USOO696.9595 B2 (12) United States Patent (10) Patent No.: US 6,969,595 B2 Brzostowicz et al. (45) Date of Patent: Nov. 29, 2005

(54) CAROTENOID PRODUCTION FROM A WO WO 02079395 A2 10/2002 SINGLE CARBON SUBSTRATE OTHER PUBLICATIONS (75) Inventors: Patricia C. Brzostowicz, West Chester, Hundle et al., Functional Assignment of Erwinia herbicola PA (US); Qiong Cheng, Wilmington, Eh010 Carotenoid Genes Expressed in Escherichia coli, DE (US); Deana DiCosimo, Rockland, Molecular and General Genetics, Springer Verlag, Berlin, DE (US); Mattheos Kofas, DE, vol. 245, 1994, pp. 406-416, XP002947 192. Wilmington, DE (US); Edward S. Pasamontes et al., Isolation and characterization of the Miller, Wilmington, DE (US); James carotenoid biosynthesis genes of Flavobacterium sp. Strain M. Odom, Kennett Square, PA (US); R1534, Gene: An International Journal on Genes and Stephen K. Picataggio, Landenberg, PA Genomes, Elsevier Science Publishers, Braking, GB, vol. (US); Pierre E. Rouviere, Wilmington, 185, No. 1, Jan. 31, 1997, pp. 35–41, XP004.093151. DE (US) Harker et al., BioSynthesis of Ketocarotenoids in transgenic cyanobacteria expressing the algal gene for (73) ASSignee: E. I. du Pont de Nemours and beta-C-4-oxygenase, crt0, FEBS Letters, Elsevier Science Company, Wilmington, DE (US) Publishers, Amsterdan, NL. Vol. 404, Mar. 1, 1997, pp. 129-134, XP002087149. Notice: Subject to any disclaimer, the term of this Fernandez-Gonzalez Blanca et al., A new type of asym patent is extended or adjusted under 35 metrically acting beta-caroteine ketolase is required for the U.S.C. 154(b) by 728 days. Synthesis of echinenone in the cyanobacterium SynechocyS tissp. PCC 6803., Journal of Biological Chemistry vol. 272, (21) Appl. No.: 09/941,947 No. 15, 1997, pp. 9728-9733, XP002222602. Hirschberg, Production of high-value compounds: Caro (22) Filed: Aug. 29, 2001 tenoids and Vitamin E, Current Opinion in biotechnology, (65) Prior Publication Data London GB, vol. 10, No. 2, Apr. 1999, pp. 186-191, XPOO2162837. US 2003/0003528 A1 Jan. 2, 2003 Misawa et al., Expression of an Wrwinia Phytoene Desatu rase Gene not only confers Multiple Resistance to Herbi Related U.S. Application Data cides Interfering with Carotenoid Biosynthesis but also (60) Provisional application No. 60/229.907, filed on Sep. 1, 2000, and provisional application No. 60/229,858, filed on alters Xanthophyll Metabolism in Transgenic Plants, Plant Sep. 1, 2000. Journal, Blackwell Scientific Publications, Oxford, GB, vol. 6, No. 4, 1994, pp. 481–489, XP002012.919. (51) Int. Cl...... G01N 33/72 Scolnik et al., A Table of Some Cloned Plant Genes Involved (52) U.S. Cl...... 435/67; 435/252.3; 536/23.2; in Isoprenoid Biosynthesis, Plant Molecular Biology 536/23.7 Reporter, New York, NY vol. 14, No. 4, Dec. 1996, pp. (58) Field of Search ...... 435/67, 183,252.3; 305-319, XPO00884796. 536/23.2, 23.7 Bartley et al., Molecular Biology of Carotenoid Biosynthesis in Plants, Annual Review of Plant Physiology and Plant (56) References Cited Molecular Biology, Annual Reviews Inc, vol. 45, 1994, pp. 287-301, XPO0088.1128. U.S. PATENT DOCUMENTS Rohmer, Isoprenoid Biosynthesis via the Mevalonate-Inde 5,182,208 A 1/1993 Johnson et al...... 435/255.1 pendent Route, A novel Target for Antibacterial Drugs?, 5,429,929 A 7/1995 Latov et al...... 435/7.9 Progress in Drug Research, Basel, vol. 50, 1998, pp. 5,429,939 A 7/1995 Misawa et al. 135-154, XPO00906878. 5,466.599 A 11/1995 Jacobson et al...... 435/255.1 Hanson et al., Methanotrophic bacteria, Microbiological 5.530,188 A 6/1996 Ausich et al...... 860/298 Reviews, American Society for Microbiology, Washington, 5.530,189 A 6/1996 Ausich et al...... 800/298 D.C., vol. 60, No. 2, Jun. 1996, pp. 439–471. 5,545,816 A 8/1996 Ausich et al...... 800/298 Zhu Xufen et al., Geranylgeranyl pyrophosphate Synthase 5,656,472 A 8/1997 Ausich et al...... 435/193 5,691,190 A 11/1997 Girard et al...... 435/255.1 encoded by the newly isolated gene GGPS6 from Arabi 5,750,821. A 5/1998 Inomata et al...... 585/312 dopsis thaliana is localized in mitochondria, Plant Molecu 5,972,642 A 10/1999 Flen.o slashed. et al...... 435/67 lar Biology, Nijhoff Publishers, Dordrecht, NL, vol. 35, No. 6,015,684 A 1/2000 Jacobson et al...... 435/67 3, 1997, pp. 331-341, XP002153683. 6,124,113 A 9/2000 Hohmann et al...... 435/67 (Continued) FOREIGN PATENT DOCUMENTS Primary Examiner Nashaat T. Nashed EP O747483 A2 12/1996 EP O872554 A2 10/1998 (57) ABSTRACT WO WO 97 23633 A1 7/1997 A method for the production of carotenoid compounds is WO WO 9907867 A1 2/1999 WO WO996.1652 A1 12/1999 disclosed. The method relies on the use of microorganisms WO WO 2000007718 A1 2/2000 which metabolize Single carbon Substrates for the production WO WO 01/66703 A1 9/2001 of carotenoid compounds in high yields. WO WO O22O733 A2 3/2002 WO WO O2/41833 A2 5/2002 22 Claims, 14 Drawing Sheets US 6,969,595 B2 Page 2

OTHER PUBLICATIONS Miura, Y. et al., 1998. Appl. Environm. Microbiol. 64: 1226-1229. Misawa et al., “Elucidation of the Erwinia uredovora Carenoid Biosynthetic Pathway by Functional Analysis of Albrecht, M. et al., 1999, Biotechnol. Lett. 21: 791-795. Gene Products Expressed in Escherichia coli”, Journal of Lidstrom and Stirling (Annu. Rev. Microbiol. 44:27-58, Bacteriology, Washington, D.C., vol. 172, No. 12, Dec. 1990. 1990, pp. 6704-6712. Murrell et al., Arch. Microbiol., 2000, 173(5-6), 325–332. Armstrong, J. Bact. 176: pp. 4795-4802. Grigoryan, E. A., Kinet. Catal., 1999, 40(3), 350-363. Armstrong, Annu. Rev. Microbiol. 51: 629–659, 1997. Beschastnyi et al., Inst. Biochem. Physiol. Microor., Push Nelis and Leenheer, Appl. Bacteriol. 70:181-191, 1991. chino, Russia, Biokhimiya (Moscow) 1992, 57(8), pp. Farmer, W. R. and J. C. Liao, 2001, Biotechnol. Prog. 17: 1215-1221. 57-61. Wang, C. et al., 2000 Biotechnol. Prog. 16:922–926. Shishkina et al., Inst. Bikhim. Fiziol. Mikroorg., Pushchino, Misawa, N. and H. Shimada, 1998, J. Biotechnol. 59: Russia, Mikrobiologiya, 1990, 59(4), 533–8. 169-181. Trotsenko et al., Studies on Phosphate metabolism in obli Shimada, H. et al., 1998, Appl. Environm. Microbiol. gate methanotrophs, Fems Microbiology Reviews 87, 1990, 64:2676-2680. pp. 267–272. U.S. Patent US 6,969,595 B2

H0

was,†

U.S. Patent US 6,969,595 B2

U.S. Patent Nov. 29, 2005 Sheet 5 of 14 US 6,969,595 B2

Cri Y

CritB critz ECORI (5301 ) U.S. Patent Nov. 29, 2005 Sheet 6 of 14 US 6,969,595 B2

400 300

MOU 200

100

O 5 10 15 2O 25 450 Mies, nn FIG. 3B

250 200.

150 OU OO 50

Minutes 450 nm BOnd E 4 nm. FIG. 3C U.S. Patent Nov. 29, 2005 Sheet 7 of 14 US 6,969,595 B2

tro promoter region U.S. Patent Nov. 29, 2005 Sheet 8 of 14 US 6,969,595 B2

A. O 200 400 600 800 1 000 200 1400 SeCOndS FIG. 4B

35000 30000 25000

OU 20000 15000 H U.S. Patent Nov. 29, 2005 Sheet 9 of 14 US 6,969,595 B2

Nhe 14 ) ECOR ) Phips ECORI ( 257 )

tro promoter Crit region

5 10 15 20 25 Minutes 450 nm Bond = 4 nm. F G. 5B U.S. Patent Nov. 29, 2005 Sheet 10 of 14 US 6,969,595 B2

ECORI ( 1)- - Crit O Nne (1631) - Phmps ECOR 187 ) PCO

region F.G. 6A U.S. Patent Nov. 29, 2005 Sheet 11 of 14 US 6,969,595 B2

10 11 12 13 14 15 16 17 18 9 20 Minutes 474 nm Bond E 4 nm F. G. 6B U.S. Patent Nov. 29, 2005 Sheet 12 of 14 US 6,969,595 B2

200 250 300 350 400 450 500 550 600 n FIG. 60 U.S. Patent Nov. 29, 2005 Sheet 13 of 14 US 6,969,595 B2

DXP-5-PReduct OSe

dxS dxr OCZ Tn5Kn 14994 bp

U.S. Patent Nov. 29, 2005 Sheet 14 of 14 US 6,969,595 B2

d NNNNNNNNNNNSNSSSSSSSSSSSNSSNSZZZZZZZ -g

NSSSSSSS-gYZZY ? V SSNSSSNSSNSSSSSSSSSSSSSSSSSNSNSZZZZZZZZZ Sk

ZZZZZZZZY e ?h NSNSN g ? N SSSSSSSNSNSSSSSSSSNSSNSSO k - ed . C-d

8. e-r at s ZZZZZZZZZ 9 ---a stby N-9. A CD A- f : / - ZZZZZZZZ -

a gig R OO ll N w n is a 2ZYZZYZZ k - A nar Perror-rr A all - C-9 (C. O seas ZZZZYZZYA

- 4

ZZZZZY O T sers an C O C C Cd O C C C O s N C O t s N s r - - "4M Ku bu IO 4M Kud 6/43 fin US 6,969,595 B2 1 2 CAROTENOID PRODUCTION FROM A Although more than 600 different carotenoids have been SINGLE CARBON SUBSTRATE identified in nature, only a few are used industrially for food colors, animal feeding, pharmaceuticals and cosmetics. This application claims the benefit of U.S. Provisional Presently, most of the carotenoids used for industrial pur poses are produced by chemical Synthesis, however, these Application No. 60/229,907, filed Sep. 1, 2000 and the compounds are very difficult to make chemically (Nelis and benefit of U.S. Provisional Application No. 60/229,858 filed Leenheer, Appl. Bacteriol. 70:181-191 (1991)). Natural Sep. 1, 2000. carotenoids can either be obtained by extraction of plant FIELD OF THE INVENTION material or by microbial Synthesis. At the present time, only a few plants are widely used for commercial carotenoid The invention relates to the field of molecular biology and production. However, the productivity of carotenoid Synthe microbiology. More Specifically, the invention describes the sis in these plants is relatively low and the resulting caro production of carotenoid compounds from microorganisms tenoids are very expensive. which metabolize Single carbon Substrates as a Sole carbon A number of carotenoids have been produced from micro SOCC. 15 bial Sources. For example, Lycopene has been produced BACKGROUND OF THE INVENTION from genetically engineered E. coli and Candia utilis (Farmer W. R. and J. C. Liao. (2001) Biotechnol. Prog. 17: Carotenoids represent one of the most widely distributed 57-61; Wang C. et al., (2000) Biotechnol Prog. 16:922–926; and Structurally diverse classes of natural pigments, produc Misawa, N. and H. Shimada. (1998). J. Biotechnol. ing pigment colors of light yellow to orange to deep red. 59:169–181; Shimada, H. et al. 1998. Appl. Environm. Eye-catching examples of carotenogenic tissues include Microbiol. 64:2676-2680). B-carotene has been produced carrots, tomatoes, red peppers, and the petals of daffodils from E. coli, Candia utilis and Pfafia rhodozyma (Albrecht, and marigolds. Carotenoids are Synthesized by all photo M. et al., (1999). Biotechnol. Lett. 21: 791-795; Miura, Y. et Synthetic organisms, as well as Some bacteria and fungi. al., 1998. Appl. Environm. Microbiol. 64:1226–1229; U.S. These pigments have important functions in photosynthesis, 25 Pat. No. 5,691,190). Zeaxanthin has been produced from nutrition, and protection against photooxidative damage. For recombinant from E. coli and Candia utilis (Albrecht, M. et example, animals do not have the ability to Synthesize al., (1999). Biotechnol. Lett. 21: 791-795; Miura, Y. et al., carotenoids but must instead obtain these nutritionally 1998. Appl. Environm. Microbiol. 64:1226–1229). Astaxan important compounds through their dietary Sources. thin has been produced from E. coli and Pfafia rhodozyma Structurally, carotenoids are 40-carbon (Co) terpenoids (U.S. Pat. Nos. 5,466.599; 6,015,684; 5,182,208; 5,972, derived from the isoprene biosynthetic pathway and its 642). five-carbon universal isoprene building block, isopentenyl Additionally genes encoding various elements of the pyrophosphate (IPP). This biosynthetic pathway can be carotenoid biosynthetic pathway have been cloned and divided into two portions: the upper isoprene pathway, expressed in various microbes. For example genes encoding which leads to the formation of IPP, and the lower caro 35 lycopene cyclase, geranylgeranyl pyrophosphate Synthase, tenoid biosynthetic pathway, which converts IPP into long and phytoene dehydrogenase isolated from Erwinia herbi Co and Co carotenogenic compounds. Both portions of this cola have been expressed recombinantly in E. coli (U.S. Pat. pathway are shown in FIG. 1. Nos. 5,656,472;5,545,816; 5.530,189: 5,530,188). Similarly Various other crt genes are known, which enable the genes encoding the carotenoid products geranylgeranyl intramolecular conversion of long Co and Co compounds 40 pyrophosphate, phytoene, lycopene, B-caroteine, and to produce numerous other carotenoid compounds. It is the Zeaxanthin-diglucoside, isolated from Erwinia uredovOra degree of the carbon backbone's unsaturation, conjugation have been expressed in E. coli, Zymomonas mobilis, and and isomerization which determines the Specific carotenoids Saccharomyces cerevisiae (U.S. Pat. No. 5,429,939). unique absorption characteristics and colors. Several Similarly, the Carotenoid biosynthetic genes crtE (1), crtB reviews discuss the genetics of carotenoid pigment 45 (3), crtI (5), crtY (7), and crtz isolated from Flavobacterium biosynthesis, such as those of Armstrong (J. Bact. 176: have been recombinantly expressed (U.S. Pat. No. 6,124, 4795-4802 (1994); Annu. Rev. Microbiol. 51:629–659 113). (1997)). Although the above methods of propducing carotenoids In reference to the availability of carotenoid genes, public are useful, these methods Suffer from low yields and reliance domain databases Such as GenBank contain Sequences iso 50 on expensive feedstocks. A method that produces higher lated from numerous organisms. For example, there are yields of carotenoids from an inexpensive feedstock is currently 26 GenBank Accession numbers relating to Vari needed. ous crtE genes isolated from 19 different organisms. The leSS There are a number of microorganisms that utilize Single frequently encountered crtz gene boasts 6 GenBank Acces carbon Substrates as Sole energy Sources. These Substrates Sion numbers with each gene isolated from a different 55 include, methane, methanol, formate, methylated amines organism. A similarly wide Selection of carotenoid genes is and thiols, and various other reduced carbon compounds available for each of the genes discussed above. which lack any carbon-carbon bonds and are generally quite The genetics of carotenoid pigment biosynthesis has been inexpensive. These organisms are referred to as methylotro extremely well Studied in the Gram-negative, pigmented phs and herein as “C1 metabolizers”. These organisms are bacteria of the genera Pantoea, formerly known as Erwinia. 60 characterized by the ability to use carbon Substrates lacking In both E. herbicola EHO-10 (ATCC 39368) and E. ure carbon to carbon bonds as a Sole Source of energy and dovora 20D3 (ATCC 19321), the crt genes are clustered in biomass. A Subset of methylotrophs are the methanotrophs two genetic units, crt Z and crt EXYIB (U.S. Pat. Nos. which have the unique ability to utilize methane as a Sole 5,656,472; 5.5545,816; 5,530,189; 5,530,188; 5,429,939). energy Source. Although a large number of these organisms Despite the similarity in operon structure, the DNA 65 are known, few of these microbes have been Successfully sequences of E. uredovora and E. herbicola show no homol harnessed to industrial processes for the Synthesis of mate ogy by DNA-DNA hybridization (U.S. Pat. No. 5,429,939). rials. Although Single carbon Substrates are cost effective US 6,969,595 B2 3 4 energy Sources, difficulty in genetic manipulation of these ing from abundantly available C1 sources, which could be microorganisms as well as a dearth of information about used as a feedstock for C1 organisms and which should their genetic machinery has limited their use primarily to the provide both economic and quality advantages over other Synthesis of native products. For example the commercial more traditional carbohydrate raw materials. Secondly, there applications of biotransformation of methane have histori is abundant knowledge available concerning organisms that cally fallen broadly into three categories: 1) Production of possess carotenogenic biosynthetic genes, the function of single cell protein, (Sharpe D. H. BioProtein Manufacture those genes, and the upper isoprene pathway which pro 1989. Ellis Horwood series in applied science and industrial duces carotenogenic precursor molecules. Finally, numerous technology. New York: Halstead Press.) (Villadsen, John, methylotrophic organisms exist in the art which are them Recent Trends Chem. React. Eng., Proc. Int. Chem. React. Selves pigmented, and thereby possess portions of the nec Eng. Conf.), 2nd (1987), Volume 2, 320–33. Editor(s): essary carotenoid biosynthetic pathway. Kulkarni, B.D., Mashelkar, R. A.; Sharma, M. M. Publisher: Despite these available tools, the art does not reveal any Wiley East., New Delhi, India; Naguib, M., Proc. OAPEC C1 metabolizers which have been genetically engineered to Symp. Petroprotein, Pap. (1980), Meeting Date 1979, make Specific carotenoids of choice, for large Scale com 253–77 Publisher: Organ. Arab Pet. Exporting Countries, 15 mercial value. It is hypothesized that the usefulness of these Kuwait, Kuwait.); 2) epoxidation of alkenes for production organisms for production of a larger range of chemicals is of chemicals (U.S. Pat. No. 4,348,476); and 3) biodegrada constrained by limitations including, relatively slow growth tion of chlorinated pollutants (Tsien et al., Gas, Oil, Coal, rates of methanotrophs, limited ability to tolerate methanol Environ. Biotechnol. 2, Pap. Int. IGT Symp. Gas, Oil, Coal, as an alternative Substrate to methane, difficulty in genetic Environ. Biotechnol.), 2nd (1990), 83-104. Editor(s): Akin, engineering, poor understanding of the roles of multiple Cavit; Smith, Jared. Publisher: Inst. Gas Technol., Chicago, carbon assimilation pathways present in methanotrophs, and Ill., WO 9633821; Merkley et al., Biorem. Recalcitrant Org., potentially high costs due to the oxygen demand of fully Pap. Int. In Situ On-Site Bioreclam. Symp.), 3rd (1995), Saturated Substrates Such as methane. The problem to be 165-74. Editor(s): Hinchee, Robert E.; Anderson, Daniel B.; solved, therefore is to provide a cost effective method for the Hoeppel, Ronald E. Publisher: Battelle Press, Columbus, 25 microbial production of carotenoid compounds, using Ohio. Meyer et al., Microb. Releases (1993), 2(1), 11–22). organisms which utilize C1 compounds as their carbon and Even here, the commercial Success of the methane bio energy Source. transformation has been limited to epoxidation of alkenes Applicants have Solved the Stated problem by engineering due to low product yields, toxicity of products and the large microorganisms which are able to use Single carbon Sub amount of cell mass required to generate product associated Strates as Sole carbon Sources for the production of caro with the process. tenoid compounds. The commercial utility of methylotrophic organisms is reviewed in Lidstrom and Stirling (Annu. Rev. Microbiol. SUMMARY OF THE INVENTION 44:27-58 (1990)). Little commercial success has been The invention provides a method for the production of a documented, despite numerous efforts involving the appli 35 carotenoid compound comprising: cation of methylotrophic organisms and their enzymes (a) providing a transformed C1 metabolizing host cell (Lidstrom and Stirling, Supra, Table 3). In most cases, it has comprising: been discovered that the organisms have little advantage (i) Suitable levels of isopentenyl pyrophosphate; and over other well-developed host systems. Methanol is fre (ii) at least one isolated nucleic acid molecule encoding quently cited as a feedstock which should provide both 40 an enzyme in the carotenoid biosynthetic pathway economic and quality advantages over other more traditional under the control of Suitable regulatory Sequences, carbohydrate raw materials, but thus far this expectation has (b) contacting the host cell of Step (a) under Suitable not been Significantly validated in published WorkS. growth conditions with an effective amount of a C1 One of the most common classes of Single carbon metabo carbon Substrate whereby an carotenoid compound is lizers are the methanotrophs. Methanotrophic bacteria are 45 produced. defined by their ability to use methane as a Sole Source of Preferred C1 carbon Substrates of the invention are carbon and energy. Methane monooxygenase is the enzyme Selected from the group consisting of methane, methanol, required for the primary Step in methane activation and the formaldehyde, formic acid, methylated amines, methylated product of this reaction is methanol (Murrell et al., Arch. thiols, and carbon dioxide. Preferred C1 metabolizers are Microbiol. (2000), 173(5–6), 325–332). This reaction occurs 50 methylotrophs and methanotrophs. Particularly preferred C1 at ambient temperature and pressures whereas chemical metabolizers are those that comprise a functional Embden transformation of methane to methanol requires tempera Meyerhof carbon pathway, Said pathway comprising a gene tures of hundreds of degrees and high pressure (Grigoryan, encoding a pyrophosphate dependent phosphofructokinase E. A., Kinet. Catal. (1999), 40(3), 350-363; WO enzyme. Optionally the preferred host may comprise at least 2000007718; U.S. Pat. No. 5,750.821). It is this ability to 55 one gene encoding a fructose bisphosphate aldolase enzyme. transform methane under ambient conditions along with the Suitable levels of isopentenyl pyrophosphate may be abundance of methane that makes the biotransformation of endogenous to the host, or may be provided by heterologusly methane a potentially unique and valuable process. introduced upper pathway isoprenoid genes Such as D-1- Many methanotrophs contain an inherent isoprenoid path deoxyxylulose-5-phosphate Synthase (DXS), D-1- way which enables these organisms to Synthesize other 60 deoxyxylulose-5-phosphate reductoisomerase (DXr), non-endogenous isoprenoid compounds. Since methanotro 2C-methyl-d-erythritol cytidylyltransferase (IspD), phs can use one carbon Substrate (methane or methanol) as 4-diphosphocytidyl-2-C-methylerythritol kinase (IspE), an energy Source, it is possible to produce carotenoids at low 2C-methyl-d-erythritol 2,4-cyclodiphosphate Synthase COSt. (IspF), CTP synthase (PyrC) and lytB. Current knowledge in the field concerning methylotrophic 65 In an alternate embodiment the invention provides a organisms and carotenoids leads to the following conclu method for the over-production of carotenoid production in Sions. First, there is tremendous commercial incentive aris a transformed C1 metabolizing host comprising: US 6,969,595 B2 S 6 (a) providing a transformed C1 metabolizing host cell and Annex C of the Administrative Instructions). The sym comprising: bols and format used for nucleotide and amino acid (i) Suitable levels of isopentenyl pyrophosphate; and sequence data comply with the rules set forth in 37 C.F.R. (ii) at least one isolated nucleic acid molecule encoding an enzyme in the carotenoid biosynthetic pathway S1.822. under the control of Suitable regulatory Sequences, SEQ ID NOS:1-38 are full length genes or proteins as and identified in Table 1. (iii) either: 1) multiple copies of at least one gene encoding an TABLE 1. enzyme Selected from the group consisting of D-1-deoxyxylulose-5-phosphate Synthase (DXS), Summary of Gene and Protein SEQ ID Numbers D-1-deoxy Xylulose-5-phosphate reductoi SEO ID SEO ID Somerase (DXr), 2C-methyl-d-erythritol cytidylyl Description Nucleic acid Peptide transferase (IspD), 4-diphosphocytidyl-2-C- Phosphofructokinase pyrophosphate 1. 2 methylerythritol kinase (IspE), 2C-methyl-d- 15 dependent erythritol 2,4-cyclodiphosphate Synthase (IspF), KHG/KDPG Aldolase 3 4 CTP synthase (PyrC) and lytB; or dxs 5 6 dXr 7 8 2) at least one gene encoding an enzyme Selected ispD (ygbP 9 1O from the group consisting of D-1-deoxyxylulose ispE (ychB) 11 12 5-phosphate Synthase (DXS), D-1-deoxyxylulose ispF (ygbB) 13 14 5-phosphate reductoisomerase (DXr), 2C-methyl pyrCi 15 16 lytB 17 18 d-erythritol cytidylyltransferase (IspD), ispA 19 2O 4-diphosphocytidyl-2-C-methylerythritol kinase CrtN1 21 22 (ISpE), 2C-methyl-d-erythritol 2,4- CrtN2 23 24 cyclodiphosphate synthase (IspF), CTP synthase 25 crtE 25 26 crtX 27 28 (PyrC) and lytB operable linked to a strong pro crtY 29 3O moter. crt 31 32 (b) contacting the host cell of step (a) under Suitable crtB 33 34 growth conditions with an effective amount of a C1 crtz, 35 36 carbon Substrate whereby a carotenoid compound is crtO 37 38 over-produced. BRIEF DESCRIPTION OF THE DRAWINGS, SEQ ID Nos:39-40 are amplification primers for the SEQUENCE DESCRIPTIONS AND HMPS promoter BIOLOGICAL DEPOSITS 35 SEQ ID Nos:41-42 are amplification primers for the crtO FIG. 1 illustrates the upper isoprene pathway and lower gene from RhodocOccuS. carotenoid biosynthetic pathway. SEQ ID NOS:43 and 44 are the primer sequences used to FIG. 2 provides microarray expression data for key car amplify the crt cluster of Pantoea Stewartii. bon pathway genes, as expressed in Methylomonas 16a. 40 FIG. 3 shows plasmid pcrt1 and HPLC spectra verifying SEQ ID NOS:45-47 are the primer sequences used to Synthesis of B-caroteine in those Methylomonas containing amplify the 16S rRNA of Rhodococcus erythropolis AN 12. plasmid pcrt1. SEQ ID NOS:48 and 49 are the primer sequences used to FIG. 4 shows plasmid pcrt3 and HPLC spectra verifying amplify the crtO gene. Synthesis of Zeaxanthin and its mono- and di-glucosides in 45 SEQ ID NOs: 50–54 are promoter sequences for the those Methylomonas containing plasmid pcrt3. HMPS gene and primers used to amplify that promoter. FIG. 5 shows plasmid pcrt4 and HPLC spectra verifying Synthesis of Zeaxanthin and its mono- and di-glucosides in SEQ ID NOS:55 and 56 are the primer sequences used to those Methylomonas containing plasmid pcrt4. amplify the dxS gene. 50 FIG. 6 shows plasmidpcrt4.1 and HPLC spectra verifying SEQ ID NOS:57 and 58 are the primer sequences used to Synthesis of canthaxanthin and astaxanthin in those Methy amplify the dxr gene. lomonas containing plasmid pcrt4.1. FIG. 7 shows plasmid pTJS75::dxs:dxr:lacZ:Tn5Kn and SEQ ID NOS:59 and 60 are the primer sequences used to amplify the lytB gene. production of the native carotenoid in those Methylomonas 55 containing plasmid pTJS75::dXs: dxr: lac Z: Tn5Kn. Applicants made the following biological deposits under Additionally, the construct pcrt4.1 is shown. the terms of the Budapest Treaty on the International Rec The invention can be more fully understood from the ognition of the Deposit of Micro-organisms for the Purposes following detailed description and the accompanying of Patent Procedure: Sequence descriptions which form a part of this application. 60 The following sequences conform with 37 C.F.R. 1.821-1.825 (“Requirements for Patent Applications Con taining Nucleotide Sequences and/or Amino Acid Sequence Depositor Identification International Depository Disclosures-the Sequence Rules”) and consistent with Reference Designation Date of Deposit World Intellectual Property Organization (WIPO) Standard 65 Methylomonas 16a ATCC PTA 2402 August 22, 2000 ST25 (1998) and the sequence listing requirements of the EPO and PCT (Rules 5.2 and 49.5(a-bis), and Section 208 US 6,969,595 B2 7 8 DETAILED DESCRIPTION OF THE The term “C carbon substrate” refers to any carbon INVENTION containing molecule that lacks a carbon-carbon bond. The present method is useful for the creation of recom Examples are methane, methanol, formaldehyde, formic binant organisms that have the ability to produce various acid, formate, methylated amines (e.g., mono-, di-, and carotenoid compounds. Nucleic acid fragments encoding a tri-methyl amine), methylated thiols, and carbon dioxide. variety of enzymes implicated in the carotenoid biosynthetic pathway have been cloned into microorganisms which use The term “C1 metabolizer” refers to a microorganism that Single carbon Substrates as a Sole carbon Source for the has the ability to use an Single carbon Substrate as a Sole production of carotenoid compounds. Source of energy and biomass. C1 metabolizers will typi There is a general practical utility for microbial produc cally be methylotrophs and/or methanotrophs. tion of carotenoid compounds as these compounds are very difficult to make chemically (Nelis and Leenheer, Appl. The term “methylotroph” means an organism capable of Bacteriol. 70:181-191 (1991)). Most carotenoids have oxidizing organic compounds which do not contain carbon Strong color and can be viewed as natural pigments or carbon bonds. Where the methylotroph is able to oxidize colorants. Furthermore, many carotenoids have potent anti 15 CH4, the methylotroph is also a methanotroph. oxidant properties and thus inclusion of these compounds in the diet is thought to be healthful. Well-known examples are The term “methanotroph” means a prokaryote capable of B-caroteine and astaxanthin. Additionally, carotenoids are utilizing methane as a Substrate. Complete oxidation of required elements of aquaculture. Salmon and shrimp aquac methane to carbon dioxide occurs by aerobic degradation ulture are particularly useful applications for this invention pathways. Typical examples of methanotrophs useful in the as carotenoid pigmentation is critically important for the present invention include but are not limited to the genera value of these organisms. (F. Shahidi, J. A. Brown, Caro Methylomonas, Methylobacter, Methylococcus, and Methy tenoid pigments in Seafood and aquaculture: Critical reviews losinus. in food Science 38(1): 1-67 (1998)). Finally, carotenoids 25 The term “high growth methanotrophic bacterial strain' have utility as intermediates in the Synthesis of Steroids, refers to a bacterium capable of growth with methane or flavors and fragrances and compounds with potential methanol as Sole carbon and energy Source which possess a electro-optic applications. functional Embden-Meyerhof carbon flux pathway resulting The disclosure below provides a detailed description of the Selection of the appropriate C1 metabolizing microor in a yield of cell mass per gram of C1 Substrate metabolized. ganism for transformation and the production of various The specific “high growth methanotrophic bacterial strain' carotenoid compounds in high yield. described herein is referred to as “Methylomonas 16a” or In this disclosure, a number of terms and abbreviations are “16a”, which terms are used interchangeably. used. The following definitions are provided. The term “Methylomonas 16a” and “Methylomonas 16a The term “Embden-Meyerhof pathway” refers to the 35 sp.” Are used interchangeably and refer to the Methylomo Series of biochemical reactions for conversion of hexoses nas Strain used in the present invention. Such as glucose and fructose to important cellular 3-carbon intermediates Such as glyceraldehyde-3-phosphate, dihy The term "isoprenoid compound” refers to any compound droxyacetone phosphate, phosphophenolpyruvate and pyru which is derived via the pathway beginning with isopentenyl Vate. These reactions typically proceed with net yield of pyrophosphate (IPP) and formed by the head-to-tail conden biochemically useful energy in the form of ATP. The key 40 sation of isoprene units which may be of 5, 10, 15, 20, 30 or enzymes unique to the Embden-Meyerhof pathway are the 40 carbons in length. There term "isoprenoid pigment” phosphofructokinase and fructose-1,6 bisphosphate aldo refers to a class of isoprenoid compounds which typically lase. have Strong light absorbing properties. The term “Entner-Douderoff pathway” refers to a series of 45 The term “upper isoprene pathway” refers to any of the biochemical reactions for conversion of hexoses Such as following genes and gene products associated with the glucose or fructose to the important 3-carbon cellular inter isoprenoid biosynthetic pathway including the dxS gene mediates pyruvate and glyceraldehyde-3-phosphate without (encoding 1-deoxyxylulose-5-phosphate Synthase), the dxr any net production of biochemically useful energy. The key gene (encoding 1-deoxy xylulose-5-phosphate enzymes unique to the Entner-Douderoff pathway are the 50 reductoisomerase), the “ispD' gene (encoding the 6-phosphogluconate dehydratase and a ketodeoxyphospho 2C-methyl-D-erythritol cytidyltransferase enzyme; also gluconate aldolase. known as ygbP), the “ispE” gene (encoding the The term "diagnostic' as it relates to the presence of a 4-diphosphocytidyl-2-C-methylerythritol kinase; also gene in a pathway refers to evidence of the presence of that known as yehB), the “ispF gene (encoding a 2C-methyl pathway, where a gene having that activity is identified. 55 Within the context of the present invention the presence of d-erythritol 2,4-cyclodiphosphate Synthase; also known as a gene encoding a pyrophosphate dependant phosphofruc ygbB), the “pyrG” gene (encoding a CTP synthase); the tokinase is "diagnostic' for the presence of the Embden “lytB gene involved in the formation of dimethylallyl Meyerhof carbon pathway and the presence of gene encod diphosphate, and the gcpE gene involved in the Synthesis of ing a ketodeoxyphosphogluconate aldolase is "diagnostic' 60 2-C-methyl-D-erythritol 4-phosphate in the isoprenoid path for the presence of the Entner-Douderoff carbon pathway. way. The term "yield” is defined herein as the amount of cell The term “DXs” refers to the 1-deoxyxylulose-5- mass produced per gram of carbon Substrate metabolized. phosphate Synthase enzyme encoded by the dxS gene. The term “carbon conversion efficiency” is a measure of how much carbon is assimilated into cell mass and is 65 The term “DXr” refers to the 1-deoxyxylulose-5- calculated assuming a bioma SS composition of phosphate reductoisomerase enzyme encoded by the dxr CH2Oos No.2s. gene. US 6,969,595 B2 9 10 The term “YgbP” or “IspD” refers to the 2C-methyl-D- farnesyl pyrophosphate (FPP), and geranylgeranyl pyro erythritol cytidyltransferase enzyme encoded by the ygbP or phosphate (GGPP) are formed. ispD gene. The names of the gene, ygbP or ispD, are used The term “CrtN1” or “CrtN, copy1” refers to copy 1 of the interchangeably in this application. The names of gene diapophytoene dehydrogenase enzyme encoded by crtN1 product, YgbP or IspD are used interchangeably in this 5 gene. application. The term “CrtN2” or “CrtN copy2" refers to copy 2 of the The term “Y chB” or “ Isp E” refers to the diapophytoene dehydrogenase enzyme(Crt) encoded by 4-diphosphocytidyl-2-C-methylerythritol kinase enzyme crtN2 gene. encoded by the yChB or ispE gene. The names of the gene, The term “CrtE’ refers to geranylgeranyl pyrophosphate ychB or ispE, are used interchangeably in this application. 10 Synthase enzyme encoded by crtE gene which converts The names of gene product, YchB or IspE are used inter trans-trans-farnesyl diphosphate and isopentenyl diphos changeably in this application. phate into pyrophosphate and geranylgeranyl diphosphate. The term “YgbB” or “IspF” refers to the 2C-methyl-d- erythritol 2,4-cyclodiphosphate Synthase enzyme encoded The term “CrtX' refers to the zeaxanthin glucosyl trans by the ygbB or ispE gene. The names of the gene, ygbB or 15 ferase enzyme encoded by the crtX gene, and which glyco ispF, are used interchangeably in this application. The names SolateS ZeaXanthin to produce Zeaxanthin-f-diglucoside. of gene product, YgbB or IspF are used interchangeably in The term “CrtY' refers to the lycopene cyclase enzyme this application. encoded by the crtY gene and which catalyzes conversion of The term “PyrG” refers to a CTP synthase enzyme 2O lycopene to 3-carotene. encoded by the pyrC gene. The term “CrtI” refers to the phytoene desaturase enzyme The term “IspA” refers to Geranyltransferase or farnesyl encoded by the crtI gene and which converts phytoene into diphosphate Synthase enzyme as one of prenyl transferase lycopene Via the intermediaries of phytofluene, Zeta family encoded by isp A gene. carotene, and neurosporene by the introduction of 4 double The term “LytB” refers to protein having a role in the 25 bonds. formation of dimethylallyl-pyrophosphate in the isoprenoid The term “CrtB” refers to the phytoene synthase enzyme encoded by the crtB gene which catalyses the reaction from pathway and which is encoded by lytB gene. prephytoene diphosphate to phytoene. The term “gcpE” refers to a protein having a role in the formation of 2-C-methyl-D-erythritol 4-phosphate in the The term "CriZ" refers to the B-caroteine hydroxylase isoprenoid pathway (Altincicek et al., J. Bacteriol. (2001), 30 y encoded by crtz gene which catalyses the hydroxy 183(8), 2411-2416; Campos et al., FEBS Lett. (2001), lation reaction from B-caroteine to Zeaxanthin. 488(3), 170–173) The term “CrtO' refers to the B-caroteine ketolase enzyme The term “lower carotenoid biosynthetic pathway” refers encoded by crt0 gene which catalyses conversion of to any of the following genes and gene products associated B-carotene into canthaxanthin (two ketone groups) W with the isoprenoid biosynthetic pathway, which are echinenone (one ketone group) as the intermediate. involved in the immediate Synthesis of phytoene (whose The term “Carotenoid compound” is defined as a class of Synthesis represents the first Step unique to biosynthesis of hydrocarbons (carotenes) and their oxygenated derivatives carotenoids) or Subsequent reactions. These genes and gene (Xanthophylls) consisting of eight isoprenoid units joined in products include the “ispA gene (encoding geranyltrans- Such a manner that the arrangement of isoprenoid units is ferase or farnesyl diphosphate synthase), the “ctrN” and " reversed at the center of the molecule so that the two central “ctrN 1” genes (encoding diapophytoene dehydrogenases), methyl groups are in a 1,6-positional relationship and the the “crtE’ gene (encoding geranylgeranyl pyrophosphate remaining nonterminal methyl groups are in a 1.5-positional Synthase), the “crtX” gene (encoding zeaxanthin glucosyl relationship. All carotenoids may be formally derived from transferase), the “crtY' gene (encoding lycopene cyclase), 45 the acyclic C40H56 structure (Formula I below), having a the “crtI” gene (encoding phytoene desaturase), the “crtB” long central chain of conjugated double bonds, by (i) gene (encoding phytoene Synthase), the “crtz’ gene hydrogenation, (ii) dehydrogenation, (iii) cyclization, or (iv) (encoding f-caroteine hydroxylase), and the “crtO' gene oxidation, or any combination of these processes.

