGF23 required a threshold level of serum phospho- and enhancing its own elimination in order to maintain 36 rus and, likewise, P-elicited increases in FGF23 were markedly appropriate circulating levels of 1,25(OH)2D. FGF23 also blunted if serum Ca was below a threshold level.20 Conse- acts at the proximal renal tubule to downregulate the quently, the best correlation between Ca and P and serum expression of CYP27B1 and stimulate the expression FGF23 was found between FGF23 and the Ca3P product.20 of CYP24A1.37,38 Decreases in CYP27B1 activity due Nevertheless, the use of a Ca3P product as a determinant of a to FGF23 may also result from a defect in translational or physiologic or pathologic event has been questioned, particu- post-translational modification of the enzyme.39 The 21 larly as it relates to ectopic calcification. Iron deficiency may decreased circulating 1,25(OH)2D that occurs as a conse- also cause high levels of both intact and carboxy-terminal quence of these actions of FGF23 can then decrease intestinal FGF23.22 In addition, circulating FGF23 levels increase very Ca absorption. 23 soon after kidney disease occurs ; however, the mechanism The active form of vitamin D, 1,25(OH)2D, can bind to the underlying this early rise is poorly understood. Finally, several VDR and form a heterodimer with the retinoid X receptor local bone-derived factors, such as PHEX, DMP1, and MEPE, (RXR). This complex can then bind to VDREs to regulate may act in an autocrine/paracrine mode to regulate FGF23 gene transcription.40,41 It has also been reported that, at expression in bone.24 Nevertheless, their mechanism of regu- high concentrations, 25(OH)D may bind as an agonist to lating FGF23 production still remains to be determined. VDR, and may be transcriptionally active.42–47 Thus, a complete lack of DMP1 in the context of normal renal Although local production of 1,25(OH)2Dbybonecells function results in increased circulating levels and bone ex- has been hypothesized to contribute to regulation of FGF23 pression of FGF23.25,26 However, overexpression of DMP1 production,48 direct evidence for an autocrine function of does not cause the inverse phenotype, that is, DMP1 excess 1,25(OH)2D in this regulation has not yet been reported. In does not suppress FGF23 expression.27,28 Furthermore, a si- this study, we used genetically engineered mouse models to multaneous increase in both DMP1 and FGF23 expression was assess the role of vitamin D metabolites in FGF23 regulation, 2 2 reported in osteocytes of patients with CKD, which also ap- and probed the contribution of skeletal 1(OH)ase / in mod- pears contrary to the concept that DMP1 acts to suppress ulating FGF23 production in the presence and absence of renal 29 FGF23 expression. 1,25(OH)2D has been reported to regu- dysfunction. late FGF23 expression by repressing DMP1 via the VDR pathway;30 however, in a study in dialysis patients treated with active vitamin D, bone-intact FGF23 increased but DMP1 RESULTS fragments were altered with therapy.31 Consequently, further understanding of the effects of DMP1 fragments on FGF23 Studies in Mice with Normal Renal Function production and the role of vitamin D in mediating this effect Serum Ca and P levels were significantly reduced and PTH 2 2 2 2 appears to be needed. levels elevated in the 1(OH)ase / mice and the VDR / mice FGF23 acts by binding to FGF receptors (FGFRs), which are on a high-Ca diet compared with wild-type (WT) mice (Fig- transmembrane phosphotyrosine kinases, and complexing ure 1, A–C). Serum Ca, P, and PTH were normalized on the 32,33 with a Klotho, an essential coreceptor for FGF23. Thus rescue diet compared with the high-Ca diet. 1,25(OH)2D lev- 2 2 coexpression of FGFR and Klotho appears to define the target els were undetectable in the 1(OH)ase / mice on either diet 2 2 tissue specificity of FGF23 action. FGF23 exerts its phospha- andwereelevatedintheVDR / mice on both diets (not turic action by reducing the sodium-P cotransporters, Npt2a shown), as previously described.49 FGF23 levels were low in 2 2 and Npt2c, in the renal proximal tubule and thus decreasing P the 1(OH)ase / mice on the high-Ca diet (Figure 1D) in 3–7 reabsorption. association with the undetectable circulating 1,25(OH)2D, Vitamin D is derived either via ultraviolet irradiation of a even though PTH levels were elevated (Figure 1C). When 2 2 2 2 skin precursor, or via intestinal absorption from the diet, and the 1(OH)ase / mice were fed a rescue diet (1(OH)ase / R) can then be enzymatically converted in the liver to calcidiol and serum Ca and P were normalized, FGF23 levels rose (25-hydroxyvitamin D [25(OH)D]), the most abundant despite a fall in PTH levels and an undetectable level of circulating vitamin D metabolite. Subsequently, CYP27b1, en- 1,25(OH)2D (Figure 1D). Consequently, PTH did not seem coding 25-hydroxyvitamin D 1a-hydroxylase (1[OH]ase), to be a critical determinant of FGF23 levels in this setting. In the 2/2 converts 25(OH)D to its active form, 1,25(OH)2D, in the kid- VDR mice, FGF23 levels were low on the high-Ca diet even in ney. Although extrarenal skeletal 1(OH)ase has been the presence of high circulating 1,25(OH)2D, indicating that the

J Am Soc Nephrol 28: 586–597, 2017 FGF23 Regulation by Vitamin D 587 BASIC RESEARCH www.jasn.org

1,25(OH)2D, a stable and sustained increase in FGF23 levels was seen (Figure 2B). This may have reflected, at least in part, the normalization of the Ca level (Figure 2C). In the un- 2 2 treated 1(OH)ase / mice on the rescue diet, with normalization of serum Ca (Figure 2C), FGF23 serum levels increased above levels in 2 2 the untreated 1(OH)ase / mice on a high- Ca diet but rose even further after only 1 week of 1,25(OH)2D treatment, suggesting that normalization of the Ca enhanced the action of 1,25(OH)2D. Exogenous 25(OH)D also produced a significant increase in FGF23 in 2 2 1(OH)ase / mice on the rescue diet, but not to the levels seen with exogenous 1,25(OH)2D(Figure2B). We postulated that the attenuated response of FGF23 to exogenous treatment with 1,25(OH)2Dand25(OH)Din1 2 2 (OH)ase / mice on a high-Ca diet, relative to the rescue diet, could be associated with a defect in VDR expression. We there- Figure 1. Circulating FGF23 is influenced by serum calcium and VDR levels. Basal fore examined VDR expression in bone by 2/2 2/2 serum biochemical parameters of WT, VDR , and 1(OH)ase mice. Serum Ca, P, immunohistochemistry (Figure 3). The PTH, and FGF23 are shown in panels (A–D), respectively. WT mice were maintained 2 2 2 2 VDR was expressed in osteoblastic cells of on normal chow. 1(OH)ase / and VDR / mice were maintained either on a high-Ca 2/2 2/2 2/2 WT mice but not in osteoblastic cells of diet or a rescue diet, denoted as 1(OH)ase CandVDR C, and 1(OH)ase Rand 2/2 2/2 6 VDR mice (Figure 3, A and D). VDR ex- VDR R, respectively. Bars represent the mean SEM of measured data from six to eight 2/2 animals of each genotype. ◆◆◆P , 0.001 compared with age-matched WT; ***P,0.001 pression was low in the bones of 1(OH)ase # mice on a high-Ca diet but expression was and **P 0.01 compared with mice of the same genotype on a high-Ca diet. 2 2 partly restored in the 1(OH)ase / mice on a rescue diet (Figure 3, B and E). Treat- effect of 1,25(OH)2D required the VDR. FGF23 levels rose in the ment with 1,25(OH)2D for 1 week increased VDR expression 2 2 2 2 VDR / mice on the rescue diet, but remained significantly slightly in 1(OH)ase / mice on a high-Ca diet (Figure 3C). 2/2 below normal levels. Therefore, although the rescue diet in the One week of 1,25(OH)2D treatment of 1(OH)ase mice 2 2 1(OH)ase / R mice resulted in a restoration of FGF23 to WT on a rescue diet, however, produced the greatest increase in levels, FGF23 levels were only increased to 25% of WT levels in VDR expression (Figure 3F), to levels above those seen with 2 2 the VDR / R mice. In view of the fact that the serum Ca and the rescue diet alone. 2 2 P were not significantly different in the 1(OH)ase / R mice In view of the capacity of high concentrations of exogenous 2 2 ontherescuedietandtheVDR / R mice on the rescue diet, 25(OH)D to increase serum FGF23 levels in the global absence 2 2 it therefore seemed likely that endogenous 25(OH)D in the of 1a(OH)ase / , we assessed whether 25(OH)D might di- 2 2 1(OH)ase / mice might be able to bind to the VDR and further rectly interact with the VDR in modulating VDR-mediated 2 2 increase FGF23 above the levels seen in the VDR / mice. gene transcription. Chromatin immunoprecipitation (ChIP) In WT mice, treatment with exogenous 1,25(OH)2Dfor1 analysis showed that 1,25(OH)2D, as well as 25(OH)D, can week increased FGF23 above control levels 24 hours after the promote the binding of VDR and RXR to the VDRE in the treatment (Figure 2A). A lesser increase in FGF23 was seen in promoter of several osteoblast target genes of 1,25(OH)2D, the WT mice after 1 week of treatment with 25(OH)D. No including osteopontin, osteocalcin, and Cyp24A1 (Figure increase in serum Ca was observed after 1 week of treatment 4A), as well as FGF23 (Figure 4B), suggesting that at least 2 2 (Figure 2C). In the 1(OH)ase / mice on a high-Ca diet, part of the effect of 25(OH)D might be by direct interaction treatment for 1 week with exogenous 1,25(OH)2D significantly with the osseous VDR. 2 2 raised FGF23 above levels in the untreated 1(OH)ase / mice, Wenext assessed whether, in additionto direct interactionwith but not to levels above those in the untreated WT mice. Exoge- the VDR, part of the effect of the exogenous 25(OH)D admin- nous 25(OH)D treatment for 1 week had no significant effect. istered to WT mice might also have been due to intraosseous, No change in serum Cawas observed after one week of treatment rather than to renal, conversion to 1,25(OH)2D3 with subsequent 2/2 with 1,25(OH)2D or with 25(OH)D in WT or in 1(OH)ase interaction with the osseous VDR. To examine this issue, we used 2 2 2 2 mice (Figure 2D). After 2 months of treatment with exogenous an osteoblast-specific1(OH)ase / mouse, (OB-1[OH]ase / )

