DOCSLIB.ORG

BRD1-Mediated Acetylation Promotes Integrin Av Gene Expression Via

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
BRD1-Mediated Acetylation Promotes Integrin Av Gene Expression Via Published OnlineFirst February 16, 2018; DOI: 10.1158/1541-7786.MCR-17-0527 Chromatin, Epigenetics and RNA Regulation Molecular Cancer Research BRD1-Mediated Acetylation Promotes Integrin aV Gene Expression Via Interaction with Sulfatide Qian Qian Cai1, Yi Wei Dong1, Bing Qi1, Xiao-Ting Shao2, Rong Wang1, Zhong Yi Chen1, Bao Mei He2, and Xing Zhong Wu1 Abstract Integrin aV gene expression is often dysregulated in cancers found to induce BRD1, monocytic leukemia zinc finger (MOZ) especially in hepatocellular carcinoma (HCC); however, the and histone acetyltransferase binding to ORC1 (HBO1) acetyl- mechanism of regulation is poorly understood. Here, it is dem- transferase multiprotein complex recruitment to the integrin onstrated that sulfatide activated integrin aV gene transcription, aV promoter, which is responsible for histone H3K9/14 acetyla- through histone H3K9/14 acetylation at the promoter, and high tion. Finally, knockdown of BRD1 limited sulfatide-induced integrin aV expression are closely associated with poor prognosis. H3K9/14 acetylation and occupancy of MOZ or HBO1 on integrin To elucidate the mechanism of regulation of acetylation, sulfa- aV gene promoter. tide-bound proteins were screened by mass spectrometry (MS), and bromodomain containing protein 1 (BRD1) was identified as Implications: This study demonstrates that sulfatide inter- an interacting protein that also colocalized with sulfatide in HCC action with BRD1 mediates acetylation and is important for cells. BRD1 was also formed a complex with Sp1, which was regulation of integrin aV gene expression. Mol Cancer Res; 1–13. recruited to the integrin aV gene promoter. Sulfatide was also Ó2018 AACR. Introduction During tumor progression integrins interact with extracellular matrix molecules such as vitronectin, collagen, or glycolipids to Angiogenesis and metastasis are the major cause of tumor trigger signal transduction involved in cell migration and tumor progression and tumor-related mortality. More than 90% of metastasis. Cerebroside sulfotransferase (CST) is the key enzyme cancer-associated deaths are due to metastatic disease, usually for the synthesis of sulfatide in the human body. CST recognizes resistant to and incurable by current therapies (1). Thus, regulators galactocerebroside (Gal-Cer) and transfers a sulfate group from in metastatic cascade, draw priority attention for extensive inves- 0 0 0 3 -phosphoadenosine-5 -phosphosulfate to the 3 hydroxyl tigation, especially those driving cancer cells to leave primary foci group of the galactose in cerebroside to produce sulfatide. and migrate to distant tissues, Cancer cells acquiring migration Sulfatide is enriched in the brain, myelin sheath, kidney, and ability is then considered as an important malignant trait to leave liver. We previously showed that overexpressed sulfatide in HCC primary tumor. Often expressed in tumor stem cells, integrin promoted aVb3 on HCC cells and metastasis (6), and this is aVb3 initiates complex with oncogene and oncogene homologue associated with the enhanced expression of the integrin aV to promote tumor cell motility and activate metastasis process (2). subunit through Sp1 (7), although the precise molecular regu- High integrin aV expression was more often seen in the colorectal lation mechanism of sulfatide remains unknown. cancer patients with later TNM stage from the statistical analysis in Gene transcription initiation is largely controlled by chro- 198 samples (3), and antagonists against integrin aVb3oraVb5 mosome remodeling and histone acetylation which is catalyzed have shown robust activities in suppression of tumor progression by histone acetyltransferases (HAT; ref. 8), a family that (4). Suppression of integrin aV expression by microRNA-25 contains many members sharing conserved domains and func- subsequently reduced the invasive cytoskeleton, migration ability, tions. Bromodomain containing protein 1 (BRD1) has been and metastasis in highly metastatic prostate cancer stem cells (5). identified in the monocytic leukemia zinc finger protein (MOZ)/MOZ paralog (MORF) complex that has intrinsic acetyltransferase activity specific for histone 3 (H3; ref. 9). 