Formula I CH CH CH CH HC1 S1 n1 N1 N1 s1 N1 S1 s1 S1 n1 N1 n1 N1 n1 N1 3 H H2 H H H H H H H H H2 CH CH CH CH (I)

60 (encoding a f-caroteine ketolase). Additionally, the term This class also includes certain compounds that arise from “carotenoid biosynthetic enzyme” is an inclusive term refer- certain rearrangements of the carbon skeleton (I), or by the ring to any and all of the enzymes in the present pathway (formal) removal of part of this structure. including CrtE, CrtX, CrtY, CrtI, CrtB, CrtZ, and CrtO. The term “Isp A” refers to the protein encoded by the ispA 65 gene, and whose activity catalyzes a Sequence of 3 prenyl- For convenience carotenoid formulae are often written in a transferase reactions in which geranyl pyrophosphate (GPP), shorthand form as US 6,969,595 B2 11 12

(IA) -- -N----- N s--- - where the broken lines indicate formal division into iso that the function of one is affected by the other. For example, prenoid units. a promoter is operably linked with a coding sequence when AS used herein, an "isolated nucleic acid fragment” is a it is capable of affecting the expression of that coding polymer of RNA or DNA that is single- or double-stranded, Sequence (i.e., that the coding sequence is under the tran optionally containing Synthetic, non-natural or altered nucle Scriptional control of the promoter). Coding sequences can otide bases. An isolated nucleic acid fragment in the form of 15 be operably linked to regulatory sequences in sense or a polymer of DNA may be comprised of one or more antisense orientation. Segments of cDNA, genomic DNA or synthetic DNA. "Gene' refers to a nucleic acid fragment that is capable of The term "expression', as used herein, refers to the being expressed as a specific protein, including regulatory transcription and stable accumulation of sense (mRNA) or Sequences preceding (5' non-coding sequences) and follow antisense RNA derived from the nucleic acid fragment of the ing (3' non-coding sequences) the coding sequence. “Native invention. Expression may also refer to translation of mRNA gene' refers to a gene as found in nature with its own into a polypeptide. regulatory Sequences. "Chimeric gene” refers to any gene “Transformation” refers to the transfer of a nucleic acid that is not a native gene, comprising regulatory and coding fragment into the genome of a host organism, resulting in Sequences that are not found together in nature. Accordingly, 25 genetically stable inheritance. Host organisms containing a chimeric gene may comprise regulatory sequences and the transformed nucleic acid fragments are referred to as coding Sequences that are derived from different sources, or “transgenic' or "recombinant’ or “transformed' organisms. regulatory Sequences and coding sequences derived from the The terms "plasmid”, “vector' and “cassette” refer to an Same Source, but arranged in a manner different than that extra chromosomal element often carrying genes which are found in nature. "Endogenous gene’ refers to a native gene not part of the central metabolism of the cell, and usually in in its natural location in the genome of an organism. A the form of circular double-stranded DNA fragments. Such "foreign' gene refers to a gene not normally found in the elements may be autonomously replicating sequences, host organism, but that is introduced into the host organism genome integrating sequences, phage or nucleotide by gene transfer. Foreign genes can comprise native genes Sequences, linear or circular, of a single- or double-stranded inserted into a non-native organism, or chimeric genes. A 35 DNA or RNA, derived from any source, in which a number “transgene' is a gene that has been introduced into the of nucleotide sequences have been joined or recombined genome by a transformation procedure. into a unique construction which is capable of introducing a "Coding Sequence” refers to a DNA sequence that codes promoter fragment and DNA sequence for a selected gene for a specific amino acid sequence. "Suitable regulatory product along with appropriate 3' untranslated sequence into Sequences” refer to nucleotide sequences located upstream 40 a cell. “Transformation cassette' refers to a specific vector (5' non-coding sequences), within, or downstream (3' non containing a foreign gene and having elements in addition to coding Sequences) of a coding sequence, and which influ the foreign gene that facilitates transformation of a particular ence the transcription, RNA processing or stability, or trans host cell. "Expression cassette' refers to a specific vector lation of the associated coding sequence. Regulatory containing a foreign gene and having elements in addition to Sequences may include promoters, translation leader 45 the foreign gene that allow for enhanced expression of that Sequences, introns, polyadenylation recognition sequences, gene in a foreign host. RNA processing site, effector binding site and stem-loop The term "percent identity”, as known in the art, is a Structure. relationship between two or more polypeptide sequences or “Promoter” refers to a DNA sequence capable of control two or more polynucleotide sequences, as determined by ling the expression of a coding sequence or functional RNA. 50 comparing the sequences. In the art, “identity” also means In general, a coding sequence is located 3' to a promoter the degree of Sequence relatedness between polypeptide or sequence. Promoters may be derived in their entirety from a polynucleotide sequences, as the case may be, as determined native gene, or be composed of different elements derived by the match between strings of Such sequences. “Identity” from different promoters found in nature, or even comprise and "similarity” can be readily calculated by known Synthetic DNA segments. It is understood by those skilled in 55 methods, including but not limited to those described in: the art that different promoters may direct the expression of Computational Molecular Biology (Lesk, A. M., ed.) Oxford a gene in different tissues or cell types, or at different stages University Press, NY (1988); Biocomputing: Informatics of development, or in response to different environmental or and Genome Projects (Smith, D. W., ed.) Academic Press, physiological conditions. Promoters which cause a gene to NY (1993); Computer Analysis of Sequence Data Part I be expressed in most cell types at most times are commonly 60 (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, NJ referred to as "constitutive promoters”. It is further recog (1994); Sequence Analysis in Molecular Biology (von nized that Since in most cases the exact boundaries of Heinje, G., ed.) Academic Press (1987); and Sequence regulatory Sequences have not been completely defined, Analysis Primer (Gribskov, M. and Devereux, J., eds.) DNA fragments of different lengths may have identical Stockton Press, NY (1991). Preferred methods to determine promoter activity. 65 identity are designed to give the best match between the The term “operably linked” refers to the association of Sequences tested. Methods to determine identity and simi nucleic acid Sequences on a single nucleic acid fragment so larity are codified in publicly available computer programs. US 6,969,595 B2 13 14 Sequence alignments and percent identity calculations may tive stability (corresponding to higher Tm) of nucleic acid be performed using the Megalign program of the LASER hybridizations decreases in the following order: RNA:RNA, GENE bioinformatics computing suite (DNASTAR Inc., DNA:RNA, DNA:DNA. For hybrids of greater than 100 Madison, Wis.). Multiple alignment of the sequences was nucleotides in length, equations for calculating Tm have performed using the Clustal method of alignment (Higgins been derived (see Sambrook et al., Supra, 9.50-9.51). For and Sharp (1989) CABIOS. 5:151-153) with the default hybridizations with Shorter nucleic acids, i.e., parameters (GAP PENALTY = 10, GAP LENGTH oligonucleotides, the position of mismatches becomes more PENALTY=10). Default parameters for pairwise alignments important, and the length of the oligonucleotide determines using the Clustal method were KTUPLE 1, GAP its specificity (see Sambrook et al., Supra, 11.7-11.8). In one PENALTY-3, WINDOW-5 and DIAGONALS SAVED=5. embodiment the length for a hybridizable nucleic acid is at Suitable nucleic acid fragments (isolated polynucleotides least about 10 nucleotides. Preferable a minimum length for of the present invention) encode polypeptides that are at a hybridizable nucleic acid is at least about 15 nucleotides, least about 70% identical, preferably at least about 80% more preferably at least about 20 nucleotides, and most identical to the amino acid Sequences reported herein. Pre preferably the length is at least 30 nucleotides. Furthermore, ferred nucleic acid fragments encode amino acid Sequences 15 the Skilled artisan will recognize that the temperature and that are about 85% identical to the amino acid Sequences wash Solution Salt concentration may be adjusted as neces reported herein. More preferred nucleic acid fragments Sary according to factorS Such as length of the probe. encode amino acid Sequences that are at least about 90% The term "sequence analysis Software” refers to any identical to the amino acid Sequences reported herein. Most computer algorithm or Software program that is useful for preferred are nucleic acid fragments that encode amino acid the analysis of nucleotide or amino acid Sequences. Sequences that are at least about 95% identical to the amino “Sequence analysis Software' may be commercially avail acid Sequences reported herein. Suitable nucleic acid frag able or independently developed. Typical Sequence analysis ments not only have the above homologies but typically Software will include but is not limited to the GCGSuite of encode a polypeptide having at least 50 amino acids, pref programs (Wisconsin Package Version 9.0, Genetics Com erably at least 100 amino acids, more preferably at least 150 25 puter Group (GCG), Madison, Wis.), BLASTP, BLASTN, amino acids, Still more preferably at least 200 amino acids, BLASTX (Altschulet al., J. Mol. Biol. 215:403-410 (1990), and most preferably at least 250 amino acids. and DNASTAR (DNASTAR, Inc. 1228 S. Park St. Madison, A nucleic acid molecule is “hybridizable” to another Wis. 53715 USA), and the FASTA program incorporating nucleic acid molecule, Such as a cDNA, genomic DNA, or the Smith-Waterman algorithm (W. R. Pearson, Comput. RNA, when a single stranded form of the nucleic acid Methods Genome Res., Proc. Int. Symp. (1994), Meeting molecule can anneal to the other nucleic acid molecule Date 1992, 111–20. Editor(s): Suhai, Sandor. Publisher: under the appropriate conditions of temperature and solution Plenum, New York, N.Y.). Within the context of this appli ionic strength. Hybridization and washing conditions are cation it will be understood that where Sequence analysis well known and exemplified in Sambrook, J., Fritsch, E. F. Software is used for analysis, that the results of the analysis and Maniatis, T. Molecular Cloning. A Laboratory Manual, 35 will be based on the “default values” of the program Second Edition, Cold Spring Harbor Laboratory Press, Cold referenced, unless otherwise Specified. AS used herein Spring Harbor (1989), particularly Chapter 11 and Table “default values' will mean any set of values or parameters 11.1 therein (entirely incorporated herein by reference). The which originally load with the Software when first initial conditions of temperature and ionic Strength determine the ized. “Stringency' of the hybridization. Stringency conditions can 40 Standard recombinant DNA and molecular cloning tech be adjusted to Screen for moderately similar fragments, Such niques used here are well known in the art and are described as homologous Sequences from distantly related organisms, by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular to highly similar fragments, Such as genes that duplicate Cloning. A Laboratory Manual, Second Edition, Cold functional enzymes from closely related organisms. Post Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. hybridization washes determine Stringency conditions. One 45 (1989) (hereinafter “Maniatis”); and by Silhavy, T. J., Set of preferred conditions uses a Series of washes Starting Bennan, M. L. and Enquist, L. W., Experiments with Gene with 6xSSC, 0.5% SDS at room temperature for 15 min, Fusions, Cold Spring Harbor Laboratory Cold Press Spring then repeated with 2xSSC, 0.5% SDS at 45° C. for 30 min, Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current and then repeated twice with 0.2xSSC, 0.5% SDS at 50° C. Protocols in Molecular Biology, published by Greene Pub for 30 min. A more preferred Set of Stringent conditions uses 50 lishing Assoc. and Wiley-Interscience (1987). higher temperatures in which the washes are identical to Identification and Isolation of C1 Metabolizing Microorgan those above except for the temperature of the final two 30 isms min washes in 0.2xSSC, 0.5% SDS was increased to 60° C. The present invention provides for the expression of Another preferred Set of highly Stringent conditions uses two genes involved in the biosynthesis of carotenoid compounds final washes in 0.1xSSC, 0.1% SDS at 65° C. An additional 55 in microorganisms which are able to use Single carbon preferred set of stringent conditions include 0.1xSSC, 0.1% Substrates as a Sole energy Source. Such microorganisms are SDS, 65 C. and washed with 2xSSC, 0.1% SDS followed referred to herein as C1 metabolizers. The host microorgan by 0.1XSSC, 0.1% SDS). ism may be any C1 metabolizer which has the ability to Hybridization requires that the two nucleic acids contain Synthesize isopentenyl pyrophosphate (IPP) the precursor complementary Sequences, although depending on the Strin 60 for many of the carotenoids. gency of the hybridization, mismatches between bases are Many C1 metabolizing microorganisms are known in the possible. The appropriate Stringency for hybridizing nucleic art which are able to use a variety of Single carbon Sub acids depends on the length of the nucleic acids and the Strates. Single carbon Substrates useful in the present inven degree of complementation, variables well known in the art. tion include but are not limited to methane, methanol, The greater the degree of Similarity or homology between 65 formaldehyde, formic acid, methylated amines (e.g. mono-, two nucleotide Sequences, the greater the value of Tm for di- and tri-methyl amine), methylated thiols, and carbon hybrids of nucleic acids having those Sequences. The rela dioxide. US 6,969,595 B2 15 16 All C1 metabolizing microorganisms are generally clas ultimately results in greater yield production of cell mass sified as methylotrophs. Methylotrophs may be defined as and other cell mass-dependent products in Methylomonas any organism capable of oxidizing organic compounds 16a. The activity of this pathway in the present 16a strain has which do not contain carbon-carbon bonds. A Subset of been confirmed through microarray data and biochemical methylotrophs are the methanotrophs, which have the dis- 5 evidence measuring the reduction of ATP. Although the 16a tinctive ability to oxidize methane. Facultative methylotro strain has been shown to possess both the Embden phs have the ability to oxidize organic compounds which do Meyerhof and the Entner-Douderoff pathway enzymes, the not contain carbon-carbon bonds, but may also use other data Suggests that the Embden-Meyerhof pathway enzymes carbon Substrates Such as Sugars and complex carbohydrates are more Strongly expressed than the Entner-Douderoff for energy and biomass. Obligate methylotrophs are those 10 pathway enzymes. This result is Surprising and counter to organisms which are limited to the use of organic com existing beliefs on the glycolytic metabolism of methan pounds which do not contain carbon-carbon bonds for the otrophic bacteria. Applicants have discovered other metha generation of energy and obligate methanotrophs are those notrophic bacteria having this characteristic, including for obligate methylotrophs that have the ability to oxidize example, Methylomonas clara and Methylosinus Sporium. It methane. 15 is likely that this activity has remained undiscovered in Facultative methylotrophic bacteria are found in many methanotrophs due to the lack of activity of the enzyme with environments, but are isolated most commonly from Soil, ATP, the typical phosphoryl donor for the enzyme in most landfill and waste treatment sites. Many facultative methy bacterial Systems. lotrophs are members of the B, and Y Subgroups of the A particularly novel and useful feature of the Embden Proteobacteria (Hanson et al., Microb. Growth C1 20 Meyerhof pathway in strain 16a is that the key phosphof Compounds., Int. Symp.), 7th (1993), 285-302. Editor(s): ructokinase Step is pyrophosphate dependent instead of ATP Murrell, J. Collin; Kelly, Don P. Publisher: Intercept, dependent. This feature adds to the energy yield of the Andover, UK; Madigan et al., Brock Biology of pathway by using pyrophosphate instead of ATP. Because of Microorganisms, 8th edition, Prentice Hall, UpperSaddle its significance in providing an energetic advantage to the River, N.J. (1997)). Facultative methylotrophic bacteria Suit- 25 Strain, this gene in the carbon flux pathway is considered able in the present invention include but are not limited to, diagnostic for the present Strain. Methylophilus, Methylobacillus, Methylobacterium, Comparison of the pyrophosphate dependent phosphof Hyphomicrobium, Xanthobacter, Bacillus, Paracoccus, ructokinase gene sequence (SEQ ID NO: 1) and deduced Nocardia, Arthrobacter, Rhodopseudomonas, and amino acid sequence (SEQ ID NO:2) to public databases Pseudomonas. 3O reveals that the most similar known sequence is about 63% The ability to utilize single carbon Substrates is not identical to the amino acid Sequence of reported herein over limited to bacteria but extends also to yeasts and fungi. A length of 437 amino acids using a Smith-Waterman align number of yeast genera are able to use Single carbon ment algorithm (W. R. Pearson, Comput. Methods Genome Substrates in addition to more complex materials as energy Res., Proc. Int. Symp. (1994), Meeting Date 1992, 111–20. Sources. Specific methylotrophic yeasts useful in the present 35 Editor(s): Suhai, Sandor. Publisher: Plenum, New York, invention include but are not limited to Candida, Hansenula, N.Y.). More preferred amino acid fragments are at least Pichia, Torulopsis, and Rhodotorula. about 80%-90% identical to the sequences herein. Most Those methylotrophs having the additional ability to preferred are nucleic acid fragments that are at least 95% utilize methane are referred to as methanotrophs. Of par identical to the amino acid fragments reported herein. ticular interest in the present invention are those obligate 40 Similarly, preferred pyrophosphate dependent phosphofruc methanotrophs which are methane utilizers but which are tokinase encoding nucleic acid Sequences corresponding to obliged to use organic compounds lacking carbon-carbon the instant gene are those encoding active proteins and bonds. Exemplary of these organisms are included in, but which are at least 80% identical to the nucleic acid not limited to, the genera Methylomonas, Methylobacter, Sequences of reported herein. More preferred pyrophosphate Mehty lococcus, Methy losinus, Methylocyctis, 45 dependent phosphofructokinase nucleic acid fragments are Methylomicrobium, and Methanomonas. at least 90% identical to the sequences herein. Most pre Of particular interest in the present invention are high ferred are pyrophosphate dependent phosphofructokinase growth obligate methanotrophs having an energetically nucleic acid fragments that are at least 95% identical to the favorable carbon flux pathway. For example, Applicants nucleic acid fragments reported herein. have discovered a specific Strain of methanotroph having 50 A further distinguishing characteristic of the present Strain Several pathway features which make it particularly useful is revealed when examining the “cleavage' Step which for carbon flux manipulation. This type of Strain has served occurs in the Ribulose Monophosphate Pathway, or RuMP as the host in the present application and is known as cycle. This cyclic Set of reactions converts methane to Methylomonas 16a (ATCC PTA 2402). biomolecules in methanotrophic bacteria. The pathway is The present Strain contains Several anomalies in the 55 comprised of three phases, each phase being a Series of carbon utilization pathway. For example, based on genome enzymatic steps (FIG. 2). The first step is “fixation” or Sequence data, the Strain is shown to contain genes for two incorporation of C-1 (formaldehyde) into a pentose to form pathways of hexose metabolism. The Entner-Douderoff a hexose or six-carbon Sugar. This occurs via a condensation Pathway, which utilizes the keto-deoxy phosphogluconate reaction between a 5-carbon Sugar (pentose) and formalde aldolase enzyme, is present in the Strain. It is generally well 60 hyde and is catalyzed by the heXulose monophosphate accepted that this is the operative pathway in obligate Synthase enzyme. The Second phase is termed “cleavage' methanotrophs. Also present however is the Embden and results in Splitting of that hexose into two 3-carbon Meyerhof Pathway, which utilizes the fructose bisphosphate molecules. One of those three-carbon molecules is recycled aldolase enzyme. It is well known that this pathway is either back through the RuMP pathway, while the other 3-carbon not present or not operative in obligate methanotrophs. 65 fragment is utilized for cell growth. In methanotrophs and Energetically, the latter pathway is most favorable and methylotrophs, the RuMP pathway may occur as one of allows greater yield of biologically useful energy, which three variants. However, only two of these variants are US 6,969,595 B2 17 18 commonly found, identified as the FBP/TA (fructose Strains. For example, the key characteristics of the present bisphosphotase/transaldolase) pathway or the KDPG/TA high growth Strain are that it is an obligate methanotroph, (keto deoxy phosphogluconate/transaldolase) pathway using only either methane of methanol as a Sole carbon (Dijkhuizen L., G. E. DeVries. The Physiology and biochem Source and possesses a functional Embden-Meyerhof, and istry of aerobic methanol-utilizing gram negative and gram particularly a gene encoding a pyrophosphate dependent positive bacteria. In: Methane and Methanol Utilizers phosphofructokinase. Methods for the isolation of methan (1992), eds. Colin Murrell and Howard Dalton; Plenum otrophs are common and well known in the art (See for Press:NY). example Thomas D. Brock Supra or Deshpande, Supra). The present Strain is unique in the way it handles the Similarly, pyrophosphate dependent phosphofructokinase “cleavage' Steps as genes were found that carry out this has been well characterized in mammalian Systems and conversion via fructose bisphosphate as a key intermediate. assay methods have been well developed (see for example The genes for fructose bisphosphate aldolase and transaldo Schliselfeld et al. Clin. Biochem. (1996), 29(1), 79–83; lase were found clustered together on one piece of DNA. Clark et al., J. Mol. Cell. Cardiol. (1980),12(10), 1053-64. Secondly, the genes for the other variant involving the keto The contemporary microbiologist will be able to use these deoxy phosphogluconate intermediate were also found clus 15 techniques to identify the present high growth Strain. tered together. Available literature teaches that these organ Genes Involved in Carotenoid Production. isms (methylotrophs and methanotrophs) rely Solely on the The enzyme pathway involved in the biosynthesis of KDPG pathway and that the FBP-dependent fixation path carotenoids can be conveniently viewed in two parts, the way is utilized by facultative methylotrophs (Dijkhuizen et upper isoprenoid pathway providing for the conversion of al., Supra). Therefore the latter observation is expected pyruvate and glyceraldehyde-3-phosphate to isopentenyl whereas the former is not. The finding of the FBP genes in pyrophosphate and the lower carotenoid biosynthetic an obligate methane utilizing bacterium is both Surprising pathway, which provides for the Synthesis of phytoene and and suggestive of utility. The FBP pathway is energetically all Subsequently produced carotenoids. The upper pathway favorable to the host microorganism due to the fact that leSS is ubiquitous in many C1 metabolizing microorganisms and energy (ATP) is utilized than is utilized in the KDPG 25 in these cases it will only be necessary to introduce genes pathway. Thus organisms that utilize the FBP pathway may that comprise the lower pathway for the biosynthesis of the have an energetic advantage and growth advantage over desired carotenoid. The key division between the two path those that utilize the KDPG pathway. This advantage may ways concerns the Synthesis of isopentenyl pyrophosphate also be useful for energy-requiring production pathways in (IPP). Where IPP is naturally present only elements of the the Strain. By using this pathway a methane-utilizing bac lower carotenoid pathway will be needed. However, it will terium may have an advantage over other methane utilizing be appreciated that for the lower pathway carotenoid genes organisms as production platforms for either single cell to be effective in the production of carotenoids, it will be protein or for any other product derived from the flow of necessary for the host cell to have suitable levels of IPP carbon through the RuMP pathway. within the cell. Where IPP synthesis is not provided by the Accordingly the present invention provides a method for 35 host cell, it will be necessary to introduce the genes neces the production of a carotenoid compound comprising pro sary for the production of IPP. Each of these pathways will viding a transformed C1 metabolizing host cell which be discussed below in detail. (a) grows on a C1 carbon Substrate Selected from the The Upper Isoprenoid Pathway group consisting of methane and methanol; and IPP biosynthesis occurs through either of two pathways. (b) comprises a functional Embden-Meyerhof carbon 40 First, IPP may be synthesized through the well-known pathway, Said pathway comprising a gene encoding a acetate/mevalonate pathway. However, recent Studies have pyrophosphate dependent phosphofructokinase demonstrated that the mevalonate-dependent pathway does enzyme. not operate in all living organisms. An alternate mevalonate Isolation of C1 Metabolizing Microorganisms independent pathway for IPP biosynthesis has been charac The C1 metabolizing microorganisms of the present 45 terized in bacteria and in green algae and higher plants invention are ubiquitous and many have been isolated and (Horbach et al., FEMS Microbiol. Lett. 111:135-140(1993); characterized. A general Scheme for isolation of these Strains Rohmer et al, Biochem. 295:517-524 (1993); Schwender et includes addition of an inoculum into a Sealed liquid mineral al., Biochem. 316: 73–80 (1996); Eisenreich et al., Proc. Salts media, containing either methane or methanol. Care Natl. Acad. Sci. USA 93: 6431-6436 (1996)). Many steps in must be made of the Volume:gas ratio and cultures are 50 both isoprenoid pathways are known (FIG. 1). For example, typically incubated between 25–55 C. Typically, a variety the initial Steps of the alternate pathway leading to the of different methylotrophic bacteria can be isolated from a production of IPP have been studied in Mycobacterium first enrichment, if it is plated or Streaked onto Solid media tuberculosis by Cole et al. (Nature 393:537-544 (1998)). when growth is first visible. Methods for the isolation of The first step of the pathway involves the condensation of methanotrophs are common and well known in the art (See 55 two 3-carbon molecules (pyruvate and D-glyceraldehyde for example Thomas D. Brock in Biotechnology: A Textbook 3-phosphate) to yield a 5-carbon compound known as D-1- of Industrial Microbiology, Second Edition (1989) Sinauer deoxyxylulose-5-phosphate. This reaction occurs by the ASSociates, Inc., Sunderland, Mass.; Deshpande, Mukund DXS enzyme, encoded by the dxS gene. Next, the isomer V., Appl. Biochem. Biotechnol., 36: 227 (1992); or Hanson, ization and reduction of D-1-deoxyxylulose-5-phosphate R. S. et al. The Prokaryotes: a handbook on habitats, 60 yields 2-C-methyl-D-erythritol-4-phosphate. One of the isolation, and identification of bacteria; Springer-Verlag: enzymes involved in the isomerization and reduction pro Berlin, New York, 1981; Volume 2, Chapter 118). ceSS is D-1-deoxyxylulose-5-phosphate reductoisomerase As noted above, preferred C1 metabolizer is one that (DXR), encoded by the gene dxr. 2-C-methyl-D-erythritol incorporates an active Embden-Meyerhof pathway as indi 4-phosphate is Subsequently converted into cated by the presence of a pyrophosphate dependent phos 65 4-diphosphocytidyl-2C-methyl-D-erythritol in a CTP phofructokinase. It is contemplated that the present teaching dependent reaction by the enzyme encoded by the non will enable the general identification and isolation of Similar annotated gene ygbP (Cole et al., Supra). Recently, however, US 6,969,595 B2 19 20 the ygbP gene was renamed as isp) as a part of the isp gene cluster (SwissProtein Accession #Q46893). TABLE 2-continued Next, the 2" position hydroxy group of 4-diphosphocytidyl-2C-methyl-D-erythritol can be phos Sources of Genes Encoding the Upper Isoprene Pathway phorylated in an ATP-dependent reaction by the enzyme Gene Genbank Accession Number and Source Organism encoded by the yehB gene. This product phosphorylates 4-diphosphocytidyl-2C-methyl-D-erythritol, resulting in ispF AB038256, Escherichia coli mecs gene AF230738, Escherichia coli 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate. AF250236, Catharanthus roseus (MECS) The yChB gene was renamed as ispE, also as a part of the isp AF279661, Plasmodium falciparum gene cluster (SwissProtein Accession #P24209). Finally, the AF321531, Arabidopsis thaliana pyrCi AB017705, Aspergillus Oryzae product of ygbB gene converts 4-diphosphocytidyl-2C AB064659, Aspergillus kawachii methyl-D-erythritol 2-phosphate to 2C-methyl-D-erythritol AFO61753, NitroSomonas europaea 2,4-cyclodiphosphate in a CTP-dependent manner. This AF206163, Solorina crocea gene has also been recently renamed, and belongs to the isp L22971, Spiroplasma citri 15 M12843, E. coli gene cluster. Specifically, the new name for the ygbB gene M19132, Emericelia nidulans is ispF (SwissProtein Accession #P36663). M69112, Mucor circinelioides It is known that 2C-methyl-D-erythritol 2,4- U15192, Chlamydia trachomatis U59237, Synechococcus PCC7942 cyclodiphosphate can be further converted into IPP to ulti U88301, Mycobacterium bovis mately produce carotenoids in the carotenoid biosynthesis X06626, Aspergillus niger pathway. However, the reactions leading to the production of X08037, Penicillium chrysogenium isopentenyl monophosphate from 2C-methyl-D-erythritol X53601, P. blakesleeanus 2,4-cyclodiphosphate are not yet well-characterized. The X67216, A. brasilense Y11303, A. fumigatus enzymes encoded by the lytB and gcpE genes (and perhaps Y13811, Aspergillus Oryzae others) are thought to participate in the reactions leading to NM OO1905 formation of isopentenyl pyrophosphate (IPP) and dimethy 25 Homo sapiens CTP synthase (CTPS), mRNA NM 016748, Mus musculus cytidine 5'-triphosphate lallyl pyrophosphate (DMAPP). synthase (Ctps), mRNA IPP may be isomerized to DMAPP via IPP isomerase, NM O19857 encoded by the idi gene, however this enzyme is not Homo sapiens CTP synthase II (CTPS2), essential for Survival and may be absent in Some bacteria X68196 using 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. mRNAS.cerevisiae ura8 gene for CTP synthetase XM 013134 Recent evidence suggests that the MEP pathway branches BCOO9408, Homo sapiens, CTP synthase, clone before IPP and separately produces IPP and DMAPP via the MGC10396 IMAGE 3355881 lytB gene product. AlytB knockout mutation is lethal in E. Homo sapiens CTP synthase II (CTPS2), mRNA coli except in media Supplemented with both IPP and XM 0468O1 35 Homo sapiens CTP synthase II (CTPS2), mRNA DMAPP. XM 046802 Genes encoding elements of the upper pathway are known Homo sapiens CTP synthase II (CTPS2), mRNA from a variety of plant, animal, and bacterial Sources, as XM 046803 Homo sapiens CTP synthase II (CTPS2), mRNA shown in Table 2. XM 046804 Homo sapiens CTP synthase II (CTPS2), mRNA TABLE 2 40 Z47198, A. parasiticus pkSA gene for polyketide synthase Sources of Genes Encoding the Upper Isoprene Pathway lytB AF027189, Acinetobacter sp. BD4I 3 AFO98521, Burkholderia pseudomallei Gene Genbank Accession Number and Source Organism AF291696, Streptococcus pneumoniae AF323927, Plasmodium falciparum gene dxs AFO35440, Escherichia coli 45 M87645, Bacilius subtillis Y18874, Synechococcus PCC6301 U38915, Synechocystis sp. AB026631, Streptomyces sp. CL190 X89371, C. jejuni AB042821, Streptomyces griseolosporeus gepE sp O67496 AF111814, Plasmodium falciparum sp P54482 AF143812, Lycopersicon esculentum AJ279019, Narcissus pseudonarcissus 50 AJ291721, Nicotiana tabacum sp O84060 ABO13300, Escherichia coli sp P27433 AB049187, Streptomyces griseolosporeus sp P44667 AF111813, Plasmodium falciparum AF116825, Mentha x piperita sp O33350 AF148852, Arabidopsis thaliana 55 pir S77159 AF182287, Artemisia annua AF250235, Catharanthus roseus sp O83460 AF282879, Pseudomonas aeruginosa AJ242588, Arabidopsis thaliana AJ250714, Zymomonas mobilis strain ZM4 AJ292312, Klebsiella pneumoniae, tr AAGO7190 AJ297566, Zea mays 60 ispD AB037876, Arabidopsis thaliana AF109075, Clostridium difficile AF230736, Escherichia coli The most preferred Source of genes for the upper isoprene AF230737, Arabidopsis thaliana ispE AF216300, Escherichia coli pathway in the present invention is from Methylomonas 16a. AF263101, Lycopersicon esculentum 65 Methylomonas 16a is particularly well suited for the present AF288615, Arabidopsis thaliana invention, as the methanotroph is naturally pink-pigmented, producing a 30-carbon carotenoid. Thus, the organism is US 6,969,595 B2 21 22 well-endowed with the genes of the upper isoprene pathway. Sequences of these preferred genes are presented as the TABLE 3 following SEQ ID numbers: the dxs gene (SEQ ID NO:5), the dxr gene (SEQ ID NO:7), the “ispD” gene (SEQ ID Sources of Genes Encoding the Lower Carotenoid NO:9), the “ispE” gene (SEQ ID NO:11), the “ispF” gene Biosynthetic Pathway (SEQ ID NO:13), the “pyrG” gene (SEQID NO:15), and the Gene Genbank Accession Number and Source Organism “lytB” gene (SEQ ID NO:17). ispA ABOO3187, Micrococcus luteus The Lower Carotenoid Biosynthetic Pathway AB016094, Synechococcus elongatus The formation of phytoene is the first “true” step unique AB021747, Oryza sativa FPPSI gene for farnesyl in the biosynthesis of carotenoids and produced via the diphosphate synthase AB028044, Rhodobacter sphaeroides lower carotenoid biosynthetic pathway, despite the com AB028046, Rhodobacter capsulatus pounds being colorless. The Synthesis of phytoene occurs AB028047, Rhodovulum sulfidophilum via isomerization of IPP to dimethylallyl pyrophosphate AF112881 and AF136602, Artemisia annua (DMAPP). This reaction is followed by a sequence of 3 AF384040, Mentha x piperita 15 DOO694, Escherichia coli prenyltransferase reactions. Two of these reactions are cata D13293, B. Stearothermophilus lyzed by ispA, leading to the creation of geranyl pyrophoS D85317, Oryza sativa phate (GPP; a 10-carbon molecule) and farnesyl pyrophos X75789, A. thaliana Y12072, G. arboreum phate (FPP, 15-carbon molecule). Z49786, H. brasiliensis The gene crtN1 and N2 convert farnesyl pyrophosphate to U80605, Arabidopsis thaliana farnesyl diphosphate naturally occurring 16 A 30-carbon pigment. synthase precursor (FPS1) mRNA, complete cds The gene crtE, encoding GGPP synthetase is responsible X76026, K. Iactis FPS gene for farnesyl diphosphate synthetase, QCR8 gene for bc1 complex, subunit VIII for the 3' prenyltransferase reaction which may occur, X82542, P. argentatum mRNA for farnesyl leading to the synthesis of phytoene. This reaction adds IPP diphosphate synthase (FPS1) to FPP to produce a 20-carbon molecule, geranylgeranyl X82543, P argentatum mRNA for farnesyl pyrophosphate (GGPP). 25 diphosphate synthase (FPS2) BCO10004, Homo Sapiens, farnesyl diphosphate Finally, a condensation reaction of two molecules of synthase (farnesyl pyrophosphate synthetase, GGPP occur to form phytoene (PPPP), the first 40-carbon dimethylallyltranstransferase, molecule of the lower carotenoid biosynthesis pathway. This geranyltranstransferase), clone MGC 15352 IMAGE, 4132071, mRNA, complete cds enzymatic reaction is catalyzed by crtB, encoding phytoene AF234168, Dictyostelium discoideum farnesyl Synthase. diphosphate synthase (Dfps) Lycopene, which imparts a "red-colored spectra, is pro L46349, Arabidopsis thaliana farnesyl diphosphate synthase (FPS2) mRNA, complete cds duced from phytoene through four Sequential dehydrogena L46350, Arabidopsis thaliana farnesyl diphosphate tion reactions by the removal of eight atoms of hydrogen, synthase (FPS2) gene, complete cds catalyzed by the gene crtI (encoding phytoene desaturase). 35 L46367, Arabidopsis thaliana farnesyl diphosphate Intermediaries in this reaction are phtyofluene, Zeta synthase (FPSI) gene, alternative products, complete cds caroteine, and neuroSporene. M89945, Rat farnesyl diphosphate synthase gene, Lycopene cyclase (crtY) converts lycopene to f-caroteine. exons 1-8 NM 002004, Homo Sapiens farnesyl diphosphate B-caroteine is converted to Zeaxanthin via a hydroxylation synthase (farnesyl pyrophosphate synthetase, reaction resulting from the activity of B-caroteine hydroxy 40 dimethylallyltranstransferase, lase (encoded by the crtz gene). B-cryptoxanthin is an geranyltranstransferase) (FDPS), mRNA intermediate in this reaction. U36376 Artemisia annua farnesyl diphosphate synthase (fps1) B-caroteine is converted to canthaxanthin by B-caroteine mRNA, complete cds ketolase encoded by the crtW gene. Echinenone in an XM 001352, Homo Sapiens farnesyl diphosphate intermediate in this reaction. Canthaxanthin can then be 45 synthase (farnesyl pyrophosphate synthetase, converted to astaxanthin by 3-caroteine hydroxylase encoded dimethylallyltranstransferase, geranyltranstransferase) (FDPS), mRNA by the crtz gene. Adonbirubrin is an intermediate in this XM 034497 reaction. Homo Sapiens farnesyl diphosphate synthase ZeaXanthin can be converted to Zeaxanthin-f-diglucoside. (farnesyl pyrophosphate synthetase, 50 dimethylallyltranstransferase, This reaction is catalyzed by ZeaXanthin glucosyltransferase geranyltranstransferase) (FDPS), mRNA (crtX). XM 034498 ZeaXanthin can be converted to astaxanthin by 3-caroteine Homo Sapiens farnesyl diphosphate synthase ketolase encoded by crtW, crtO or bkt. Adonixanthin is an (farnesyl pyrophosphate synthetase, intermediate in this reaction. dimethylallyltranstransferase, 55 geranyltranstransferase) (FDPS), mRNA Spheroidene can be converted to Spheroidenone by Sphe XM 03.4499 Homo Sapiens farnesyl diphosphate synthase roidene monooxygenase encoded by crtA. (farnesyl pyrophosphate synthetase, NeroSporene can be converted Spheroidene and lycopene dimethylallyltranstransferase, can be converted to Spirilloxanthin by the Sequential actions geranyltranstransferase) (FDPS), mRNA of hydroxyneuroSporene Synthase, methoxyneuroSporene XM 034500 60 Homo Sapiens farnesyl diphosphate synthase desaturase and hydroxyneurosporene-O-methyltransferase (farnesyl pyrophosphate synthetase, encoded by the crtC, crtD and crtF genes, respectively. dimethylallyltranstransferase, B-caroteine can be converted to isorenieratene by geranyltranstransferase) (FDPS), mRNA crtN X73889, S. aureus b-caroteine desaturase encoded by crtU. crtE (GGPP AB000835, Arabidopsis thaliana Genes encoding elements of the lower carotenoid biosyn 65 Synthase) AB016043 and ABO19036, Homo Sapiens thetic pathway are known from a variety of plant, animal, ABO16044, Mus musculus and bacterial Sources, as shown in Table 3. US 6,969,595 B2 23 24