588 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 586–597, 2017 www.jasn.org BASIC RESEARCH

Studies in Mice with Reduced Renal Function In view of the fact that FGF23 levels rise dramatically in the presence of renal dysfunction, we used a mouse model of CKD to examine the regulation of FGF23 by vitamin D in this setting. Adenine administration to WTmice for 5 weeks produced, approximately, a tripling in serum urea nitrogen (Figure 6A), no significant change in serum Ca (Figure 6B), and a rise in serum P (Figure 6C). 1,25(OH)2D levels fell to about 30% of the levels in nonadenine- treated WT mice (Figure 6D), and PTH levels increased (Figure 6E). FGF23 levels increased markedly (Figure 6F). When we induced uremia with adenine in the global 2 2 1(OH)ase / mice, serum urea nitrogen rose, Ca rose, P rose, and PTH levels rose dramatically.FGF23levelswere,however,again low, despite the rise in PTH. We then exam- 2 2 ined FGF23 levels in the OB-1(OH)ase / Figure 2. FGF23 increases induced by vitamin D metabolites are enhanced by increasing the serum calcium. Comparison of the FGF23 responses to exogenous mice in which we had induced renal dys- 2/2 1,25(OH)2D and 25(OH)D treatment of WT mice (A) and of 1(OH)ase Cmice(ona function with adenine. Serum urea nitrogen 2 2 high-Ca diet) and 1(OH)ase / R mice (on a rescue diet) (B). Serum Ca levels are shown rose (Figure 6A), Ca did not change (Figure 2/2 2/2 in WT mice (C) and in 1(OH)ase Cand1(OH)ase R mice (D) after treatment with 6B), P rose (Figure 6C), 1,25(OH)2D levels 1,25(OH)2D and 25(OH)D. Intraperitoneal injections of 1,25(OH)2D (6 ng/g) or 25(OH)D fell (Figure 6D), and PTH levels rose (Figure (100 ng/g) were given every 2 days for 1 week. Alternatively, exogenous 1,25(OH)2D 6E), all to about the same levels as those 2/2 (50 pg/g) was administered for 2 months (2M) to 1(OH)ase C mice (on a high-Ca diet). seen in the adenine-treated WT mice. Nev- 6 fi Bars represent the mean SEM. Signi cant differences between groups were determined ertheless, serum FGF23 levels increased by one-way ANOVA followed by Bonferroni test. *P#0.05; **P#0.01; ***P#0.001; and ****P#0.0001 compared with vehicle-treated mice of the same genotype on the same only 12-fold, compared with 58-fold in ‡ 2 2 diet; P#0.05 compared with 1(OH)ase / Cmice. the WTmice, after inducing uremia (Figure 6F). The increased serum FGF23 levels in adenine-treated WT mice (Figure 6F) were using an osteocalcin promoter–driven Cre recombinase to delete associated with markedly increased FGF23 Cyp27b1 from mature osteoblastic cells. Circulating levels of mRNA (Figure 6G). In contrast, adenine treatment of mice deficient in osteoblastic 1(OH)ase showed only a modest in- 1,25(OH)2D, as well as serum Ca, P, and PTH, did not differ 2 2 significantly in OB-1(OH)ase / mice from values in WT mice crease in FGF23 mRNA (Figure 6G). Consequently, osteoblas- (Figure 5, A–D, respectively). Circulating FGF23 levels, however, tic 1(OH)ase appeared to contribute to increased circulating 2 2 were significantly lower in the OB-1(OH)ase / mice than in FGF23 at least in large part by increasing FGF23 gene expres- via WT mice (Figure 5E). sion local 1,25(OH)2D production. Therefore, the osteo- Specific osteoblastic deletion of 1(OH)ase did not affect the blastic 1a(OH)ase appeared to be a major regulator of FGF23 a FGF23 response to treatment with exogenous 1,25(OH)2D, production in uremia and loss of only the osteoblastic 1 (OH) and a robust increase in FGF23 levels, comparable to that in WT ase could account for most of the reduction of FGF23 which 2/2 mice, was seen. In contrast, exogenous 25(OH)D failed to increase was observed in the global 1(OH)ase mice. FGF23 levels in these mice (Figure 5E). Neither 1,25(OH)2Dnor The low levels of serum 24,25(OH)2D in the global 1 2/2 25(OH)D increased the serum Ca (data not shown). (OH)ase mice before and after administration of adenine Administration of 25(OH)D significantly increased the serum supported the likelihood that 1,25(OH)2D was the major reg- 2/2 25(OH)D levels in WT,global,andbone-specific1(OH)ase mice ulator of 24(OH)ase activity. Serum 24,25(OH)2D levels were 2 2 relative to vehicle-treated control mice of the same genotype (Figure also reduced in both WT and in OB-1(OH)ase / mice sug- 5F). However, after administration of the same dose of 25(OH)D, gesting that the reduced 1,25(OH)2D levels after adenine ad- 2 2 global 1(OH)ase / mice had significantly higher circulating levels ministration decreased 24-hydroxylase activity (Figure 6H), of 25(OH)D and lower circulating levels of 24,25(OH)2D than Furthermore, the reduction of serum 24,25(OH)2Dinthe 2 2 in the WT and OB-1(OH)ase / mice (Figure 5G). WT mice occurred despite elevated circulating FGF23 levels

J Am Soc Nephrol 28: 586–597, 2017 FGF23 Regulation by Vitamin D 589 BASIC RESEARCH www.jasn.org

indicating that increased FGF23 had failed to increase 24(OH)ase activity. A model of FGF23 regulation by medi- ators examined in this study is presented in Figure 7.