1 Department of Biochemistry and Molecular Biology, School of Basic Medical BRD1, also known as bromodomain and PHD finger- Sciences, Fudan University, Key Lab of Glycoconjugate Research, Ministry of containing protein 2 (BRPF2), belongs to the BRPF protein Public Health, Shanghai, China. 2Yu Ying Hospital, Wenzhou Medical University, Wenzhou, China. family that includes BRPF1, BRD1/BPF2, and BRPF3, and contains a bromodomain, two plant homeodomain (PHD) Note: Supplementary data for this article are available at Molecular Cancer zinc fingers, and a proline–tryptophan–tryptophan–proline Research Online (http://mcr.aacrjournals.org/). (PWWP) domain. The bromodomain can selectively recognize Q.Q. Cai and Y.W. Dong contributed equally to this article. acetylated lysine residues, particularly on histones (10). In this Corresponding Author: Xing Zhong Wu, School of Basic Medical Sciences, study, we investigated the roles of BRD1 in sulfatide-induced Fudan University, 138 Yi Xue Yuan Road, Shanghai 200032, PR China. Phone: transcriptional activation of the integrin aV subunit gene in 54237697; Fax: 54237697; E-mail: [email protected] human HCC cells. We demonstrated that BRD1 formed a novel doi: 10.1158/1541-7786.MCR-17-0527 complex that was involved in the regulation of integrin aV Ó2018 American Association for Cancer Research. subunit expression by sulfatide. www.aacrjournals.org OF1 Downloaded from mcr.aacrjournals.org on October 6, 2021. © 2018 American Association for Cancer Research. Published OnlineFirst February 16, 2018; DOI: 10.1158/1541-7786.MCR-17-0527 Cai et al. Materials and Methods sion vector. Plasmids of CST were constructed as in our pre- vious study (7). Cell culture and treatment SMMC-7721 and BEL-7404 HCC cell lines were obtained from Polymerase chain reaction the Shanghai Institute of Biochemistry & Cellular Biology, Chi- PCR procedures were performed as previously described (7). nese Academy of Science, Shanghai, China, and their morpho- Quantitative PCR was performed with Bestar SybrGreen qPCR fi logical characteristics were identi ed every 3 years to be consistent mastermix (DBI Bioscience) in the iQ5 PCR detection system with the report of establishment (11). Human embryonic kidney (Bio-Rad). The specific primers are listed in Supplementary cells (HEK293T) were obtained from the ATCC and cultured not Table S2. more than 20 passages each time after thawing. These cells were grown in monolayer in the medium of DMEM supplemented Immunoprecipitation and Western blot analysis with 10% newborn calf serum (Biosera, France) or FBS (Gibco), Immunoprecipitation assays were performed as previously with penicillin(100 U/mL)/streptomycin (100 mg/mL) under a described (13). Briefly, whole cell lysates were incubated with 5% CO atmosphere at 37C. All cells were not contaminated by 2 indicated antibodies and rocked at 4C with protein A/G agarose mycoplasma as tested by the mycoplasma PCR Detection Kit beads overnight. The beads were then washed with ice-cold (Sigma), and also not infected by bacteria or fungi. For treatment, lysate buffer (50 mmol/L Tris-HCl pH 8.0, 120 mmol/L NaCl, cells were incubated with Gal-Cer (galactocerebroside), sulfatide 10 mg/mL aprotinin, 1 mmol/L PMSF, 1 mmol/L sodium vana- (2 mmol/L, 24 hours for RNA analysis, 48 hours for protein date, 100 mmol/L