TABLE 3-continued TABLE 3-continued Sources of Genes Encoding the Lower Carotenoid Sources of Genes Encoding the Lower Carotenoid Biosynthetic Pathway Biosynthetic Pathway Gene Genbank Accession Number and Source Organism Gene Genbank Accession Number and Source Organism AB027705 and ABO27706, Daucus carota X86452, L. esculentum mRNA for lycopene f-cyclase AB034249, Croton Sublyratus X95596, S. griseus AB034250, Scoparia dulcis X98796, N. pseudonarcissus AFO20041, Helianthus annuus crtl ABO46992, Citrus unshiu CitPDS1 mRNA for AFO49658, Drosophila melanogaster signal phytoene desaturase, complete cds recognition particle 19kDa protein (Srp19) gene, partial AFO39.585 sequence; and geranylgeranyl pyrophosphate Zea mays phytoene desaturase (pds1) gene promoter synthase (quemao) gene, complete cds region and exon 1 AFO49659, Drosophila melanogaster geranylgeranyl AFO49356 pyrophosphate synthase mRNA, complete cds 15 Oryza Sativa phytoene desaturase precursor (Pds) AF139916, Brevibacterium linens mRNA, complete cds AF279807, Penicillium paxilligeranylgeranyl AF139916, Brevibacterium linens pyrophosphate synthase (ggs1) gene, complete AF218415, Bradyrhizobium sp. ORS278 AF2798O8 AF251014, Tagetes erecta Penicillium paxilli dimethylallyl tryptophan synthase AF364515, Citrus x paradisi (paxD) gene, partial cds; and cytochrome P450 D58420, Agrobacterium aurantiacum monooxygenase (paxQ), cytochrome P450 D83514, Erythrobacter longus monooxygenase (paxP), PaxC (paxC), L16237, Arabidopsis thaliana monooxygenase (paxM), geranylgeranyl L37405, Streptomyces griseus geranylgeranyl pyrophosphate synthase (paxG), PaxU (paxU), and pyrophosphate synthase (crtB), phytoene desaturase metabolite transporter (paxT) genes, complete cds (cftE) and phytoene synthase (cftl) genes, complete AJO10302, Rhodobactersphaeroides cds AJ133724, Mycobacterium aurum 25 L39266, Zea mays phytoene desaturase (Pds) AJ276129, Mucor circinelloides flusitanicus carG mRNA, complete cds gene for geranylgeranyl pyrophosphate synthase, M64704, Soybean phytoene desaturase exons 1-6 M88683, Lycopersicon esculentum phytoene D85O29 desaturase (pds) mRNA, complete cds Arabidopsis thaliana mRNA for geranylgeranyl S71770, carotenoid gene cluster pyrophosphate synthase, partial cds U37285, Zea mays L25813, Arabidopsis thaliana U46919, Solanum lycopersicum phytoene desaturase L37405, Streptomyces griseus geranylgeranyl (Pds) gene, partial cds pyrophosphate synthase (crtB), phytoene desaturase U62808, Flavobacterium ATCC21588 (cftE) and phytoene synthase (cftl) genes, complete X55289, Synechococcus pds gene for phytoene cds desaturase U15778, Lupinus albus geranylgeranyl 35 X59948, L. esculentum pyrophosphate synthase (ggps1) mRNA, complete X62574, Synechocystis sp. pds gene for phytoene cds desaturase U44876, Arabidopsis thaliana pregeranyigeranyl X68058 pyrophosphate synthase (GGPS2) mRNA, complete C. annuum pds1 mRNA for phytoene desaturase cds X71O23 X92893, C. roseus 40 Lycopersicon esculentum pds gene for phytoene X95596, S. griseus desaturase X98795, S. alba X78271, L. esculentum (Ailsa Craig) PDS gene Y15112, Paracoccus marcusii X78434, P. blakesleeanus (NRRL1555) carB gene crtX D90087, E. uredovora X78815, N. pseudonarcissus M87280 and M90698, Pantoea agglomerans X86783, H. pluvialis Y14807, Dunaiella bardawill crtY AF139916, Brevibacterium linens 45 YI 5007, Xanthophyllomyces dendrorhous AF152246, Citrus x paradisi Y15112, Paracoccus marcusii AF218415, Bradyrhizobium sp. ORS278 Y15114, Anabaena PCC7210 crtP gene AF272737, Streptomyces griseus strain IFO13350 Z11165, R. capsulatus AJ133724, Mycobacterium aurum crtB AB001284, Spirulina platensis AJ250827, Rhizomucor circinelloides flusitanicus AB032797, Daucus carota PSY mRNA for phytoene carRP gene for lycopene cyclase/phytoene synthase, 50 synthase, complete cds exons 1-2 AB034704, Rubrivivax gelatinosus AJ276965, Phycomyces blakesleeanus carRA gene ABO37975, Citrus unshiu for phytoene synthase/lycopene cyclase, exons 1-2 AFOO9954, Arabidopsis thaliana phytoene synthase D58420, Agrobacterium aurantiacum (PSY) gene, complete cds D83513, Erythrobacter longus AF139916, Brevibacterium linens L40176, Arabidopsis thaliana lycopene cyclase 55 AF152892, Citrus x paradisi (LYC) mRNA, complete cds AF218415, Bradyrhizobium sp. ORS278 M87280, Pantoea agglomerans AF220218, Citrus unshiu phytoene synthase (Psy1) U50738, Arabodopsis thaliana lycopene epsilon mRNA, complete cds cyclase mRNA, complete cds AJO10302, Rhodobacter U50739 AJ133724, Mycobacterium aurum Arabidosis thaliana lycopene B cyclase mRNA, 60 AJ278287, Phycomyces blakesleeanus carRA gene complete cds for lycopene cyclase/phytoene synthase, U62808, Flavobacterium ATCC21588 X74599 Helianthus annuus mRNA for phytoene synthase (psy Synechococcus sp. Icy gene for lycopene cyclase gene) X81787 A3O8385 N. tabacum CrtL-1 gene encoding lycopene cyclase 65 Helianthus annuus mRNA for phytoene synthase (psy X86221, C. annuum gene) US 6,969,595 B2 25 26 The most preferred Source of genes for the lower caro TABLE 3-continued tenoid biosynthetic pathway in the present invention are from a variety of sources. The “ispA” gene (SEQID NO:19) Sources of Genes Encoding the Lower Carotenoid is native to Methylomonas 16a, as the organism produces Biosynthetic Pathway respiratory quinones and a 30-carbon carotenoid via the Gene Genbank Accession Number and Source Organism 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. However, Methylomonas does not synthesize the desired D58420, Agrobacterium aurantiacum L23424 40-carbon carotenoids. FPP is the end-product of the MEP Lycopersicon esculentum phytoene synthase (PSY2) pathway in Methylomonas 16A and is Subsequently con mRNA, complete cds verted to its natural 30-carbon carotenoid by the action of the L25812, Arabidopsis L37405, Streptomyces griseus geranylgeranyl SqS, crtN1 and crtN2 gene products. AS a native gene to the pyrophosphate synthase (crtB), phytoene desaturase preferred host organism, the ispA gene (SEQ ID NO:19) is (cftE) and phytoene synthase (cftI) genes, complete the most preferred Source of the gene for the present cds invention. M38424 15 Pantoea agglomerans phytoene synthase (crtE) The majority of the most preferred Source of crt genes are gene, complete cds primarily from Panteoa Stewartii. Sequences of these pre M87280, Pantoea agglomerans ferred genes are presented as the following SEQ ID num S71770, carotenoid gene cluster bers: the crtE gene (SEQ ID NO:25), the crtX gene (SEQ ID U32636 Zea mays phytoene synthase (Y1) gene, complete NO:27), crtY (SEQ ID NO:29), the crtI gene (SEQ ID cds NO:31), the crtB gene (SEQ ID NO:33) and the crtz gene U62808, Flavobacterium ATCC21588 (SEQ ID NO:35). Additionally, the crt0 gene isolated from U87626, Rubrivivax gelatinosus Rhodococcus erythropolis AN12 and presented as SEQ ID U91900, Dunaiella bardawill NO:37 is preferred in combination with other genes for the X52291, Rhodobacter capsulatus X60441, L. esculentum GTom5 gene for phytoene present invention. synthase 25 By using various combinations of the genes presented in X63873 Table 3 and the preferred genes of the present invention, Synechococcus PCC7942 pys gene for phytoene innumerable different carotenoids and carotenoid deriva synthase X68O17 tives could be made using the methods of the present C. annuum psy1 mRNA for phytoene synthase invention, provided sufficient sources of IPP are available in X69172 the host organism. For example, the gene cluster crtEXYIB Synechocystis sp. pys gene for phytoene synthase X78814, N. pseudonarcissus enables the production of B-carotene. Addition of the crt Z. crtz, D58420, Agrobacterium aurantiacum to crtEXYIB enables the production of zeaxanthin, while the D58422, Alcaligenes sp. crt EXYIBZO cluster leads to production of astaxanthin and D90087, E. uredovora canthaxanthin. M87280, Pantoea agglomerans 35 It is envisioned that useful products of the present inven U62808, Flavobacterium ATCC21588 Y15112, Paracoccus marcusii tion will include any carotenoid compound as defined herein crtW AF218415, Bradyrhizobium sp. ORS278 including but not limited to antheraxanthin, adonixanthin, D45881, Haematococcus pluvialis astaxanthin, canthaxanthin, capSorubrin, B-cryptoxanthin D58420, Agrobacterium aurantiacum alpha-carote ne, beta-carote ne, epsilon-carote ne, D58422, Alcaligenes sp. X86782, H. pluvialis 40 echine none, gamma-caroteine, Zeta-carote ne, alpha Y15112, Paracoccus marcusii cryptoXanthin, diatoxanthin, 7,8-didehydroastaxanthin, crtO X86782, H. pluvialis fucoxanthin, fucoxanthinol, isorenieratene, lactucaxanthin, Y15112, Paracoccus marcusii lute in, lycope ne, neo Xanthin, neuro Spor ene, crtU AF047490, Zea mays AF121947, Arabidopsis thaliana hydroxyneurosporene, peridinin, phytoene, rhodopin, AF139916, Brevibacterium linens 45 rhodopin glucoside, Siphona Xanthin, Spheroidene, AF195507, Lycopersicon esculentum Spheroidenone, Spirilloxanthin, uriolide, uriolide acetate, AF272737, Streptomyces griseus strain IFO13350 Violaxanthin, ZeaXanthin-?3-diglucoside, and ZeaXanthin. AF372617, Citrus x paradisi AJ133724, Mycobacterium aurum Additionally the invention encompasses derivitization of AJ224683, Narcissus pseudonarcissus these molecules to create hydroxy-, methoxy-, OXO-, epoxy-, D26095 and U38550, Anabaena sp. 50 carboxy-, or aldehydic functional groups, or glycoside X89897, C. annuum esters, or Sulfates. Y15115, Anabaena PCC7210 crtO gene crtA AJO10302, Rhodobactersphaeroides Construction of Recombinant C1 Metabolizing Microorgan (spheroidene Z11165 and X52291, Rhodobacter capsulatus isms monooxygenase) Methods for introduction of genes encoding the appro crtC AB034704, Rubrivivax gelatinosus 55 priate upper isoprene pathway genes or lower carotenoid AF195122 and AJO10302, Rhodobacter sphaeroides biosynthetic pathway genes into a Suitable C1 metabolizing AF287480, Chlorobium tepidum U73944, Rubrivivax gelatinosus host are common. Microbial expression Systems and expres X52291 and Z11165, Rhodobacter capsulatus Sion vectors containing regulatory Sequences Suitable for Z21955, M. xanthus expression of heterologus genes in C1 metabolizing hosts crtD AJO10302 and X63204, Rhodobacter sphaeroides 60 are known. Any of these could be used to construct chimeric (carotenoid 3, U73944, Rubrivivax gelatinosus genes for expression of any of the above mentioned caro 4-desaturase X52291 and Z11165, Rhodobacter capsulatus tenoid biosynthetic genes. These chimeric genes could then crtF AB034704, Rubrivivax gelatinosus (1-OH-carotenoid AF288602, Chloroflexus aurantiacus be introduced into appropriate hosts via transformation to methylase) AJO10302, Rhodobactersphaeroides provide high level expression of the enzymes. X52291 and Z11165, Rhodobacter capsulatus 65 Vectors or cassettes useful for the transformation of Suitable host cells are available. For example Several classes of promoters may be used for the expression of genes US 6,969,595 B2 27 28 encoding the present carotenoid biosynthetic genes in C1 its gene expression by preventing the accumulation of metabolizers including, but not limited to endogenous pro mRNA which encodes the protein of interest. The person moterS Such as the deoxy-xylulose phosphate Synthase or skilled in the art will know that Special considerations are methanol dehydrogenase operon promoter (Springer et al. asSociated with the use of antisense technologies in order to (1998) FEMS Microbiol Lett 160:119-124), the promoter reduce expression of particular genes. For example, the for polyhydroxyalkanoic acid synthesis (Foellner et al. Appl. proper level of expression of antisense genes may require Microbiol. Biotechnol. (1993) 40:284–291), or promoters the use of different chimeric genes utilizing different regu identified from native plasmids in methylotrophs (EP latory elements known to the skilled artisan. 296484). In addition to these native promoters, non-native Although targeted gene disruption and antisense technol promoters may also be used, as for example the promoter for ogy offer effective means of down regulating genes where the lactose operon Plac (Toyama et al. Microbiology (1997) the Sequence is known, other leSS Specific methodologies 143:595-602; EP 62971) or a hybrid promoter such as Ptrc have been developed that are not sequence based. For (Brosius et al. (1984) Gene 27:161-172). Similarly, promot example, cells may be exposed to a UV radiation and then erS associated with antibiotic resistance, e.g. kanamycin Screened for the desired phenotype. Mutagenesis with (Springer et al. (1998) FEMS Microbiol Lett 160:119–124; 15 chemical agents is also effective for generating mutants and Ueda et al. Appl. Environ. Microbiol. (1991)57:924-926) or commonly used Substances include chemicals that affect tetracycline (U.S. Pat. No. 4,824.786), are also suitable. non-replicating DNA such as HNO and NH-OH, as well as Once the Specific regulatory element is Selected, the agents that affect replicating DNA Such as acridine dyes, promoter-gene cassette can be introduced into a C1 metabo notable for causing frameshift mutations. Specific methods lizer on a plasmid containing either a replicon for episomal for creating mutants using radiation or chemical agents are expression (Brenner et al. Antonie Van Leeuwenhoek (1991) well documented in the art. See for example Thomas D. 60:43–48; Ueda et al. Appl. Environ. Microbiol. (1991) Brock in Biotechnology: A Textbook of Industrial 57.924-926) or homologous regions for chromosomal inte Microbiology, Second Edition (1989) Sinauer Associates, gration (Naumov et al. Mol. Genet. Mikrobiol. Virusol. Inc., Sunderland, Mass., or Deshpande, Mukund V., Appl. (1986) 11:44–48). 25 Biochem. Biotechnol., 36, 227, (1992). Typically, the vector or cassette contains Sequences direct Another non-specific method of gene disruption is the use ing transcription and translation of the relevant gene, a of transpoSoable elements or transposons. Transposons are Selectable marker, and Sequences allowing autonomous rep genetic elements that insert randomly in DNA but can be lication or chromosomal integration. Suitable vectors com latter retrieved on the basis of Sequence to determine where prise a region 5' of the gene which harbors transcriptional the insertion has occurred. Both in vivo and in vitro trans initiation controls and a region 3' of the DNA fragment position methods are known. Both methods involve the use which controls transcriptional termination. It is most pre of a transposable element in combination with a transposase ferred when both control regions are derived from genes enzyme. When the transposable element or transposon, is homologous to the transformed host cell, although it is to be contacted with a nucleic acid fragment in the presence of the understood that Such control regions need not be derived 35 transposase, the transposable element will randomly insert from the genes native to the Specific Species chosen as a into the nucleic acid fragment. The technique is useful for production host. random mutagenesis and for gene isolation, Since the dis Where accumulation of a specific carotenoid is desired it rupted gene may be identified on the basis of the Sequence may be necessary to reduce or eliminate the expression of of the transposable element. Kits for in vitro transposition certain genes in the target pathway or in competing path 40 are commercially available (see for example The Primer ways that may serve as competing Sinks for energy or Island Transposition Kit, available from Perkin Elmer carbon. Alternatively, it may be useful to over-express Applied BioSystems, Branchburg, N.J., based upon the yeast various genes upstream of desired carotenoid intermediates Ty1 element; The Genome Priming System, available from to enhance production. New England Biolabs, Beverly, Mass.; based upon the Methods of up-regulating and down-regulating genes for 45 bacterial transposon TnT.; and the EZ:TN Transposon Inser this purpose have been explored. Where Sequence of the tion Systems, available from Epicentre Technologies, gene to be disrupted is known, one of the most effective Madison, Wis., based upon the Tn5 bacterial transposable methods gene down regulation is targeted gene disruption element. where foreign DNA is inserted into a structural gene So as to In the context of the present invention the disruption of disrupt transcription. This can be effected by the creation of 50 certain genes in the terpenoid pathway may enhance the genetic cassettes comprising the DNA to be inserted (often accumulation of Specific carotenoids however, the decision a genetic marker) flanked by Sequence having a high degree of which genes to disrupt would need to be determined on of homology to a portion of the gene to be disrupted. an empirical basis. Candidate genes may include one or Introduction of the cassette into the host cell results in more of the prenyltransferase genes which, as described insertion of the foreign DNA into the structural gene via the 55 earlier, which catalyze the Successive condensation of iso native DNA replication mechanisms of the cell. (See for pentenyl diphosphate resulting in the formation of prenyl example Hamilton et al. (1989) J. Bacteriol. diphosphates of various chain lengths (multiples of C-5 171:4617-4622, Balbas et al. (1993) Gene 136:211-213, isoprene units). Other candidate genes for disruption would Gueldener et al. (1996) Nucleic Acids Res. 24:2519-2524, include any of those which encode proteins acting upon the and Smith et al. (1996) Methods Mol. Cell. Biol. 5:270–277.) 60 terpenoid backbone prenyl diphosphates. AntiSense technology is another method of down regul Similarly, over-expression of certain genes upstream of lating genes where the Sequence of the target gene is known. the desired product will be expected to have the effect of To accomplish this, a nucleic acid Segment from the desired increasing the production of that product. For example, may gene is cloned and operably linked to a promoter Such that of the genes in the upper isoprenoid pathway (D-1- the anti-sense strand of RNA will be transcribed. This 65 deoxyxylulose-5-phosphate Synthase (DXS), D-1- construct is then introduced into the host cell and the deoxyxylulose-5-phosphate reductoisomerase (DXr), antisense strand of RNA is produced. Antisense RNA inhib 2C-methyl-d-erythritol cytidylyltransferase (IspD), US 6,969,595 B2 29 30 4-diphosphocytidyl-2-C-methylerythritol kinase (IspE), cell growth or end product concentration. For example, one 2C-methyl-d-erythritol 2,4-cyclodiphosphate Synthase method will maintain a limiting nutrient Such as the carbon (IspF), CTP synthase (PyrC) and lytB) could be expressed Source or nitrogen level at a fixed rate and allow all other on multicopy plasmids, or under the influence of Strong parameters to moderate. In other Systems a number of non-native promoters. In this fashion the levels of desired factors affecting growth can be altered continuously while carotenoids may be enhanced. the cell concentration, measured by media turbidity, is kept Industrial Production of Carotenoids constant. Continuous Systems Strive to maintain Steady State Where commercial production of carotenoid compounds growth conditions and thus the cell loSS due to media being is desired according to the present invention, a variety of drawn off must be balanced against the cell growth rate in culture methodologies may be applied. For example, large the culture. Methods of modulating nutrients and growth Scale production of a Specific gene product, Over-expressed factors for continuous culture processes as well as tech from a recombinant microbial host may be produced by both niques for maximizing the rate of product formation are well batch or continuous culture methodologies. known in the art of industrial microbiology and a variety of A classical batch culturing method is a closed System methods are detailed by Brock, Supra. where the composition of the media is Set at the beginning 15 Fermentation media in the present invention must contain of the culture and not Subject to artificial alterations during Suitable carbon Substrates for C1 metabolizing organisms. the culturing process. Thus, at the beginning of the culturing Suitable Substrates may include but are not limited to process the media is inoculated with the desired organism or one-carbon Substrates Such as carbon dioxide, methane or organisms and growth or metabolic activity is permitted to methanol for which metabolic conversion into key bio occur adding nothing to the System. Typically, however, a chemical intermediates has been demonstrated. In addition “batch” culture is batch with respect to the addition of to one and two carbon Substrates, methylotrophic organisms carbon Source and attempts are often made at controlling are also known to utilize a number of other carbon contain factorS Such as pH and oxygen concentration. In batch ing compounds Such as methylamine, glucosamine and a Systems the metabolite and biomass compositions of the variety of amino acids for metabolic activity. For example, System change constantly up to the time the culture is 25 methylotrophic yeast are known to utilize the carbon from terminated. Within batch cultures cells moderate through a methylamine to form trehalose or glycerol (Bellion et al., Static lag phase to a high growth log phase and finally to a Microb. Growth C1 Compa, Int. Symp.), 7th (1993), Stationary phase where growth rate is diminished or halted. 415-32. Editor(s): Murrell, J. Collin; Kelly, Don P. Pub Ifuntreated, cells in the Stationary phase will eventually die. lisher: Intercept, Andover, UK). Similarly, various species of Cells in log phase are often responsible for the bulk of Candida will metabolize alanine or oleic acid (Sulter et al., production of end product or intermediate in Some Systems. Arch. Microbiol. 153:485-489 (1990)). Hence it is contem Stationary or post-exponential phase production can be plated that the source of carbon utilized in the present obtained in other Systems. invention may encompass a wide variety of carbon contain A variation on the standard batch system is the Fed-Batch ing substrates and will only be limited by the choice of System. Fed-Batch culture processes are also Suitable in the 35 organism. present invention and comprise a typical batch System with the exception that the Substrate is added in increments as the EXAMPLES culture progresses. Fed-Batch Systems are useful when The present invention is further defined in the following catabolite repression is apt to inhibit the metabolism of the Examples. It should be understood that these Examples, cells and where it is desirable to have limited amounts of 40 while indicating preferred embodiments of the invention, are Substrate in the media. Measurement of the actual Substrate given by way of illustration only. From the above discussion concentration in Fed-Batch systems is difficult and is there and these Examples, one skilled in the art can ascertain the fore estimated on the basis of the changes of measurable essential characteristics of this invention, and without factorS Such as pH, dissolved oxygen and the partial pressure departing from the Spirit and Scope thereof, can make of waste gases Such as CO2. Batch and Fed-Batch culturing 45 various changes and modifications of the invention to adapt methods are common and well known in the art and it to various usages and conditions. examples may be found in Thomas D. Brock in Biotech General Methods nology: A Textbook of Industrial Microbiology, Second Standard recombinant DNA and molecular cloning tech Edition (1989) Sinauer Associates, Inc., Sunderland, Mass., niques used in the Examples are well known in the art and or Deshpande, Mukund V., Appl. Biochem. Biotechnol., 36, 50 are described by Sambrook, J., Fritsch, E. F. and Maniatis, 227, (1992), herein incorporated by reference. T. Molecular Cloning. A Laboratory Manual; Cold Spring Commercial production of carotenoids using C1 metabo Harbor Laboratory Press: Cold Spring Harbor, (1989) lizers may also be accomplished with a continuous culture. (Maniatis) and by T. J. Silhavy, M. L. Bennan, and L. W. A continuous culture is an open System where a defined Enquist, Experiments with Gene Fusions, Cold Spring Har culture media is added continuously to a bioreactor and an 55 bor Laboratory, Cold Spring Harbor, N.Y. (1984) and by equal amount of conditioned media is removed Simulta Ausubel, F. M. et al., Current Protocols in Molecular neously for processing. Continuous cultures generally main Biology, pub. by Greene Publishing Assoc. and Wiley tain the cells at a constant high liquid phase density where Interscience (1987). cells are primarily in log phase growth. Alternatively con Materials and methods Suitable for the maintenance and tinuous culture may be practiced with immobilized cells 60 growth of bacterial cultures are well known in the art. where carbon and nutrients are continuously added, and Techniques Suitable for use in the following examples may valuable products, by-products or waste products are con be found as set out in Manual of Methods for General tinuously removed from the cell mass. Cell immobilization Bacteriology (Phillipp Gerhardt, R. G. E. Murray, Ralph N. may be performed using a wide range of Solid Supports Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg composed of natural and/or Synthetic materials. 65 and G. Briggs Phillips, eds), American Society for Continuous or Semi-continuous culture allows for the Microbiology, Washington, D.C. (1994)) or by Thomas D. modulation of one factor or any number of factors that affect Brock in Biotechnology: A Textbook of Industrial US 6,969,595 B2 31 32 Microbiology, Second Edition, Sinauer ASSociates, Inc., Sunderland, Mass. (1989). All reagents, restriction enzymes TABLE 5-continued and materials used for the growth and maintenance of bacterial cells were obtained from Aldrich Chemicals Nitrate liquid medium (BTZ-3)" (Milwaukee, Wis.), DIFCO Laboratories (Detroit, Mich.), GIBCO/BRL (Gaithersburg, Md.), or Sigma Chemical Com MW Conc. (mM) g per L. NaSO 142.04 3.52 0.5 pany (St. Louis, Mo.) unless otherwise specified. MgCl2 x 6H2O 2O3.3 O.98 O.2 Manipulations of genetic Sequences were accomplished CaCl2 x 2HO 147.02 O.68 O1 using the Suite of programs available from the Genetics 1 M HEPES (pH 7) 238.3 50 mL. Computer Group Inc. (Wisconsin Package Version 9.0, Solution 1 10 mL. Genetics Computer Group (GCG), Madison, Wis.). Where **Dissolve in 900 mL HO. Adjust to pH = 7, and add HO to give 1 L. the GCG program "Pileup' was used the gap creation For agar plates: Add 15 g of agarose in 1 L of medium, autoclave, let cool default value of 12, and the gap extension default value of down to 50 C., mix, and pour plates. 4 were used. Where the CGC “Gap' or “Bestfit' programs Assessment of Microbial Growth and Conditions for Har were used the default gap creation penalty of 50 and the 15 vesting Cells default gap extension penalty of 3 were used. In any case Cells obtained for experimental purposes were allowed to where GCG program parameters were not prompted for, in grow to maximum optical density (O.D. 660-1.0). Har these or any other GCG program, default values were used. vested cells were obtained by centrifugation in a Sorval The meaning of abbreviations is as follows: “h” means RC-5B centrifuge using a SS-34 rotor at 6000 rpm for 20 hour(s), “min' means minute(s), “Sec’ means Second(s), “d” min. These cell pellets were resuspended in 50 mM HEPES means day(s), “mL” means milliliters, “L” means liters. buffer pH 7. These cell suspensions are referred to as Microbial Cultivation, Preparation of Cell Suspensions, and washed, resting cells. Associated Analyses for Methylomonas 16a Microbial growth was assessed by measuring the optical The following conditions were used throughout the density of the culture at 660 nm in an Ultrospec 2000 experimental Examples for treatment of Methylomonas 16a, 25 UV/Vis spectrophotometer (Pharmacia Biotech, Cambridge unless conditions were specifically specified otherwise. England) using a 1 cm light path cuvet. Alternatively micro Methylomonas 16a is typically grown in Serum Stoppered bial growth was assessed by harvesting cells from the culture medium by centrifugation as described above and, Wheaton bottles (Wheaton Scientific, Wheaton Ill.) using a resuspending the cells in distilled water with a Second gas/liquid ratio of at least 8:1 (i.e. 20 mL of Nitrate liquid centrifugation to remove medium Salts. The washed cells “BTZ-3” media of 160 mL total volume). The standard gas were then dried at 105 C. overnight in a drying oven for dry phase for cultivation contained 25% methane in air. These Weight determination. conditions comprise growth conditions and the cells are Methane concentration was determined as described by referred to as growing cells. In all cases, the cultures were Emptage et al. (1997 Env Sci. Technol. 31:732–734), hereby grown at 30° C. with constant shaking in a Lab-Line rotary incorporated by reference. Shaker unless otherwise Specified. 35 Nitrate and Nitrite Assays Nitrate Medium for Methylomonas 16A 1 mL Samples of cell culture were taken and filtered Nitrate liquid medium, also referred to herein as “defined through a 0.2 micron Acrodisc filter to remove cells. The medium' or “BTZ-3’ medium was comprised of various filtrate from this step contains the nitrite or nitrate to be salts mixed with Solution 1 as indicated below (Tables 4 and analyzed. The analysis was performed on a DioneX ion 5) or where specified the nitrate was replaced with 15 mM 40 chromatograph 500 system (Dionex, Sunnyvale Calif.) with ammonium chloride. Solution 1 provides the comosition for an AS3500 autosampler. The column used was a 4 mm 100 fold concentrated Stock Solution of trace minerals. Ion-Pac AS11-HC separation column with an AG-AC guard column and an ATC trap column. All columns are provided TABLE 4 by Dionex. 45 The mobile phase was a potassium hydroxide gradient Solution 1* from 0 to 50 mM potassium hydroxide over a 12 min time interval. Cell temperature was 35 C. with a flow rate of 1 MW Conc. (mM) g per L. mL/min. Nitriloacetic acid 1911 66.9 12.8 HPLC Analysis of Carotenoid Content CuCl2 x 2H2O 170.48 O.15 O.O254 50 Cell pellets were extracted with 1 ml acetone by vortexing FeCl x 4H2O 198.81 1.5 O.3 for 1 min and intermittent vortexing over the next 30 min. MnCl2 x 4HO 197.91 0.5 O.1 Cell debris was removed by centrifugation at 14,000xg for CoCl2 x 6H2O 237.9 1.31 O.312 10 min and the Supernatants was collected and passed ZnCl2 136.29 O.73 O.1 HBO 61.83 O16 O.O1 through a 0.45uM filter. A Beckman System Gold(R) HPLC NaMoO x 2HO 241.95 O.04 O.O1 with Beckman Gold Nouveau Software (Columbia, Md.) NiCl, x 6HO 237.7 O.77 O.184 was used for the study. The crude extraction (0.1 mL) was loaded onto a 125x4 mm RP8 (5 um particles) column with * Mix the gram amounts designated above in 900 mL of HO, adjust to pH corresponding guard column (Hewlett-Packard, San = 7, and add HO to an end volume of 1 L. Keep refrigerated. Fernando, Calif.). The flow rate was 1 mL/min, while the solvent program used was: 0-11.5 min 40% water/60% TABLE 5 60 methanol; 11.5–20 min 100% methanol; 20–30 min 40% water/60% methanol. The spectral data was collected by a Nitrate liquid medium (BTZ-3)" Beckman photodiode array detector (model 168). MW Conc. (mM) g per L. Example 1 NaNO 84.99 1O O.85 65 Isolation and Sequencing of Methylomonas 16a KHPO 136.09 3.67 0.5 The original environmental Sample containing the isolate was obtained from pond Sediment. The pond Sediment was US 6,969,595 B2 33 34 inoculated directly into defined medium with ammonium as (Fleischmann, R. et al., Whole-Genome Random sequenc nitrogen Source under 25% methane in air. Methane was the ing and assembly of Haemophilus influenzae Rd Science Sole Source of carbon and energy. Growth was followed until 269(5223):496-512 (1995)). Sequence was generated on an the optical density at 660 nm was stable, whereupon the ABI Automatic Sequencer using dye terminator technology culture was transferred to fresh medium Such that a 1:100 (U.S. Pat. No. 5,366,860; EP 272,007) using a combination dilution was achieved. After 3 Successive transfers with of Vector and insert-specific primerS. Sequence editing was methane as Sole carbon and energy Source, the culture was performed in either DNAStar (DNA Star Inc.) or the Wis plated onto growth agar with ammonium as nitrogen Source consin GCG program (Wisconsin Package Version 9.0, and incubated under 25% methane in air. Many methan otrophic bacterial Species were isolated in this manner. Genetics Computer Group (GCG), Madison, Wis.) and the However, Methylomonas 16a was Selected as the organism CONSED package (version 7.0). All sequences represent to Study due to its rapid growth of colonies, large colony coverage at least two times in both directions. size, ability to grow on minimal media, and pink pigmen tation indicative of an active biosynthetic pathway for Example 2 carotenoids. 15 Genomic DNA was isolated from Methylomonas 16a Identification and Characterization of Bacterial according to Standard protocols. Genomic DNA and library Genes from Methylomonas construction were prepared according to published protocols (Fraser et al., The Minimal Gene Complement of Myco All Sequences from Example 1 were identified by con plasma genitalium, Science 270 (5235):397–403 (1995)). A ducting BLAST (Basic Local Alignment Search Tool; cell pellet was reSuspended in a Solution containing 100 mM Altschul, S. F., et al., (1993).J. Mol. Biol. 215:403-410; see Na-EDTA pH 8.0, 10 mM Tris-HCl pH 8.0, 400 mM NaCl, also www.ncbi.nim.nih.gov/BLAST/) searches for similar and 50 mM MgCl. ity to sequences contained in the BLAST “nr” database Genomic DNA preparation After resuspension, the cells (comprising all non-redundant GenBank CDS translations, were gently lysed in 10% SDS, and incubated for 30 min at 25 Sequences derived from the 3-dimensional Structure 55 C. After incubation at room temperature, proteinase K Brookhaven Protein Data Bank, the SWISS-PROT protein was added to 100 tug/mL and incubated at 37 C. until the sequence database, EMBL, and DDBJ databases). The suspension was clear. DNA was extracted twice with Tris Sequences were analyzed for Similarity to all publicly avail equilibrated phenol and twice with chloroform. DNA was able DNA sequences contained in the “nr” database using precipitated in 70% ethanol and resuspended in a Solution the BLASTN algorithm provided by the National Center for containing 10 mM Tris-HCl and 1 mM Na-EDTA (TE), pH Biotechnology Information (NCBI). The DNA sequences 7.5. The DNA solution was treated with a mix of RNAases, were translated in all reading frames and compared for then extracted twice with Tris-equilibrated phenol and twice Similarity to all publicly available protein Sequences con with chloroform. This was followed by precipitation in tained in the “nr” database using the BLASTX algorithm ethanol and resuspension in TE. 35 (Gish, W. and States, D. J. (1993) Nature Genetics Library construction 200 to 500 lug of chromosomal DNA 3:266-272) provided by the NCBI. All comparisons were was resuspended in a solution of 300 mMSodium acetate, 10 done using either the BLASTNnr or BLASTXnr algorithm. mM Tris-HCl, 1 mM Na-EDTA, and 30% glycerol, and The results of these BLAST comparisons are given below sheared at 12 psi for 60 sec in an Aeromist Downdraft 40 in Table 6 for many critical genes of the present invention. Nebulizer chamber (IBI Medical products, Chicago, Ill.). Table 6 Summarizes the sequence to which each Methylomo The DNA was precipitated, resuspended and treated with nas gene has the most similarity (presented as % Similarities, Bal31 nuclease. After size fractionation, a fraction (2.0 kb, % identities, and expectation values). The table displays data or 5.0 kb) was excised and cleaned, and a two-step ligation based on the BLASTXnr algorithm with values reported in procedure was used to produce a high titer library with 45 expect values. The Expect value estimates the Statistical greater than 99% single inserts. Significance of the match, Specifying the number of matches, Sequencing A Shotgun Sequencing Strategy approach was with a given Score, that are expected in a Search of a database adopted for the Sequencing of the whole microbial genome of this size absolutely by chance.