DISCUSSION

In previous studies, Ca-mediated increases in serum FGF23 in vivo required a threshold level of serum P, and P-elicited increases in FGF23 were markedly blunted if serum Ca was below a threshold level.20 However, these changes appeared to occur in the absence of the Ca-sensing receptor.20

Figure 3. Increased VDR expression in osteoblasts is induced by 1,25(OH)2Dand Furthermore, although extracellular Ca has further amplified by increasing serum calcium. Representative sections of VDR ex- been reported to increase FGF23 levels in 2 2 pression in bone analyzed by immunohistochemistry of femur from WT, VDR / ,and vitro via L-type voltage-sensitive Ca chan- 2 2 1(OH)ase / mice. The decalcified bone tissue was paraffin-embedded and stained nels in osteoblastic MC3T3-E1 cells50; in for antibodies to VDR. Positive labeling for VDR in WT mice on normal chow is clearly vitro studies in another osteoblastic cell 2/2 evident in brown and denoted by black arrows (A). VDR expression in VDR mice on line, ROS17/2.8, failed to show an effect a rescue diet was a negative control and showed no staining (D). VDR expression in 2 2 of extracellular Ca on the regulation of femurs of 1(OH)ase / mice on a high-Ca diet contained undetectable to low levels of FGF23 expression.8 The results of this VDR (B), and no change was observed after treatment with exogenous 1,25(OH)2D(C). 2/2 study demonstrate that raising serum VDR expression in 1(OH)ase mice was upregulated by a rescue diet (E) and in- 2 2 Ca and/or serum P levels in the VDR / creased further after exogenous treatment with 1,25(OH)2D (F). Original magnifica- tion, 3300 in A and D; 3200 in B, C, E, and F. mice on the rescue diet increased FGF23 levels independent of any VDR-mediated action, providing further evidence for mineral regulation of FGF23; however the precise mechanism remains unclear. The critical role of the VDR in FGF23 production has also been reported, for example, after specificdeletionofVDRin chondrocytes, which resulted in decreased FGF23 expression and low serum FGF23 levels.51 In this study, despite the increase 2 2 in FGF23 in the VDR / mice on the rescue diet, FGF23 levels did not reach those seen in the WTmice which are replete with

Figure 4. 1,25(OH)2D and 25(OH)D stimulate VDR and RXR recruitment to the VDRE 25(OH)D, 1,25(OH)2D, and the VDR, or 2/2 site on the promoters of osteoblastic proteins. Chromatin was extracted from intact in the 1(OH)ase mice on the rescue diet – MC3T3 or UMR106 osteoblastic cells that had been treated with vehicle or 10 7 M which express VDR and have increased cir- –6 1,25(OH)2Dor10 M 25(OH)D for 2 hours, in the presence of 25 mM ketoconazole to culating 25(OH)D. This suggests that part inhibit 1-hydroxylation of 25(OH)D. Extracts were then crosslinked and subjected to oftheeffectofCaand/orPmightbedueto immunoprecipitation with VDR or RXR antibody. Nonimmunoprecipitated (Input) and direct stimulation of FGF23, and part ﬁ Immunoprecipitated DNA from MC3T3-E3 cells were subjected to PCR using speci c might be by enhancing the action of ambi- primers designed according to the VDRE site located in the promoter region of the ent vitamin D metabolites via the VDR. In- target genes osteopontin, osteocalcin, and Cyp24a1 (A). PCR products were analyzed deed, in the presence of hypocalcemia and using 2% agarose gels, and representative agarose gels of 2–3 independent experiments are shown. Control was DNA immunoprecipitated with IgG. For assessment of the absence of endogenous 1,25(OH)2D, VDR and RXR recruitment to the promoter of the FGF23 gene chromatin extracted skeletal VDR levels were low in the global 2/2 from UMR106 cells and DNA immunoprecipitated by ChIP assay as above were an- 1(OH)ase mice, and raising serum Ca 2/2 alyzed by qPCR using a SsoFast-EvaGreen real-time PCR kit. Expression was nor- levels in the global 1(OH)ase mice on malized to the expression of input. Values represent results of three independent the rescue diet increased VDR expression experiments (B). and increased FGF23 levels. Of interest,

590 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 586–597, 2017 www.jasn.org BASIC RESEARCH

Figure 5. Circulating FGF23 levels, are reduced in non-uremic mice deﬁcient in osteoblastic 1(OH)ase and are increased by exogenous 2/2 2/2 1,25(OH)2D but not 25(OH)D. Serum biochemistry of OB-1(OH)ase mice. WT and OB-1(OH)ase mice were maintained on normal chow and were euthanized at 3 months of age. Blood was collected for biochemical assays as described in Concise Methods. 2/2 Serum 1,25(OH)2D (A), Ca (B), P (C), PTH (D), FGF23 (E), 25(OH)D (F), and 24,25(OH)2D (G) are shown in WT, 1(OH)ase C, and OB- 2/2 1(OH)ase mice after treatment with vehicle (V) or with exogenous 1,25(OH)2D (6 ng/g every 2 days for 1 week) or with 25(OH)D (100 ng/g every 2 days for 1 week). Bars represent the mean6SEM of 6–8 animals per group; signiﬁcant differences between groups were determined by one-way ANOVA followed by Bonferroni test. *P#0.05; ***P,0.001; and ****P#0.001 relative to mice of the same ‡ ‡‡ ‡‡‡‡ genotype on the same diet; P#0.05; P#0.01; and P#0.001 compared with WT mice.

Ca-stimulated VDR expression has previously been report- effect of normalizing the serum Ca alone. Therefore, circulat- ed within the parathyroid cell, in both in vitro and in vivo ing 1,25(OH)2D appears to regulate FGF23 production by experiments.52 enhancing VDR expression and, most likely, by stimulating 2 2 In the global 1(OH)ase / mice on the rescue diet, the gene transcription over and above any effect of ambient Ca. likeliest available ligand for the VDR would have been It has previously been reported that the FGF23 response to 25(OH)D per se, in view of the absence of 1,25(OH)2D pro- acute treatment with an active vitamin D analog, doxercalci- 2 2 duction. The increased VDR expression caused by raising se- ferol, was delayed in hypocalcemic 1(OH)ase / mice, rum Ca levels appeared to facilitate VDR-mediated increases although a robust response was seen after 10 weeks, suggesting of FGF23 levels by 25(OH)D. Indeed, a direct interaction of that 1,25(OH)2D and PTH could stimulate FGF23 only if a 25(OH)D with the osseous VDR leading to enhanced tran- state of hypocalcemia was not present.50 On the basis of our scriptional activity of known osteoblastic genes was demon- results, the delayed FGF23 response in that study could be strated through 25(OH)D-dependent promoter occupancy of explained by defective VDR expression in bone and the delay known osteoblastic genes (including FGF23) by VDR/RXR. required to normalize Ca levels and VDR expression after ad- This is consistent with previous in vitro studies which have ministration of exogenous 1,25(OH)2D. reported that 25(OH)D is a VDR agonist with gene regulatory The same dose of exogenously administered 25(OH)D was 2 2 activity,43–47 and from in vivo and in vitro studies demonstrat- more effective in stimulating FGF23 in global 1(OH)ase / 2 2 ing that 25(OH)D is likely responsible for the toxicity of vita- mice on a rescue diet than in the WT or OB-1(OH)ase / min D excess.47 mice. This may have reﬂected direct ligand binding activity 1,25(OH)2D has also been reported to increase VDR gene of the higher circulating concentrations of 25(OH)D achieved 2 2 expression in the kidney and parathyroid gland,53–57 and ad- in the global 1(OH)ase / mice compared with the WT or 2/2 2/2 dition of exogenous 1,25(OH)2Dto1(OH)ase mice on a OB-1(OH)ase mice. These higher 25(OH)D concentra- rescue diet further enhanced skeletal VDR expression over the tions were accompanied by lower 24,25(OH)2D levels in the

J Am Soc Nephrol 28: 586–597, 2017 FGF23 Regulation by Vitamin D 591 BASIC RESEARCH www.jasn.org

Figure 6. The FGF23 increase in uremic mice is absent after global deletion of the 1(OH)ase and markedly reduced after speciﬁc 2 2 deletion of the osteoblastic 1(OH)ase. Comparison of biochemical abnormalities in adenine-induced CKD in WT, 1(OH)ase / C, and 2/2 OB-1(OH)ase mice. Serum urea nitrogen (A), Ca (B), P (C), 1,25(OH)2D (D), PTH (E), and FGF23 (F) levels are shown. Levels of mRNA 2 2 encoding FGF23 extracted from long bone of WT and OB-1(OH)ase / mice and determined by qPCR are shown in (G) and serum

24,25(OH)2D levels in (H). Bars represent the mean6SEM of measured data from six to eight animals per group. Signiﬁcant differences between adenine-treated mice compared with age-matched control mice on a regular diet were determined by one-way ANOVA followed by a Bonferroni test. *P#0.05; **P#0.01; ***P,0.001; and ****P#0.0001 relative to mice of the same genotype on a regular diet; ◆P,0.05 and ◆◆P,0.01 compared with age-matched WT mice on the same diet.