NaF, and 0.5% NP-40). The proteins obtained assays),the histone deacetylase (HDAC) inhibitor trichostatin A were separated on an 8% SDS-PAGE gel and transferred to a (TSA; 300 nmol/L, 24 hours for RNA analysis, 48 hours for protein PVDF membrane. The blot was probed with the anti-integrin aV, assays), or nicotianamine (NA; 20 mmol/L, 48 hours; all from HDAC, MOZ, HBO1, Sp1, BRD1, SIN3B, ING4, and acetylated Sigma-Aldrich). histone antibodies (Santa Cruz Biotechnology), followed by a horseradish peroxidase-conjugated secondary antibody. After Tissue microarray and IHC visualizing, the density of protein bands were analyzed using A total of 80 patients with HCC from Shanghai Oriental TotalLab v2.01 (Nonlinear Dynamics Ltd.). Hepatobiliary Hospital, Zhongshan University Affiliated 3rd Hos- fi pital, Wenzhou Medical University Af liated 1st Hospital, and Nuclear and cytoplasmic extracts Shanghai 10th People's Hospital underwent curative surgery and Nuclear and cytoplasmic extracts were prepared using the fi the diagnosis of HCC was con rmed by histological examination. Nuclear Extraction Kit (Chemicon International Inc.) according fi Tissue blocks embedded in paraf n and the corresponding hema- to manufacturer's instructions. Briefly, the cells were disrupted by toxylin- and eosin-stained sections were overlaid for tissue micro- cytoplasmic lysis buffer, and the cytosolic portion was collected fi array preparation. The paraf n-embedded tissue microarray was after centrifugation. Then the nuclear pellets were further dis- constructed from triplicate pairs of tumor and nontumor tissue rupted by nuclear extraction buffer. The cytoplasmic and nuclear fi from each patient. Paraf n sections were stained with an integrin proteins were then analyzed by Western blotting. aV mouse monoclonal antibody and BRD1 rabbit antibody (Santa Cruz Biotechnology) using the DouSP Double-Stain Kit Mass spectrometry (Maxim-Biomedical). Scoring of immunohistochemical staining Epoxy magnetic particles were first reacted with 4-hydroxy- was performed independently by
Load more

Recommended publications
  • Epidermal Wnt Signalling Regulates Transcriptome Heterogeneity and Proliferative Fate in Neighbouring Cells
    bioRxiv preprint doi: https://doi.org/10.1101/152637; this version posted June 20, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Title: Epidermal Wnt signalling regulates transcriptome heterogeneity and proliferative fate in neighbouring cells Arsham Ghahramani1,2 , Giacomo Donati2,3 , Nicholas M. Luscombe1,4,5,† and Fiona M. Watt2,† 1The Francis Crick Institute, 1 Midland Road, London NW1 1AT, United Kingdom 2King’s College London, Centre for Stem Cells and Regenerative Medicine, 28th 8 Floor, Tower Wing, Guy’s Hospital, Great Maze Pond, London SE1 9RT, United Kingdom 3Department of Life Sciences and Systems Biology, University of Turin, Via Accademia Albertina 13, 10123 Torino, Italy 4UCL Genetics Institute, University College London, London WC1E 6BT, United Kingdom 5Okinawa Institute of Science & Technology Graduate University, Okinawa 904-0495, Japan † Correspondence to: [email protected] and [email protected] Abstract: Canonical Wnt/beta-catenin signalling regulates self-renewal and lineage selection within the mouse epidermis. Although the transcriptional response of keratinocytes that receive a Wnt signal is well characterised, little is known about the mechanism by which keratinocytes in proximity to the Wnt- receiving cell are co-opted to undergo a change in cell fate. To address this, we performed single-cell mRNA-Seq on mouse keratinocytes co-cultured with and without the presence of beta-catenin activated neighbouring cells. We identified seven distinct cell states in cultures that had not been exposed to the beta-catenin stimulus and show that the stimulus redistributes wild type subpopulation proportions.