TABLE 6 Identification of Critical Methylomonas Genes Based on Sequence Homology % Gene SEO ID % Similarity Name Similarity Identified SEQ ID peptide Identity b E-value Citation Phosphofructokinase Phosphofructokinase 1. 2 63% 83%, 1.7e-97 Ladror et al., J. Biol. Chem. 266, pyrophosphate pyrophosphate 16550-16555 (1991) dependent dependent gi150931gbAAA25 675.1(M67447) KHG/KDPG (AL352972) 3 4 59% 72%. 1e-64 Redenbach et al., Mol. Microbiol. 21 KHG/KDPG aldolase (1), 77-96 (1996) Streptomyces coelicolor dxs 1-deoxyxylulose-5- 5 6 60% 86% 5.7e-149 Lois et al., Proc. Natl. Acad. Sci. phosphate synthase USA. 95 (5), 2105-2110 (1998) (E. coli) US 6,969,595 B2 35 36

TABLE 6-continued Identification of Critical Methylomonas Genes Based on Sequence Homology % Gene SEO ID % Similarity Name Similarity Identified SEQ ID peptide Identity b E-value Citation dXr 1-deoxy-d-xylulose 7 8 55% 78% 3.3e-74 Takahashi et al., Proc. Natl. Acad. 5-phosphate USA95:9879–9884 (1998) reductoisomerase (E. coli) ygbPfispD 2C-methyl-d- 9 1O 52% 74%, 7.7e-36 Rohdich et al., Proc Natl Acad Sci erythrito USA 1999 Oct 12:96(21):11758-63 cytidylyl ransferase (E. coli) ychB/IspE 4-diphosphocytidyl-2- 11 12 50% 73% 8.8e-49 Luttgen et al., Proc Natl Acad Sci C-methylerythritol USA 2000 Feb 1:97(3):1062–7. kinase (E. coli) ygbB/ispF 2C-methyl-d- 13 14 69% 84%, 1.6e-36 Herz et al., Proc Natl Acad Sci US erythritol 2,4- A 2000 Mar 14:97(6):2486-90 cyclodiphosphate synthase (E. coli) pyrCi CTP syn hase 15 16 67% 89% 2.4e-141 Weng. et al., J. Biol. Chem. (E. coli) 261:5568-5574 (1986) lytB Acinetobacter sp 17 18 65 87 3.4e–75 Genbanki G.I. 5915671 BD413 Putative penicillin binding protein lspA Geranyltranstransfer 19 2O 57% 78%, 7.8e-56 Ohto,et al., Plant Mol. Biol. 40 (2), ase (also farnesyl 307-321 (1999) diphosphate synthase) (Synechococcus elongatus) crtN1 diapophytoene 21 22 34% 72% 4e-66 Xiong, et al., Proc. Natl. Acad. Sci. dehydrogenase U.S.A. 95 (25), 14851–14856 (1998) CrtN-copy 1 (Heliobacillus mobilis) crtN2 Diapophytoene 23 24 49% 78%. 13e-76 Genbank #: X97985 dehydrogenase CrtN-copy 2 (Staphylococcus aureus)