2 2 global 1(OH)ase / mice compared with WT or to OB- Conflicting results have been obtained regarding the role of 2 2 1(OH)ase / mice. This is consistent with decreased 24(OH)ase PTH in stimulating FGF23 production. Thus, several in vivo activity in the global knockout49 and suggests that renal, rather and in vitro studies have demonstrated that PTH increases than osteoblastic, 24(OH)ase is a major determinant of circulating FGF23 mRNA levels by interacting directly with the type 1 24,25(OH)2D levels, as it is for circulating 1,25(OH)2D, and that PTH receptor on osteocytes and on osteoblastic UMR106 10,11 1,25(OH)2D generated by the kidney is an important regulator of cells. FGF23 has also been reported to be increased in renal Cyp24A1 expression. vivo in mice and humans with hyperparathyroid states.62–65 High levels of circulating 25(OH)D may also arise from very Thus, secondary hyperparathyroidism is a characteristic con- high dietary intake and, in this regard, in a double-blinded trial sequence of CKD and the increased circulating PTH is in healthy volunteers treated with daily oral cholecalciferol or believed to enhance FGF23 production in this disorder. Fur- placebo, FGF23 increased significantly in the cholecalciferol- thermore, studies in rats with experimental uremia suggested treated group but not in the placebo group.58 A randomized that secondary hyperparathyroidism is necessary for the in- trial in hemodialysis patients comparing ergocalciferol with duction of the high FGF23 levels in animals with CKD. It has placebo showed that FGF23 increased significantly between also been reported that the PTH stimulating effect on FGF23 baseline and week 12 but there were no significant changes was partly mediated by inhibiting sclerostin and thereby in- in FGF23 between treated and control groups.59 In a random- creasing Wnt-signaling.10 However, these studies did not ad- ized, controlled trial of cholecalciferol in hemodialysis pa- dress the increase of FGF23 at early stages of CKD before tients, low 25(OH)D levels were restored to normal and secondary hyperparathyroidism can be detected. Indeed, in- 1,25(OH)2D levels increased but PTH did not fall and creases in bone sclerostin and FGF23 both occur early in CKD FGF23 did not increase,60 despite the fact that activated vita- before elevations in serum PTH are observed,66,67 and can be min D compounds have been shown to decrease PTH and increased by active vitamin D compounds.29 Furthermore, increase FGF23 in dialysis patients.61 To date, there are no although rapid increases in both PTH and FGF23 have been trials of 25(OH)D treatment in dialysis patients. reported after inducing AKI, osteocyte-specific deletion of the

592 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 586–597, 2017 www.jasn.org BASIC RESEARCH

type 1 PTH receptor and ablation of PTH did not prevent the large elevations of FGF23 levels in response to AKI induction suggesting that the increases in FGF23 occurred independent of PTH-signaling and of PTH.23 Other studies, using calvarial cells isolated from uremic rats, demonstrated that FGF23 synthesis is regulated directly by 1,25(OH)2Dbutnotby PTH.68 In our studies, in mice with normal renal function, we show that exogenous 1,25(OH)2DcouldstimulateFGF23in the presence of suppressed PTH; additionally, in the absence of 1,25(OH)2Din nonuremic mice with global 1a(OH)ase deletion on a high-Ca diet, FGF23 was reduced despite the presence of high concentrations of PTH. Furthermore, FGF23 failed to increase in adenine-induced ure- 2 2 mia in global 1(OH)ase / mice in the presence of severe hyperparathyroidism. Consequently, ambient concentrations of active vitamin D appear to supersede the effects of PTH on regulating FGF23. We also found that osteoblastic 1(OH) ase activity alone appeared to play an important role in increasing FGF23 release. Thus, FGF23 levels were reduced in mice with conditional deletion of osteoblastic 1 (OH)ase and normal renal function, compared with WT mice with normal renal function, even in the presence of normal circulating 1,25(OH)2Dlevels.Further- more, in the presence of uremia, the im- portance of osteoblastic 1 (OH)ase in the production of FGF23 was even more pro- nounced, in view of the fact that its absence resulted in only a modest increase in FGF23 in uremic mice with conditional osteoblas- Figure 7. Model of the regulation of FGF23 by vitamin D metabolites and minerals tic 1(OH)ase deletion, compared with the showing the important role of renal-derived and osteoblast- derived 1,25(OH)2D. (A) In the presence of normal renal function. Circulating 25(OH)D can be converted in the kidney to 1,25(OH)2D via the 1(OH)ase (Cyp27b1). 1,25(OH)2D can stimulate 24(OH) concentrations and facilitate the actions of ase and 25(OH)D can be degraded by the 24(OH)ase (Cyp24a1) to 24,25(OH)2D 1,25(OH)2D and 25(OH)D. Ca and P can in- (24,25D). 1,25(OH)2D can also be converted to 1,24,25(OH)3D(1,24,25D)bythe crease FGF23 production by unknown mech- 24(OH)ase. 1,25(OH)2D can itself stimulate 24(OH)ase activity. Renal-derived circu- anisms. (B) In the absence of renal function. lating 1,25(OH)2D can then enter the mature osteoblast/osteocyte and bind the VDR Renal conversion of 25(OH)D to 1,25(OH)2Dis which then complexes with the RXR. In the nucleus, this complex may bind to an impaired, and renal degradation of 25(OH)D FGF23 VDRE and increase FGF23 transcription, resulting in increased FGF23 production is also impaired. Osteoblastic production and release. Circulating 25(OH)D may also enter the mature osteoblast/osteocyte and be of 1,25(OH)2D becomes the major source converted by the osteoblastic 1(OH)ase to 1,25(OH)2D or be degraded by the osteo- of 1,25(OH)2D in the mature osteoblast/ blastic 24(OH)ase to 24,25(OH)2D. The intracellular 1,25(OH)2Dproducedfrom25(OH)D osteocyte and a major regulator of FGF23 by the osteoblast may act as an intracrine factor and bind to VDR and increase FGF23 production. Circulating 25(OH)D levels may production. At high circulating concentrations of 25(OH)D, this vitamin D metabolite may be inﬂuenced by nutritional intake of vitamin D also act by directly binding to VDR and stimulating FGF23 production. Both Ca, by as well as ultraviolet light–induced production unknown mechanisms, and 1,25(OH)2D, by stimulation of transcription, can increase VDR of vitamin D.

J Am Soc Nephrol 28: 586–597, 2017 FGF23 Regulation by Vitamin D 593 BASIC RESEARCH www.jasn.org increase seen in the uremic WTmice. After adenine treatment (59-TCCCAGACAGAGACATCCGTGTAGG). Mice were maintained 2/2 of global 1(OH)ase mice, 24,25(OH)2D levels were lower on standard chow or on an adenine diet to induce kidney injury. A than in adenine-treated mice with an absence of osteoblastic CKD mouse model was developed by adapting the original rat model 1(OH)ase, again consistent with a role for renal-derived or of T. Yokozawa74 with modifications for use in mice. Briefly, male 2/2 2/2 circulating 1,25(OH)2D as the major determinant of WT, 1(OH)ase and OB-1(OH)ase 8-week-old mice were kept 24(OH)ase activity. Furthermore, after adenine treatment of on a regular diet containing 0.25% adenine (Harlan Teklad, Madison, fi WTmice, 24,25(OH)2D levels were similar to those of adenine- WI) for 5 weeks and then sacri ced. Serum and bone were collected 2 2 treated OB-1(OH)ase / mice. This occurred despite higher for analysis. serum FGF23 levels in the WT mice. Consequently, FGF23 does not appear to be a major activator of 24(OH)ase activity Treatment with Exogenous 1,25(OH)2D and 25(OH)D 69,70 in uremia and “resistance” to effects of elevated FGF23 on To compare the FGF23 response with exogenous 1,25(OH)2Dorto 2 2 24(OH)ase in CKD may, at least in part, be due to decreased 25(OH)D, WT and OB-1(OH)ase / mice were maintained on reg- 2/2 renal 1,25(OH)2D production in CKD, which then limits the ular chow and 1(OH)ase mice on a high-Ca diet and treated with capacity of FGF23 to increase 24(OH)ase activity. 6ng/gof1,25(OH)2D or with 100 ng/g of 25(OH)D every 2 days for Therefore, in addition to the direct effect of high circulating 1week. concentrations of 25(OH)D, local osteoblast activation of To further investigate the role of VDR expression in the FGF23