    [Show full text]
  • A Role for Mammalian Sin3 in Permanent Gene Silencing
    Molecular Cell Article A Role for Mammalian Sin3 in Permanent Gene Silencing Chris van Oevelen,1 Jinhua Wang,1 Patrik Asp,1 Qin Yan,2,3 William G. Kaelin, Jr.,2,3 Yuval Kluger,1,* and Brian David Dynlacht1,* 1New York University School of Medicine, NYU Cancer Institute, 522 1st Avenue, New York, NY 10016, USA 2Howard Hughes Medical Institute 3Department of Medical Oncology Dana Farber Cancer Institute and Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115, USA *Correspondence: [email protected] (B.D.D.), [email protected] (Y.K.) DOI 10.1016/j.molcel.2008.10.015 SUMMARY substoichiometric regulatory proteins, including Swi/Snf-remod- eling proteins, retinoblastoma (RB)-binding protein 2 (RBP2), and The multisubunit Sin3 corepressor complex regu- other proteins (Hayakawa et al., 2007; Nagl et al., 2007; Sif et al., lates gene transcription through deacetylation of nu- 2001). Interestingly, RBP2 was recently shown to be a demethy- cleosomes. However, the full range of Sin3 activities lase specific for di- and trimethylated lysine 4 of histone H3 and targets is not well understood. Here, we have (Christensen et al., 2007; Klose et al., 2007). Thus, the Sin3 investigated genome-wide binding of mouse Sin3 complex provides a versatile platform for chromatin modifying and RBP2 as well as histone modifications and nucle- and remodeling activities. Sin3/Rpd3 corepressor complexes are recruited to promoter osome positioning as a function of myogenic differ- regions via sequence-specific repressors such as Ume6 or entiation. Remarkably, we find that Sin3 complexes Mad in yeast and mammalian cells, respectively, resulting in spread immediately downstream of the transcription localized deacetylation of histones within promoter regions and start site on repressed and transcribed genes during transcriptional silencing (Ayer et al., 1995; Kadosh and Struhl, differentiation.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Chromatin Modification and Disease
    J Med Genet 2000;37:905–915 905 Chromatin modification and disease J Med Genet: first published as 10.1136/jmg.37.12.905 on 1 December 2000. Downloaded from Colin A Johnson “Physicians consider that when they have discov- plexes that bring about histone acetylation (the ered the cause of disease, they have also discovered family of histone acetyltransferases or HAT the method of treating it.” Cicero, Tusculan Dis- coactivators) and deacetylation (the histone putations, III.x.23. deacetylases or HDAC corepressors). This In the last few years, the exciting realisation review will focus on some of the clinical aspects in the field of gene regulation is that transcrip- of this recent work on acetylation and the inti- tion factors can function by recruiting large, mate connection that it is now known to have multiprotein complexes which mediate several with the methylation of cytosine residues in types of chromatin modification and remodel- DNA. A third type of chromatin remodelling is ling events that alter the structure of chroma- the direct physical repositioning or disruption tin. Chromatin structure changes include post- of nucleosomes mediated by a family of DNA translational modifications of histones, DNA dependent ATPases. The connection between methylation, remodelling of the chromatin, and this latter type of remodelling and either the maintenance of a heterochromatic or histone acetylation or DNA methylation is euchromatic state. Most of these events are complicated, but progress is being made. For brought about by enzymatic mechanisms. In example, the NuRD multiprotein complex (see general, the catalytic subunits are only one below, fig 1C) contains histone deacetylase and component of the complexes, with the distribu- chromatin remodelling activities, as well as the tion and localisation of the structural changes methyl DNA binding protein MBD3, which dependent on targeting components.