Example 3 the samples onto coated glass slides (Telechem, Sunnyvale, Calif.). Each PCR product was arrayed in duplicate on each Microarray for Gene Expression in Methylomonas slide. After cross-linking by UV light, the slides were stored 16a 45 under Vacuum in a desiccator at room temperature. RNA Isolation. Methylomonas 16a was cultured in a All bacterial ORFs of Methylomonas were prepared for defined medium with ammonium or nitrate (10 mM) as a DNA microarray. The following Example presents the spe nitrogen Source under 25% methane in air. Samples of the cific protocols utilized for microarray analysis. minimal medium culture were harvested when the O.D. Amplification of DNA regions for the construction of 50 reached 0.3 at Asoo (exponential phase). Cell cultures were DNA microarray. harvested quickly and ruptured in RLT buffer (Qiagen Specific primer pairs were used to amplify each protein RNeasy Mini Kit, Valencia, Calif.) with a beads-beater specifying ORF of Methylomonas sp. strain 16a. Genomic (Biol(01, Vista, Calif.). Debris was pelleted by centrifuga DNA (10-30 ng) was used as the template. The PCR tion for 3 min at 14,000xg at 4 C. RNA isolation was reactions were performed in the presence of HotStart Taq TM 55 completed using the protocol Supplied with this kit. After DNA polymerase (Qiagen, Valencia, Calif.) and dNTPs on-column DNAase treatment, the RNA product was eluted (Gibco BRL Life Science Technologies, Gaithersberg, Md.). with 50-100 lull RNAase-free water. RNA preparations were Thirty-five cycles of denaturation at 95 C. for 30 sec, stored frozen at either -20 or -80 C. annealing at 55 C. for 30 Sec, and polymerization at 72 C. Synthesis of fluorescent cDNA from total RNA. RNA for 2 min were conducted. The quality of PCR reactions was 60 Samples (7 to 15 lug) and random hexamer primers (6 ug; checked with electrophresis in a 1% argarose gel. The DNA Gibco BRL, Gaithersburg, Md.) were diluted with RNAase samples were purified by the high-throughput PCR purifi free water to a volume of 25 ul. The sample was denatured cation kit from Qiagen. at 70° C. for 10 min and then chilled on ice for 30 sec. After Arraying amplified ORFs. Before arraying, an equal Vol adding 14 till of labeling mixture, the annealing was accom ume of DMSO (10 ul) and DNA (10 uD) sample was mixed 65 plished by incubation at room temperature for 10 min. The in 384-well microtiter plates. A generation II DNA spotter labeling mixture contained 8 till of 5x enzyme buffer, 4 till (Molecular Dynamics, Sunnyvale, Calif.) was used to array DTT (0.1M), and 2 ul of 20x dye mixture. The dye mixture US 6,969,595 B2 37 38 consisted of 2 mM of each dATP, dGTP, and dTTP, 1 mM Cy-5, while the total RNA was labeled with reverse tran dCTP, and 1 mM of Cy3-dCTP or Cy5-dCTP. After adding Scriptase and Cy-3. After hybridization, the Signal intensities 1 to 1.5 till of SuperScript II reverse transcriptase (200 of both Cy-3 and Cy-5 for each spot in the array were units/mL, Life Technologies Inc., Gaithersberg, Md.), cDNA quantified. The intensity ratio of Cy-3 and Cy-5 was then synthesis was allowed to proceed at 42 C. for 2 hr. The 5 used to calculate the fraction of each transcript (as a RNA was removed by adding 2 ul NaOH (2.5 N) to the percentage), according to the following formula: (generatio/ reaction. After 10 min of incubation at 37 C., the pH was sum of all ratio)x100. The value obtained reflects the adjusted with 10 ul of HEPES (2 M). The labeled cDNA relative abundance of mRNA of an individual gene. was then purified with a PCR purification kit (Qiagen, Accordingly, transcriptional activity of all the genes repre Valencia, Calif.). Labeling efficiency was monitored using Sented by the array can be ranked based on its relative either Asso for Cy3 incorporation, or Aso for Cy5. mRNA abundance in a descending order. The numbers in Fluorescent labeling of genomic DNA. Genomic DNA FIG.2 next to each Step indicate the relative expression level was nebulized to approximately 2 kb pair fragments. of that enzyme. For example, mRNA abundance for the Genomic DNA (0.5 to 1 lug) was mixed with 6 ug of random methane monooxygenase was the most highly expressed hexamers primers (Gibco BRL Life Science Technologies, 15 enzyme in the cell (ranked #1) because its genes had the Gaithersburg, Md.) in 15 uL of water. The mix was dena highest transcriptional activity when the organism was tured by placement in boiling water for 5 min, followed by grown with methane as the carbon source (FIG. 2). The next annealing on ice for 30 Sec before transfer to room tem most highly expressed enzyme is methanol dehydrogenase perature. Then, 2 ul 5x Buffer 2 (Gibco BRL) and 2 ul dye (ranked #2). The heXulose-monophosphate Synthase gene is mixture were added. The components of the dye mixture and one of the ten most highly expressed genes in cells grown on the labeling procedure are the Same as described above for methane. RNA labeling, except that the Klenow fragment of DNA The genes considered “diagnostic' for Entner-Douderoff polymerase 1 (5 ug?u, Gibco BRL) was used as the pathway are the 6-phosphogluconate dehydratase and the 2 enzyme. After incubation at 37 C. for 2 hr, the labeled DNA keto-3-deoxy-6-phosphogluconate aldolase. In contrast, the probe was purified using a PCR purification kit (Qiagen, 25 phosphofructokinase and fructose bisphosphate aldolase are Valencia, Calif.). “diagnostic' of the Embden-Meyerhoff sequence. Messen Hybridization and washing. Slides were first incubated ger RNA transcripts of phosphofructokinase (ranked #232) with prehybridization solution containing 3.5xSSC (Gibco and fructose bisphosphate aldolase (ranked #65) were in BRL, Gaithersberg, Md.), 0.1% SDS (Gibco BRL), 1% higher abundance than those for glucose 6 phosphate dehy bovine serum albumin (BSA, Fraction V, Sigma, St. Louis, drogenase (ranked #717), 6 phosphogluconate dehydratase Mo.). After prehybridization, hybridization solutions (ranked #763) or the 2-keto-3-deoxy-6-gluconate aldolase. (Molecular Dynamics, Sunnyvale, Calif.) containing labeled The data suggests that the Embden-Meyerhoff pathway probes were added to Slides and covered with cover Slips. enzymes are more Strongly expressed than the Entner Slides were placed in a humidified chamber in a 42 C. Douderoff pathway enzymes. This result is Surprising and incubator. After overnight hybridization, slides were initially 35 counter to existing beliefs on the central metabolism of washed for 5 min at room temperature with a washing methanotrophic bacteria (Dijkhuizen, L., et al. The physi solution containing 1XSSC, 0.1% SDS and 0.1xSSC, 0.1% ology and biochemistry of aerobic methanol-utilizing gram SDS. Slides were then washed at 65° C. for 10 min with the negative and gram-positive bacteria. In: Methane and Same Solution for three times. After Washing, the slides were Methanol Utilizers, Biotechnology Handbooks 5, 1992. Eds: dried with a Stream of nitrogen gas. 40 Colin Murrell, Howard Dalton; pp 149-157). Data Collection and Analysis. The Signal generated from Example 5 each slide was quantified with a laser Scanner (Molecular Dynamics, Sunnyvale, Calif.). The images were analyzed Direct Enzymatic Evidence for a Pyrophosphate Linked Phosphofructokinase with ArrayVision 4.0 Software (Imaging Research, Inc., 45 Ontario, Canada). The raw fluorescent intensity for each This example shows the evidence for the presence of a Spot was adjusted by Subtracting the background. These pyrophosphate-linked phosphofructokinase enzyme in the readings were exported to a spreadsheet for further analysis. current Strain, thereby confirming the functionality of the Example 4 Embden-Meyerhoff pathway in the present Methylomonas 50 Strain. Comparison of Gene Expression Levels in the Phosphofructokinase activity was shown to be present in Entner Douderoff Pathway as Compared with the Methylomonas 16a by using the coupled enzyme assay Embeden Meyerof Pathway described below. Assay conditions are given in Table 7 below. This Example presents microarray evidence demonstrat 55 Coupled ASSay Reactions ing the use of the Embden-Meyerhoff pathway for carbon Phosphofructokinase reaction is measured by a coupled metabolism in the 16a Strain. enzyme assay. Phosphofructokinase reaction is coupled with FIG.2 shows the relative levels of expression of genes for fructose 1,6, biphosphate aldolase followed by triosephos the Entner-Douderoff pathway and the Embden-Meyerhoff phate isomerase. The enzyme activity is measured by the pathway. The relative transcriptional activity of each gene 60 disappearance of NADH. was estimated with DNA microarray as described previously Specifically, the enzyme phosphofructokinase catalyzes (Example 3; Wei, et al., J. Bact. 183:545-556 (2001)). the key reaction converting fructose 6 phosphate and pyro Specifically, a single DNA microarray containing 4000 phosphate to fructose 1.6 bisphosphate and orthophosphate. ORFs (open reading frames) of Methylomonas 16a was Fructose-1,6-bisphosphate is cleave d to hybridized with probes generated from genomic DNA and 65 3-phosphoglyceraldehyde and dihydroxyacetonephosphate total RNA. The genomic DNA of 16a was labeled with the by fructose 1,6-bisphosphate aldolase. Dihydroxyacetone Klenow fragment of DNA polymerase and fluorescent dye phosphate is isomerized to 3-phosphoglyceraldehyde by US 6,969,595 B2 39 40 triosephosphate isomerase. Glycerol phosphate dehydroge phosphoryl donor for phosphofructokinase) is essentially nase plus NADH and 3-phosphoglyceraldehyde yields the ineffective in the phosphofructokinase reaction in methan alcohol glycerol-3-phosphate and NAD. Disappearance of otrophic bacteria. Only inorganic pyrophosphate was found NADH is monitored at 340 nm using spectrophotometer to Support the reaction in all methanotrophs tested. (UltraSpec 4000, Pharmacia Biotech). Secondly, not all methanotrophs contain this activity. The activity was essentially absent in Methylobacter whittenbury TABLE 7 and in MethylococcuS capsulatus. Intermediate levels of activity were found in Methylomonas clara and Methylosi Assay Protocol nuS Sporium. These data show that many methanotrophic Volume (ul) Final assay bacteria may contain a hitherto unreported phosphofructoki Stock solution per 1 mL total concentration nase activity. It may be inferred from this that methanotro Reagent (mM) reaction volume (mM) phs containing this activity have an active Embden Tris-HCl pH 7.5 1OOO 1OO 1OO Meyerhoff pathway. MgCl2.2H2O 1OO 35 3.5 NaPO7.1OHO 1OO 2O 2 15 Example 6 or ATP Fructose-6- 1OO 2O 2 phophate Cloning of Carotenoid Genes from Pantoea NADH 50 6 O.3 Stewartii Fructose 100 (units/mL) 2O 2 (units) bisphosphate Primers were designed using the Sequence from Pantoea aldolase ananatis to amplify a fragment by PCR containing a crt Triose phosphate (7.2 unitsful) 3.69 27 units cluster of genes. These Sequences included 5'-3': isomerase/glycerol (0.5 unitsful) 1.8 units phosphate dehydrogenase ATGACGGTCTGCGCAAAAAAACACG SEQ ID NO : 43 KCI 1OOO 50 50 H2O adjust to 1 mL 25 GAGAAATTATGTTGTGGATTTGGAATGC SEQ ID NO: 44 Crude extract 0-50 Chromosomal DNA was purified from Pantoea Stewati This coupled enzyme assay was further used to assay the (ATCC no. 8.199) and PfuTurbo polymerase (Stratagene, La activity in a number of other methanotrophic bacteria as Jolla, Calif.) was used in a PCR amplifcation reaction under shown below in Table 8. The data in Table 8 shows known the following conditions: 94° C., 5 min; 94° C. (1 min)-60 ATCC strains tested for phosphofructokinase activity with C. (1 min)-72 C. (10 min) for 25 cycles, and 72° C. for 10 ATP or pyrophosphate as the phosphoryl donor. These min. A single product of approximately 6.5 kb was observed organisms were classified as either a Type I or Type X following gel electrophoresis. Taq polymerase (Perkin ribulose monophosphate-utilizing Strains or a Type II Serine Elmer) was used in a ten min 72 C. reaction to add utilizer. Established literature makes these types of classi 35 additional 3' adenoside nucleotides to the fragment for fications based on the mode of carbon incorporation, TOPO cloning into pCR4-TOPO (Invitrogen, Carlsbad, morphology, 7% GC content and the presence or absence of Calif.). Following transformation to E. coli DH5C. (Life key specific enzymes in the organism. Technologies, Rockville, Md.) by electroporation, several colonies appeared to be bright yellow in color, indicating TABLE 8 40 that they were producing a carotenoid compound. Following Comparison Of Pyrophosphate Linked And ATP Linked plasmid isolation as instructed by the manufacturer using the Phosphofructokinase Activity. In Qiagen (Valencia, Calif.) miniprep kit, the plasmid contain Different Methanotrophie Bacteria ing the 6.5 kb amplified fragment was transposed with pGPS1.1 using the GPS-1 Genome Priming System kit Assimi- ATP-PFK Ppi-PFK 45 ation umol NADHI umol NADH/ (New England Biolabs, Inc., Beverly, Mass.). A number of Strain Type Pathway min/mg min/mg these transposed plasmids were Sequenced from each end of the transposon. Sequence was generated on an ABI Auto Methylomonas 16a I Ribulose O 2.8 ATCC PTA 2402 OO matic sequencer using dye terminator technology (U.S. Pat. OSlate No. 5,366,860; EP 272007) using transposon specific prim Methylomonas I Ribulose O.O1 3.5 50 erS. Sequence assembly was performed with the Sequencher agile OO program (Gene Codes Corp., Ann Arbor Mich.). ATCC 35068 OSlate Methylobacter I Ribulose O.O1 O.O25 Example 7 Whittenbury OO ATCC 51738 OSlate Methylomonas I Ribulose O O.3 55 Cloning of Rhodococcus erythropolis crtO clara OO ATCC 31226 OSlate The present example describes the isolation, Sequencing, Methylomicrobium I Ribulose O.O2 3.6 and identification of a carotenoid biosynthetic pathway gene albuS OO from Rhodococcus erythropolis AN12. ATCC 33003 OSlate Isolation and Characterization of Strain AN12 Methylococcus X Ribulose O.O1 O.O4 60 capsulatus OO Strain AN12 of Rhodococcus erythropolis was isolatd on ATCC 19069 OSlate the basis of being able to grow on aniline as the Sole Source Methylosinus II Serine O.O7 0.4 of carbon and energy. Bacteria that grew on aniline were Sporium isolated from an enrichment culture. The enrichment culture ATCC 35069 was established by inoculating 1 ml of activated sludge into 65 10 ml of S12 medium (10 mM ammonium sulfate, 50 mM Several conclusions may be drawn from the data pre potassium phosphate buffer (pH 7.0), 2 mM MgCl2, 0.7 mM sented above. First, it is clear that ATP (which is the typical CaCl, 50 uM MnCl, 1 uM FeCls, 1 uM ZnCls, 1.72 uM US 6,969,595 B2 41 42 CuSO, 2.53 uM CoCl2, 2.42 uM NaMoO, and 0.0001% bated at 55 C. for 5 h. The suspension became clear and the FeSO) in a 125 ml screw cap Erlenmeyer flask. The clear lysate was extracted with equal Volume of phenol:chlo activated sludge was obtained from a wastewater treatment roform:isoamyl alcohol (25:24:1). After centrifuging at facility. The enrichment culture was supplemented with 100 17,000 g for 20 min, the aqueous phase was carefully ppm aniline added directly to the culture medium and was removed and transferred to a new tube. Two volumes of incubated at 25 C. with reciprocal shaking. The enrichment ethanol were added and the DNA was gently spooled with a culture was maintained by adding 100 ppm of aniline every Sealed glass pasteur pipet. The DNA was dipped into a tube 2-3 days. The culture was diluted every 14 days by replacing containing 70% ethanol, then air dried. After air drying, 9.9 ml of the culture with the same volume of S12 medium. DNA was resuspended in 400 ul of TE (10 mM Tris-1 mM Bacteria that utilized aniline as a Sole Source of carbon and EDTA, pH 8) with RNaseA (100 ug/mL) and stored at 4 C. energy were isolated by spreading Samples of the enrich Library construction. 200 to 500 lug of chromosomal DNA ment culture onto S12 agar. Aniline (5 uD) was placed on the was resuspended in a solution of 300 mMSodium acetate, 10 interior of each petri dish lid. The petri dishes were sealed mM Tris-HCl, 1 mM Na-EDTA, and 30% glycerol, and with parafilm and incubated upside down at room tempera sheared at 12 psi for 60 sec in an Aeromist Downdraft ture (approximately 25° C). Representative bacterial colo 15 Nebulizer chamber (IBI Medical products, Chicago, Ill.). nies were then tested for the ability to use aniline as a Sole The DNA was precipitated, resuspended and treated with Source of carbon and energy. Colonies were transferred from Bal31 nuclease (New England Biolabs, Beverly, Mass.). the original S12 agar plates used for initial isolation to new After Size fractionation by 0.8% agarose gel electrophoresis, S12 agar plates and Supplied with aniline on the interior of a fraction (2.0 kb, or 5.0 kb) was excised, cleaned and a each petri dish lid. The petri dishes were sealed with two-step ligation procedure was used to produce a high titer parafilm and incubated upside down at room temperature library with greater than 99% single inserts. (approximately 25 C.). Sequencing. A shotgun Sequencing Strategy approach was The 16S rRNA genes of each isolate were amplified by adopted for the Sequencing of the whole microbial genome PCR and analyzed as follows. Each isolate was grown on (Fleischmann, Robert et al., Whole-Genome Random R2A agar (Difco Laboratories, Bedford, Mass.). Several 25 Sequencing and assembly of Haemophilus influenzae Rd colonies from a culture plate were Suspended in 100 ul of Science, 269:1995). water. The mixture was frozen and then thawed once. The Sequence was generated on an ABI Automatic Sequencer 16S rRNA gene sequences were amplified by PCR using a using dye terminator technology (U.S. Pat. No. 5,366,860; commercial kit according to the manufacturers instructions EP 272007) using a combination of vector and insert (Perkin Elmer) with primers HK12 (5'- Specific primerS. Sequence editing was performed in either GAGTTTGATCCTGGCTCAG-3) (SEQ ID NO:45) and DNAStar (DNA Star Inc., Madison, Wis.) or the Wisconsin HK13 (5'-TACCTTGTTACGACTT-3) (SEQ ID NO:46). GCG program (Wisconsin Package Version 9.0, Genetics PCR was performed in a Perkin Elmer Gene Amp 9600 Computer Group (GCG), Madison, Wis.) and the CONSED (Norwalk, Conn.). The samples were incubated for 5 min at package (version 7.0). All Sequences represent coverage at 94° C. and then cycled 35 times at 94° C. for 30 sec, 55° C. 35 least two times in both directions. for 1 min, and 72° C. for 1 min. The amplified 16S rRNA Sequence Analysis of CrtO genes were purified using a commercial kit according to the Two ORFs were identified in the genomic sequence of manufacturer's instructions (QIAquick PCR Purification Rhodococcus erythropolis AN12 which shared homology to Kit, Qiagen, Valencia, Calif.) and Sequenced on an auto two different phytoene dehydrogenases. One ORF was des mated ABI sequencer. The Sequencing reactions were initi 40 ignated CrtI and had the highest homology (45% identity, ated with primers HK12, HK13, and HK14 (5'- 56% similarity) to a putative phytoene dehydrogenase from GTGCCAGCAGYMGCGGT-3) (SEQ ID NO:47, where Streptomyces coelicolor A3(2). The other ORF (originally Y=C or T, M=A or C). The 16S rRNA gene sequence of each designated as CrtI2, now as CrtO) had the highest homology isolate was used as the query Sequence for a BLAST Search (35% identity, 50% similarity; White O. et al Science 286 (Altschul, et al., Nucleic Acids Res. 25:3389-3402(1997)) of 45 (5444), 1571–1577 (1999)) to a probable phytoene dehy GenBank for Similar Sequences. drogenase DRO093 from Deinococcus radiodurans. Subse A 16S rRNA gene of strain AN12 was sequenced and quent examination of the protein by motif analysis indicated compared to other 16S rRNA sequences in the GenBank that the crtO might function as a ketolase. Sequence database. The 16S rRNA gene Sequence from In Vitro Assay for Ketolase Activity of Rhodococcus CrtO strain AN12 was at least 98% similar to the 16S rRNA gene 50 To confirm if crt0 encoded a ketolase, the Rhodococcus Sequences of high G+C Gram positive bacteria belonging to crtO gene in E. coli was expressed was assayed for the the genus RhodococcuS. presence of ketolase activity in Vitro. The crtO gene was Preparation of Genomic DNA for Sequencing and Sequence amplified from AN12 using the primers crtI2-N: Generation ATGAGCGCATTTCTCGACGCC (SEQ ID NO:48) and Genomic DNA preparation. Rhodococcus erythropolis 55 crtI2-C. TCACG ACCTGCTCGAACGAC (SEQ ID AN12 was grown in 25 mL NBYE medium (0.8% nutrient NO:49). The amplified 1599 bp full-length crtO gene was broth, 0.5% yeast extract, 0.05% Tween 80) till mid-log cloned into pTrcHis2-TOPO cloning vector (Invitrogen, phase at 37 C. with aeration. Bacterial cells were centri Carlsbad, Calif.) and transformed into TOP10 cells follow fuged at 4,000 g for 30 min at 4 C. The cell pellet was ing manufacture's instructions. The construct (designated washed once with 20 ml 50 mM NaCO containing 1M KCl 60 pDCQ117) containing the crt0 gene cloned in the forward (pH 10) and then with 20 ml 50 mM NaOAc (pH 5). The cell orientation respective to the trc promoter on the Vector was pellet was gently resuspended in 5 ml of 50 mM Tris-10 mM confirmed by restriction analysis and Sequencing. EDTA (pH 8) and lysozyme was added to a final concen The in vitro enzyme assay was performed using crude cell tration of 2 mg/mL. The suspension was incubated at 37 C. extract from E. coli TOP10 (pDCQ117) cells expressing for 2 h. Sodium dodecyl sulfate was then added to a final 65 crtO. 100 ml of LB medium containing 100 lug/ml amplicillin concentration of 1% and proteinase K was added to was inoculated with 1 ml fresh overnight culture of TOP10 100 ug/ml final concentration. The Suspension was incu (pDCQ117) cells. Cells were grown at 37° C. with shaking US 6,969,595 B2 43 44 at 300 rpm until ODoo reached 0.6. Cells were then induced Substrate. No product peaks were detected in the control with 0.1 mM IPTG and continued growing for additional 3 reaction mixture. hrs. Cell pellets harvested from 50 ml culture by centrifu gation (4000 g, 15 min) were frozen and thawed once, and resuspended in 2 ml ice cold 50 mM Tris-HCl (pH7.5) In Summary, the in vitro assay data confirmed that crtO containing 0.25% TritonX-100. 10 ug of B-caroteine Sub encodes a ketolase, which converted B-caroteine into can strate (Spectrum Laboratory Products, Inc.) in 50 ul of thaxanthin (two ketone groups) via echinenone (one ketone acetone was added to the Suspension and mixed by pipetting. group) as the intermediate. This symmetric ketolase activity The mixture was divided into two tubes and 250 mg of of Rhodococcus CrtO is different from what was reported for zirconia/silica beads (0.1 mm, BioSpec Products, Inc, the asymmetric function of Synechocystis CrtO. Bartlesville, Okla.) was added to each tube. Cells were broken by bead beating for 2 min, and cell debris was removed by spinning at 10000 rpm for 2 min in an Eppen TABLE 9 dorf microcentrifuge 5414C. The combined supernatant (2 HPLC Analysis Of The In Vitro Reaction ml) was diluted with 3 ml of 50 mM Tris pH 7.5 buffer in 15 Mixtures With Rhodococcus CrtO a 50 ml flask, and the reaction mixture was incubated at 30 Canthaxanthin Echinenone 3-caroteine C. with shaking at 150 rpm for different lengths of time. The 474 mm 459 mm 449 mm 474 mm reaction was stopped by addition of 5 ml methanol and 13.8 min 14.8 min 15.8 min extraction with 5 ml diethyl ether. 500 mg of NaCl was Ohr O% O% 100% added to Separate the two phases for extraction. Carotenoids 2 hr O% 14% 86% in the upper diethyl ether phase was collected and dried 16 hr 16% 28% 56% under nitrogen. The carotenoids were re-dissolved in 0.5 ml 20hr 30% 35% 35% of methanol, for HLPC analysis, using a Beckman System Gold(E) HPLC with Beckman Gold Nouveau Software (Columbia, Md.). 0.1 ml of the crude acetone extraction was 25 loaded onto a 125x4 mm RP8 (5 um particles) column with corresponding guard column (Hewlett-Packard, San Example 8 Fernando, Calif.). The flow rate was 1 ml/min and the Solvent program was 0-11.5 min 40% water/60% methanol, 11.5–20 min 100% methanol, 20–30 min 40% water/60% methanol. Spectral data was collected using a Beckman All sequences from Examples 6 and 7 were identified by photodiode array detector (model 168). conducting BLAST (Basic Local Alignment Search Tool; Three peaks were identified at 470 nm in the 16 hr Altschul, S. F., et al., (1993).J. Mol. Biol. 215:403-410; see reaction mixture. When compared to Standards, it was deter also www.ncbi.nlm.nih.gov/BLAST/) searches for similar mined that the peak with a retention time of 15.8 min was 35 B-caroteine and the peak with retention time of 13.8 min was ity to sequences contained in the BLAST “nr” database, canthaxanthin. The peak at 14.8 min was most likely according to the methodology of Example 2. echinenone, the intermediate with only one ketone group addition. In the 2 hr reaction mixture, the echinenone intermediate was the only reaction product and no canthax 40 anthin was produced. Longer incubation times resulted in The results of these BLAST comparisons are given below higher levels of echinenone and the appearance of a peak in Table 10. The table displays databased on the BLASTXnr corresponding to canthaxanthin. Canthaxanthin is the final algorithm with values reported in expect values. The Expect product in this step representing the addition of two ketone value estimates the Statistical significance of the match, groups (Table 9). To confirm that the ketolase activity was 45 Specifying the number of matches, with a given Score, that Specific for crtO gene, the assay was also performed with are expected in a Search of a database of this size absolutely extracts of control cells that would not use B-caroteine as the by chance.

TABLE 10 Identification of Carotenoid Genes Based on Sequence Homology

% Gene SEO ID % Similarity Name Similarity Identified SEQ ID Peptide Identity b E-value Citation crtE Geranylgeranyl pryophosphate 25 26 83 88 e-137 Misawa et al., J. Bacteriol. 172 synthetase (or GGPP synthetase, (12), 6704-6712 (1990) or farnesyltranstransferase) EC 2.5.1.29 gi117509sp|P21684|CRTE PAN ANGERANYLGERANYL PYROPHOSPHATE SYNTHETASE (GGPP SYNTHETASE) (FARNESYLTRANSTRANSFERA SE) US 6,969,595 B2 45 46

TABLE 10-continued Identification of Carotenoid Genes Based on Sequence Homology % Gene SEO ID % Similarity Name Similarity Identified SEQ ID Peptide Identity b E-value Citation crtX Zeaxanthin glucosyl transferase 27 28 75 79 O.O Lin et al., Mol. Gen. Genet. EC 2.4.1.- 245 (4), 417–423 (1994) gi1073294pir|S52583 crtX protein - Erwinia herbicola C Lycopene cyclase 29 3O 83 91 O.O Lin et al., Mol. Gen. Genet. gi1073295pir|S52585 dycopene 245 (4), 417–423 (1994) cyclase - Erwinia herbicola crt Phytoene desaturaseEC 1.3.-- 31 32 89 91 O.O Lin et al., Mol. Gen. Genet. gi1073299pir|S52586 phytoene 245 (4), 417–423 (1994) dehydrogenase (EC 1.3.--)- Erwinia herbicola crtB Phytoene synthaseEC2.5.1.- 33 34 88 92 e-150 Lin et al., Mol. Gen. Genet. gi1073300pir|S52587 245 (4), 417–423 (1994) prephytoene pyrophosphate synthase - Erwinia herbicola crtz, -carotene hydroxylase 35 36 88 91 3e-88 Misawa et al., J. Bacteriol. 172 gi117526sp|P21688CRTZ PAN (12, 6704-6712 (1990) AN-CAROTENE HYDROXYLASE C sIrO088 - Synechocystis 37 38 35 64% White O. et al Science 286 hypothetical protein (5444), 1571–1577 (1999) Fernández-González, et al., J. Biol. Chem., 1997, 272:9728 9733

Example 9 (Gibco/BRL, Rockville, Md.). pCR4-crt was digested with EcoRI and the 6.3 kb EcoRI fragment containing the crt Expression of B-carotene in Methylomonas 16A gene cluster (crtEXYIB) was purified following gel electro Growing on Methane phoresis in 0.8% agarose (TAE). This DNA fragment was The crt gene cluster comprising the crtEXYIBZ genes ligated to EcoRI-digested p3HR1 and the ligated DNA was from Pantoea Stewarti (Example 6) was introduced into 35 used to transform E. coli DH5C. by electroporation. Trans Methylomonas 16a to enable the synthesis of desirable formants were Selected on LB medium containing 50 ug/ml 40-carbon carotenoids. kanamycin. Primers were designed using the Sequence from Erwinia Several isolates were found to be sensitive to chloram uredovora to amplify a fragment by PCR containing the crt 40 phenicol (25 ug/ml) and demonstrated a yellow colony genes. These Sequences included 5'-3': phenotype after overnight incubation at 37 C. Analysis of the plasmid DNA from these transformants confirmed the presence of the crt gene cluster cloned in the Same orienta ATGACGGTCTGCGCAAAAAAACACG SEQ ID 43 tion as the pBHR1 chloramphenicol-resistance gene and this plasmid was designated pCrt1 (FIG. 3). In contrast, analysis GAGAAATTATGTTGTGGATTTGGAATGC SEQ ID 44 45 of the plasmid DNA from transformants demonstrating a Chromosomal DNA was purified from Pantoea Stewadtii white colony phenotype confirmed the presence of the crt (ATCC no. 8.199) and PfuTurbo polymerase (Stratagene, La gene cluster cloned in the opposite orientation as the p3HR1 Jolla, Calif.) was used in a PCR amplification reaction under chloramphenicol-resistance gene and this plasmid was des the following conditions: 94° C., 5 min; 94° C. (1 min)-60° 50 ignated pCrt2. These results Suggested that functional C. (1 min)-72 C. (10 min) for 25 cycles, and 72° C. for 10 expression of the crt gene cluster was directed from the min. A Single product of approximately 6.5 kb was observed pBHR1 cat promoter. following gel electrophoresis. Taq polymerase (Perkin Plasmid pcrt1 was transferred into Methylomonas 16a by Elmer) was used in a ten minute 72 C. reaction to add tri-parental conjugal mating. The E. Coli helper Strain con additional 3' adenoside nucleotides to the fragment for 55 taining pRK2013 and the E. coli DH5O. donor strain con TOPO cloning into pCR4-TOPO (Invitrogen, Carlsbad, taining pCrt1 were grown overnight in LB medium contain Calif.). Following transformation to E. coli DH5C. (Life ing kanamycin (50 ug/mL), washed three times in LB, and Technologies, Rockville, Md.) by electroproation, several resuspended in a Volume of LB representing approximately colonies appeared to be bright yellow in color indicating that a 60-fold concentration of the original culture volume. The they were producing a carotenoid compound 60 Methylomonas 16a recipient was grown for 48 hours in For introduction into Methylomonas 16a, the crt gene Nitrate liquid “BTZ-3” medium (General Methods) in an cluster from pCR4-crt was first subcloned into the unique atmosphere containing 25% (v/v) methane, washed three EcoRI site within the chloramphenicol-resistance gene of times in BTZ-3, and resuspended in a volume of BTZ-3 the broad host range vector, pBHR1 (MoBiTec, LLC, Marco representing a 150-fold concentration of the original culture Island, Fla.). pBHR1 (500 ng) was linearized by digestion 65 Volume. The donor, helper, and recipient cell pastes were with EcoRI (New England Biolabs, Beverly, Mass.) and then combined on the Surface of BTZ-3 agar plates containing dephosphorylated with calf intestinal alkaline phosphatase 0.5% (w/v) yeast extract in ratios of 1:1:2 respectively. US 6,969,595 B2 47 48 Plates were maintained at 30° C. in 25% methane for 16–72 for this pCrt3 construct is shown in FIG. 4. The P. hours to allow conjugation to occur, after which the cell promoter is illustrated with a small bold black arrow, in pastes were collected and resuspended in BTZ-3. Dilutions contrast to the large wide arrows, representing specific genes were plated on BTZ-3 agar containing kanamycin as labeled. (50 ug/mL) and incubated at 30° C. in 25% methane for up Plasmid pCrt3 was transferred into Methylomonas 16a by to 1 week. Transconjugants were Streaked onto BTZ-3 agar tri-parental conjugal mating, as described above for pCrt1 with kanamycin (50 ug/mL) for isolation. Analysis of plas (Example 9). Transconjugants containing this plasmid dem mid DNA isolated from these transconjugants confirmed the onstrated yellow colony color following growth on BTZ-3 presence of pCrt1 (FIG. 3). agar with kanamycin (50 ug/mL) and methane as the Sole For analysis of carotenoid composition, transconjugants carbon Source. were cultured in 25 ml BTZ-3 containing kanamycin (50 HPLC analysis of extracts from Methylomonas 16A con ug/mL) and incubated at 30° C. in 25% methane as the sole taining pCrt3 revealed the presence of Zeaxanthin and its carbon source for up to 1 week. The cells were harvested by mono- and diglucosides. These results are shown in FIG. 4. centrifugation and frozen at -20° C. After thawing, the The left panel shows the HPLC profile of extracts from pellets were extracted and carotenoid content was analyzed 15 Methylomonas 16A or Methylomonas 16A containing the by HPLC according to the methodology of the General pcrt3. The right panel shows the UV spectra of the individual Methods. peaks displayed in the HPLC profile and demonstrate the HPLC analysis of extracts from Methylomonas 16a con Synthesis of Zeaxanthin and its mono- and di-glucosides in taining pCrt1 confirmed the synthesis of B-carotene. The left Methylomonas 16A containing pcrt3. These results Sug panel of FIG. 3 shows the HPLC results obtained using the gested that the crtEXYIB genes were functionally expressed B-caroteine Standard and a single peak is present at 15.867 from the trc promoter while the crtz gene was transcribed in min. Similarly, the right panel of FIG. 3 shows the HPLC the opposite orientation from the pBHR1 cat promoter in profile obtained for analysis of Methylomonas 16a transcon Methylomonas 16A. jugant cultures containing the pCrt1 plasmid. A similar peak 25 One skilled in the art would expect that deletion of crtX at 15.750 min is indicative of B-carotene in the cultures. from this and Subsequent plasmids should enable the pro Example 10 duction of Zeaxanthin without formation of the mono- and di-glucosides. Furthermore, a plasmid in which the crtEY Expression of Zeaxanthin in Methylomonas 16A IBZ genes are expressed in the same orientation from one or Growing on Methane more promoters may be expected to alleviate potential transcriptional interference and enhance the Synthesis of To enable the Synthesis of zeaxanthin in Methylomonas Zeaxanthin. This would readily be possible using standard 16a, the crt gene cluster from pTrcHis-crt2 (as described cloning techniques know to those skilled in the art. above) was Subcloned into the chloramphenicol-resistance gene of the broad host range vector, pBHR1 (MoBiTec, 35 Example 11 LLC, Marco Island, Fla.). pBHR1 (500 ng) was digested sequentially with EcoRI and Scal and the 4876 bp EcoRI Expression of Zeaxanthin in Methylomonas 16A Scal DNA fragment was purified following gel electrophore Growing on Methane, with an Optimized HMPS sis in 0.8% agarose (TAE). Plasmid pTrcHis-crt2 was Promoter digested simultaneously with Sspl and EcoRI and the 6491 40 bp Sspl-EcoRI DNA fragment containing the crt gene cluster Analysis of gene array data following growth of Methy (crtEXYIB) under the transcriptional control of the E. coli lomonas 16a on methane Suggested the heXoulose trc promoter was purified following gel electrophoresis in monophosphate synthase (HMPS) to be one of the ten most 0.8% agarose (TAE). The 6491 bp Sspl-EcoRI fragment was highly expressed genes. Thus, one may use the DNA ligated to the 4876 bp EcoRI-Scal fragment and the ligated 45 Sequences comprising the HMPS promoter to direct high DNA was used to transform E. coli DH5C. by electropora level expression of heterologous genes, including those in tion. Transformants were Selected on LB medium containing the P. Stewartii crt gene cluster, in Methylomonas 16A. 50 ug/ml kanamycin. Several kanamycin-resistant isolates Analysis of the 5'-DNA sequences upstream from the HMPS were also sensitive to chloramphenicol (25 ug/ml) and gene identified potential transcription initiation sites in both demonstrated yellow colony color after overnight incubation 50 DNA strands using the NNPP/neural network prokaryotic at 37 C. Analysis of the plasmid DNA from these transfor promoter prediction program from Baylor College of Medi mants confirmed the presence of the crt gene cluster cloned cine Predictions concerning the forward strand of the H6P into pBHR1 under the transcriptional control of the E. coli synthase are shown below in Table 11; similar results are trc promoter and were designated as pCrt3. The plasmid map shown below in Table 12 for the reverse strand.

TABLE 11

Promoter Predictions for H6P synthase-Forward Strand

Start End Score Promoter Seguences

63. 108 O 93 GAGAATTGGCTGAAAAACCAAATAAATAACAAAATTTAG (SEQ ID NO : 50) CGAGTAAATGG

11.9 164 O 91 TTCAATTGACAGGGGGGCTCGTTCTGATTTAGAGTTGC (SEQ ID NO:51) TGCCAGCTTTTT US 6,969,595 B2 49 SO

TABLE 11-continued Promoter Predictions for H6P synthase-Forward Strand Start End Score Promoter Seguences

211 256 O. 85 GGGTTGTCCAGATGTTGGTGAGCGGTCCTTATAACTAT (SEQ ID NO: 52) AACTGTAACAAT The transcription start sites are indicated in bold text.

TABLE 12 Promoter Predictions for H6P synthase-Reverse Strand Start End Score Promoter Sequences 284 239 O. 89 TTAATGGTCTTGCCATGAGATGTGCTCCGATTGTTACAG (SEQ ID NO:53) TATAGTTATA 129 84 O 95 CCCCCTGTCAATTGAAAGCCCGCCATTTACTCGCTAAAT (SEQ ID NO:54) TTTGTTATTTA The transcription start sites are indicated in bold text.

Based on these Sequences, the following primers were 25 the presence of Zeaxanthin, and its mono- and di-glucosides, used in a polymerase chain reaction (PCR) to amplify a 240 thereby confirming expression of the crtz gene. This data is bp DNA sequence comprising the HMPS promoter from shown in FIG. 5. Peaks with retention times of 13.38 min, Methylomonas 16a genomic DNA: 12.60 min and 11.58 min correspond to Zeaxanthin, a mixture of Zeaxanthin mono-glucosides and ZeaXanthin diglucoside, respectively, 5' CCGAGTACTGAAGCGGGTTTTTGCAGGGAG 3' (SEQ ID NO:39) 5' GGGCTAGCTGCTCCGATTGTTACAG 3' (SEQ ID NO: 40) Example 12 The PCR conditions were: 94° C. for 2 min, followed by Expression of Canthaxanthin and AStaxanthin in 35 cycles of 94° C. for 1 min, 50° C. for 1 min and 72 C. Methylomonas 16A Growing on Methane for 2 min, and final extension at 72 C. for 5 min. After 35 purification, the 240 bp PCR product was ligated to pCR2.1 To enable the Synthesis of canthaxanthin and astaXanthin (Invitrogen, Carlsbad, Calif.) and transformed into E. coli in Methylomonas 16a, the Rhodococcus erythropolis AN 12 DH5C. by electroporation. Analysis of the plasmid DNA crtO gene encoding f-caroteine ketolase (Example 7) was from transformants that demonstrated white colony color on cloned into pcrt4. The crtO gene was amplified by PCR from LB agar containing kanamycin (50 ug/ml) and X-gal iden 40 pDCQ117 (Example 7) using the following primers to tified the expected plasmid, which was designated pHMPS. introduce convenient Spel and Nhe restriction sites as well PHMPS was digested with EcoRI and the 256 bp DNA as the ribosome binding site found upstream of crtE which fragment containing the HMPS promoter was purified fol was presumably recognized in Methylomonas 16a.