25(OH)D to 1,25(OH)2D, even at normal circulating 25(OH) response with exogenous 1,25(OH)2D or 25(OH)D, two additional 2/2 2/2 D and 1,25(OH)2D concentrations, appears to be an impor- groups of 1(OH)ase mice were added. In the ﬁrst group, 1(OH)ase tant positive regulator of FGF23 production and this effect mice were maintained on a high-Ca diet and then treated with 50 pg/g 2/2 appears even more signiﬁcant in uremia. of 1,25(OH)2D (IP) for 2 months; in the second group, 1(OH)ase mice were maintained on a rescue diet from weaning then treated

with 6 ng/g of 1,25(OH)2D or 100 ng/g of 25(OH)D every 2 days for CONCISE METHODS 1 week. Serum was collected 24 hours after the last dose for biochemistry analysis. Control mice were treated with vehicle (saline/ In Vivo propylene glycol/ethanol in a ratio of 40:50:10, respectively). All animal experiments were carried out in compliance with, and after approval by the Institutional Animal Care and Use Committee of Serum Biochemistry McGill University and followed the guidelines of the Canada Council Blood was collected 24 hours after the last treatment and serum was on Animal Care. obtained by centrifugation at 3000 rpm and stored at 280°C before Male WT mice (C57BL/6 background) were purchased from assay. Serum biochemistry for Ca and P were determined by auto- 2 2 Charles River. 1(OH)ase / mice expressing the null mutation for analyzer (Beckman Synchron 67; Beckman Instruments). Serum the 1(OH)ase enzyme and which exhibit tissue-wide inability to syn- urea nitrogen was measured by the Diagnostic Laboratory of the 69 thesize 1,25(OH)2D have previously been described. To determine Animal Resource Center of McGill University, using a colorimetric 2/2 the 1(OH)ase genotype, genomic DNA was isolated from tail assay. Mouse intact PTH, 1,25(OH)2D, and intact-FGF23 were mea- fragments and analyzed as previously described.71 Mice were weaned sured by ELISA according to the manufacturer’s protocol (Immuno- at 3 weeks old and were maintained on either a high-Ca diet contain- Diagnostic Systems, Fountain Hills, AZ; Immunotopics, San ing 1.5% Ca in the drinking water and regular autoclaved chow Clemente, CA; and Kaino, Tokyo, Japan, respectively). Serum containing 1% Ca, 0.85% phosphorus, 0% lactose, and 2.2 units/g 24,25(OH)2D was measured by Heartland Assays LLC (Ames, IA) vitamin D, or a “rescue diet” (TD96348; Teklad, Madison, WI) of by liquid chromatography/mass spectrometry. Serum 25(OH) D was g-irradiated chow containing 2% Ca, 1.25% phosphorus, 20% lac- measured by enzyme immunoassay (Immunodiagnostic Systems tose, and 2.2 units/g vitamin D. Ltd., Boldon, UK). VDR-knockout mice were bred from heterozygote breeders purchased from The Jackson Laboratory (Bar Habor, ME). Genomic Tissue Harvest and Histology DNA was isolated from mouse tails and genotyped using the primers Tissues were collected and fixed overnight in periodate-lysine- and protocol provided. VDR-knockout mice were weaned at 3 weeks paraformaldehyde fixative solution and placed in 70% ethanol. Fixed of age and were also maintained on a high-Ca diet or a rescue diet. tissues were embedded in paraffin and sectioned. To generate mice lacking 1(OH)ase in mature osteoblasts and For bone immunohistochemistry, femur sections from six to 2 2 osteocytes (OB-1[OH]ase / ), osteocalcin-Cre (Oc-Cre) mice (gen- eight mice per experimental group were fixed in periodate-lysine- erously provided by Dr. T. Clemens) were mated with mice homo- paraformaldehyde and decalcified before embedding in paraffin. The zygous for a floxed Cyp27b1 allele,72 derived from mice originally VDR-D6 antibody (sc13133; Santa Cruz Biotechnology, Santa Cruz, from Dr. Rene St. Arnaud (McGill University, Montreal, Canada). For CA) was applied to dewaxed paraffinsections overnight. After washing genotyping, genomic DNAwas isolated from mouse tail and analyzed with high-salt buffer, slides were incubated with secondary antibody, by PCR, as described previously for the Oc-Cre transgene73 and washed, and processed using the Vectastain ABC-AP kit (Vector floxed-Cyp27b171 using reverse primer (R-primer) (59-TGCAGAC- Laboratories, Burlingame, CA) and mounted with Permount (Fisher CAGTTTAAAAGTGGGCC) and forward primer (F-primer) Scientific, Waltham, MA). Images from 4 to 6 sections were processed