    [Show full text]
  • Rabbit Mab A
    Revision 1 C 0 2 - t SIN3A (D1B7) Rabbit mAb a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 1 9 Web: [email protected] 6 www.cellsignal.com 7 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source/Isotype: UniProt ID: Entrez-Gene Id: WB, ChIP H M R Mk Endogenous 145 Rabbit IgG Q96ST3 25942 Product Usage Information nucleosome binding of the complex. The SIN3 complex functions to repress transcription, in part, by deacetylating histones at target gene promoters (3,4). In addition, recent For optimal ChIP results, use 5 μl of antibody and 10 μg of chromatin (approximately 4 x studies have shown that SIN3 is recruited to the coding regions of repressed and active 106 cells) per IP. This antibody has been validated using SimpleChIP® Enzymatic genes, where it deacetylates histones and suppresses spurious transcription by RNA Chromatin IP Kits. polymerase II (3,5). In addition to histone deacetylase activity, the SIN3 complex associates with histone methyltransferase (ESET), histone demethylase Application Dilution (JARID1A/RBP2), ATP-dependent chromatin remodeling (SWI/SNF), methylcytosine dioxygenase (TET1), and O-GlcNAc transferase (OGT) activities, all of which appear to Western Blotting 1:1000 contribute to the regulation of target genes (5-9). The SIN3 complex is critical for proper Chromatin IP 1:100 regulation of embryonic development, cell growth and proliferation, apoptosis, DNA replication, DNA repair, and DNA methylation (imprinting and X-chromosome inactivation) Storage (3,4).
    [Show full text]
  • Stress-Mediated Sin3b Activation Leads to Negative Regulation of Subset of P53 Target Genes
    Biosci. Rep. (2015) / 35 / art:e00234 / doi 10.1042/BSR20150122 Stress-mediated Sin3B activation leads to negative regulation of subset of p53 target genes Rama Kadamb*1, Shilpi Mittal*, Nidhi Bansal* and Daman Saluja*1 *Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, Delhi-110007, India Synopsis Downloaded from http://portlandpress.com/bioscirep/article-pdf/35/4/e00234/476914/bsr035e234.pdf by guest on 24 September 2021 The multiprotein SWI-independent 3 (Sin3)–HDAC (histone deacetylase) corepressor complex mediates gene re- pression through its interaction with DNA-binding factors and recruitment of chromatin-modifying proteins on to the promoters of target gene. Previously, an increased expression of Sin3B and tumour suppressor protein, p53 has been established upon adriamycin treatment. We, now provide evidence that Sin3B expression is significantly up-regulated under variety of stress conditions and this response is not stress-type specific. We observed that Sin3B expression is significantly up-regulated both at transcript and at protein level upon DNA damage induced by bleomycin drug, a radiomimetic agent. This increase in Sin3B expression upon stress is found to be p53-dependent and is associated with enhanced interaction of Sin3B with Ser15 phosphorylated p53. Binding of Sin3–HDAC repressor complex on to the promoters of p53 target genes influences gene regulation by altering histone modifications (H3K9me3 and H3K27me3) at target genes. Furthermore, knockdown of Sin3B by shRNA severely compromises p53-mediated gene repression under stress conditions. Taken together, these results suggest that stress-induced Sin3B activation is p53-dependent and is essential for p53-mediated repression of its selective target genes.