5'-AGCAGCTAGCGGAGGAATAAACCATGAGCGCATTTCTC-3' (SEQ ID NO: 41 5'-GACTAGTCACGACCTGCTCGAACGAC-3' (SEQ ID NO: 42)

50 lowing gel electrophoresis in 1.5% agarose (TEA). This The PCR conditions were: 95°C. for 5 min, 35 cycles of 95° DNA fragment was ligated to pCrt3 previously digested with C. for 30 sec, 45–60° C. gradient with 0.15° C. decrease/ EcoRI and dephosphorylated with calf intestinal alkaline cycle for 30 sec and 72 C. for 90 sec, and a final extension at 72° C. for 7 min. The 1653 bp PCR product was purified phosphatase. The ligated DNA was used to transform E. coli following gel electrophoresis in 1.0% agarose (TAE), DH5C. by electroporation. Analysis of plasmid DNA from 55 digested simultaneously with Spel and Nhe restriction transformants that demonstrated yellow colony color on LB endonucleases and then ligated to pCrt4 previously digested agar containing kanamycin (50 ug/ml) identified the with Nhe and dephosphorylated with calf intestinal alkaline expected plasmid, designated pCrt4, containing the phosphatase. The ligated DNA was used to transform E. coli crtEXYIB genes under the transcriptional control of the trc DH5C. by electroporation. promoter and the crtz gene under the transcriptional control 60 Analysis of plasmid DNA from transformants that dem of the himps promoter (FIG. 5). onstrated yellow colony color on LB agar containing kana mycin (50 ug/ml) identified the expected plasmid, desig Plasmid pCrt4 was transferred into Methylomonas 16a by nated pCrt4.1, in which the crtEXYIB genes were cloned tri-parental conjugal mating. Transconjugants containing under the transcriptional control of the trc promoter and the this plasmid demonstrated yellow colony color following crtO and crtz genes were cloned under the transcriptional growth on BTZ-3 agar with kanamycin (50 ug/mL) and 65 control of the himps promoter This plasmid construct is methane as the sole carbon source. HPLC analysis of shown in FIG. 6. Upon prolonged incubation, transformants extracts from Methylomonas 16a containing pCrt4 revealed containing pcrt4.1 demonstrated a Salmon pink colony color. US 6,969,595 B2 S1 52 Plasmid pCrt4.1 was transferred into Methylomonas 16a Calif.), cuvettes (0.2 cm; Invitrogen), and Bio-Rad Gene by tri-parental conjugal mating. Transconjugants containing Pulser III (Hercules, Calif.) with standard settings were used this plasmid demonstrated orange colony color following for electroporation. growth on BTZ-3 agar with kanamycin (50 ug/mL) and First, dxS was cloned into the Bam HI site, which was methane as the sole carbon source. HPLC analysis of 5 located between the lacZ gene and the Tn5Kn cassette of extracts of Methylomonas 16a containing pCrt4.1 are shown pTJS75::lacZ:Tn5Kn. The resulting plasmids were isolated in FIG. 6. These results revealed the presence of the endog from E. coli transformants growing on LB+ kanamycin (Kn, enous Methylomonas 16a 30-carbon carotenoid (retention 50 ug/mL). The plasmid containing the insert in direction of time of 12.717 min) as well as canthaxanthin (retention time the Kn-resistance gene (as confirmed by restriction analysis) of 13.767 min). The retention time of the wild-type pigment was chosen for further cloning. The dxr gene was cloned in is very close to that expected for astaxanthin. Analysis of a between dxS and the Tn5Kn cassette by using the XhoI and shoulder on this peak confirmed the presence of astaxanthin Xba I sites. The anticipated plasmid was isolated from E. The predominant formation of the wild-type 16A pigment coli transformants. The presence of dxs and dxr in the in this Strain Suggested transcriptional interference of the plasmid was confirmed by restriction analysis and sequenc crtEXYIB operon by high-level expression of the crtOZ 15 ing. The resulting plasmid, pTJS75:dxs:dxr:lacZ:Tn5Kn is operon from the strong himps promoter. In addition, it is shown in FIG. 7. hypothesized that the cat promoter on the pPHR1 vector The plasmid pTJS75::dxs:dxr:lacZ:Tn5Kn was trans may be directing expression of crtOZ in concert with the ferred from E. coli into Methylomonas 16a by triparental himps promoter. Plasmids in which the crtEYIBZO genes are conjugation. A spontaneous rifampin (Rif)-resistant isolate expressed in the same orientation from one or more pro of strain Methylomonas 16a was used as the recipient to moters may be expected to alleviate potential transcriptional Speed the isolation of the methanotroph from contaminating interference and thereby enhance the Synthesis of canthax E. coli following the mating. Six separately isolated anthin and astaxanthin. kanamycin-resistant Methylomonas 16a transconjugants were used for carotenoid content determination. Example 13 25 For carotenoid determination, six 100 mL cultures of transconjugants (in BTZ+50 ug/mL Kn) were grown under Enhanced Synthesis of the Native Carotenoid of methane (25%) over the weekend to stationary growth Methylomonas 16A by Amplification of Upper phase. Two cultures of each, the wild-type strain and its Isoprenoid Pathway Genes Rif-resistant derivative without the plasmid, served as a Native isoprene pathway genes dxS and dxr were ampli control to see whether there are different carotenoid contents fied from the Methylomonas 16a genome by using PCR with in those strains and to get a standard deviation of the the following primers. carotenoid determination. Cells were spun down, washed DXS. Primers: with distilled water, and freeze-dried (lyophilizer: Virtis, Forward reaction: aaggat.ccgcgtattegtactic (contains a Bam Gardiner, N.Y.) for 24h in order to determine dry-weights. HI site, SEQ ID NO:55). 35 After the dry-weight of each culture, was determined, cells Reverse reaction: ctggat.ccgatctagaaataggctic were extracted. First, cells were welled with 0.4 mL of water gagttgtcgttcagg (contains a Bam HI and a Xho I site, SEQ and let stand for 15 min. After 15 min, four mL of acetone ID NO:56). was added and thoroughly vortexed to homogenize the DXr Primers: sample. The samples were then shaken at 30° C. for 1 hr. Forward reaction: aaggatcc tact.cgagctgacatcagtgct 40 After 1 hr, the cells were centrifuged. Pink coloration was (contains a Bam HI and a Xho I site, SEQ ID NO:57). observed in the Supernatant. The Supernatant was collected Reverse reaction: gctictagatgcaaccagaatcg (contains a Xba and pellets were extracted again with 0.3 mL of water and I site, SEQ ID NO:58). 3 mL of acetone. The Supernatants from the second extrac The expected PCR products of dxs and dxr genes included tion were lighter pink in color. The Supernatants of both Sequences of 323 bp and 420 bp, respectively, upstream of 45 extractions were combined, their volumes were measured, the Start codon of each gene in order to ensure that the and analyzed spectrophotometrically. No qualitative differ natural promoters of the genes were present. The PCR ences were seen in the spectra between negative control and program (in Perkin-Elmer, Norwalk, Conn.) was as follows: transconjugant Samples. In acetone extract, a following denaturing 95°C. (900 sec);35 cycles of 94° C. (45 sec),58° observation was typical measured by spectrophotometer C. (45 sec), 72° C. (60 sec); final elongation 72° C. (600 50 (shoulder at 460 nm, maxima at 491 and 522 nm) sec). The reaction mixture (50 ul total volume) contained: 25 (Amersham Pharmacia Biotech, Piscataway, N.J.). For cal All Hot Star master mix (Qiagen, Valencia, Calif.), 0.75 ul culation of the carotenoid content, the absorption at 491 nm genomic DNA (approx. 0.1 ng), 1.2 ul sense primer (=10 was read, the molar extinction coefficient of bacterioruberin pmol), 1.2 ul antisense primer (=10 pmol), 21.85 ul deion (188,000) and a MW of 552 were used. The MW of the ized water. 55 carotenoid (552 g/mol) was determined by MALDI-MS of a Standard procedures (Sambrook, J., Fritsch, E. F. and purified sample (Silica/Mg adsorption followed by Silica Maniatis, T. Molecular Cloning: A Laboratory Manual, column chromatography, reference: Britton, G., Liaaen Second Edition, Cold Spring Harbor Laboratory Press, Cold Jensen, S., Pfander, H., Carotenoids Vol. 1a; Isolation and Spring Harbor (1989)), were used in order to clone dxs and analysis, Birkhauser Verlag, Basel, Boston, Berlin (1995)). dxr into pTJS75::lacZ:Tn5Kn, a low-copy, broad-host plas 60 A crude acetone extract from Methylomonas 16a cells has mid (Schmidhauser and Helinski J. Bacteriology. Vol. a typical absorption spectrum (inflexion at 460 nm, maxima 164:446–455 (1985)). at 491 nm and 522 nm). HPLC analysis (as described in the For isolation, concentration, and purification of DNA, General Methods, except solvent program: 0-10 min 15% Qiagen kits (Valencia, Calif.) were used. Enzymes for the water/85% methanol, then 100% methanol) of acetone cloning were purchased from Gibco/BRL (Rockville, Md.) 65 extracts confirmed that one major carotenoid (net retention or NEB (Beverly, Mass.). To transfer plasmids into E. coli, Volume at about 6 mL) with the above mentioned absorption One Shot Top10 competent cells (Invitrogen, Carlsbad, Spectrum is responsible for the pink coloration of wild-type US 6,969,595 B2 S3 S4 and transconjugant Methylomonas 16a cells. Because noth increased the endogenous 30-carbon carotenoid content by ing else in the extract absorbs at 491 nm, carotenoid content about 30%. Amplification of dxs, dxr and other isoprenoid was directly measured in the acetone extract with a spec pathway genes, Such as lytB, may be used to increase the trophotometer (Amersham Pharmacia Biotech, Piscataway, metabolic flux into an engineered carotenoid pathway and N.J.). thereby enhance production of 40-carbon carotenoids, Such The molar extinction coefficient of bacterioruberin (188, as B-caroteine, Zeaxanthin, canthaxanthin and astaXanthin. 000), was used for the calculation of the quantity. The lytB gene was amplified by PCR from Methylomonas The following formula was used (Lambert-Beer's law) to 16a using the following primers that also introduced con determine the quantity of carotenoid: venient XhoI restriction sites for subcloning:

Ca: Carotenoid amount (g) 5'-TGGCTCGAGAGTAAAACACTCAAG-3' (SEQ ID NO:59) A: Absorption of acetone extract at 491 nm (-) d: Light path in cuvette (1 cm) 5'-TAGCTCGAGTCACGCTTGC-3' (SEQ ID NO: 60) e: Molar extinction coefficient (L/(molxcm)) 15 The PCR conditions were: 95°C. for 5 min, 35 cycles of 95° MW. Molecular weight (g/mol) C. for 30 sec, 47–62 C. gradient with 0.25° C. decrease/ v: Volume of extract (L) cycle for 30 sec and 72 C. for 1 min, and a final extension To get the carotenoid content, the calculated carotenoid at 72° C. for 7 min. amount has to be divided by the corresponding cell dry Following purification, the 993 bp PCR product was weight. digested with Xho I and ligated to pTJS75::dxs:dxr:lacZ:Tn5Kn, previously digested with TABLE 13 XhoI and dephosphorylated with calf intestinal alkaline phosphatase. The ligated DNA was used to transform E. coli Native Carotenoid contents in Methylomonas 16a cells DH10B by electroporation. Analysis of the plasmid DNA carotenoid content 25 from transformants Selected on LB agar containing kana Cultures dry weight (mg) carotenoid (g) (ug/g) mycin (50 ug/ml) identified a plasmid in which the lytB gene 16a-1 30.8 3.OO194E-06 97.5 was Subcloned between the dxS and dxr genes in an operon 16a-2 30.8 3.0865E-06 100.2 under the control of the native dxS promoter. This operon 16a Rif-1 29.2 3.12937E-06 107.2 was excised as a 4891 bp DNA fragment following sequen 16a Rif-2P 30.1 3.02O14E-O6 100.3 tial digestion with HindIII and BamHI restriction dxp 1 28.2 3.48817E-06 123.7 dxp 2 23.8 3.17224E-06 133.3 endonucleases, made blunt-ended by treatment with T4 dxp 3 31.6 4.O1962E-O6 127.2 DNA polymerase and purified following gel electrophoresis dxp 4 31.8 4.38899E-06 138.O in 1.0% agarose (TAE). The purified DNA fragment was dxp 5 28.4 3.4547E-O6 121.6 ligated to crt3 (Example 10) previously linearized within the dxp 6 30.3 4.OO817E-06 132.3 35 crtz gene by digestion with BstXI, made blunt-ended by Methylomonas 16a native strain treatment with T4 DNA polymerase and dephosphorylated Rif resistant derivative of Methylomonas 16a without plasmid with calf intestinal alkaline phosphatase. The ligated DNA transconjugants containing pTJS75::dxs:dxr:lacZ:Tn5Kn plasmid was used to transform E. coli DH10B by electroporation and There were no significant differences between four nega transformants were Selected on LB agar containing kana tive controls. Likewise, there were no significant differences 40 mycin (50 ug/ml). Analysis of the plasmid DNA from between six transconjugants. However, approximately 28% transformants which demonstrated more intense yellow increase in average carotenoid production was observed in colony color than those containing crt3 identified a plasmid, the transconjugants in comparison to the average carotenoid designated pcrt3.2, containing both the crtEXYIB and dxs production in negative controls (Table 13; FIG. 7 lytB-dxr operons (FIG. 7). 45 HPLC analysis of extracts from E. coli containing pcrt3.2 In order to confirm the structure, Methylobacterium confirmed the synthesis of B-carotene. Transfer of this rhodinum (formerly Pseudomonas rhodos: ATCC No. plasmid into Methylomonas 16a by tri-parental conjugal 14821) of which C30-carotenoid was identified was used as mating will enhance production of B-caroteine compared to a reference Strain (Kleinig et al., Z. Naturforsch 34c, transconjugants containing pcrt3. 181-185 (1979); Kleinig and Schmitt, Z. Naturforsch 37c, 50 758–760 (1982)). A saponified extract of Methylobacterium Example 15 rhodinum and of Methylomonas 16a were compared by HPLC analysis under the same conditions as mentioned Industrial Production of B-Carotene in above. The results are shown as follows: Methylomonas 16a Optical Density Measurements Saponified M. rhodinum: inflexion at 460 nm, maxima at 55 Growth of the Methylomonas culture was monitored at 487 nm, 517 nm. 600 nm using a Shimadzu 160U UV/Vis dual beam, record Net retention volume=1.9 mL. ing spectrophotometer. Water was used as the blank in the Saponified Methylomonas 16a: inflexion at 460 nm, maxima reference cell. Culture Samples were appropriately diluted at 488 nm, 518 nm. with de-ionized water to maintain the absorbance values leSS Net retention volume=2.0 mL. 60 than 1.0. Example 14 Dry Cell Weight Determination 20 mL of Methylomonas cell culture was filtered through Enhanced Synthesis of Genetically Engineered a pre-weighed 0.2 um filter (Type GTTP, Millipore, Bedford, Carotenoids in Methylomonas 16A by Amplification Mass.) by vacuum filtration. Following filtration of biomass of Upper Isoprenoid Pathway Genes 65 samples, filters were washed with 10 mL of de-ionized water The previous example (Example 13) demonstrated that and filtered under vacuum to dryness. Filters were then amplification of the dxS and dxr genes in Methylomonas 16a placed in a drying oven at 95 C. for 24 to 48 hr. After 24 US 6,969,595 B2 SS 56 hr; filters were cooled to room temperature and re-weighed. The carbon dioxide evolution rate was calculated from the After recording the filter weight, the filters were returned to following formula: the drying oven and the process repeated at various time intervals until no further change in weight loss was recorded. CER=) mmol hr' = Media contribution to the dry cell weight (DCW) measure 5 ment was obtained by filtering 20 mL of fermentation media Exit Pressure: CO2 concentration: inlet gas flowrate prior to inoculation by the above procedure. Dry cell weight R: Absolute temperature of the exit gas stream is calculated by the following formula: In the above equation the exit pressure from the fermenter (weight of filter + cells) - was assumed to be equal to the atmospheric pressure. The (weight of filter) - (weight of filter + media) - inlet gas flowrate was calculated from the Sum of the DCW=l (g mL = (weight of filter) individual methane and air flowrates. R is the ideal gas = |g 20 mL culture volume constant=82.06 cm atm mol' K'. The absolute tempera ture of the exit gas stream was calculated by the following Ammonia Concentration Determination 15 formula: T(K)=t(° C)+273.15, where T is the absolute 3 mL culture samples for ammonia analyses were taken temperature in K, and t is the exit gas temperature in C. and from the fermenter and centrifuged at 10,000xg and 4°C. for was assumed to be equal to the ambient temperature. 10 min. The Supernatant was then filtered through a 0.2 lim B-Caroteine Extraction and Determination by High Perfor syringe filter (Gelman Lab., Ann Arbor, Mich.) and placed mance Liquid Chromatography (HPLC) at -20° C. until analyzed. Ammonia concentration in the 15–30 mL of the Methylomonas culture was centrifuged fermentation broth was determined by ion chromatography at 10,000xg and 4° C. for 10 min. The Supernatant was using a Dionex System 500 Ion Chromatograph (Dionex, decanted and the cell pellet frozen at -20°C. The frozen cell Sunnyvale, Calif.) equipped with a GP40 Gradient Pump, pellet was thawed at room temperature to which 2.5 mL of AS3500 Autosampler, and ED40 Electrochemical Detector acetone was added. The sample was vortexed for 1 min and operating in conductivity mode with an SRS current of 100 25 allowed to stand at room temperature for an additional 30 mA. Separation of ammonia was accomplished using a min before being centrifuged at 10,000xg and 4 C. for 10 Dionex CS12A column fitted with a Dionex CG12A Guard min. The acetone layer was decanted and Saved. The pellet column. The columns and the chemical detection cell were was then re-extracted with an additional 2.5 mL of acetone, maintained at 35° C. Isocratic elution conditions were centrifuged, and the two acetone pools combined. Visual employed using 22 mM H2SO as the mobile phase at a observation of the cell pellet revealed that all the f3-caroteine flowrate of 1 mL min. The presence of ammonia in the had been removed from the cells following the Second fermentation broth was verified by retention time compari extraction. The acetone pool was then concentrated to 1 mL son with an NHCl standard. The concentration of ammonia under a stream of N, filtered through a 0.45 um filter, and in the fermentation broth was determined by comparison of analyzed by HPLC. area counts with a previously determined NHCl standard 35 Acetone samples containing f-caroteine were analyzed calibration curve. When necessary, samples were diluted using a Beckman System Gold HPLC (Beckman Coulter, with de-ionized water so as to be within the bounds of the Fullerton, Calif.) equipped with a model 125 ternary pump calibration curve. system, model 168 diode array detector, and model 508 Carbon Dioxide Evolution Rate (CER) Determination autosampler. 100 lull of concentrated acetone extracts were The carbon dioxide concentration in the exit gas stream 40 injected onto a HP LichroCART 125-4, Cs reversed phase from the fermenter was determined by gas chromatography HPLC column (Hewlett Packard, Avondale, Pa.). Peaks (GC) using a Hewlett Packard 5890 Gas Chromatograph were integrated using Beckman Gold Software. Retention (Hewlett Packard, Avondale, Pa.) equipped with a TCD time and spectral comparison confirmed peak identity with detector and HP19091 P-Q04, 32 mx32 umx20 um B-caroteine pure component standards in the Wavelength divinylbenzene/styrene porous polymer capillary column. 45 range from 220 to 600 nm. The retention time and spectral Gas samples were withdrawn from the outlet gas stream profiles of the B-caroteine in the acetone extracts were an through a sample port consisting of a polypropylene “T” to exact match to those obtained from the pure component which the side arm was covered with a butyl rubber stopper. B-caroteine standards. The B-caroteine concentrations in the 200 lull samples were collected by piercing the rubber acetone extracts were quantified by comparison of area stopper with a Hamilton (Reno, Nev.) gas-tight GCSyringe. 50 counts with a previously determined calibration curve as Samples were collected after purging the barrel of the described below. A wavelength of 450 nm, corresponding to syringe a minimum of 4 times with the outlet gas. Imme the maximum absorbance wavelength of f-caroteine in diately following sample collection, the Volume in the acetone, was used for quantitation. syringe was adjusted to 100 u, and injected through a A mobile consisting of methanol and water was used for splitless injection port onto the column. Chromatographic 55 reversed phase separation of B-caroteine. The separation of conditions used for CO determination were as follows: B-caroteine was accomplished using a linear gradient of 60% Injector Temperature (100 C.); Oven Temperature (35 C); methanol and 40% water changing linearly over 11.5 min Detector Temperature (140 C); Carrier Gas (Helium); Elu utes to 100% methanol. Under the chromatographic condi tion Profile (Isothermal); Column Head Pressure (15 psig). tions employed, resolution of Ol-caroteine from f-caroteine The presence of CO in the exit gas stream was verified by 60 could not be attained. retention time comparison with a pure component CO2 B-caroteine calibration curves were prepared from Stock standard. The concentration of CO2 in the exit gas stream solutions by dissolving 25 mg of B-caroteine (96% purity, was determined by comparison of area counts with a pre Spectrum Chemical Inc., New Brunswick, N.J.) in 100 mL viously determined CO standard calibration curve. Stan of acetone. Appropriate dilutions of this stock Solution were dard gas cylinders (Robert's Oxygen, Kenneft Square, Pa.) 65 made to span the f3-caroteine concentrations encountered in containing CO in the concentration range of 0.1% (v/v) to the acetone extracts. Calibration curves constructed in this 10% (v/v) were used to generate the calibration curve. manner were linear over the concentration range examined. US 6,969,595 B2 57 58 Fermentation of Methylomonas 16a inoculated medium was Shaken for approximately 48 hr at 30° C. in a controlled environmental rotary shaker. When Fermentation was performed as a fed-batch fermentation cell growth reached Saturation, 5 mL of this culture was used under nitrogen limitation using a 3 liter, Vertical, Stirred tank to inoculate 2 100-mL cultures as described above. When the fermenter (B. Braun Biotech Inc., Allentown, Pa.) with a optical density of the cultures reached 0.8, 60 mL of each working Volume of 2 liters. The fermenter was equipped culture was used to inoculate the fermenter. with 2 six-bladed Rushton turbines and stainless steel head plate with fittings for pH, temperature, and dissolved oxygen probes, inlets for pH regulating agents, Sampling tube for Samples were taken at 4-5 hr intervals during the course withdrawing liquid Samples, and condenser. The exit gas of the fermentation to monitor carotenoid production as a line from the fermenter contained a separate port for Sam function of the growth phase of the organism. The Specific pling the exit gas Stream for GC analysis of methane, O, growth rate of the culture was 0.13 hr'. No adjustment of and CO concentrations. The fermenter was jacketed for air or methane flows was employed to prevent the culture temperature control with the temperature maintained con 15 from becoming oxygen limited during the course of the Stant at 30°C. through the use of an external heat exchanger. fermentation. Furthermore, the aeration and methane addi Agitation was maintained in the range of 870-885 rpm. The tion continued once the culture had stopped growing to pH of the fermentation was maintained constant at 6.95 explore f3-caroteine production in the absence of cell growth. through the use of 2.5 M NaOH and 2 MHSO. Cessation of growth was indicated when no changes in optical density were observed, by the disappearance of Methane was used as the Sole carbon and energy Source ammonia from the fermentation media, and by an observed during the fermentation. The flow of methane to the fer decrease in the CER. The B-caroteine content of the cells, dry menter was metered using a Brooks (Brooks Instrument, cell weight, ammonia levels, and carbon dioxide evolution Hatfield, Pa.) mass flow controller. A separate mass flow 25 rate were determined as described Supra. The results are controller was used to regulate the flow of air. Prior to stated in Table 15 below. entering the fermenter, the individual methane and air flows were mixed and filtered through a 0.2 um in-line filter TABLE 1.5 (Millipore, Bedford, Mass.) giving a total gas flowrate of 260 mL min' (0.13 V/v/min) and methane concentration of Fed-Batch Fermentation Results of Methylomonas Sp. 16alpCRT1 B 23% (v/v) in the inlet gas stream. The gas was delivered to B- Caro the medium 3 cm below the lower Rushton turbine through caroteine tene Am a perforated pipe. 2 liters of a minimal Salts medium of the Titer Titer monia CER po composition given in Table 14 was used for the fermenta Time OD DCWa (ug (mg Conc. (mimol (% tion. Silicone antifoam (Sigma Chemical Co., St. Louis, 35 (hr) 600 (g L') gDCW) L') (mM) hr') Satn) O.O 0.351 ND NDd NDd 23.7 NDd NDd Mo.) was added to a final concentration of 800 ppm prior to 37.7 1.59 O.54 2640 1.42 17.8 8.1 53.65 Sterilization to SuppreSS foaming. Before inoculating, the 41.6 2.50 0.87 63OO 5.51 13.9 13.2 33.50 fermenter and it contents were Sterilized by autoclaving for 45.9 4.27 155 7710 11.94 8.7 22.1 1.OO 40 49.3 7.99 2.36 5050 12.07 O.12 19.4 O.O 1 hr at 121 C. and 15 psia. Once the medium had cooled, 53.5 11.68 3.44 451O 15.51 O 10.4 45.50 4 mL of a 25 mg mL. kanamycin stock Solution was added 58.9 13.63 4.07 3960 15.85 O 4.2 65.85 to the fermentation medium to maintain plasmid Selection 63.8 13.80 3.87 41SO 15.96 O 4.2 72.70 preSSure during the fermentation. 69.6 13.45 3.93 4890 19.01 O 2.O 75.30 DCW = Dry Cell Weight TABLE 1.4 45 CER = Carbon Dioxide Evolution Rate pO2 = Dissolved Oxygen Concentration in Fermenter Fermentation Media Composition 'ND = Not Determined Amount Component (g L') 50 NHCI 1.07 At 46 hr into the fermentation B-caroteine titers reached a KHPO, 1. maximum titer of 7,710 ppm on a dry weight basis. Shortly MgCl*6H.O 0.4 CaCl2.H2O O.2 after this time the B-caroteine titer dropped Substantially as 1M HEPES Solution (pH 7) 50 mL. L. the fermenter became oxygen limited as noted by the Solution 1* 30 mL. L. 55 dissolved oxygen concentration. Thus, it is apparent that NaSO 1. maintenance of high B-caroteine titers is dependent on high *Note: The composition of Solution 1 is provided in the General Methods. oxygen tensions present in the fermentation media. Presum ably higher B-carotene titers could be reached than reported here through better control of the dissolved oxygen concen 1 ml of frozen Methylomonas 16a containing plasmid 60 pCRT1 was used to inoculate a 100 mL culture of sterile tration during the course of the fermentation. Maximum 0.5x minimal salts media containing 50 ug mL of kana B-caroteine productivities were calculated as 620 ug mycin in a 500 mL. Wheaton bottle sealed with a butyl gDCW hr' and 886 ug L' hr. In addition, B-carotene rubber Stopper and aluminum crimp cap. Methane was concentrations were found to Stabilize at roughly 4,400 ppm added to the culture by piercing the rubber stopper with a 60 65 as the cells transitioned into Stationary phase. It is apparent mL Syringe fitted with a 21 gauge needle to give a final that B-caroteine titers are growth associated as well as methane concentration in the headspace of 25% (v/v). The dependent on oxygen tension.