594 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 586–597, 2017 www.jasn.org BASIC RESEARCH blindly using image analysis software (Bioquant Image Analysis, (pH 8.1), and TE buffer. The A-agarose beads were eluted (1% SDS Nashville, TN). and 0.1 M sodium bicarbonate), the crosslinking was reversed by incubating at 65°C overnight, and purified eluates using a PCR purifica- Detection of FGF23 Gene Transcripts tion kit (Qiagen, Germantown, MD). DNA sequences of mCyp24, Total RNA was extracted from long bone using the TRIzol reagent m-osteopontin, and m-osteocalcin, associated with the VDR or RXR (Invitrogen, Carlsbad, CA) following the manufacturer’s protocol, immunoprecipitates, were quantitated by PCR using specificprimers reverse transcribed into cDNA using SuperScript II, and analyzed designed according to the VDRE site located in the promoter region of by real-time PCR, using F-primer 59-CACTGCTAGAGCCTATTC 1,25(OH)2D target genes, i.e., mCyp24 (promoter region -236 to -51) and R-primer 59-CACTGTAGATAGTCTGATGG. Relative expression F-primer 59-GGTTATCTCCGGGGTGGAGT-39 and R-primer – values were evaluated with the 2 DDCt method and values were nor- 59-GGTGGCCAATGAGCACGC (186 base pairs [bp]); m-osteopontin malized to GAPDH signals. cDNAs from three independent experi- promoter region -757 to -743, F-primer 59-ACCACCTCTTCTGCTC- ments were analyzed. TATATGGC and R-primer 59-TGACACTTGAGCTATGCAGCCGC (187 bp); m-ostecalcin F-primer59-CTGAACTGGGCAAATGAGGACA; ChIP Assays and R-primer 59AGGGGATGCTGCCAGGACTAAT (403 bp). PCR To determine whether 25(OH)D might exert direct actions on target products were analyzed using 2% agarose gel. DNA sequences of genes independent of 1,25(OH)2D, we examined the capacity of rFGF23 associated with the VDR or RXR immunoprecipitates were 25(OH)D to recruit the VDR to the promoter regions of the target F-primer 59-: CATTTCCTGATGGAAGTGGGACA and R-primer genesosteopontin,osteocalcin,and24hydroxylaseinmouse 59-TTCAAGCCAGTGCTCTCATAAGT. cDNA and were analyzed by MC3T3-E3 osteoblastic cells using a ChIP assay in the presence of quantitative real-time PCR (qPCR) using a SsoFast-EvaGreen real- 25 mM ketoconazole to inhibit 1a hydroxylation. MC3T3-E3 cells time PCR kit (Bio-Rad, Hercules, CA). Expression was normalized to were maintained in a-modified MEM (a-MEM), containing 10% the expression of input. FBS and changed to a-MEM containing 2% charcoal-stripped FBS 24 hours before the ChIP assay. The capacity of 25(OH)D to recruit Statistical Analyses 6 the VDR to the promoter region of FGF23 was investigated in a rat All values are presented as means SEM and statistical analyses were osteoblastic cell line, UMR-106. UMR-106 cells were maintained in assessed using one-way ANOVA with Bonferroni multiple-group DMEM Nutrient Mixture F-12 (DMEM-F12) Media supplemented comparison after test (GraphPad Prism 5 Software; GraphPad Inc., fi P# with 10% FBS. Medium was replaced by serum-free DMEM-F12 San Diego, CA). The signi cance level was set at 0.05. overnight and changed to DMEM-F12 containing 2% charcoal-stripped FBS for ChIP assay. For the assays, both cell lines were pretreated for 2 hours with 25 mM of ketoconazole (Sigma-Aldrich, St Louis, ACKNOWLEDGMENTS MO) to inhibit 1-hydroxylation of 25(OH)D and treated for 2 hours 27 26 with 10 M 1,25(OH)2D, 10 M of 25(OH)D, or vehicle. ChIP This study was supported by a grant from the Canadian Institutes for assay was performed with a commercial kit (Upstate, Temecula, Health Research to D.G. CA) following the protocol provided. Briefly, nuclear proteins were crosslinked to DNA by adding formaldehyde (Sigma-Aldrich, #F8775) directly to the cultures to a final concentration of 1% and DISCLOSURES incubated for 10 minutes at 37°C. Cells were washed and resuspended None. in 200 ml of SDS lysis buffer. Sonicated cells containing sheared DNA were centrifuged at 13,000 rpm at 4°C to obtain cleared cell lysate. The lysates were diluted with ChIP dilution buffer and protease in- REFERENCES hibitor cocktail (Roche, Basel, Switzerland). A portion (2%) of the diluted lysate was taken as input/starting material to quantify the 1. Bonewald LF, Wacker MJ: FGF23 production by osteocytes. Pediatr – fi Nephrol 28: 563 568, 2013 amount of DNA present in different samples. To reduce nonspeci c 2. ADHR Consortium: Autosomal dominant hypophosphataemic rickets is background, samples were precleared by incubating with 75 mlof associated with mutations in FGF23. Nat Genet 26: 345–348, 2000 protein A-agarose/salmon sperm DNA 50% slurry for 30 minutes 3. Bai XY, Miao D, Goltzman D, Karaplis AC: The autosomal dominant at 4°C with agitation, centrifuged briefly at 4°C to collect the super- hypophosphatemic rickets R176Q mutation in fibroblast growth factor natant, and the histone DNA complex was immunoprecipitated by 23 resists proteolytic cleavage and enhances in vivo biological potency. J Biol Chem 278: 9843–9849, 2003 m overnight rotation-incubation at 4°C with 4 g of either primary 4. Larsson T, Marsell R, Schipani E, Ohlsson C, Ljunggren O, Tenenhouse antibody, anti-VDR (N-20) and anti-RXR (DN 197) (Santa Cruz Bio- HS, Jüppner H, Jonsson KB: Transgenic mice expressing fibroblast technology), or with normal rabbit IgG as control. To collect the growth factor 23 under the control of the a1(I) collagen promoter ex- antibody, histone or DNA complex, 60 ml of protein A-agarose/salmon hibit growth retardation, osteomalacia, and disturbed phosphate ho- – sperm DNA 50% slurry was added. The protein A-agarose, antibody, his- meostasis. Endocrinology 145: 3087 3094, 2004 5. Shimada T, Urakawa I, Yamazaki Y, Hasegawa H, Hino R, Yoneya T, Takeuchi tone, or DNA complex were rinsed sequentially with TSE I buffer, TSE II Y, Fujita T, Fukumoto S, Yamashita T: FGF-23 transgenic mice demonstrate buffer, lithium chloride wash buffer (0.25 M lithium chloride, 1% NP-40, hypophosphatemic rickets with reduced expression of sodium phosphate 1% deoxycholate [sodium salt]), 1 mM EDTA, 10 mM Tris hydrochloride cotransporter type IIa. Biochem Biophys Res Commun 314: 409–414, 2004

J Am Soc Nephrol 28: 586–597, 2017 FGF23 Regulation by Vitamin D 595 BASIC RESEARCH www.jasn.org