    [Show full text]
  • Chromatin-Associated Protein SIN3B Prevents Prostate Cancer Progression by Inducing Senescence Anthony J
    Published OnlineFirst August 14, 2017; DOI: 10.1158/0008-5472.CAN-16-3410 Cancer Tumor and Stem Cell Biology Research Chromatin-Associated Protein SIN3B Prevents Prostate Cancer Progression by Inducing Senescence Anthony J. Bainor1, Fang-Ming Deng2, Yu Wang1, Peng Lee2,4, David J. Cantor1, Susan K. Logan1,3,4, and Gregory David1,3,4 Abstract Distinguishing between indolent and aggressive prostate ade- cinoma. Furthermore, SIN3B was downregulated in human pros- nocarcinoma remains a priority to accurately identify patients tate adenocarcinoma correlating with upregulation of its target who need therapeutic intervention. SIN3B has been implicated in genes. Our results suggest a tumor suppressor function for the initiation of senescence in vitro. Here we show that in a mouse SIN3B that limits prostate adenocarcinoma progression, with model of prostate cancer, SIN3B provides a barrier to malignant potential implications for the use of SIN3B and its target genes progression. SIN3B was required for PTEN-induced cellular senes- as candidate diagnostic markers to distinguish indolent from cence and prevented progression to invasive prostate adenocar- aggressive disease. Cancer Res; 77(19); 1–10. Ó2017 AACR. Introduction damage, activation of oncogenes, or loss of a tumor suppres- sor (5, 6). Senescent cells have been identified in preneoplastic Prostate adenocarcinoma is the second most common cancer lesions of several solid tumor types, including prostatic intrae- type in American men with approximately 230,000 new pithelial neoplasias (PIN), but are rarely found in normal patients diagnosed each year, equating to about 1 in 7 men prostate or prostate adenocarcinoma (7). On the basis of these being diagnosed with prostate adenocarcinoma in his lifetime findings, cellular senescence has been hypothesized to prevent (1).
    [Show full text]
  • Senescence-Associated SIN3B Promotes Inflammation and Pancreatic Cancer Progression
    Senescence-associated SIN3B promotes inflammation and pancreatic cancer progression Maïté Rielland, … , George Miller, Gregory David J Clin Invest. 2014;124(5):2125-2135. https://doi.org/10.1172/JCI72619. Research Article Oncology Pancreatic ductal adenocarcinoma (PDAC) is strikingly resistant to conventional therapeutic approaches. We previously demonstrated that the histone deacetylase–associated protein SIN3B is essential for oncogene-induced senescence in cultured cells. Here, using a mouse model of pancreatic cancer, we have demonstrated that SIN3B is required for activated KRAS-induced senescence in vivo. Surprisingly, impaired senescence as the result of genetic inactivation of Sin3B was associated with delayed PDAC progression and correlated with an impaired inflammatory response. In murine and human pancreatic cells and tissues, levels of SIN3B correlated with KRAS-induced production of IL-1α. Furthermore, evaluation of human pancreatic tissue and cancer cells revealed that Sin3B was decreased in control and PDAC samples, compared with samples from patients with pancreatic inflammation. These results indicate that senescence-associated inflammation positively correlates with PDAC progression and suggest that SIN3B has potential as a therapeutic target for inhibiting inflammation-driven tumorigenesis. Find the latest version: https://jci.me/72619/pdf Research article Senescence-associated SIN3B promotes inflammation and pancreatic cancer progression Maïté Rielland,1 David J. Cantor,1 Richard Graveline,1 Cristina Hajdu,2 Lisa Mara,2 Beatriz de Diego Diaz,1 George Miller,3,4 and Gregory David1,5 1Department of Biochemistry and Molecular Pharmacology, 2Department of Pathology, 3Department of Surgery, 4Department of Cell Biology, and 5New York University (NYU) Cancer Institute, NYU School of Medicine, New York, New York, USA.