US 6,969,595 B2 61

-continued Asp Ser Tyr Pro Val Thr Ala Glu Val Arg Lys Lys Ala Gly Val Lieu 85 90 95 Glin Arg Phe Gly Gly Ser Val Ile Gly Asn. Ser Arg Val Lys Lieu. Thr 100 105 110 Asn. Wall Lys Asp Cys Wall Lys Arg Gly Lieu Val Lys Glu Gly Glu Asp 115 120 125 Pro Gln Lys Val Ala Ala Asp Glin Leu Val Lys Asp Gly Val Asp Ile 130 135 1 4 0 Lieu. His Thir Ile Gly Gly Asp Asp Thr Asn Thr Ala Ala Ala Asp Lieu 145 15 O 155 160 Ala Ala Phe Leu Ala Arg Asn. Asn Tyr Gly Lieu. Thr Val Ile Gly Lieu 1.65 170 175 Pro Llys Thr Val Asp Asn Asp Val Phe Pro Ile Lys Glin Ser Lieu Gly 18O 185 19 O Ala Trp Thr Ala Ala Glu Gln Gly Ala Arg Tyr Phe Met Asn Val Val 195 200 2O5 Ala Glu Asn. Asn Ala Asn Pro Arg Met Lieu. Ile Val His Glu Wal Met 210 215 220 Gly Arg Asn. Cys Gly Trp Lieu. Thir Ala Ala Thr Ala Glin Glu Tyr Arg 225 230 235 240 Lys Lieu Lieu. Asp Arg Ala Glu Trp Lieu Pro Glu Lieu Gly Lieu. Thir Arg 245 250 255 Glu Ser Tyr Glu Val His Ala Val Phe Val Pro Glu Met Ala Ile Asp 260 265 27 O Leu Glu Ala Glu Ala Lys Arg Lieu Arg Glu Val Met Asp Llys Val Asp 275 280 285 Cys Val Asin Ile Phe Val Ser Glu Gly Ala Gly Val Glu Ala Ile Val 29 O 295 3OO Ala Glu Met Glin Ala Lys Gly Glin Glu Val Pro Arg Asp Ala Phe Gly 305 310 315 320 His Ile Lys Lieu. Asp Ala Wall Asn Pro Gly Lys Trp Phe Gly Glu Glin 325 330 335 Phe Ala Gln Met Ile Gly Ala Glu Lys Thr Lieu Val Glin Lys Ser Gly 340 345 35 O Tyr Phe Ala Arg Ala Ser Ala Ser Asn. Wall Asp Asp Met Arg Lieu. Ile 355 360 365 Lys Ser Cys Ala Asp Leu Ala Val Glu Cys Ala Phe Arg Arg Glu Ser 370 375 38O Gly Val Ile Gly His Asp Glu Asp Asn Gly Asn Val Lieu Arg Ala Ile 385 390 395 400 Glu Phe Pro Arg Ile Lys Gly Gly Lys Pro Phe Asn. Ile Asp Thr Asp 405 410 415 Trp Phe Asn. Ser Met Leu Ser Glu Ile Gly Glin Pro Lys Gly Gly Lys 420 425 43 O

Wall Glu Wal Ser His 435

<210> SEQ ID NO 3 &2 11s LENGTH 636 &212> TYPE DNA <213> ORGANISM: Methylomonas 16a <400 SEQUENCE: 3 gaaaatacta totcc.gtcac catcaaagaa gtcatgacca cct cqc.ccgt tatgc.cggto US 6,969,595 B2 63 64

-contin ued atgg to atca atcatctgga acatgcc.gto cctctggcto gc gcgctagt Cgacggtggc 120 ttgaaagttt tggagatcac attgcgcacg CCggtgg CaC tggaatgitat cc.gacgitatic 18O aaag.ccgaag taccggacgc catcgtoggc gCggg Cacca toatcaa.ccc. tdataccttg 240 tatcaag.cga ttgacgc.cgg tgcggaattic atcgt.ca.gc.c cc.ggcatcac cgaaaatcta citcaac galag cgctago atc cgg.cgtgcct atcct gcc.cg gc gtcatcac accoagc gag 360 gtoatgcgtt tattggaaaa agg catcaat gc gatgaaat totttcc.ggc tgaagcc.gc.c 420 ggcggCatac cgatgctgaa atcccittggc ggc.cccttgc cgcaagttcac cittctgtc.cg 480 accggcgg.cg tdaatcc.cala aaacgc.gc.cc gaatatotgg cattgaaaaa tgtc.gc.ctgc 540 gtoggcggct cctggatggc gcc gg.ccgat citggtagatg cc.gaagacitg ggcggaaatc 600 acgcgg.cggg Cgagcgaggc cgcgg cattg aaaaaa. 636

<210> SEQ ID NO 4 <211& LENGTH 212 &212> TYPE PRT <213> ORGANISM: Methylomonas 16a <400 SEQUENCE: 4

Glu Asn Thr Met Ser Wall Thir Ile Lys Glu Val Met Thir Thr Ser Pro 1 5 10 15

Wal Met Pro Wal Met Wall Ile Asn His Leu Glu His Ala Wall Pro Leu 25 30

Ala Arg Ala Lieu Val Asp Gly Gly Lieu Lys Wall Leu Glu Ile Thir Leu 35 40 45

Arg Thr Pro Val Ala Lieu Glu Cys Ile Arg Arg Ile Lys Ala Glu Wall 50 60

Pro Asp Ala Ile Val Gly Ala Gly Thir Ile Ile Asn Pro His Thir Leu 65 70 75 8O

Tyr Glin Ala Ile Asp Ala Gly Ala Glu Phe Ile Wal Ser Pro Gly Ile 85 90 95

Thr Glu Asn Leu Lleu. Asn. Glu Ala Leu Ala Ser Gly Val Pro Ile Leu 100 105 110

Pro Gly Val Ile Thr Pro Ser Glu Val Met Arg Leu Lleu Glu 115 120 125

Ile Asn Ala Met Lys Phe Phe Pro Ala Glu Ala Ala Gly Gly Ile Pro 130 135 1 4 0

Met Leu Lys Ser Leu Gly Gly Pro Leu Pro Glin Wall. Thir Phe 145 15 O 155 160

Thr Gly Gly Val Asn Pro Lys Asn Ala Pro Glu Tyr Lieu Ala Lieu Lys 1.65 170 175

Asn. Wall Ala Cys Val Gly Gly Ser Trp Met Ala Pro Ala Asp Leu Wall 18O 185 19 O

Asp Ala Glu Asp Trp Ala Glu Ile Thr Arg Arg Ala Ser Glu Ala Ala 195 200 2O5 Ala Lieu Lys Lys 210

<210 SEQ ID NO 5 &2 11s LENGTH 1860 &212> TYPE DNA <213> ORGANISM: Methylomonas 16a <400 SEQUENCE: 5 atgaaact ga ccaccgacta toccittgctt aaaaa.catcc acacgc.cggc gga catacgc 60

US 6,969,595 B2 67

-continued

50 55 60 Val Phe Asn Thr Pro Val Asp Gln Leu Val Trp Asp Val Gly His Glin 65 70 75 8O Ala Tyr Pro His Lys Ile Leu Thr Gly Arg Lys Glu Arg Met Pro Thr 85 90 95 Ile Arg Thr Lieu Gly Gly Val Ser Ala Phe Pro Ala Arg Asp Glu Ser 100 105 110 Glu Tyr Asp Ala Phe Gly Val Gly His Ser Ser Thr Ser Ile Ser Ala 115 120 125 Ala Leu Gly Met Ala Ile Ala Ser Glin Leu Arg Gly Glu Asp Llys Lys 130 135 1 4 0 Met Val Ala Ile Ile Gly Asp Gly Ser Ile Thr Gly Gly Met Ala Tyr 145 15 O 155 160 Glu Ala Met Asn His Ala Gly Asp Wall Asn Ala Asn Lieu Lieu Val Ile 1.65 170 175 Lieu. Asn Asp Asn Asp Met Ser Ile Ser Pro Pro Val Gly Ala Met Asn 18O 185 19 O Asn Tyr Leu Thr Lys Val Leu Ser Ser Lys Phe Tyr Ser Ser Val Arg 195 200 2O5 Glu Glu Ser Lys Lys Ala Leu Ala Lys Met Pro Ser Val Trp Glu Lieu 210 215 220 Ala Arg Lys Thr Glu Glu His Val Lys Gly Met Ile Val Pro Gly Thr 225 230 235 240 Leu Phe Glu Glu Lieu Gly Phe Asn Tyr Phe Gly Pro Ile Asp Gly His 245 250 255 Asp Val Glu Met Leu Val Ser Thr Lieu Glu Asn Lieu Lys Asp Lieu. Thr 260 265 27 O Gly Pro Val Phe Leu. His Val Val Thr Lys Lys Gly Lys Gly Tyr Ala 275 280 285 Pro Ala Glu Lys Asp Pro Leu Ala Tyr His Gly Val Pro Ala Phe Asp 29 O 295 3OO Pro Thr Lys Asp Phe Leu Pro Lys Ala Ala Pro Ser Pro His Pro Thr 305 310 315 320 Tyr Thr Glu Val Phe Gly Arg Trp Lieu. Cys Asp Met Ala Ala Glin Asp 325 330 335 Glu Arg Lieu Lieu Gly Ile Thr Pro Ala Met Arg Glu Gly Ser Gly Lieu 340 345 35 O Val Glu Phe Ser Gln Lys Phe Pro Asn Arg Tyr Phe Asp Val Ala Ile 355 360 365 Ala Glu Gln His Ala Val Thr Lieu Ala Ala Gly Glin Ala Cys Glin Gly 370 375 38O Ala Lys Pro Val Val Ala Ile Tyr Ser Thr Phe Leu Glin Arg Gly Tyr 385 390 395 400 Asp Gln Lieu. Ile His Asp Val Ala Lieu Glin Asn Lieu. Asp Met Leu Phe 405 410 415 Ala Lieu. Asp Arg Ala Gly Lieu Val Gly Pro Asp Gly Pro Thr His Ala 420 425 43 O Gly Ala Phe Asp Tyr Ser Tyr Met Arg Cys Ile Pro Asn Met Leu Ile 435 4 40 4 45 Met Ala Pro Ala Asp Glu Asn. Glu Cys Arg Glin Met Lieu. Thir Thr Gly 450 455 460 Phe Glin His His Gly Pro Ala Ser Val Arg Tyr Pro Arg Gly Lys Gly 465 470 475 480

US 6,969,595 B2 71

-continued

&212> TYPE PRT <213> ORGANISM: Methylomonas 16a <400 SEQUENCE: 8 Met Lys Gly Ile Cys Ile Leu Gly Ala Thr Gly Ser Ile Gly Val Ser 1 5 10 15 Thr Lieu. Asp Val Val Ala Arg His Pro Asp Llys Tyr Glin Val Val Ala 2O 25 30 Lieu. Thir Ala Asn Gly Asn. Ile Asp Ala Leu Tyr Glu Glin Cys Lieu Ala 35 40 45 His His Pro Glu Tyr Ala Val Val Val Met Glu Ser Lys Val Ala Glu 50 55 60 Phe Lys Glin Arg Ile Ala Ala Ser Pro Wall Ala Asp Ile Llys Val Lieu 65 70 75 8O Ser Gly Ser Glu Ala Leu Glin Glin Val Ala Thr Lieu Glu Asn. Wall Asp 85 90 95 Thr Val Met Ala Ala Ile Val Gly Ala Ala Gly Leu Leu Pro Thr Leu 100 105 110 Ala Ala Ala Lys Ala Gly Lys Thr Val Lieu Lieu Ala Asn Lys Glu Ala 115 120 125 Leu Val Met Ser Gly Glin Ile Phe Met Glin Ala Val Ser Asp Ser Gly 130 135 1 4 0 Ala Val Lieu Lleu Pro Ile Asp Ser Glu His Asn Ala Ile Phe Glin Cys 145 15 O 155 160 Met Pro Ala Gly Tyr Thr Pro Gly His Thr Ala Lys Glin Ala Arg Arg 1.65 170 175 Ile Leu Leu Thr Ala Ser Gly Gly Pro Phe Arg Arg Thr Pro Ile Glu 18O 185 19 O Thr Leu Ser Ser Val Thr Pro Asp Glin Ala Val Ala His Pro Llys Trp 195 200 2O5 Asp Met Gly Arg Lys Ile Ser Val Asp Ser Ala Thr Met Met Asn Lys 210 215 220 Gly Lieu Glu Lieu. Ile Glu Ala Cys Lieu Lleu Phe Asn Met Glu Pro Asp 225 230 235 240

Glin Ile Glu Wal Wall Ile His Pro Glin Ser Ile Ile His Ser Met Wall 245 250 255 Asp Tyr Val Asp Gly Ser Val Lieu Ala Glin Met Gly Asn Pro Asp Met 260 265 27 O Arg Thr Pro Ile Ala His Ala Met Ala Trp Pro Glu Arg Phe Asp Ser 275 280 285 Gly Val Ala Pro Leu Asp Ile Phe Glu Val Gly His Met Asp Phe Glu 29 O 295 3OO Lys Pro Asp Leu Lys Arg Phe Pro Cys Lieu Arg Lieu Ala Tyr Glu Ala 305 310 315 320 Ile Lys Ser Gly Gly Ile Met Pro Thr Val Lieu. Asn Ala Ala Asn. Glu 325 330 335 Ile Ala Val Glu Ala Phe Lieu. Asn. Glu Glu Wall Lys Phe Thr Asp Ile 340 345 35 O Ala Val Ile Ile Glu Arg Ser Met Ala Glin Phe Lys Pro Asp Asp Ala 355 360 365 Gly Ser Lieu Glu Lieu Val Lieu Glin Ala Asp Glin Asp Ala Arg Glu Val 370 375 38O Ala Arg Asp Ile Ile Lys Thr Lieu Val Ala 385 390 US 6,969,595 B2 73 74

-contin ued

<210 SEQ ID NO 9 &2 11s LENGTH 693 &212> TYPE DNA <213> ORGANISM: Methylomonas 16a <400 SEQUENCE: 9 atgaac coaa ccatccaatg citggg.ccgto gtgc.ccgcag CCggcgt.cgg caaacgcatg 60 caagcc gatc gcc ccaaaca atatttaccg cittgc.cggta aaacggtoat c galacacaca 120 citgacticgac tacttgagtc cgacgcct to caaaaagttg Cggtggc gat titc.cgtogaa 18O gacccittatt ggcctgaact gtocatagoc aaacaccc.cg acatcatcac cgc.gc.ctggc 240 ggcaaggaac gc gcc.gactic ggtgctgtct gCactgaagg citttagaaga tatagocago gaaaatgatt gggtgctggit acacgacgcc gcc.cgc.ccct gCttgacggg cagogacatc 360 caccittcaaa. togatacctt aaaaaatgac CCggtoggcg gcatcctggc cittgagttcg 420 cacgacacat tgaaac acgt. ggatggtgac acgatcaccg calaccataga cagaaag cac 480 gtotgg.cgc.g ccittgacgcc gcaaatgttc aaatacggca tgttgcgcga cgc gttgcaa 540

C galacc galag gcaatc.cggc cgtcaccgac gaa.gc.ca.gtg cgctggaact tittgggc cat 600 a.a.a.C. C. Caaaa. togtggalagg cc.gc.ccggac alacatcaaaa. to accogccc ggaagatttg 660 gcc.ctggcac aattittatat ggagcaacaa gCa 693

<210> SEQ ID NO 10 <211& LENGTH: 231 &212> TYPE PRT <213> ORGAN ISM: Methy omonas 16a <400 SEQUENCE: 10

Met Asn. Pro Thir Ile G in Cys Trp Ala Wal Wall Pro Ala Ala Gly Val 1 5 10 15

Gly Lys Arg Met Glin. A Pro Lys Glin Tyr Leu Pro Leu Ala 2O 25 30

Gly Lys Thr Wall Ile G u His Thr Lieu. Thir Arg Leu Lleu Glu Ser Asp 35 40 45

Ala Phe Glin Lys Val A a Wall Ala Ile Ser Wall Glu Asp Pro 50 55 60

Pro Glu Lieu Ser Te A. a Lys His Pro Asp Ile Ile Thr Ala Pro Gly 65 75 8O

Gly Lys Glu Arg Ala Asp Ser Val Leu Ser Ala Leu Lys Ala Leu Glu 90 95

Asp Ile Ala Ser Glu Asn Asp Trip Wall Leu Wall His Asp Ala Ala Arg 100 105 110

Pro Cys Lieu Thr Gly Ser Asp Ile His Leu Glin Ile Asp Thr Lieu Lys 115 120 125

Asn Asp Pro Val Gly Gly Ile Leu Ala Leu Ser Ser His Asp Thir Leu 130 135 1 4 0

Lys His Val Asp Gly Asp Thr Ile Thr Ala Thr Ile Asp Arg Lys His 145 15 O 155 160

Val Trp Arg Ala Leu Thr Pro Glin Met Phe Lys Tyr Gly Met Leu Arg 1.65 170 175

Asp Ala Lieu Glin Arg Thr Glu Gly Asn Pro Ala Val Thr Asp Glu Ala 18O 185 19 O

Ser Ala Lieu Glu Lieu Lieu Gly His Lys Pro Lys Ile Wall Glu Gly Arg 195 200 2O5

US 6,969,595 B2 77 78

-contin ued

Phe Val Phe Gly Cys Ser Ala Trp Gly Glu Gly Wal Ser Glu Asp Lieu 145 15 O 155 160

Glin Ala Ile Thr Leu Pro Glu Glin Trp Phe Val Ile Ile Lys Pro Asp 1.65 170 175

Cys His Val Asn Thr Gl y Glu Ile Phe Ser Ala Glu Asn Lieu Thr Arg 18O 185 19 O

Asn Ser Ala Wal Wall Thr Met Ser Asp Phe Lieu Ala Gly Asp Asn Arg 195 200 2O5 Asn Asp Cys Ser Glu Val Val Cys Lys Lieu. Tyr Arg Pro Val 210 215 220

Ala Ile Asp Ala Leu Lieu. Cys Tyr Ala Glu Ala Arg Lieu. Thr Gly Thr 225 23 O 235 240

Gly Ala Cys Val Phe Al a Glin Phe Cys Asn Lys Glu Asp Ala Glu Ser 245 250 255

Ala Leu Glu Gly Lieu Lys Asp Arg Trp Leu Val Phe Leu Ala 260 265 27 O Lieu. Asn Glin Ser Ala Leu Tyr Lys Lys Lieu Glu Glin Gly 275 280 285

SEQ ID NO 13 LENGTH 471 TYPE DNA ORGANISM: Methylomonas 16a

<400 SEQUENCE: 13 atgatacgcg taggcatggg ttacgacgtg caccgtttca acgacgg.cga ccacatcatt 60 ttggg.cgg.cg toaaaatc.cc titatgaaaaa ggCCtggaag cccattcc.ga Cgg.cgacgtg 120 gtgctgcacg cattggcc.ga cgc.catcttg ggagcc.gc.cg citttggg.cga catcggcaaa 18O catttc.ccgg acaccg acco caatttcaag ggcgc.cgaca gCagggtgct actg.cgc.cac 240 gtgtacgg catcgtoaagga aaaaggctat aaactggtoa acgc.cgacgt. gaccatcatc gcto aggcgc cqaagatgct gcc acacgtg cc.cgg catgc gc gccaacat tgcc.gcc gat 360 citggaalaccg atgtcgattt cattaatgta aaag.ccacga C gaCC gagaa actgggctitt 420 gaggg.ccgta aggaaggcat cgc.cgtgcag gctgtggtot tgatagaacg. c 471

SEQ ID NO 14 LENGTH 157 TYPE PRT ORGANISM: Methylomonas 16a

<400 SEQUENCE: 14 Met Ile Arg Val Gly Met Gly Tyr Asp Wal His Arg Phe Asn Asp Gly 1 5 10 15 Asp His Ile Ile Leu Gl y Gly Val Lys Ile Pro Tyr Glu Lys Gly Lieu 25 30

Glu Ala His Ser Asp Gl y Asp Val Wall Leu. His Ala Leu Ala Asp Ala 35 40 45 Ile Leu Gly Ala Ala Al a Lieu Gly Asp Ile Gly Lys His Phe Pro Asp 50 55 60

Thr Asp Pro Asn. Phe Lys Gly Ala Asp Ser Arg Wall Leu Lieu Arg His 65 70 75 8O

Val Tyr Gly Ile Wall Lys Glu Lys Gly Tyr Lys Leu Wall Asn Ala Asp 85 90 95

Wall Thir Ile Ile Ala Gl in Ala Pro Lys Met Lieu Pro His Wall Pro Gly

US 6,969,595 B2 81 82

-continued <213> ORGANISM: Methylomonas 16a <400 SEQUENCE: 16

Met Thr Lys Phe Ile Phe Ile Thr Gly Gly Wall Wall Ser Ser Telu Gly 1 5 10 15

Lys Gly Ile Ala Ala Ser Ser Leu Ala Ala Ile Teu Glu Asp Arg Gly 25 30

Teu Lys Wall Thr Ile Thr Lys Lieu. Asp Pro Tyr Ile Asn Wall Asp Pro 35 40 45

Gly Thr Met Ser Pro Phe Glin His Gly Glu Wall Phe Wall Thr Glu Asp 50 55 60

Gly Ala Glu Thr Teu Asp Leu Gly His Tyr Glu Arg Phe Telu Lys 65 70 75

Thr Thr Met Thr Lys Asn Asin Phe Thr Thr Gly Glin Wall Tyr Glu 85 90 95

Glin Wall Telu Arg Asn Glu Lys Gly Asp Tyr Teu Gly Ala Thr Wall 100 105 110

Glin Wall Ile Pro His Ile Thr Asp Glu Ile Lys Arg Arg Wall Glu 115 120 125

Ser Ala Glu Gly Lys Asp Wall Ala Leu Ile Glu Wall Gly Gly Thr Wall 130 135 1 4 0

Gly Asp Ile Glu Ser Teu Pro Phe Leu Glu Thr Ile Arg Glin Met Gly 145 15 O 155 160

Wall Glu Telu Gly Arg Asp Ala Leu Phe Ile His Teu Thr Telu Wall 1.65 170 175

Pro Ile Lys Ser Ala Gly Glu Lieu Lys Thr Pro Thr Glin His 18O 185 19 O

Ser Wall Lys Glu Teu Thr Ile Gly Ile Glin Pro Asp Ile Telu Ile 195 200

Arg Ser Glu Glin Pro Ile Pro Ala Ser Glu Arg Arg Ile Ala 210 215 220

Teu Phe Thr Asn Wall Ala Glu Lys Ala Wall Ile Ser Ala Ile Asp Ala 225 230 235 240

Asp Thr Ile Tyr Arg Ile Pro Telu Telu Telu Arg Glu Glin Gly Telu Asp 245 250 255

Asp Telu Wall Wall Asp Glin Teu Arg Lieu Asp Wall Pro Ala Ala Asp Telu 260 265 27 O

Ser Ala Trp Glu Lys Wall Wall Asp Gly Telu Thr His Pro Thr Asp Glu 275 280 285

Wall Ser Ile Ala Ile Wall Gly Lys Tyr Wall Asp His Thr Asp Ala 29 O 295

Lys Ser Telu Asn Glu Ala Teu Ile His Ala Gly Ile His Thr Arg His 305 310 315 320

Wall Glin Ile Ser Tyr Ile Asp Ser Glu Thr Ile Glu Ala Glu Gly 325 330 335

Thr Ala Telu Lys Asn Wall Asp Ala Ile Teu Wall Pro Gly Gly Phe 340 345 35 O

Gly Glu Arg Gly Wall Glu Gly Lys Ile Ser Thr Wall Arg Phe Ala Arg 355 360 365

Glu Asn Ile Pro Tyr Teu Gly Ile Cys Teu Gly Met Glin Ser Ala 370 375

Wall Ile Glu Phe Ala Arg Asn Wal Wall Gly Teu Glu Gly Ala His Ser 385 390 395 400

US 6,969,595 B2 85 86

-contin ued

25 30 Ile Tyr Val Arg His Glu Val Val His Asn Arg Thir Wal Wall Asp Gly 35 40 45

Leu Lys Glin Lys Gly Ala Val Phe Ile Glu Glu Leu Ser Asp Wall Pro 50 55 60

Val Gly Ser Tyr Leu Ile Phe Ser Ala His Gly Val Ser Lys Glu Wall 65 70 75 8O

Glin Glin Glu Ala Glu Glu Arg Glin Leu. Thr Wall Phe Asp Ala Thr Cys 85 90 95

Pro Leu Wall Thr Lys Val His Met Glin Wall Ala Lys His Ala Lys Glin 100 105 110

Gly Arg Glu Val Ile Lieu. Ile Gly His Ala Gly His Pro Glu Wall Glu 115 120 125 Gly Thr Met Gly Glin Tyr Glu Lys Cys Thr Glu Gly Gly Gly Ile Tyr 130 135 1 4 0

Leu Val Glu Thr Pro Glu Asp Val Arg Asn Lieu Lys Val Asn Asn. Pro 145 15 O 155 160

Asn Asp Lieu Ala Tyr Val Thr Glin Thir Thr Leu Ser Met Thr Asp Thr 1.65 170 175

Lys Val Met Val Asp Ala Leu Arg Glu Glin Phe Pro Ser Ile Lys Glu 18O 185 19 O

Glin Lys Lys Asp Asp Ile Cys Tyr Ala Thr Glin Asn Arg Glin Asp Ala 195 200 2O5 Val His Asp Leu Ala Lys Ile Ser Asp Leu. Ile Leu Wal Wall Gly Ser 210 215 220

Pro Asn. Ser Ser Asn. Ser Asn Arg Leu Arg Glu Ile Ala Wall Gln Leu 225 230 235 240 Gly Lys Pro Ala Tyr Lieu. Ile Asp Thr Tyr Glin Asp Leu Lys Glin Asp 245 250 255

Trp Leu Glu Gly Ile Glu Val Val Gly Val Thr Ala Gly Ala Ser Ala 260 265 27 O

Pro Glu Wall Leu Wall Glin Glu Wall Ile Asp Glin Leu Lys Ala Trp Gly 275 280 285

Gly Glu Thr Thr Ser Val Arg Glu Asn Ser Gly Ile Glu Glu Lys Wall 29 O 295 3OO

Wall Phe Ser Ile Pro Lys Glu Lieu Lys Lys His Met Glin Ala 305 310 315

<210 SEQ ID NO 19 &2 11s LENGTH 891 &212> TYPE DNA <213> ORGANISM: Methylomonas 16a <400 SEQUENCE: 19 atgagtaaat tgaaag.ccita cct gaccgto tgccaagaac gCgtcgagcg cgc.gctggac 60 gcc.cgtctgc citgcc.gaaaa catactg.cca caaaccttgc atcaggc cat gcgctattoc 120 gtattgaacg gCggcaaacg. caccc.ggccc ttgttgactt atgcga.ccgg to aggctittg 18O ggCttgc.cgg aaaacgtgct ggatgcgc.cg gCttgcgcgg tagaattcat ccatgtgitat 240 togctgatto acgacgatct gcc.ggcCatg gacaacgatg atctg.cgc.cg cggcaaaccg acctgtcaca aggcttacga c gaggccacc gcc attittgg CCggcgacgc actgcaggCg 360 citggcc tittg aagttctggc caacg accoc ggcatcaccg to gatgc.ccc ggctogcctg 420 aaaatgatca cggctttgac ggctotcaag gCatggtggg 480 US 6,969,595 B2 87

-continued atcgatctog gotcc.gtcgg cc.gcaaattg acgctg.ccgg aacto gaaaa catgcatato 540 cacaag acto go.gc.cctgat cog cqccago gtcaatctgg cqg cattatc caaacco gat 600 citggatacitt gcgtogcc aa gaaactggat cactatocca aatgcatagg cittgtcgttc 660 caggtoaaag acgacattct c gacatcgaa googacaccg cqacacticgg caag acticag 720 ggcaaggaca to gataacga caaac cqacc taccctd.cgc tattggg cat ggctggc gcc. 78O aaacaaaaag cccaggaatt gcacgaacaa goagtcgaaa gottaacggg atttggcago 840 gaagcc gacc togctg.cgcga act atc.gctt tacatcatcg agcgcacgca c 891

<210> SEQ ID NO 20 &2 11s LENGTH 297 &212> TYPE PRT <213> ORGANISM: Methylomonas 16a <400 SEQUENCE: 20 Met Ser Lys Lieu Lys Ala Tyr Lieu. Thr Val Cys Glin Glu Arg Val Glu 1 5 10 15 Arg Ala Lieu. Asp Ala Arg Lieu Pro Ala Glu Asn. Ile Leu Pro Glin Thr 2O 25 30 Lieu. His Glin Ala Met Arg Tyr Ser Val Lieu. Asn Gly Gly Lys Arg Thr 35 40 45 Arg Pro Leu Lieu. Thr Tyr Ala Thr Gly Glin Ala Lieu Gly Lieu Pro Glu 50 55 60 Asn Val Leu Asp Ala Pro Ala Cys Ala Val Glu Phe Ile His Val Tyr 65 70 75 8O Ser Lieu. Ile His Asp Asp Lieu Pro Ala Met Asp Asn Asp Asp Leu Arg 85 90 95 Arg Gly Lys Pro Thr Cys His Lys Ala Tyr Asp Glu Ala Thr Ala Ile 100 105 110 Leu Ala Gly Asp Ala Lieu Glin Ala Lieu Ala Phe Glu Val Lieu Ala Asn 115 120 125 Asp Pro Gly Ile Thr Val Asp Ala Pro Ala Arg Lieu Lys Met Ile Thr 130 135 1 4 0 Ala Lieu. Thir Arg Ala Ser Gly Ser Glin Gly Met Val Gly Gly Glin Ala 145 15 O 155 160 Ile Asp Leu Gly Ser Val Gly Arg Lys Lieu. Thir Lieu Pro Glu Lieu Glu 1.65 170 175 Asn Met His Ile His Lys Thr Gly Ala Lieu. Ile Arg Ala Ser Val Asn 18O 185 19 O Leu Ala Ala Leu Ser Lys Pro Asp Lieu. Asp Thr Cys Val Ala Lys Lys 195 200 2O5 Leu Asp His Tyr Ala Lys Cys Ile Gly Lieu Ser Phe Glin Val Lys Asp 210 215 220 Asp Ile Leu Asp Ile Glu Ala Asp Thr Ala Thr Lieu Gly Lys Thr Glin 225 230 235 240 Gly Lys Asp Ile Asp Asn Asp Llys Pro Thr Tyr Pro Ala Lieu Lieu Gly 245 250 255 Met Ala Gly Ala Lys Glin Lys Ala Glin Glu Lieu. His Glu Glin Ala Val 260 265 27 O Glu Ser Lieu. Thr Gly Phe Gly Ser Glu Ala Asp Leu Lleu Arg Glu Lieu 275 280 285 Ser Leu Tyr Ile Ile Glu Arg Thr His 29 O 295

US 6,969,595 B2 91 92

-continued

50 55 60

Wall Telu Asp Glu Met Phe Glu Lieu Cys Glu Arg Arg Ser Glu Asp Tyr 65 70 75

Teu Glu Phe Telu Pro Teu Ser Pro Met Tyr Arg Teu Teu Asp Asp 85 90 95

Arg Asp Ile Phe Wall Tyr Ser Asp Arg Glu Asn Met Arg Ala Glu Telu 100 105 110

Glin Wall Phe Glu Gly Thr Asp Gly Tyr Glu Glin Phe Met Glu 115 120 125

Glin Glu Arg Lys Phe Asn Ala Telu Pro Cys Ile Thr Arg Asp 130 135 1 4 0

Tyr Ser Ser Telu Lys Ser Phe Leu Ser Telu Asp Teu Ile Ala Telu 145 15 O 155 160

Pro Trp Telu Ala Phe Pro Lys Ser Wall Phe Asn Asn Teu Gly Glin 1.65 170 175

Phe Asn Glin Glu Lys Met Arg Lieu Ala Phe Cys Phe Glin Ser 18O 185 19 O

Teu Gly Met Ser Pro Trp Glu Cys Pro Ala Teu Phe Thr Met Telu Pro 195 200

Telu Glu His Glu Tyr Gly Ile Tyr His Wall Lys Gly Gly Telu Asn 210 215 220

Arg Ile Ala Ala Ala Met Ala Glin Wall Ile Ala Glu Asn Gly Gly Glu 225 230 235 240

Ile His Telu Asn Ser Glu Ile Glu Ser Telu Ile Ile Glu Asn Gly Ala 245 250 255

Ala Lys Gly Wall Lys Teu Glin His Gly Ala Glu Teu Arg Gly Asp Glu 260 265 27 O

Wall Ile Ile Asn Ala Asp Phe Ala His Ala Met Thr His Telu Wall 275 280 285

Pro Gly Wall Telu Lys Tyr Thr Pro Glu Asn Teu Glin Arg Glu 29 O 295

Tyr Ser Ser Thr Phe Met Leu Tyr Telu Gly Teu Ile Tyr 305 310 315 320

Asp Telu Pro His His Thr Ile Wall Phe Ala Lys Asp Thr Thr Asn 325 330 335

Ile Asn Ile Phe Asp Asn Lys Thr Telu Thr Asp Asp Phe Ser Phe 340 345 35 O

Wall Glin Asn Ala Ser Ala Ser Asp Asp Ser Teu Ala Pro Ala Gly 355 360 365

Ser Ala Telu Tyr Wall Leu Wall Pro Met Pro Asn Asn Asp Ser Gly 370 375

Teu Asp Trp Glin Ala His Cys Glin Asn Wall Arg Glu Glin Wall Telu Asp 385 390 395 400