6. Shimada T, Kakitani M, Yamazaki Y, Hasegawa H, Takeuchi Y, Fujita T, 24. Rowe PS: Regulation of bone-renal mineral and energy metabolism: the Fukumoto S, Tomizuka K, Yamashita T: Targeted ablation of Fgf23 PHEX, FGF23, DMP1, MEPE ASARM pathway. Crit Rev Eukaryot Gene demonstrates an essential physiological role of FGF23 in phosphate Expr 22: 61–86, 2012 and vitamin D metabolism. J Clin Invest 113: 561–568, 2004 25. Lorenz-Depiereux B, Bastepe M, Benet-Pagès A, Amyere M, 7. Sitara D, Razzaque MS, Hesse M, Yoganathan S, Taguchi T, Erben RG, Wagenstaller J, Müller-Barth U, Badenhoop K, Kaiser SM, Rittmaster Jüppner H, Lanske B: Homozygous ablation of fibroblast growth factor- RS, Shlossberg AH, Olivares JL, Loris C, Ramos FJ, Glorieux F, Vikkula 23 results in hyperphosphatemia and impaired skeletogenesis, and M, Jüppner H, Strom TM: DMP1 mutations in autosomal recessive reverses hypophosphatemia in Phex-deficient mice. Matrix Biol 23: hypophosphatemia implicate a bone matrix protein in the regulation of 421–432, 2004 phosphate homeostasis. Nat Genet 38: 1248–1250, 2006 8. Liu S, Zhou J, Tang W, Jiang X, Rowe DW, Quarles LD: Pathogenic role of 26. Liu S, Zhou J, Tang W, Menard R, Feng JQ, Quarles LD: Pathogenic role Fgf23 in Hyp mice. Am J Physiol Endocrinol Metab 291: E38–E49, 2006 of Fgf23 in Dmp1-null mice. Am J Physiol Endocrinol Metab 295: E254– 9. Nishi H, Nii-Kono T, Nakanishi S, Yamazaki Y, Yamashita T, Fukumoto S, E261, 2008 Ikeda K, Fujimori A, Fukagawa M: Intravenous calcitriol therapy in- 27. Lu Y, Ye L, Yu S, Zhang S, Xie Y, McKee MD, Li YC, Kong J, Eick JD, creases serum concentrations of fibroblast growth factor-23 in dialysis Dallas SL, Feng JQ: Rescue of odontogenesis in Dmp1-deficient mice patients with secondary hyperparathyroidism. Nephron Clin Pract 101: by targeted re-expression of DMP1 reveals roles for DMP1 in early c94–c99, 2005 odontogenesis and dentin apposition in vivo. Dev Biol 303: 191–201, 10. Lavi-Moshayoff V, Wasserman G, Meir T, Silver J, Naveh-Many T: PTH 2007 increases FGF23 gene expression and mediates the high-FGF23 levels 28. Martin A, David V, Li H, Dai B, Feng JQ, Quarles LD: Overexpression of of experimental kidney failure: a bone parathyroid feedback loop. Am J the DMP1 C-terminal fragment stimulates FGF23 and exacerbates the Physiol Renal Physiol 299: F882–F889, 2010 hypophosphatemic rickets phenotype in Hyp mice. Mol Endocrinol 26: 11. Rhee Y, Bivi N, Farrow E, Lezcano V, Plotkin LI, White KE, Bellido T: 1883–1895, 2012 Parathyroid hormone receptor signaling in osteocytes increases the 29. Pereira RC, Juppner H, Azucena-Serrano CE, Yadin O, Salusky IB, expression of fibroblast growth factor-23 in vitro and in vivo. Bone 49: Wesseling-Perry K: Patterns of FGF-23, DMP1, and MEPE expression in 636–643, 2011 patients with chronic kidney disease. Bone 45: 1161–1168, 2009 12. Fan Y, Bi R, Densmore MJ, Sato T, Kobayashi T, Yuan Q, Zhou X, Erben 30. Nociti FH Jr, Foster BL, Tran AB, Dunn D, Presland RB, Wang L, RG, Lanske B: Parathyroid hormone 1 receptor is essential to induce Bhattacharyya N, Collins MT, Somerman MJ: Vitamin D represses FGF23 production and maintain systemic mineral ion homeostasis. dentin matrix protein 1 in cementoblasts and osteocytes. JDentRes93: FASEB J 30: 428–440, 2016 148–154, 2014 13. Meir T, Durlacher K, Pan Z, Amir G, Richards WG, Silver J, Naveh-Many 31. Pereira RC, Jüppner H, Gales B, Salusky IB, Wesseling-Perry K: Os- T: Parathyroid hormone activates the orphan nuclear receptor Nurr1 to teocytic protein expression response to doxercalciferol therapy in pe- induce FGF23 transcription. Kidney Int 86: 1106–1115, 2014 diatric dialysis patients. PLoS One 10: e0120856, 2015 14. Kolek OI, Hines ER, Jones MD, LeSueur LK, Lipko MA, Kiela PR, Collins 32. Urakawa I, Yamazaki Y, Shimada T, Iijima K, Hasegawa H, Okawa K, JF, Haussler MR, Ghishan FK: 1alpha,25-Dihydroxyvitamin D3 Fujita T, Fukumoto S, Yamashita T: Klotho converts canonical FGF re- upregulates FGF23 gene expression in bone: the final link in a renal- ceptor into a specific receptor for FGF23. Nature 444: 770–774, 2006 gastrointestinal-skeletal axis that controls phosphate transport. Am J 33. Bai X, Dinghong Q, Miao D, Goltzman D, Karaplis AC: Klotho ablation Physiol Gastrointest Liver Physiol 289: G1036–G1042, 2005 converts the biochemical and skeletal alterations in FGF23 (R176Q) 15. Haussler MR, Whitfield GK, Kaneko I, Forster R, Saini R, Hsieh JC, transgenic mice to a Klotho-deficient phenotype. Am J Physiol Endo- Haussler CA, Jurutka PW: The role of vitamin D in the FGF23, klotho, crinol Metab 296: E79–E88, 2009 and phosphate bone-kidney endocrine axis. Rev Endocr Metab Disord 34. Howard GA, Turner RT, Sherrard DJ, Baylink DJ: Human bone cells in 13: 57–69, 2012 culture metabolize 25-hydroxyvitamin D3 to 1,25-dihydroxyvitamin D3 16. Kaneko I, Saini RK, Griffin KP, Whitfield GK, Haussler MR, Jurutka PW: and 24,25-dihydroxyvitamin D3. J Biol Chem 256: 7738–7740, 1981 FGF23 gene regulation by 1,25-dihydroxyvitamin D: opposing effects 35. Ichikawa F, Sato K, Nanjo M, Nishii Y, Shinki T, Takahashi N, Suda T: in adipocytes and osteocytes. J Endocrinol 226: 155–166, 2015 Mouse primary osteoblasts express vitamin D3 25-hydroxylase mRNA 17. Liu S, Tang W, Zhou J, Stubbs JR, Luo Q, Pi M, Quarles LD: Fibroblast and convert 1 alpha-hydroxyvitamin D3 into 1 alpha,25-dihydroxyvitamin growth factor 23 is a counter-regulatory phosphaturic hormone for vi- D3. Bone 16: 129–135, 1995 tamin D. JAmSocNephrol17: 1305– 1315, 2006 36.MasudaS,KaufmannM,ByfordV,GaoM,St-ArnaudR,ArabianA, 18. Ferrari SL, Bonjour JP, Rizzoli R: Fibroblast growth factor-23 relation- Makin HL, Knutson JC, Strugnell S, Jones G: Insights into Vitamin D ship to dietary phosphate and renal phosphate handling in healthy metabolism using cyp24 over-expression and knockout systems in young men. J Clin Endocrinol Metab 90: 1519–1524, 2005 conjunction with liquid chromatography/mass spectrometry (LC/MS). J 19. Burnett SM, Gunawardene SC, Bringhurst FR, Jüppner H, Lee H, Steroid Biochem Mol Biol 89-90: 149–153, 2004 Finkelstein JS: Regulation of C-terminal and intact FGF-23 by dietary 37. Shimada T, Hasegawa H, Yamazaki Y, Muto T, Hino R, Takeuchi Y, Fujita phosphate in men and women. J Bone Miner Res 21: 1187–1196, 2006 T, Nakahara K, Fukumoto S, Yamashita T: FGF-23 is a potent regulator 20. Quinn SJ, Thomsen AR, Pang JL, Kantham L, Bräuner-Osborne H, of vitamin D metabolism and phosphate homeostasis. JBoneMiner Pollak M, Goltzman D, Brown EM: Interactions between calcium and Res 19: 429–435, 2004 phosphorus in the regulation of the production of fibroblast growth 38. Perwad F, Zhang MY, Tenenhouse HS, Portale AA: Fibroblast growth factor 23 in vivo. Am J Physiol Endocrinol Metab 304: E310–E320, 2013 factor 23 impairs phosphorus and vitamin D metabolism in vivo and 21. O’Neill WC: The fallacy of the calcium-phosphorus product. Kidney Int suppresses 25-hydroxyvitamin D-1alpha-hydroxylase expression in vi- 72: 792–796, 2007 tro. Am J Physiol Renal Physiol 293: F1577–F1583, 2007 22. Imel EA, Peacock M, Gray AK, Padgett LR, Hui SL, Econs MJ: Iron 39. Bai X, Miao D, Li J, Goltzman D, Karaplis AC: Transgenic mice over- modifies plasma FGF23 differently in autosomal dominant hypo- expressing human fibroblast growth factor 23 (R176Q) delineate a phosphatemic rickets and healthy humans. J Clin Endocrinol Metab 96: putative role for parathyroid hormone in renal phosphate wasting dis- 3541–3549, 2011 orders. Endocrinology 145: 5269–5279, 2004 23. Christov M, Waikar SS, Pereira RC, Havasi A, Leaf DE, Goltzman D, 40. Pike JW, Meyer MB: The vitamin D receptor: new paradigms for the Pajevic PD, Wolf M, Jüppner H: Plasma FGF23 levels increase rapidly regulation of gene expression by 1,25-dihydroxyvitamin D(3). Endo- after acute kidney injury. Kidney Int 84: 776–785, 2013 crinol Metab Clin North Am 39: 255–269, 2010

596 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 586–597, 2017 www.jasn.org BASIC RESEARCH