    [Show full text]
  • 2Czy Lichtarge Lab 2006
    Pages 1–6 2czy Evolutionary trace report by report maker July 31, 2009 4.3.1 Alistat 5 4.3.2 CE 6 4.3.3 DSSP 6 4.3.4 HSSP 6 4.3.5 LaTex 6 4.3.6 Muscle 6 4.3.7 Pymol 6 4.4 Note about ET Viewer 6 4.5 Citing this work 6 4.6 About report maker 6 4.7 Attachments 6 1 INTRODUCTION From the original Protein Data Bank entry (PDB id 2czy): Title: Solution structure of the nrsf/rest-msin3b pah1 complex Compound: Mol id: 1; molecule: paired amphipathic helix protein sin3b; chain: a; fragment: pah1 domain (residues 31-107); synonym: sin3b, transcriptional corepressor sin3b, histone deacetylase complex subunit sin3b; engineered: yes; mol id: 2; molecule: transcription factor rest (version 3); chain: b; fragment: sin3 interaction domain (residues 43-57); synonym: nrsf/rest; engineered: yes CONTENTS Organism, scientific name: Mus Musculus; 2czy contains a single unique chain 2czyA (77 residues long). 1 Introduction 1 Chain 2czyB is too short (15 residues) to permit statistically signi- ficant analysis, and was treated as a peptide ligand. This is an 2 Chain 2czyA 1 NMR-determined structure – in this report the first model in the file 2.1 Q62141 overview 1 was used. 2.2 Multiple sequence alignment for 2czyA 1 2.3 Residue ranking in 2czyA 2 2 CHAIN 2CZYA 2.4 Top ranking residues in 2czyA and their position on 2.1 Q62141 overview the structure 2 2.4.1 Clustering of residues at 25% coverage. 2 From SwissProt, id Q62141, 100% identical to 2czyA: 2.4.2 Overlap with known functional surfaces at Description: Paired amphipathic helix protein Sin3b (Transcriptio- 25% coverage.
    [Show full text]
  • Identification of Genomic Targets of Krüppel-Like Factor 9 in Mouse Hippocampal
    Identification of Genomic Targets of Krüppel-like Factor 9 in Mouse Hippocampal Neurons: Evidence for a role in modulating peripheral circadian clocks by Joseph R. Knoedler A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Neuroscience) in the University of Michigan 2016 Doctoral Committee: Professor Robert J. Denver, Chair Professor Daniel Goldman Professor Diane Robins Professor Audrey Seasholtz Associate Professor Bing Ye ©Joseph R. Knoedler All Rights Reserved 2016 To my parents, who never once questioned my decision to become the other kind of doctor, And to Lucy, who has pushed me to be a better person from day one. ii Acknowledgements I have a huge number of people to thank for having made it to this point, so in no particular order: -I would like to thank my adviser, Dr. Robert J. Denver, for his guidance, encouragement, and patience over the last seven years; his mentorship has been indispensable for my growth as a scientist -I would also like to thank my committee members, Drs. Audrey Seasholtz, Dan Goldman, Diane Robins and Bing Ye, for their constructive feedback and their willingness to meet in a frequently cold, windowless room across campus from where they work -I am hugely indebted to Pia Bagamasbad and Yasuhiro Kyono for teaching me almost everything I know about molecular biology and bioinformatics, and to Arasakumar Subramani for his tireless work during the home stretch to my dissertation -I am grateful for the Neuroscience Program leadership and staff, in particular
    [Show full text]
  • Supplemental Material For: Screen Identifies Bromodomain Protein