Thr Telu Gly Ala Arg Teu Gly Lieu Ser Asp Ile Arg Ala His Ile Glu 405 410 415

Glu Ile Ile Thr Pro Glin Thr Trp Glu Thr Asp Glu His Wall 420 425 43 O

Lys Gly Ala Thr Phe Ser Lieu Ser His Phe Ser Glin Met Telu 435 4 40 4 45

Trp Arg Pro His Asn Arg Phe Glu Glu Teu Ala Asn Telu 450 455 460

Wall Gly Gly Gly Thr His Pro Gly Ser Gly Teu Pro Thr Ile Glu 465 470 475 480

US 6,969,595 B2 95 96

-continued

Glin Telu Ile Glu Lys Asn Asp Lys Wall Gly Gly Lys Teu Asn Ile Met 35 40 45

Thr Lys Asp Gly Phe Thr Phe Telu Gly Pro Ser Ile Telu Thr Met 50 55 60

Pro His Ile Phe Glu Ala Teu Phe Thr Gly Ala Gly Lys Asn Met Ala 65 70 75

Asp Wall Glin Ile Glin Lys Wall Glu Pro His Trp Arg Asn Phe Phe 85 90 95

Glu Asp Gly Ser Wall Ile Telu Cys Glu Asp Ala Glu Thr Glin Arg 100 105 110

Arg Glu Telu Asp Lys Teu Gly Pro Gly Thr Ala Glin Phe Glin Arg 115 120 125

Phe Telu Asp Tyr Ser Lys Asn Telu Cys Thr Glu Thr Glu Ala Gly Tyr 130 135 1 4 0

Phe Ala Gly Teu Asp Gly Phe Trp Asp Teu Teu Phe Gly 145 15 O 155 160

Pro Telu Arg Ser Teu Teu Ser Phe Wall Phe Arg Ser Met Asp Glin 1.65 170 175

Gly Wall Arg Arg Phe Ile Ser Asp Pro Teu Wall Glu Ile Telu Asn 18O 185 19 O

Phe Ile Lys Tyr Wall Gly Ser Ser Pro Asp Ala Pro Ala Telu 195 200

Met Asn Telu Telu Pro Tyr Ile Glin Tyr His Gly Teu Trp Wall 210 215 220

Lys Gly Gly Met Tyr Gly Met Ala Glin Ala Met Glu Telu Ala Wall 225 230 235 240

Glu Telu Gly Wall Glu Ile Telu Asp Ala Glu Wall Ser Glu Ile Glin 245 250 255

Glin Asp Gly Arg Ala Cys Ala Wall Teu Ala Asn Gly Asp Wall 260 265 27 O

Teu Pro Ala Asp Ile Wall Wall Ser Asn Met Glu Wall Ile Pro Ala Met 275 280 285

Glu Lys Telu Telu Ser Pro Ala Ser Glu Teu Lys Met Glin Arg 29 O 295

Phe Glu Pro Ser Cys Ser Gly Telu Wall Telu His Teu Gly Wall Asp Arg 305 310 315 320

Teu Pro Glin Teu Ala His His Asn Phe Phe Ser Asp His Pro 325 330 335

Arg Glu His Phe Asp Ala Wall Phe Lys Ser His Arg Teu Ser Asp Asp 340 345 35 O

Pro Thr Ile Tyr Teu Wall Ala Pro Cys Thr Asp Pro Ala Glin Ala 355 360 365

Pro Ala Gly Cys Glu Ile Ile Lys Ile Telu Pro His Ile Pro His Telu 370 375

Asp Pro Asp Lys Teu Teu Thr Ala Glu Asp Tyr Ser Ala Telu Arg Glu 385 390 395 400

Arg Wall Telu Wall Lys Teu Glu Met Gly Teu Thr Asp Telu Arg Glin 405 410 415

His Ile Wall Thr Glu Glu Tyr Trp Thr Pro Teu Asp Ile Glin Ala 420 425 43 O

Ser Asn Glin Gly Ser Ile Tyr Gly Wall Wall Ala Asp Arg Phe 435 4 40 4 45

Asn Telu Gly Phe Lys Ala Pro Glin Arg Ser Ser Glu Telu Ser Asn

US 6,969,595 B2 101 102

-continued atcggcaa.gc gtgcgtc.tc.g gtttactacc agc catgcgc tiggcgcggca gatto gatcg 1140 citgctgacta acaccgatta ccc.gcagogt atgacaaaaa ttcaggcc.gc attgcgtctg 1200 gCaggcggca caccago.cgc cgc.cgatatt gttgaac agg cqatgcggac citgtcago.ca 1260 gtacticagtg ggCaggatta tgcaa.ccgca citatga 1296

SEQ ID NO 28 LENGTH 431 TYPE PRT ORGANISM: Pantoea stewarti i

<400 SEQUENCE: 28

Met Ser His Phe Ala Wall Ile Ala Pro Pro Phe Phe Ser His Wall Arg 1 5 10 15

Ala Telu Glin Asn Lieu Ala Glin Glu Telu Wall Ala Arg Gly His Arg Wall 25 30

Thr Phe Phe Glin Gln His Asp Cys Ala Teu Wall Thr Gly Ser Asp 35 40 45

Ile Gly Phe Gln Thr Val Gly Leu Glin Thr His Pro Pro Gly Ser Telu 50 60

Ser His Telu Lieu. His Leu Ala Ala His Pro Teu Gly Pro Ser Met Telu 65 70 75

Arg Telu Ile Asn Glu Met Ala Arg Thr Ser Asp Met Teu Arg Glu 85 90 95

Teu Pro Ala Ala Phe His Ala Lieu Glin Ile Glu Gly Wall Ile Wall Asp 100 105 110

Glin Met Glu Pro Ala Gly Ala Val Wall Ala Glu Ala Ser Gly Telu Pro 115 120 125

Phe Wall Ser Val Ala Cys Ala Lieu Pro Telu Asn Arg Glu Pro Gly Telu 130 1 4 0

Pro Telu Ala Wal Met Pro Phe Glu Gly Thr Ser Asp Ala Ala Arg 145 15 O 155 160

Glu Arg Thr Thr Ser Glu Lys Ile Tyr Asp Trp Teu Met Arg Arg 1.65 170 175

His Asp Arg Wall Ile Ala His His Ala Cys Arg Met Gly Telu Ala Pro 18O 185 19 O

Arg Glu Lys Leu. His His Cys Phe Ser Pro Teu Ala Glin Ile Ser Glin 195 200

Teu Ile Pro Glu Lieu. Asp Phe Pro Arg Lys Ala Teu Pro Asp Phe 210 215 220

His Ala Wall Gly Pro Leu Arg Glin Pro Glin Gly Thr Pro Gly Ser Ser 225 230 235 240

Thr Ser Phe Pro Ser Pro Asp Pro Arg Ile Phe Ala Ser Telu 245 250 255

Gly Thr Telu Glin Gly His Arg Tyr Gly Telu Phe Arg Thr Ile Ala 260 265 27 O

Ala Glu Glu Val Asp Ala Glin Telu Telu Teu Ala His Gly Gly 275 280 285

Teu Ser Ala Thr Glin Ala Gly Glu Telu Ala Arg Gly Gly Asp Ile Glin 29 O 295

Wall Wall Asp Phe Ala Asp Glin Ser Ala Ala Teu Ser Glin Ala Glin Telu 305 310 315 320

Thr Ile Thr His Gly Gly Met Asn Thr Wall Teu Asp Ala Ile Ala Ser 325 330 335

US 6,969,595 B2 105 106

-continued

25 30

Teu Telu Ile Glu Ala Gly Pro Glu Ala Gly Gly Asn His Thr Trp Ser 35 40 45

Phe His Glu Glu Lieu. Thir Lieu Asn Glin His Arg Trp Ile Ala Pro 50 55 60

Teu Wall Wall His His Trp Pro Asp Tyr Glin Wall Arg Phe Pro Glin Arg 65 70 75 8O

Arg Arg His Wall Asn Ser Gly Tyr Tyr Cys Wall Thr Ser His Phe 85 90 95

Ala Gly Ile Telu Glin Glin Phe Gly Glin His Teu Trp Telu His Thr 100 105 110

Ala Wall Ser Ala Wall His Ala Glu Ser Wall Glin Teu Ala Asp Gly 115 120 125

Ile Ile His Ala Ser Thr Wall Ile Asp Gly Arg Gly Tyr Thr Pro Asp 130 135 1 4 0

Ser Ala Telu Wall Gly Phe Glin Ala Phe Ile Gly Glin Glu Trp Glin 145 155 160

Teu Ser Ala Pro His Gly Lieu Ser Ser Pro Ile Ile Met Asp Ala Thr 1.65 170 175

Wall Asp Glin Glin Asn Phe Wall Thr Teu Pro Telu Ser 18O 185 19 O

Ala Thr Ala Telu Teu Ile Glu Asp Thr His Ile Asp Lys Ala Asn 195 200

Teu Glin Ala Glu Arg Ala Arg Gln Asn Ile Arg Asp Ala Ala Arg 210 215 220

Glin Gly Trp Pro Teu Glin Thr Leu Telu Glu Glu Glin Gly Ala Telu 225 235 240

Pro Ile Thr Telu Thr Gly Asp Asn Glin Phe Trp Glin Glin Glin Pro 245 250 255

Glin Ala Cys Ser Gly Leu Arg Ala Gly Telu Phe His Pro Thr Thr Gly 260 265 27 O

Ser Telu Pro Teu Ala Wall Ala Telu Ala Asp Arg Teu Ser Ala Telu 275 280 285

Asp Wall Phe Thr Ser Ser Ser Wall His Glin Thr Ile Ala His Phe Ala 29 O 295

Glin Glin Trp Glin Glin Glin Gly Phe Phe Arg Met Teu Asn Arg Met 305 310 315 320

Teu Phe Telu Ala Gly Pro Ala Glu Ser Arg Trp Arg Wall Met Glin Arg 325 330 335

Phe Gly Telu Pro Glu Asp Lieu Ile Ala Arg Phe Ala Gly Lys 340 345 35 O

Teu Thr Wall Thr Arg Lieu Arg Ile Telu Ser Gly Lys Pro Pro Wall 355 360 365

Pro Wall Phe Ala Ala Leu Glin Ala Ile Met Thr Thr His Arg 370 375 38O

<21 Oc SEQ ID NO 31 <211 LENGTH 1479 <212> TYPE DNA <213> ORGANISM: Pantoea stewartii

<400 SEQUENCE: 31 atgaaaccala citacggtaat tdgtgcgggc tittggtogcc togg cactggc aattic gttta caggcc.gcag gtattoctot tittgctgctt gag cagogcg acaa.gc.cggg togcc.gggct

US 6,969,595 B2 109 110

-continued

Arg Ala Wall Phe Asn Glu Gly Tyr Telu Lys Teu Gly Thr Wall Pro Phe 130 135 1 4 0

Teu Ser Phe Lys Met Teu Ala Ala Pro Glin Teu Ala Lys Telu 145 15 O 155 160

Glin Ala Trp Ser Wall Tyr Ser Lys Wall Ala Gly Ile Glu Asp 1.65 170 175

Glu His Telu Arg Glin Ala Phe Ser Phe His Ser Teu Teu Wall Gly Gly 18O 185 19 O

Asn Pro Phe Ala Thr Ser Ser Ile Tyr Thr Teu Ile His Ala Telu Glu 195 200 2O5

Arg Trp Gly Wall Trp Phe Pro Gly Gly Thr Gly Ala Telu Wall g 215 220

Asn Met Ile Lys Teu Phe Glin Asp Telu Gly Gly Glu Wall Wall Telu 225 230 235 240

Asn Arg Wall Ser His Met Glu Thr Wall Gly Asp Ile Glin Ala 245 250 255

Wall Telu Glu Asp Gly Phe Glu Thr Ala Wall Ala Ser 260 265 27 O

Asn Asp Wall Wall His Thr Tyr Arg Asp Teu Teu Ser Glin His Pro 275 280 285

Ala Ala Glin Ala Lys Lys Telu Glin Ser Lys Arg Met Ser Asn 295

Ser Phe Wall Teu Tyr Phe Gly Telu Asn His His His Asp Glin Telu 305 310 315 320

Ala His His Thr Wall Phe Gly Pro Arg Arg Glu Telu Ile His 325 330 335

Glu Ile Phe Asn His Asp Gly Telu Ala Glu Asp Phe Ser Telu Telu 340 345 35 O

His Ala Pro Wall Thr Pro Ser Telu Ala Pro Glu Gly Gly 355 360 365

Ser Tyr Wall Teu Ala Pro Wall Pro His Teu Gly Thr Ala Asn Telu 370 375

Asp Trp Ala Wall Glu Gly Pro Telu Arg Asp Arg Ile Phe Asp Tyr 385 390 395 400

Teu Glu Glin His Tyr Met Pro Gly Telu Arg Ser Glin Teu Wall Thr His 405 410 415

Arg Met Phe Thr Pro Phe Phe Arg Asp Glu Teu Asn Ala Trp Glin 420 425 43 O

Gly Ser Ala Phe Ser Wall Glu Pro Ile Telu Thr Glin Ser Ala Trp Phe 435 4 40 4 45

Arg Pro His Asn Asp Lys His Ile Asp Asn Teu Telu Wall Gly 450 455 460

Ala Gly Thr His Pro Gly Ala Gly Ile Pro Gly Wall Ile Gly Ser Ala 465 470 475 480

Ala Thr Ala Gly Teu Met Telu Glu Asp Teu Ile 485 490

SEQ ID NO 33 LENGTH 891. TYPE DNA ORGANISM: Pantoea stewartii

<400 SEQUENCE: 33 atgg.cggttg gcticgaaaag citttgcgact gcatcgacgc titt to gacgc caaaaccogt

US 6,969,595 B2 113 114

-contin ued

225 230 235 240 Lys Il e Gly Wall Lys Val Glu Glin Ala Gly Lys Glin Ala Trp Asp His 245 250 255

Arg Gl in Ser Thr Ser Thr Ala Glu Lys Leu Thr Teu Telu Telu Thr Ala 260 265 27 O

Ser Gl y Glin Ala Val Thr Ser Arg Met Lys Thr Tyr Pro Pro Arg Pro 275 280 285 Ala His Leu Trp Glin Arg Pro Ile 29 O 295

SEQ ID NO 35 LENGTH 528 TYPE DNA ORGANISM: Pantoea stewartii

<400 SEQUENCE: 35 atgttgttgga tittggaatgc cct gatcgtg tttgtcaccg tggtogg cat ggalagtggitt 60 gctgcactgg cacataaata catcatgcac ggctggggitt ggggctggca totttcacat 120 catgaaccgc gtaaaggcgc atttgaagtt aac gatctot atgcc.gtggit attc.gc.catt 18O gtgtcgattg ccctgattta citt.cggcagt acaggaatct ggcc.gcticca gtggattggit 240 gCaggC atga cc.gctitatgg tttactgtat tittatggtoc acgacgg act ggtacaccag cgctggcc.gt toc got acat accgc.gcaaa gqctacctga aacggittata catggcc cac 360 cgitatgcatc atgctgtaag g g gaaaagag ggctg.cgtgt cctittggittt totgtacgc.g 420 ccaccgittat citaaacttica gg.cgacgctg agagaaaggc atgcggctag atcggg.cgct 480 gccagagatg agcaggacgg g g toggatacg tottcatcc.g ggalagtaa 528

SEQ ID NO 36 LENGTH 175 TYPE PRT ORGANISM: Pantoea stewartii

<400 SEQUENCE: 36 Met Leu Trp Ile Trp Asn Ala Leu Ile Val Phe Wall. Thir Wall Val Gly 1 5 10 15 Met Gl u Val Val Ala Ala Leu Ala His Lys Tyr Ile Met His Gly Trp 2O 25 30

Gly Trp Gly Trp His Leu Ser His His Glu Pro Arg Lys Gly Ala Phe 35 40 45

Glu Val Asn Asp Leu Tyr Ala Val Val Phe Ala Ile Wal Ser Ile Ala 50 55 60

Lieu. Il e Tyr Phe Gly Ser Thr Gly Ile Trp Pro Leu Gln Trp Ile Gly 65 70 75 8O

Ala Gl y Met Thr Ala Tyr Gly Leu Leu Tyr Phe Met Wal His Asp Gly 85 90 95 Leu Val His Glin Arg Trp Pro Phe Arg Tyr Ile Pro Arg Lys Gly Tyr 100 105 110 Leu Lys Arg Lieu. Tyr Met Ala His Arg Met His His Ala Wall Arg Gly 115 120 125

Lys Gl u Gly Cys Val Ser Phe Gly Phe Leu Tyr Ala Pro Pro Teu Ser 13 O 135 1 4 0 Lys Lieu Glin Ala Thr Lieu Arg Glu Arg His Ala Ala Arg Ser Gly Ala 145 15 O 155 160 Ala Arg Asp Glu Glin Asp Gly Val Asp Thir Ser Ser Ser Gly

US 6,969,595 B2 117 118

-continued

35 40 45

Phe Pro Gly Tyr Lys Wall Asp Gly Ser Ser Ala His Telu Met Ile 50 55 60

Arg His Ser Gly Ile Ile Glu Glu Telu Gly Teu Gly Ala His Gly Telu 65 70 75 8O

Arg Ile Asp Cys Asp Pro Trp Ala Phe Ala Pro Pro Ala Pro Gly 85 90 95

Thr Asp Gly Pro Gly Ile Wall Phe His Arg Asp Teu Asp Ala Thr 100 105 110

Glin Ser Ile Glu Ala Cys Gly Thr Lys Asp Ala Asp Ala Arg 115 120 125

Arg Phe Wall Ala Wall Trp Ser Glu Arg Ser Arg His Wall Met Ala 130 135 1 4 0

Phe Ser Thr Pro Pro Thr Gly Ser Asn Telu Ile Gly Ala Phe Gly Gly 145 15 O 155 160

Teu Ala Thr Ala Arg Gly Asn Ser Glu Telu Ser Arg Glin Phe Telu Ala 1.65 170 175

Pro Gly Asp Ala Teu Teu Asp Glu Tyr Phe Asp Ser Glu Ala Telu 18O 185 19 O

Ala Ala Telu Ala Trp Phe Gly Ala Glin Ser Gly Pro Pro Met Ser Glu 195 200

Pro Gly Thr Ala Pro Met Wall Gly Phe Ala Ala Teu Met His Wall Telu 210 215 220

Pro Pro Gly Arg Ala Wall Gly Gly Ser Gly Ala Teu Ser Ala Ala Telu 225 230 235 240

Ala Ser Met Ala Wall Asp Gly Ala Thr Wall Ala Teu Gly Asp Gly 245 250 255

Wall Thr Ser Ile Arg Arg Asn Ser Asn His Trp Thr Wall Thr Thr Glu 260 265 27 O

Ser Gly Arg Glu Wall His Ala Arg Lys Wall Ile Ala Gly Cys His Ile 275 280 285

Teu Thr Thr Telu Asp Teu Teu Gly Asn Gly Gly Phe Asp Arg Thr Thr 29 O 295

Teu Asp His Trp Arg Lys Ile Arg Wall Gly Pro Gly Ile Gly Ala 305 310 315 320

Wall Telu Telu Ala Thr Ser Ala Telu Pro Ser Arg Gly Asp Ala 325 330 335

Thr Thr Glu Ser Thr Ser Gly Telu Glin Teu Teu Wall Ser Asp Arg 340 345 35 O

Ala His Telu Thr Ala His Gly Ala Ala Teu Ala Gly Glu Telu Pro 355 360 365

Pro Arg Pro Ala Wall Teu Gly Met Ser Phe Ser Gly Ile Asp Pro Thr 370 375

Ile Ala Pro Ala Gly Arg His Glin Wall Thr Teu Trp Ser Glin Trp Glin 385 390 395 400

Pro Telu Ser Gly His Asp Trp Ala Ser Wall Ala Glu Ala 405 410 415

Glu Ala Asp Arg Ile Wall Gly Glu Met Glu Ala Phe Ala Pro Gly Phe 420 425 43 O

Thr Asp Ser Wall Teu Asp Phe Ile Glin Thr Pro Arg Asp Ile Glu 435 4 40 4 45

Ser Glu Telu Gly Met Ile Gly Gly Asn Wall Met His Wall Glu Met Ser 450 455 460 US 6,969,595 B2 119 120

-continued

Leu Asp Gln Met Met Leu Trp Arg Pro Leu Pro Glu Lieu Ser Gly. His 465 470 475 480 Arg Val Pro Gly Ala Asp Gly Lieu. Tyr Lieu. Thr Gly Ala Ser Thr His 485 490 495 Pro Gly Gly Gly Val Ser Gly Ala Ser Gly Arg Ser Ala Ala Arg Ile 5 OO 505 51O. Ala Leu Ser Asp Ser Arg Arg Gly Lys Ala Ser Glin Trp Met Arg Arg 515 52O 525

Ser Ser Arg Ser 530

SEQ ID NO 39 LENGTH 30 TYPE DNA ORGANISM: Methylomonas 16a

<400 SEQUENCE: 39 cc.gagtactgaag.cgg gttt ttgcagggag 30

SEQ ID NO 40 LENGTH 25 TYPE DNA ORGANISM: Methylomonas 16a <400 SEQUENCE: 40 gggctagotg citc.cgattgt tacag 25

SEQ ID NO 41 LENGTH 38 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer, derived from Rhodococcus erythropolis AN12

<400 SEQUENCE: 41 agcagotago ggaggaataa accatgagcg catttct c 38

SEQ ID NO 42 LENGTH 26 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer, derived from Rhodococcus erythropolis AN12

<400 SEQUENCE: 42 gacitagtcac gacctgctic g aacgac 26

SEQ ID NO 43 LENGTH 25 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer <400 SEQUENCE: 43 atgacggtot gcgcaaaaaa acacg 25

SEQ ID NO 44 LENGTH 2.8 TYPE DNA ORGANISM: Artificial Sequence US 6,969,595 B2 121 122

-continued

&220s FEATURE <223> OTHER INFORMATION: primer <400 SEQUENCE: 44 gagaaattat gttgttggatt toggaatgc 28

<210> SEQ ID NO 45 &2 11s LENGTH 19 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: primer <400 SEQUENCE: 45 gagtttgatc ctdgcticag 19

<210> SEQ ID NO 46 &2 11s LENGTH 16 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: primer <400 SEQUENCE: 46 taccttgtta cq actt 16

<210> SEQ ID NO 47 &2 11s LENGTH 17 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: primer <221 NAME/KEY: misc feature <222> LOCATION: (11) . . (11) &223> OTHER INFORMATION: Y = C or T <221 NAME/KEY: misc feature <222> LOCATION: (12) . . (12) &223> OTHER INFORMATION: M = A or C

<400 SEQUENCE: 47 gtgc.ca.gcag ymg.cggit 17

<210> SEQ ID NO 48 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: primer <400 SEQUENCE: 48 atgagcgcat ttctogacgc c 21

<210 SEQ ID NO 49 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: primer <400 SEQUENCE: 49 toac gacctg. citcgaacgac 20

<210 SEQ ID NO 50 &2 11s LENGTH 50 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE US 6,969,595 B2 123 124

-continued <223> OTHER INFORMATION: primer <400 SEQUENCE: 50 gaga attggc tigaaaaacca aataaataac aaaatttagc gagtaaatgg 5 O

EQ ID NO 51 ENGTH 50 YPE DNA RGANISM: Artificial Sequence EATURE THER INFORMATION: primer

<400 S EQUENCE: 51 ttcaattgac aggggggcto gttctgattt agagttgctg. ccagotttitt 5 O

EQ ID NO 52 ENGTH 50 YPE DNA RGANISM: Artificial Sequence EATURE THER INFORMATION: primer

<400 S EQUENCE: 52 gggttgtcca gatgttggtg agcggtoott atalactataa citgtaacaat 5 O

EQ ID NO 53 ENGTH 50 YPE DNA RGANISM: Artificial Sequence EATURE THER INFORMATION: primer

<400 S EQUENCE: 53 ttaatggtot toccatgaga tigtgctoc ga ttgttacagt tatagittata 5 O

EQ ID NO 54 ENGTH 50 YPE DNA RGANISM: Artificial Sequence EATURE THER INFORMATION: primer

<400 S EQUENCE: 54 ccccctgtca attgaaag.cc cgc.catttac togctaaatt ttgttattta 5 O

EQ ID NO 55 ENGTH 22 YPE DNA RGANISM: Artificial Sequence EATURE THER INFORMATION: primer

<400 S EQUENCE: 55 aaggat.ccgc gtattogtac to 22

EQ ID NO 56 ENGTH 40 YPE DNA RGANISM: Artificial Sequence EATURE THER INFORMATION: primer <400 SEQUENCE: 56 citggat.ccga totagaaata ggcto gagtt gtc gttcagg 40 US 6,969,595 B2 125 126

-continued SEQ ID NO 57 LENGTH 30 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer <400 SEQUENCE: 57 aaggat.ccita citcgagctga catcagtgct 30

SEQ ID NO 58 LENGTH 22 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer <400 SEQUENCE: 58 gctotagatg caaccagaat cq 22

SEQ ID NO 59 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer <400 SEQUENCE: 59 tggcto gaga gtaaaacact caag 24

SEQ ID NO 60 LENGTH 19 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer <400 SEQUENCE: 60 tagcto gagt cacgcttgc 19

What is claimed is: 4. A method according to claim 3 wherein the gene 1. A method for the production of a carotenoid compound encoding a pyrophosphate dependent phosphofructokinase comprising: 45 enzyme has the amino acid Sequence as Set forth in SEQ ID NO:2. (a) providing a transformed methylotrophic host cell 5. A method according to claim 3 wherein the high growth comprising: methanotrophic bacterial Strain optionally contains a func (i) isopentenyl pyrophosphate; and tional Entner-Douderoff carbon pathway. (ii) at least one isolated nucleic acid molecule encoding 50 6. A method according to claim 3 wherein the high growth an enzyme in the carotenoid biosynthetic pathway methanotrophic Strain is methylomonas 16a having the under the control of Suitable regulatory Sequences, ATCC designation ATCC PTA 2402. 7. A method according to claim 1 wherein the isolated (b) contacting the host cell of step (a) under Suitable nucleic acid molecule encodes a carotenoid biosynthetic growth conditions with an effective amount of a C1 enzyme Selected from the group consisting of geranylgera carbon Substrate, Selected from the group consisting of 55 nyl pyrophosphate (GGPP) synthase, phytoene Synthase, methane and methanol whereby an carotenoid com phytoene de Saturase, lycopene cyclase, B-carote ne pound is produced. hydroxylase, Zeaxanthin glucosyl transferase, B-caroteine 2. A method according to claim 1 wherein the methy ketolase, B-caroteine C-4 oxygenase, B-caroteine desaturase, lotrophic host cell is a methanotroph Selected from the group Spheroidene monooxygenase, caroteine hydratase, caro consisting of Methylomonas, Methylo bacter, 60 tenoid 3,4-desaturase, 1-OH-carotenoid methylase, farnesyl Methylococcus, Methy losinus, Methylocyctis, diphosphate Synthetase, and diapophytoene dehydrogenase. Methylomicrobium, Methanomonas, and Methylophilu. 8. A method according to claim 7 wherein the gera 3. A method according to claim 2 wherein the methan nylgeranyl pyrophosphate (GGPP) synthase as the amino otrophic host is a high growth methanotrophic Strain which acid sequence as set forth in SEQ ID NO:26. comprises a functional Embden-Meyerhof carbon pathway, 65 9. A method according to claim 7 wherein the phytoene Said pathway comprising a gene encoding a pyrophosphate Synthase as the amino acid Sequence as Set forth in SEQ ID dependent phosphofructokinase enzyme. NO:34. US 6,969,595 B2 127 128 10. A method according to claim 7 wherein the phytoene isorenieratene, lactucaxanthin, lutein, lycopene, neoxanthin, desaturase as the amino acid Sequence as Set forth in SEQID neurosporene, hydroxyneuroSporene, peridinin, phytoene, NO:32. rhodopin, rhodopin glucoside, Siphonaxanthin, Spheroidene, 11. A method according to claim 7 wherein the lycopene Spheroidenone, Spirilloxanthin, uriolide, uriolide acetate, cyclase as the amino acid Sequence as Set forth in SEQ ID 5 Violaxanthin, Zeaxanthin-f-diglucoside, and Zeaxanthin. NO:30. 21. A method for the Over-production of carotenoid pro 12. A method according to claim 7 wherein B-caroteine duction in a transformed methylotrophic host comprising: hydroxylase as the amino acid Sequence as Set forth in SEQ (a) providing a transformed methylotrophic host cell ID NO:36. comprising: 13. A method according to claim 7 wherein zeaxanthin (i) isopentenyl pyrophosphate; and glucosyltransferase as the amino acid Sequence as Set forth (ii) at least one isolated nucleic acid molecule encoding in SEO ID NO:28. an enzyme in the carotenoid biosynthetic pathway 14. A method according to claim 7 wherein the isolated under the control of Suitable regulatory Sequences, nucleic acid molecule encoding a carotenoid biosynthetic and enzyme encodes a B-caroteine ketolase having the amino 15 (iii) either: acid sequence as set for the in SEQ ID NO:38. 1) multiple copies of at least one gene encoding an 15. A method according to claim 7 wherein the isolated enzyme Selected from the group consisting of nucleic acid molecule encoding a carotenoid biosynthetic D1-deoxyxylulose-5-phosphate Synthase (DXS), enzyme encodes a farnesyl diphosphate Synthetase having D-1-deoxy Xylulose-5-phosphate reductoi the amino acid sequence as set forth in SEQ ID NO:20. Somerase (DXr), 2C-methyl-d-erythritol cytidylyl 16. A method according to claim 7 wherein the isolated transferase (IspD), 4-diphosphocytidyl-2-C- nucleic acid molecule encoding a carotenoid biosynthetic methylerythritol kinase (IspE), 2C-methyl-d- enzyme encodes a diapophytoene dehydrogenase enzyme erythritol 2,4-cyclodiphosphate Synthase (IspF), having the amino acid Sequence Selected from the group CTP synthase (PyrC) lytB and gcpE; or consisting of SEQ ID NO:22 and SEQ ID NO:24. 25 2) at least one gene encoding an enzyme Selected 17. A method according to claim 2 wherein Said metha from the group consisting of D-1-deoxyxylulose notroph is methylomonas 16a ATCC PTA 2402. 5-phosphate Synthase (DXS), D-1-deoxyxylulose 18. A method according to claim 1 wherein isopentenyl 5-phosphate reductoisomerase (DXr), 2C-methyl pyrophosphate is provided by the expression of heterologous d-erythritol cytidylyltransferase (IspD), upper pathway isoprenoid pathway genes. 4-diphosphocytidyl-2-C-methylerythritol kinase 19. A method according to claim 18 wherein said upper (ISpE), 2C-methyl-d-erythritol 2,4- pathway isoprenoid genes are selected from the group cyclodiphosphate synthase (IspF), CTP synthase consisting of D-1-deoxyxylulose-5-phosphate Synthase (PyrC), lytB and gcpE operably linked to a strong (DXS), D-1-deoxyxylulose-5-phosphate reductoisomerase promoter; (DXr), 2C-methyl-d-erythritol cytidylyltransferase (IspD), 35 (b) contacting the host cell of Step (a) under Suitable 4-diphosphocytidyl-2-methylerthritol kinase (IspE), growth conditions with an effective amount of a C1 2C-methyl-d-erythritol 2,4-cyclodiphosphate Synthase carbon Substrate, Selected from the group consisting of (IspF), CTP synthase (PyrC), lytB, and GcpE. methane and methanol whereby a carotenoid com 20. A method according to claim 1 wherein the carotenoid pound is over-produced. compound is Selected from the group consisting of 40 22. A method according to claim 21 wherein the at least antheraxanthin, adonixanthin, astaxanthin, canthaxanthin, one gene encoding an enzyme of either part (a)(iii)(1) or capSorubrin, B-cryptoxanthin alpha-carotene, beta-caroteine, (a)(iii)(2) encodes an enzyme Selected from the group con epsilon-caroteine, echine none, gamma-caroteine, Zeta sisting of SEQ ID NO:6, 8, 10, 12, 14, 16, and 18. carote ne, alpha-cryptoXanthin, diato Xanthin, 7,8- didehydroastaXanthin, fucoxanthin, fucoxanthinol, k k k k k