41. Haussler MR, Jurutka PW, Mizwicki M, Norman AW: Vitamin D receptor 60. Seibert E, Heine GH, Ulrich C, Seiler S, Köhler H, Girndt M: Influence of (VDR)-mediated actions of 1a,25(OH)₂vitamin D₃: genomic and non-genomic cholecalciferol supplementation in hemodialysis patients on monocyte mechanisms. Best Pract Res Clin Endocrinol Metab 25: 543–559, 2011 subsets: a randomized, double-blind, placebo-controlled clinical trial. 42. Rowling MJ, Gliniak C, Welsh J, Fleet JC: High dietary vitamin D pre- Nephron Clin Pract 123: 209–219, 2013 vents hypocalcemia and osteomalacia in CYP27B1 knockout mice. J 61. Cozzolino M, Ketteler M, Martin KJ, Sharma A, Goldsmith D, Khan S: Nutr 137: 2608–2615, 2007 Paricalcitol- or cinacalcet-centred therapy affects markers of bone 43. Ritter CS, Brown AJ: Direct suppression of Pth gene expression by the mineral disease in patients with secondary hyperparathyroidism re- vitamin D prohormones doxercalciferol and calcidiol requires the vi- ceiving haemodialysis: results of the IMPACT-SHPT study. Nephrol Dial tamin D receptor. J Mol Endocrinol 46: 63–66, 2011 Transplant 29: 899–905, 2014 44. Ritter CS, Armbrecht HJ, Slatopolsky E, Brown AJ: 25-Hydroxyvitamin 62. Kawata T, Imanishi Y, Kobayashi K, Miki T, Arnold A, Inaba M, Nishizawa Y: D(3) suppresses PTH synthesis and secretion by bovine parathyroid Parathyroid hormone regulates fibroblast growth factor-23 in a mouse model cells. Kidney Int 70: 654–659, 2006 of primary hyperparathyroidism. JAmSocNephrol18: 2683–2688, 2007 45. Lou YR, Molnár F, Peräkylä M, Qiao S, Kalueff AV, St-Arnaud R, Carlberg 63. Kobayashi K, Imanishi Y, Miyauchi A, Onoda N, Kawata T, Tahara H, C, Tuohimaa P: 25-Hydroxyvitamin D(3) is an agonistic vitamin D re- Goto H, Miki T, Ishimura E, Sugimoto T, Ishikawa T, Inaba M, Nishizawa ceptor ligand. J Steroid Biochem Mol Biol 118: 162–170, 2010 Y: Regulation of plasma fibroblast growth factor 23 by calcium in pri- 46. Munetsuna E, Kawanami R, Nishikawa M, Ikeda S, Nakabayashi S, mary hyperparathyroidism. Eur J Endocrinol 154: 93–99, 2006 Yasuda K, Ohta M, Kamakura M, Ikushiro S, Sakaki T: Anti-proliferative 64. Brown WW, Jüppner H, Langman CB, Price H, Farrow EG, White KE, activity of 25-hydroxyvitamin D3 in human prostate cells. Mol Cell McCormick KL: Hypophosphatemia with elevations in serum fibroblast Endocrinol 382: 960–970, 2014 growth factor 23 in a child with Jansen’s metaphyseal chondrodysplasia. 47. Deluca HF, Prahl JM, Plum LA: 1,25-Dihydroxyvitamin D is not re- JClinEndocrinolMetab94: 17–20, 2009 sponsible for toxicity caused by vitamin D or 25-hydroxyvitamin D. Arch 65. Silver J, Naveh-Many T: FGF-23 and secondary hyperparathyroidism in Biochem Biophys 505: 226–230, 2011 chronic kidney disease. Nat Rev Nephrol 9: 641–649, 2013 48. Sapir-Koren R, Livshits G: Bone mineralization is regulated by signaling 66. Sabbagh Y, Graciolli FG, O’Brien S, Tang W, dos Reis LM, Ryan S, Phillips L, cross talk between molecular factors of local and systemic origin: the Boulanger J, Song W, Bracken C, Liu S, Ledbetter S, Dechow P, Canziani role of fibroblast growth factor 23. Biofactors 40: 555–568, 2014 ME, Carvalho AB, Jorgetti V, Moyses RM, Schiavi SC: Repression of osteo- 49. PandaDK,MiaoD,BolivarI,LiJ,HuoR,HendyGN,GoltzmanD:Inactivation cyte Wnt/b-catenin signaling is an early event in the progression of renal of the 25-hydroxyvitamin D 1a-hydroxylase and vitamin D receptor dem- osteodystrophy. JBoneMinerRes27: 1757–1772, 2012 onstrates independent and interdependent effects of calcium and vitamin D 67. Liu S, Song W, Boulanger JH, Tang W, Sabbagh Y, Kelley B, Gotschall R, on skeletal and mineral homeostasis. J Biol Chem 279: 16754–16766, 2004 Ryan S, Phillips L, Malley K, Cao X, Xia TH, Zhen G, Cao X, Ling H, 50. David V, Dai B, Martin A, Huang J, Han X, Quarles LD: Calcium regu- Dechow PC, Bellido TM, Ledbetter SR, Schiavi SC: Role of TGF-b in a lates FGF-23 expression in bone. Endocrinology 154: 4469–4482, 2013 mouse model of high turnover renal osteodystrophy. J Bone Miner Res 51. Masuyama R, Stockmans I, Torrekens S, Van Looveren R, Maes C, 29: 1141–1157, 2014 Carmeliet P, Bouillon R, Carmeliet G: Vitamin D receptor in chon- 68. Saji F, Shigematsu T, Sakaguchi T, Ohya M, Orita H, Maeda Y, Ooura M, drocytes promotes osteoclastogenesis and regulates FGF23 pro- Mima T, Negi S: Fibroblast growth factor 23 production in bone is di- duction in osteoblasts. J Clin Invest 116: 3150–3159, 2006 rectly regulated by 1alpha,25-dihydroxyvitamin D, but not PTH. Am J 52. Garfia B, Cañadillas S, Canalejo A, Luque F, Siendones E, Quesada M, Physiol Renal Physiol 299: F1212–F1217, 2010 Almadén Y, Aguilera-Tejero E, Rodríguez M: Regulation of parathyroid 69. Dai B, David V, Alshayeb HM, Showkat A, Gyamlani G, Horst RL, Wall vitamin D receptor expression by extracellular calcium. JAmSoc BM, Quarles LD: Assessment of 24,25(OH)2D levels does not support Nephrol 13: 2945–2952, 2002 FGF23-mediated catabolism of vitamin D metabolites. Kidney Int 82: 53. Costa EM, Feldman D: Homologous up-regulation of the 1,25 (OH)2 vitamin 1061–1070, 2012 D3 receptor in rats. Biochem Biophys Res Commun 137: 742–747, 1986 70. Bosworth CR, Levin G, Robinson-Cohen C, Hoofnagle AN, Ruzinski J, Young 54. Goff JP, Reinhardt TA, Beckman MJ, Horst RL: Contrasting effects of B, Schwartz SM, Himmelfarb J, Kestenbaum B, de Boer IH: The serum 24,25- exogenous 1,25-dihydroxyvitamin D [1,25-(OH)2D] versus endoge- dihydroxyvitamin D concentration, a marker of vitamin D catabolism, is re- nous 1,25-(OH)2D, induced by dietary calcium restriction, on vitamin D duced in chronic kidney disease. Kidney Int 82: 693–700, 2012 receptors. Endocrinology 126: 1031–1035, 1990 71. Panda DK, Miao D, Tremblay ML, Sirois J, Farookhi R, Hendy GN, 55. Russell J, Bar A, Sherwood LM, Hurwitz S: Interaction between calcium and Goltzman D: Targeted ablation of the 25-hydroxyvitamin D 1a -hydroxylase 1,25-dihydroxyvitamin D3 in the regulation of preproparathyroid hormone enzyme: evidence for skeletal, reproductive, and immune dysfunction. Proc and vitamin D receptor messenger ribonucleic acid in avian parathyroids. Natl Acad Sci U S A 98: 7498–7503, 2001 Endocrinology 132: 2639–2644, 1993 72. Naja RP, Dardenne O, Arabian A, St Arnaud R: Chondrocyte-specific 56. Brown AJ, Zhong M, Finch J, Ritter C, Slatopolsky E: The roles of calcium and modulation of Cyp27b1 expression supports a role for local synthesis of 1,25-dihydroxyvitamin D3 in the regulation of vitamin D receptor expression 1,25-dihydroxyvitamin D3 in growth plate development. Endocrinol- by rat parathyroid glands. Endocrinology 136: 1419–1425, 1995 ogy 150: 4024–4032, 2009 57. Healy KD, Frahm MA, DeLuca HF: 1,25-Dihydroxyvitamin D3 up-regulates 73. Zhang M, Xuan S, Bouxsein ML, von Stechow D, Akeno N, Faugere MC, therenalvitaminDreceptorthroughindirectgeneactivationandreceptor Malluche H, Zhao G, Rosen CJ, Efstratiadis A, Clemens TL: Osteoblast- stabilization. Arch Biochem Biophys 433: 466–473, 2005 specific knockout of the insulin-like growth factor (IGF) receptor gene 58. Nygaard B, Frandsen NE, Brandi L, Rasmussen K, Oestergaard OV, reveals an essential role of IGF signaling in bone matrix mineralization. Oedum L, Hoeck HC, Hansen D: Effects of high doses of cholecalciferol in J Biol Chem 277: 44005–44012, 2002 normal subjects: a randomized double-blinded, placebo-controlled trial. 74. Yokozawa T, Zheng PD, Oura H: Experimental Renal Failure Rats Induced PLoS One 9: e102965, 2014 by Adenine—Evaluation of Free Amino Acid, Ammonia Nitrogen and 59. Bhan I, Dobens D, Tamez H, Deferio JJ, Li YC, Warren HS, Ankers E, Guanidino Compound Levels. Agric Biol Chem 47: 2341–2348, 1983 Wenger J, Tucker JK, Trottier C, Pathan F, Kalim S, Nigwekar SU, Thadhani R: Nutritional vitamin D supplementation in dialysis: a randomized trial. See related editorial, “The Pas de Trois of Vitamin D, FGF23, and PTH,” on Clin J Am Soc Nephrol 10: 611–619, 2015 pages 393–395.

J Am Soc Nephrol 28: 586–597, 2017 FGF23 Regulation by Vitamin D 597