    Supplemental Material for: Screen identifies bromodomain protein ZMYND8 in chromatin recognition of transcription-associated DNA damage that promotes homologous recombination Fade Gong1,2,6, Li-Ya Chiu1,2,6, Ben Cox1,2, François Aymard3,4, Thomas Clouaire3,4, Justin W. Leung1,2, Michael Cammarata5, Mercedes Perez1,2, Poonam Agarwal1,2, Jennifer S. Brodbelt5, Gaëlle Legube3,4 & Kyle. M. Miller1,2,* 1. Supplemental Materials and Methods 2. Supplemental References 3. Supplemental Figure S1-S10 with legends 4. Supplemental Table S1-S3 with legends 1 Supplemental Materials and Methods Plasmid and siRNA transfections Mammalian expression vectors were transfected into U2OS cells by Hilymax (Dojindo) or Fugene HD (Promega) according to manufacturer’s instructions. The I-SceI expressing vector (pCAG-I-SceI) or control vector (pCAG) were transfected into the U2OS DR-GFP cells by Fugene HD (Promega). For HEK293T cells, transient transfections were carried out with pEI (Polyethylenimine, Sigma). Analyses for transient plasmid transfection were performed 24-48 h after transfection. Transfections for siRNA were carried out with lipofectamine RNAiMax (Invitrogen) following the manufacturer’s instructions. Analyses from siRNA treated cells were performed 48-72 h after transfection. The siRNAs used in this study were: siControl: non-targeting pool (Dharmacon); siZMYND8 #1: SMARTpool (Dharmacon); siZMYND8 #2: GGACUUUCCCCUUUUUAUA (targeting the 3’-UTR region of ZMYND8) (Sigma); siZMYND8 #3: GAACAUAGAUGAAUGAAA (Sigma); siCHD4: CCCAGAAGAGGAUUUGUCA (Sigma), siLSD1: GCCUAGACAUUAAACUGAAUA (Sigma); siTIP60 SMARTpool (Dharmacon); siMOF: GCAAAGACCAUAAGAUUUA (Sigma); siCtIP: GGUAAAACAGGAACGAAUC (Sigma); siLigaseIV: AGGAAGUAUUCUCAGGAAUUA (Sigma). Cloning and plasmids 2 cDNAs of human BRD-containing proteins were cloned into the Gateway entry vector pENTR11 by restriction sites, or pDONR201 by attB recombinant sites.
    [Show full text]
  • Oxidized Phospholipids Regulate Amino Acid Metabolism Through MTHFD2 to Facilitate Nucleotide Release in Endothelial Cells
    ARTICLE DOI: 10.1038/s41467-018-04602-0 OPEN Oxidized phospholipids regulate amino acid metabolism through MTHFD2 to facilitate nucleotide release in endothelial cells Juliane Hitzel1,2, Eunjee Lee3,4, Yi Zhang 3,5,Sofia Iris Bibli2,6, Xiaogang Li7, Sven Zukunft 2,6, Beatrice Pflüger1,2, Jiong Hu2,6, Christoph Schürmann1,2, Andrea Estefania Vasconez1,2, James A. Oo1,2, Adelheid Kratzer8,9, Sandeep Kumar 10, Flávia Rezende1,2, Ivana Josipovic1,2, Dominique Thomas11, Hector Giral8,9, Yannick Schreiber12, Gerd Geisslinger11,12, Christian Fork1,2, Xia Yang13, Fragiska Sigala14, Casey E. Romanoski15, Jens Kroll7, Hanjoong Jo 10, Ulf Landmesser8,9,16, Aldons J. Lusis17, 1234567890():,; Dmitry Namgaladze18, Ingrid Fleming2,6, Matthias S. Leisegang1,2, Jun Zhu 3,4 & Ralf P. Brandes1,2 Oxidized phospholipids (oxPAPC) induce endothelial dysfunction and atherosclerosis. Here we show that oxPAPC induce a gene network regulating serine-glycine metabolism with the mitochondrial methylenetetrahydrofolate dehydrogenase/cyclohydrolase (MTHFD2) as a cau- sal regulator using integrative network modeling and Bayesian network analysis in human aortic endothelial cells. The cluster is activated in human plaque material and by atherogenic lipo- proteins isolated from plasma of patients with coronary artery disease (CAD). Single nucleotide polymorphisms (SNPs) within the MTHFD2-controlled cluster associate with CAD. The MTHFD2-controlled cluster redirects metabolism to glycine synthesis to replenish purine nucleotides. Since endothelial cells secrete purines in response to oxPAPC, the MTHFD2- controlled response maintains endothelial ATP. Accordingly, MTHFD2-dependent glycine synthesis is a prerequisite for angiogenesis. Thus, we propose that endothelial cells undergo MTHFD2-mediated reprogramming toward serine-glycine and mitochondrial one-carbon metabolism to compensate for the loss of ATP in response to oxPAPC during atherosclerosis.
    [Show full text]